SimRNAweb2.0


SimRNA

Tutorial


Things to prepare before using SimRNAweb

It is best to gather as much information as possible before using SimRNAweb to do a simulation. SimRNAweb can do de novo folding and can often solve a short hairpin sequence quite successfully. However, most of the interesting RNA structures are complex. Secondary structure information alone may not be adequate to ensure that a correct prediction is obtained. Therefore, it may be necessary to obtain information on tertiary structure.

The more information is available, the more reliable the prediction will be. Nevertheless, when nothing is known, then the only option is to fold the sequence de novo. It is important to note that the reliability of such predictions depends strongly on how much information can be assembled beforehand.

Example input

In Figures 1a-g, we show various examples of using restraints with sequences and PDB files under various circumstances for PDB id 1L2X.

(1. Sequence alone) When only the sequence is submitted to SimRNAweb, the RNA sequence should be pasted into Box (3):

Input: **select "Sequence" as input type
GGCGCGGCACCGUCCGCGGAACAAACGG

Figure 1a. Submitting sequence alone to SimRNAweb.


(2. Sequence and secondary structure) When the sequence is submitted along with the structure of a pseudoknot (perhaps obtained from RFAM or from SHAPE data), Boxes (3) and (4) are used. The sequence above is submitted in Box (3), as above

GGCGCGGCACCGUCCGCGGAACAAACGG
and the pseudoknot structure is introduced by submitting two lines of secondary structure corresponding to the two overlapping helices in the secondary structure field (Box (4)),

..(((((......)))))..........
.........(((.............)))

You can use either Hard secondary structure restraints or Soft secondary structure restraints (advanced option), or even both of them with different secondary structures. The hard secondary structure restraints force SimRNA to create the specified secondary structure, while the soft restraints wait for SimRNA to detect the base pair during simulation. With a bonus, they assist in maintaining the base pair once detected.

Note that pseudoknot restraints are expressed by including an additional line with the entangled helix on a second line. This can be done up to as many lines as needed to specify any very deeply entangled pseudoknots. This notation allows clear specification for more than one pseudoknot, as opposed to the usual notation "..(((((..[[[.))))).......]]]".


Figure 1b. Submitting sequence along with secondary structure restraints to SimRNAweb.

(3. Refining a 3D structure) When starting with a structure in PDB/mmCIF Format (e.g., 1l2x_rna_clust0.pdb), one should select the PDB/mmCIF in the Box(3) upload either format in Box (4) of the submission form. In principle, the secondary structure restraints listed in Box (5) or (6) are not absolutely required. However, in general, unless one wishes to continue (or restart) a simulation from some intermediate point without restraints, there is little reason to submit a correct PDB structure and do a simulation on it. Maybe there is a situation where this might be necessary, but in general, the purpose would (probably) be refinement.

The secondary structure information is entered in Box (5) or (6) as before,

..(((((......)))))..........
.........(((.............)))

and the input PDB structure file: 1l2x_rna_clust0.pdb is entered in Box (3).


Figure 1c. Submitting a PDB file along with secondary structure restraints to SimRNAweb.

(4. Refining a 3D structure with freezing residues, distance restraints, and hard secondary structure restraints) It is also possible to submit a PDB/mmcif format (Box (4)) with hard secondary structure restraints (Box (5)),

..(((((......)))))..........
.........(((.............)))

include the PDB structure file (1l2x_rna_clust0.pdb) for refinement in Box (11), specify frozen residues in the PDB file in Box (6),

A:3-7, 14-18

and upload any additional distance restraints into Box (10) using a text file with the appropriate syntax (e.g., 1l2x_restraints.txt)

SLOPE   A/14/C4' A/7/P    3.0  4.0    1.0
WELL    A/14/C4' A/7/P    4.0  6.0    1.0

NOTE: Please see the last Section of this help document to find more information on formatting and combining distance restraints (including some applied examples).


Figure 1d. Submitting a PDB file to SimRNAweb along with secondary structure restraints, distance restraints, and frozen parts of the structure (based on the PDB file).

