Experiment Name | Partially unwound DNA |
---|---|
Type | DNA |
Subtype | dsDNA |
Low Wave Length | 170 |
High Wave Length | 321 |
Interval | 1 |
Dwell Time | 1.2 |
Concentration | 1.0(mM) |
Cell id | CaF2 |
Units | mdeg,delta_epsilon |
Temperature | 4.0 |
Zeroed Between | 310-315 |
Sequence
   5'GCCATGGTTTTTTTTTTCCATGGC3'•5'GCCATGGTTTTTTTTTTCCATGGC3'
Cite
Pictures and data taken from NACDDB must be cited in your work following the instructions given in the Frequently Asked Questions Section (FAQ)