Experiment Name | DsrA22 GC ADN 10mM-85 C |
---|---|
Type | DNA |
Subtype | ssDNA |
Low Wave Length | 170 |
High Wave Length | 321 |
Interval | 1 |
Dwell Time | 1.2 |
Concentration | 0.5(mM) |
Cell id | CaF2 |
Units | mdeg,delta_epsilon |
Temperature | 4.0 |
Zeroed Between | 310-315 |
Reference | 10.18388/abp.2014_1941 |
Sequence
   5'AAGCGCTTCTTGCTTAAGCAAG3'
Cite
Pictures and data taken from NACDDB must be cited in your work following the instructions given in the Frequently Asked Questions Section (FAQ)