Experiment Name | pseudoknot_experiment.gen |
---|---|
Type | RNA |
Subtype | ssRNA |
Low Wave Length | 170 |
High Wave Length | 321 |
Interval | 1(nm) |
Dwell Time | 9(s) |
Concentration | 0(mM) |
Cell id | CaF2 |
Temperature | 0(°C) |
Zeroed Between | 320-0 |
Sequence
   5'GGGCUGUUUUUCUCGCUGACUUUCAGCCCCAAACAAAAAAGUCAGCA3'
Cite
Pictures and data taken from NACDDB must be cited in your work following the instructions given in the Frequently Asked Questions Section (FAQ)