(5. Sequence with pairing restraints) It is possible to provide information about the secondary structure in the pairing format. As before, the input type in Box (3) must be selected as "Sequence," and the sequence must be uploaded in box (4).

  GGCGCGGCACCGUCCGCGGAACAAACGG
Similarly to hard and soft secondary structure restraints, you can utilize hard or soft pairing restraints by pasting the pairing information in Box (8) or (9).

  A;3;C;A;18;G;WWc
  A;4;G;A;C;17;WWc
  A;5;C;A;G;16;WWc
  A;6;G;A;C;15;WWc
  A;7;G;A;C;14;WWc
  A;10;G;A;28;C;WWc
  A;11;C;A;27;G;WWc
  A;12;C;A;26;G;WWc

The current input format for constraints on non-canonical base pairs requires the user to specify the base pair type. This feature is particularly useful for known motifs based on non-canonical interactions, such as k-turns, e-loops and others. The example already included in the paper is the G-quadruplex, which is based solely on non-canonical base pairs, and where the specific interactions are known (the user can assume which residue pairs with which residue and what type of base pair is formed). We recognize that predicting the specific nature of non-canonical base pairs is difficult outside of the usual motifs. Most methods that can predict non-canonical pairs only do so at the residue pair level, but they rarely specify a concrete type of non-canonical base pair. If the user is unsure of the base pair type, the new soft constraints feature allows multiple alternative base pairing possibilities to be specified for the same pair of residues, allowing for an ambiguous definition of base pairs.


Figure 1e. submitting a sequence to SimRNAweb along with secondary structure restraints and distance restraints.

(6. Sequence with soft secondary structure restraints and chemical restraints) As before input type (Box (3)) must be "Sequence" and be entered in the Box (4)

  GCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUGAAGUG
Secondary structure should be pasted in Box (6)

  ((((((((...((((((.........))))))........((((((.......))))))..)))))))).
chemical probing information should be provided in Box (7)
#A
1 0.0
2 0.0
3 0.0
4 0.0
5 0.12
6 0.06
7 0.02
8 0.4
11 0.28
12 0.03
13 0.0
14 0.0
15 0.0
16 0.02
17 0.06
18 0.2
19 0.25
20 0.17
21 0.05
22 0.48
23 0.21
...
the full input for chemical probing can be found here (just add #A at the begining of the chemical probing data)
Figure 1f. submitting a sequence to SimRNAweb along with secondary structure restraints and distance restraints.

NOTE: Regarding the interpretation of chemical probing data, SimRNAWeb v2.0 employs a simplistic approach focused solely on base pairing, while the reactivity to chemical probes can be influenced by factors beyond the status of base pairing. Thus, on one hand, this method does not accommodate the inherent noise in chemical probing data, and on the other, it does not endeavor to interpret complex 3D structural features that may affect actual reactivity. Nonetheless, these types of restraints serve merely as a bias and do not drive the simulation to completely fulfill and potentially overfit the restraints. The current implementation enables users to input data that guide the simulation towards conformations enriched in regions of low reactivity in chemical probing experiments, which are preferably (but not exclusively) involved in forming helices or long-range interactions


Detailed description of inputs

1. Format of sequence input files

The input data is written in a single line in a basic text file with the sequence of RNA (both upper and lower cases are acceptable). For example:

AGACUGCUGAGAGACC

There should be nothing but the desired sequence or sequences contained in the file because the program will read everything in the file as though it were part of a sequence. There should be no additional spaces either.

To have more than one RNA chain as an input, the user must separate the different chains by white spaces. For example:

AAGCUA AAAGCUGGGCU

2. Format of secondary structure restraint files

If the user wants to provide secondary structure restraints, the contents of the restraint file should be in the following one-line format:

.((((......)))).

Or, when pseudoknots are involved, several lines can be provided depending on the characteristics of the pseudoknot. For example, if there is only one pseudoknot, then the following is sufficient:

.((((......)))).
......(........)

