SimRNAweb2.0


SimRNA (Demo5)

RNA models for: Demo5/ (Demo5)

GGCGUUUUCGCCUUCGGGCGAAUUUUUUCGCU
n steps: 500 (~ n of SimRNA frames: 10000, curr n of frames None = 0%)
May 12, 2026, 10:14 a.m.

The best score and representatives of up to five top clusters from your simulation:

The trajectory file for the simulation can be found here (the file might be > 1GB!).

Download simulation files as ZIP (TRC, TRAFL, configuration, HDR, PDB, FA, SS, and distance-restraint files).

Best score model:

Demo5

1st cluster representative:

2nd cluster representative:

The log of the data processing.