RNA models for: Demo6 (Demo6)
UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA
n steps: 1000 (~ n of SimRNA frames: 80000, curr n of frames None = 0%) March 27, 2024, 10:48 a.m.
The best score and representatives of up to five top clusters from your simulation:
- Best score Demo6_1minE-000001_AA.pdb
- #1 cluster Demo6_clust01-000001_AA.pdb
- #2 cluster Demo6_clust02-000001_AA.pdb
- #3 cluster Demo6_clust03-000001_AA.pdb
- #4 cluster Demo6_clust04-000001_AA.pdb
- #5 cluster Demo6_clust05-000001_AA.pdb
The trajectory file for the simulation can be found here (the file might be > 1GB!).
The raw output files for each step of the pipeline can be found here
The log of the data processing.