If more than one pseudoknot is involved, each one should be written on a separate line. For example, the following structure would involve two pseudoknots:

((((.......))))...............((((.........))))).
......((((.............))))......................
..................((((..............)))).........
Comments:
  • In general, it is good policy to write the dominant secondary structure on the first line and place only single hairpin loops closing the pseudoknots on subsequent lines; however, this is not strictly required.
  • The program reads in the constraints line by line. Therefore, the following input
    (((......)))    
    can also be written as follows
    (..........)
    .(........).
    ..(......)..    
    It is important to emphasize that the data for secondary structure and pseudoknots must be listed on subsequent lines regardless of how the data is specified. Otherwise, SimRNA will assume that there is a second chain, and it is likely that an error will occur.
  • Constraints can also be applied to multichain problems. For example, in the case of two chains, restraints can be written as follows:

    AAAACCCCUUUU AAAACCCCUUUU
    ((((....(((( ))))....))))    

    The above example will form a double-stranded RNA (dsRNA) stem with an interior loop containing poly(C). When the sequence is written as above in the restraint file, the first line is ignored.

  • If more than two chains are involved, this can also be accommodated by the above scheme. For example, constraints on four chains could be written as follows

    AAAACCCCUUUU AAAACCCCUUUU AAAAGGGGAAAA AAAAGGGGAAAA
    ((((....(((( ))))....)))) ............ ............
    ............ ....((((.... ....)))).... ............
    ....((((.... ............ ............ ....))))....    


    Figure 3. A possible 3D structure of the four sequence shown above folded under the proposed restraints using SimRNA.

  • In general, there is a variety of ways that this file can be written. However, clarity is probably the most important thing to remember.

  • Finally, please note that SimRNAweb doesn’t allow the user to exclude the possibility of base pairing using the secondary structure constraints file. Thus, even the dot “.” does not prohibit the formation of base pairing.

3. Format of structure input files

The user requests starting the calculation with a structure provided by the user in PDB format.

Essentially, a PDB file is cleaned (water, ions, non-standard residues are removed) with `rna-pdb-tools` to get a file "SimRNA ready". However, these tools simply follow orders (all muscle and no brain). Therefore, it is wise when the user prepares the PDB files to avoid any inadvertent misinterpretation of desired structural information on the part of the automated tools.

Hence, although a fair amount of flexibility is built into SimRNAweb, there are some important caveats to keep in mind.

  • SimRNAweb can read the HETATM tags. Therefore, most of the time, it is sufficient to simply change a modified residue name to its unmodified name (A, C, G or U) without any additional effort on editing the PDB file. However, the user should make sure that the HETATM references point to desired parts of the RNA structure: not ligands or other molecules that may have been needed to crystallize the RNA structure in a particular state or are part of the crystal structure that was obtained. The outcome of a job submission for such uninspected PDB files simply cannot be predicted. Therefore, it is the user's responsibility to be sure that SimRNAweb is being fed the intended RNA structure and not garbage.
  • Sometimes, some of the backbone atoms are present for a residue, but important parts (or all) of the base are missing. Also, sometimes, to crystallize the structure, very special residues are constructed that do not have the same essential atoms needed by SimRNA. The essential atoms are C4′,P,N1,C2,C4 (for any pyrimidine residues) or C4′,P,N9,C2,C6 (for any purine residues). If any of these critical atoms are missing, then all of the atoms of the residue (including the backbone) should be removed from the PDB file, and the correct sequence (including the missing base) should be inserted in Box (3), as in the examples shown above. Therefore, it is important to examine the PDB file for missing or incomplete information. If any part of this information is missing, the structure is inadequately defined and will be rejected by SimRNAweb.
  • Another problem is modified bases. In some cases, simply changing HETATM to ATOM and changing the residue name to the unmodified base (A, C, G or U) is sufficient. However, if the modification changes the name of any one of the essential atoms that are used by SimRNA, this will be the same as having an incompletely defined residue. After changing the tag and the name of the residue, the residue atoms should be inspected to verify that the critical atoms C4′,P,N1,C2,C4 (for a pyrimidine) or C4′,P,N9,C2,C6 (for a purine) are present. If any of these are missing, the residue should be removed from the PDB file and only specified in the sequence (submitted in Box (3), as explained above).
  • SimRNAweb will insert the 5′ most phospate if it is missing. However, it does not hurt to verify whether it is present or not, because the way of doing this insertion presently is to rename the O5' atom to a P atom at the 5′-most position. In general, this should not introduce any issues, particularly when SimRNA is converted from its reduced representation to the all atom representation after a brief simulation. Nevertheless, it should be kept in mind that this amounts to a "quick fix" and may not be what the user genuinely wants. If so, then the user will need to find a way to insert the desired 5′ P in a more amenable position.

4. Distance restraint command formats

In SimRNA, distance restraints can be defined for any pair of atoms used in SimRNA representation, as well as to the central point of the nucleic acid base: for pyrimidines P, C4′, N (N1, N9), C2, C4 and for purines P, C4′, N9, C2, C4 and C6 (for purines) and the the middle of the base (label MB).

The restraints come in two basic forms: WELL and SLOPE. A typical WELL restraint effectively "captures" the two beads when they come within a prescribed distance from each other as in Figure 4a, where the penalty is zero when the distance between the orange and red bead is outside of the well, and some negative number when inside the well. This means nothing happens until it finds the hole. A typical SLOPE restraint penalizes any region outside the zone where the penalty is zero as in Figure 4b.

Figure 4. A cartoon describing the way restraints affect the interaction between two beads: here orange is the reference bead and the red bead is shown moving relative to the orange bead. a) A WELL restraint where outside the hole, the red bead moves freely and inside the hole, it is trapped to a specific range. b) A SLOPE restraint where the penalty is zero when the distance between the beads is inside the zone, and outside this, the beads are either pulled together or pushed away.

The restraints come in two basic forms: WELL and SLOPE. A typical WELL restraint effectively "captures" the two beads when they come within a prescribed distance from each other as in Figure 4a, where the penalty is zero when the distance between the orange and red bead is outside of the well, and some negative number when inside the well. This means nothing happens until it finds the hole. A typical SLOPE restraint penalizes any region outside the zone where the penalty is zero as in Figure 4b.

Figure 4. A cartoon describing the way restraints affect the interaction between two beads: here orange is the reference bead and the red bead is shown moving relative to the orange bead. a) A WELL restraint where outside the hole, the red bead moves freely and inside the hole, it is trapped to a specific range. b) A SLOPE restraint where the penalty is zero when the distance between the beads is inside the zone, and outside this, the beads are either pulled together or pushed away.

The WELL restraint is expressed by a single line in the restraints file as follows:

WELL atom_1_id atom_2_id min_dist max_dist weight

The SLOPE restraint is expressed similarly as follows:

SLOPE atom_1_id atom_2_id min_dist max_dist weight 

or (alternative for SLOPE):

DISTANCE atom_1_id atom_2_id min_dist max_dist weight  

Example line in a restraints file:

SLOPE A/23/C4' C/45/P 5.5 8.5 1.0
WELL A/23/C4' C/45/P 6.5 7.5 1.0  

where

A/23/C4' means atom C4' of nucleotide 23 in chain A
C/45/P means atom P in nucleotide 45 in chain C

5.5 [Å]: minimal distance where the weight is zero (for SLOPE)
6.5 [Å]: minimal distance where the weight is -1 (for WELL)
7.5 [Å]: maximal distance where the weight is -1 (for WELL)
8.5 [Å]: maximal distance where the weight is zero (for SLOPE)
1.0 weight of this restraint weight for both SLOPE and WELL. For WELL, the value is -1 between 6.5 and 7.5 [Å], for SLOPE the value increases for distances greater than 8.5 or less than 5.5 [Å].

This is an example of a multifunctional restraint that resembles Figure 5e.

Comments:

  • If the input file is a PDB file, then the nucleotide numbers specified in the restraints file are according to numbering in input PDB file!
  • In SimRNA representation, the atom name N represents the nitrogen that binds the base to the backbone. Hence,N corresponds to N1 for pyrimidines and N9 for purines! This label can also be used instead of N9 for purines and N1 for pyrimidines. SimRNA also permits the user to restrain the C2 atom or and also the C6 atom for purines or the C4 atom for pyrimidines.
  • The user can also apply restraints for a middle atom of the base (pseudo atom) which is named MB! This is useful for restraining the bases such that they are only in contact but not specifically tied to some prescribed orientation such as Watson-Crick, or Hoogsteen edge, or whatever.

Restraint options

Figure 5. Examples of types of constraints. a) An elementary function of type SLOPE that depends on the following three parameters: the minimum distance, the maximum distance and the slope. b) An elementary function of type WELL that depends on three parameters: the minimum and maximum distance and the depth of the well. c) A single SLOPE function with negative weight. d) A single WELL function with negative weight. e) A combination one SLOPE function and one WELL function. f) A combination of three SLOPE and two WELL functions, both one WELL function and one SLOPE function with negative weights.


A restraint can be thought of as a flexible tether that drives the selected atoms towards a certain distance by applying a penalty for distances that deviate from that range. It can also provide a reward when a desired distance is achieved. The penalty and reward are positive and negative contributions to the total energy of the simulated system, respectively.

There are two types of distance restraints: WELL and SLOPE (the keyword DISTANCE can also be used in the place of SLOPE). Both restraints describe an inner zone between the specified minimum number and maximum number (which can be the same number). For SLOPE, the penalty within the inner zone is zero, and all regions outside change linearly with distance by the weight outside this zone. When the weight is positive, the SLOPE forms a "V" shape or a "\_/" shape depending on the size of the inner zone (Figure 5a). If the weight is negative, the shape will be inverted, but the penalty in the inner zone is always zero (for SLOPE). In the case of WELL, a positive weight produces a divot "|_|" where outside the zone, the value is zero and inside the well, the energy is negative (Figure 5a). Changing the sign of the weight for WELL means we create a wall or a stumbling block (a positive penalty) in the inner zone.

The basic forms for SLOPE and WELL, where the weight is positive, are shown in Figure 5a and b.

In the case of a SLOPE-type restraint, the two atoms are tethered towards the region by applying a linear penalty that corresponds to the degree of violation of the distance from the desired region. When the distance between the atoms becomes equal to the desired value, the value of the function reaches zero. The shape of the function resembles a V, with a bottom that can correspond to a single point or to a “flat” region (Figure 5a).

In case of a WELL-type restraint, the function is flat and equals zero for any distance outside the desired range, while the distances within the desired range correspond to the negative value of the weight (Figure 5b).

Both the SLOPE and WELL restraint functions can be “reversed” when a negative weight is applied (c.f., Figures 5c and d). For example, applying a SLOPE-type function with a negative weight can be used as a repelling function (Figure 5c). This function can be useful in simulations in which the user desires to study molecule stretching between terminal residues, for example. On the other hand, the WELL-type function can be applied with a negative weight when the user wishes to define a distance range that the atoms should avoid. When atoms are in the distance range specified by WELL, an additional penalty is applied (Figure 5d).

Any number of these two types of functions can be also combined in order to define complex restraints. The resulting function can adopt various shapes (Figures 5e and f). Therefore, the relative distance of two atoms under consideration can be described by a dedicated function or a linear combination of functions used as a part of the total scoring of the energy.

For both types of restraints, the user must specify the restraints in subsequent lines of the restraint file in the following format

ChX/i/atom_i ChY/j/atom_jmin_distmax_distweight

where examples are provided in the next section. Here, ChX and ChY specify the chain index (chain name can be the same or different), i and j refer to the index of the particular residue on the respective chain, and atom_i and atom_j refer to the atom on which the constraint is applied. Restraints of type WELL are 0 except for the range between min_dist and max_dist. For the region between min/max (min_distmax_dist), the value becomes -1*weight.

Restraints of type SLOPE are 0 within the range, min_distmax_dist. Outside that range, a linear increasing positive penalty is added (the pair of atoms are attracted to each other because there is less penalty as they approach the region between min_dist and max_dist). The value for the penalty is dist_violation*weight.

