RNA models for: Demo6/ (Demo6)

UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA

n steps: 500 (~ n of SimRNA frames: 10000, curr n of frames None = 0%)
May 12, 2026, 10:16 a.m.

• Best score Demo6_1minE-000001_AA.pdb
• #1 cluster Demo6_clust01-000001_AA.pdb
• #2 cluster Demo6_clust02-000001_AA.pdb
• #3 cluster Demo6_clust03-000001_AA.pdb
• #4 cluster Demo6_clust04-000001_AA.pdb
• #5 cluster Demo6_clust05-000001_AA.pdb

The trajectory file for the simulation can be found here (the file might be > 1GB!).

Download simulation files as ZIP (TRC, TRAFL, configuration, HDR, PDB, FA, SS, and distance-restraint files).

Best score model:

1^st cluster representative:

2^nd cluster representative: