Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex
Overview of McQuaid KT et al.
Authors | McQuaid KT Takahashi S Baumgaertner L Cardin DJ Paterson NG Hall JP Sugimoto N Cardin CJ |
---|---|
Affiliation | Department of Chemistry University of Reading Whiteknights Reading RG6 6AD U.K. |
Journal | J Am Chem Soc |
Year | 2022 |
Abstract
The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)(2)(qdppz)](2+) displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T(18)), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T(10)-T(11)-A(12). The two remaining wide lateral loops are linked through a third K(+) ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.