Restraints for a given pair of atoms can be combined (added). It requires two (or more) lines to specify subsequent contributions.

For an applied example of using the above described restraints, Figure 6 shows two examples where the secondary structure restraints and distance restraints (WELL and SLOPE) were used to improve the fit of the 3D structure for two tRNA structures. The necessary restraint files and sequence for folding 3L0U are also provided as an example on the submission page of SimRNAweb, where the best structure using this combination of restraints was 6.1 Angstroms RMSD (Figure 6a). Figure 6b provides the requisite files for PDB structure 1EVV, where SimRNAweb produced one cluster with 6.5 Angstroms RMSD.


Figure 6a. Results of folding the sequence for PDB id 3L0U with secondary structure restraints and distance restraints using SLOPE and WELL. The native structure is shown in green. The blue region shows where the distance restraints were applied. The tRNA structure has modified bases in this region of the structure.

Figure 6b. Results of folding the sequence for PDB id 1EVV with secondary structure restraints and distance restraints using SLOPE and WELL. The native structure is shown in green. Here also, the tRNA structure has modified bases in this region of the structure.

5. Format of pairing restraint file

In SimRNA, pairing restraints can be defined for two nucleotides. Distances between atoms in the nucleic acid base: for pyrimidines P, C4′, N (N1, N9), C2, C4 and for purines P, C4′, N9, C2, C4 and C6 (for purines) are pre-calculated with data in ClaRNA

The restraints format is as below:

    chain_id_1;nucleotide_number_1;nucleotide_name_1;chain_id_2;nucleotide_number_2;nucleotide_name_2
  
Example line in pairing restraint file
    A;3;C;A;18;G;WWc
  

NOTE: The current input format for constraints on non-canonical base pairs requires the user to specify the base pair type. This feature is particularly useful for known motifs based on non-canonical interactions, such as k-turns, e-loops and others. The example already included in the paper is the G-quadruplex, which is based solely on non-canonical base pairs, and where the specific interactions are known (the user can assume which residue pairs with which residue and what type of base pair is formed). We recognize that predicting the specific nature of non-canonical base pairs is difficult outside of the usual motifs. Most methods that can predict non-canonical pairs only do so at the residue pair level, but they rarely specify a concrete type of non-canonical base pair. If the user is unsure of the base pair type, the new soft constraints feature allows multiple alternative base pairing possibilities to be specified for the same pair of residues, allowing for an ambiguous definition of base pairs. If the user is uncertain about the base pair type, the novel soft constraints feature permits the specification of multiple alternative base pairing possibilities for the same residue pair, facilitating an ambiguous definition of base pairs. SimRNAWeb also gives the user the ability to impose restraints on the spatial proximity of the bases, without implying any particular type of the interaction (see 4. Distance restraint command formats).

6. Format of chemical probing restraint file

In SimRNA, chemical probing restraints can be defined for any nucleotide the format is as below:

    #chain_id
    nucleotide_number nucleotid_reactivity
  
the reactivity can be any number but number lesser than 0 would be interpreted as 0 and number greater than 1 would be interpreated as 1. and there is no information for a residue it would be interpted as 0.5 therefore it is recomended to use normalized reactivity as restraints in SimRNA. An example for chemical probing restraints:
    #A
    1 0.0
    2 0.0
    3 0.0
    4 0.0
    5 0.12
    6 0.06
    7 0.02
    8 0.4
  

Note: If you have several different chains but lack chemical probing data for some of them, simply use "#" in the correct position for each chain.

Note: The nucleotide numbering must be continuous from the previous chain.

    #A(1:38)
    1 0.0
    2 0.0
    3 0.0
    4 0.0
    .
    .
    .
    35 0.12
    36 0.06
    37 0.02
    38 0.4
    #B(39:50) without data
    #C(51:60) without data
    #D(61:98)
    61 0.0
    62 0.0
    63 0.0
    64 0.0
    .
    .
    .
    95 0.12
    96 0.06
    97 0.02
    98 0.4
  

The separation symbol between different chains is "#"; other things in the following are for informational purposes to provide users with additional details.

