SimRNA (alt struct)

SimRNA (alt struct)

RNA models for: Demo5 (alt struct)

GGCGUUUUCGCCUUCGGGCGAAUUUUUUCGCU

n steps: 1000 (~ n of SimRNA frames: 80000, curr n of frames None = 0%)
March 27, 2024, 10:37 a.m.

The best score and representatives of up to five top clusters from your simulation:

Best score Demo5_1minE_TOTAL-000001_AA.pdb
#1 cluster Demo5_clust01-000001_AA.pdb
#2 cluster Demo5_clust02-000001_AA.pdb
#3 cluster Demo5_clust03-000001_AA.pdb
#4 cluster Demo5_clust04-000001_AA.pdb
#5 cluster Demo5_clust05-000001_AA.pdb

The trajectory file for the simulation can be found here (the file might be > 1GB!).

The raw output files for each step of the pipeline can be found here

Best score model:

Demo5

1^st cluster representative:

2^nd cluster representative:

The log of the data processing.