Experiment Name | d_T10G4A10_parallel |
---|---|
Type | DNA |
Subtype | ssDNA |
Low Wave Length | 201 |
High Wave Length | 319 |
Interval | 1(nm) |
Dwell Time | 0(s) |
Concentration | 0.1 M NaCl, 0.01 M Na3PO4 buffer, 0.1 mM EDTA |
Temperature | 23(°C) |
Sequence
   5'TTTTTTTTTTGGGGAAAAAAAAAA3'
Cite
Pictures and data taken from NACDDB must be cited in your work following the instructions given in the Frequently Asked Questions Section (FAQ)