NOTE: Regarding the interpretation of chemical probing data, SimRNAWeb v2.0 employs a simplistic approach focused solely on base pairing, while the reactivity to chemical probes can be influenced by factors beyond the status of base pairing. Thus, on one hand, this method does not accommodate the inherent noise in chemical probing data, and on the other, it does not endeavor to interpret complex 3D structural features that may affect actual reactivity. Nonetheless, these types of restraints serve merely as a bias and do not drive the simulation to completely fulfill and potentially overfit the restraints. The current implementation enables users to input data that guide the simulation towards conformations enriched in regions of low reactivity in chemical probing experiments, which are preferably (but not exclusively) involved in forming helices or long-range interactions.

7. Clustering options

We have broadened the clustering functionalities to incorporate two novel methods for identifying clusters among the highest-scored frames in a SimRNA trajectory. Previously, the server only offered Option Density-based (the default setting in SimRNA), which identifies a frame that attracts the maximal count of best-scored frames within a specified clustering threshold. This frame is designated as the cluster representative, the set of frames is extracted as the cluster, and this process is recursively applied to the remaining best-scored frames to delineate up to five largest clusters. The newly integrated Option Center-based stipulates that every cluster member must maintain an inter-frame RMSD below a user-defined threshold, with the cluster's representative being the frame that minimizes the cumulative RMSD to all other frames. This option is useful for the identification of clusters that are relatively tight in terms of conformational variability. Additionally, Option Energy-based has been introduced, where initially the highest-scored frame is identified, and all frames with an RMSD below a specified threshold relative to this frame are grouped and extracted, and this method is iteratively applied to the remaining frames.

Submit options

Job title – letters, digits, and +_-.(), 20 first characters of a title will make a job id so pick something short, sweet, and to the point.

E-mail address – the email address will be used to send results, but is not required of the user. However, for long sequences, the simulation can take many hours, so if the page is lost, there is no way to find it again.

RNA sequence – see above

Secondary structure restraints (hard and soft) – see above

Pairing restraints (hard and soft) – see above

Chemical probing restraints – see above

distance restraints – see above


Workflow of modeling your sequence using a fragment of the tetraloop motif

(For the old version of SimRNAWeb but still useful!)

This is a more advanced demo on how SimRANweb can be used to give you a feel of the usability of the server.

Prepare a PDB file used as a fragment to model a tetraloop motif of your sequence

To model your RNA sequence of interest (CGCGCAAGCG) using a tetraloop PDB motif taken from the PDB database, first we have to prepare the PDB file.
   XXXX    <- use the tetraloop from 1zih to model your RNA
1234567890 # numbering of your RNA sequence
CGCGCAAGCG # your RNA sequence
(((....))) # secondary structure of your RNA sequence
Start PyMOL (https://www.pymol.org/) and fetch a structure 1zih (fetch 1zih).

Remember, it is absolutely essential to examine the PDB file (e.g. with PyMOL), check for missing parts, gaps (or unusual numbering), ions, water, or anything else that looks suspicious.

Note that this PDB structure has hydrogen atoms, please remove them (Action -> hydrogen -> remove). Select the tetraloop ('GCAA') and extract it to a new object and rename this object to set_name 1zih, tetraloop. Since the number of the tetraloop is slightly different than in the RNA sequence, the numbering must be shifted by 1 (the 5th residue becomes the 4th etc) using alter (sele), resv-=1. Note that this PDB file has 10 states, we need only one to use with SimRNAweb. The easiest way to get rid of additional states is to save the molecule to a new PDB file. Now you can use this file to model your sequence.

SimRNAweb

Now you are ready to run SimRNAweb. Type a sequence, secondary structure and residues to freeze (i.e., residues that should not move during the simulation).
seq: CGCGCAAGCG
secondary structure: (((....)))
freeze: A:4-7
upload the file tetraloop.pdb and click Submit! Happy prediction!