Experiment Name | R-loop Bottom Top RNA |
---|---|
Type | HYBRID |
Subtype | dsDNA-ssRNA |
Low Wave Length | 170 |
High Wave Length | 321 |
Interval | 1 |
Dwell Time | 1.2 |
Concentration | 1.0(mM) |
Cell id | CaF2 |
Units | mdeg,delta_epsilon |
Temperature | 15.0 |
Zeroed Between | 310-315 |
Predicted Tertiary Structure
Disclaimer
This 3D model is a theoretical prediction and was not created directly based on experimental data. Therefore, it most likely contains various inaccuracies and it cannot be excluded that it is partially or completely wrong. It should therefore be used with caution and serves only to illustrate a hypothetical 3D structure
Sequence
   5'GCTGGATCCATACCCACCCACCCACCCTGAATTCGGCG3'•5'CGCCGAATTCCCTCTGAGTTTTCACCTATGGATCCAGC3'•5'GGGUGGGUGGGUGGGUGGGU3'
Cite
Pictures and data taken from NACDDB must be cited in your work following the instructions given in the Frequently Asked Questions Section (FAQ)