GCCGAGUAGUGUUGGGUCGCGAAAGGC
n steps: 1000 (~ n of SimRNA frames: 1000, curr n of frames 1000 = 100.0%) Dec. 24, 2023, 2:33 p.m.
The trajectory file for the simulation can be found here (the file might be > 1GB!).
The raw output files for each step of the pipeline can be found here
The log of the data processing.
Job log:SimRNA (c) 2009-2024 Genesilico, ver. 3.33 .reading parameteres before entireStruct->initialize(input) reading input pdb file: /home/smoafinejad/SimRNP/test/SIMULATIONS/Demo4-07d8682d/inputs/struct.pdb number of recognized chains: 1 chain 'A' contains: 27 residues chain 'A' is classfied as RNA number of RNA chain(s) to be parsed: 1 RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 27 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 DONE x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 140 n_atoms_counter: 140 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 RNAStructure::tertiaryStrcWeight = 1.000000 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2 : 26 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2 : 25 , with interaction type: CG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2 : 24 , with interaction type: CG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2 : 19 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2 : 18 , with interaction type: UG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2 : 17 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2 : 23 , with interaction type: GA_SHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2 : 22 , with interaction type: AA_HHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2 : 6 , with interaction type: GU_SHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2 : 21 , with interaction type: UA_WHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2 : 20 , with interaction type: AG_HSt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2 : 15 , with interaction type: UG_WWt EntireStructure::rnaStruct limitingSphereRadius : 27.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) random seed = 1 number of iterations = 1600000 trajectory write in every 1600 iterations initTemp = 1.350 finalTemp = 0.900 tempStep = -2.812500e-07 DONE .calculating ===================================== Write number: 1 Temperature: 1.350000 Total energy: -274.319703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.319703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.342096 (E_RNA) where: Base-Base interactions energy: -178.442 where: short stacking energy: -77.995 Base-Backbone interact. energy: -5.654 local terms energy: -90.245543 where: bonds (distance) C4'-P energy: -19.580 bonds (distance) P-C4' energy: -22.255 flat angles C4'-P-C4' energy: -17.086 flat angles P-C4'-P energy: -13.584 tors. eta vs tors. theta energy: -17.740 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 2 Temperature: 1.349550 Total energy: -274.833295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.833295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.855688 (E_RNA) where: Base-Base interactions energy: -179.245 where: short stacking energy: -78.574 Base-Backbone interact. energy: -5.654 local terms energy: -89.956068 where: bonds (distance) C4'-P energy: -19.464 bonds (distance) P-C4' energy: -22.023 flat angles C4'-P-C4' energy: -17.086 flat angles P-C4'-P energy: -13.576 tors. eta vs tors. theta energy: -17.807 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 3 Temperature: 1.349100 Total energy: -212.215442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.215442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.455695 (E_RNA) where: Base-Base interactions energy: -148.737 where: short stacking energy: -69.947 Base-Backbone interact. energy: -1.567 local terms energy: -67.151241 where: bonds (distance) C4'-P energy: -13.379 bonds (distance) P-C4' energy: -20.013 flat angles C4'-P-C4' energy: -9.650 flat angles P-C4'-P energy: -5.355 tors. eta vs tors. theta energy: -18.755 Dist. restrs. and SS energy: 5.240 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 4 Temperature: 1.348650 Total energy: -215.942779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.942779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.106978 (E_RNA) where: Base-Base interactions energy: -145.836 where: short stacking energy: -58.697 Base-Backbone interact. energy: 0.324 local terms energy: -72.595605 where: bonds (distance) C4'-P energy: -14.910 bonds (distance) P-C4' energy: -7.485 flat angles C4'-P-C4' energy: -19.631 flat angles P-C4'-P energy: -12.218 tors. eta vs tors. theta energy: -18.352 Dist. restrs. and SS energy: 2.164 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 5 Temperature: 1.348200 Total energy: -221.226685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.226685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.820988 (E_RNA) where: Base-Base interactions energy: -145.339 where: short stacking energy: -55.919 Base-Backbone interact. energy: -0.196 local terms energy: -77.286302 where: bonds (distance) C4'-P energy: -12.025 bonds (distance) P-C4' energy: -17.940 flat angles C4'-P-C4' energy: -18.201 flat angles P-C4'-P energy: -8.498 tors. eta vs tors. theta energy: -20.622 Dist. restrs. and SS energy: 1.594 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 6 Temperature: 1.347750 Total energy: -200.140020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.140020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.247686 (E_RNA) where: Base-Base interactions energy: -139.041 where: short stacking energy: -61.134 Base-Backbone interact. energy: -0.654 local terms energy: -67.552827 where: bonds (distance) C4'-P energy: -13.660 bonds (distance) P-C4' energy: -17.995 flat angles C4'-P-C4' energy: -11.846 flat angles P-C4'-P energy: -13.553 tors. eta vs tors. theta energy: -10.499 Dist. restrs. and SS energy: 7.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 7 Temperature: 1.347300 Total energy: -198.366423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.366423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.919014 (E_RNA) where: Base-Base interactions energy: -134.900 where: short stacking energy: -61.732 Base-Backbone interact. energy: -0.576 local terms energy: -67.442549 where: bonds (distance) C4'-P energy: -16.434 bonds (distance) P-C4' energy: -14.202 flat angles C4'-P-C4' energy: -15.491 flat angles P-C4'-P energy: -11.399 tors. eta vs tors. theta energy: -9.917 Dist. restrs. and SS energy: 4.553 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 8 Temperature: 1.346850 Total energy: -196.865587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.865587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.881123 (E_RNA) where: Base-Base interactions energy: -137.974 where: short stacking energy: -66.005 Base-Backbone interact. energy: 0.788 local terms energy: -66.694488 where: bonds (distance) C4'-P energy: -15.822 bonds (distance) P-C4' energy: -16.114 flat angles C4'-P-C4' energy: -15.062 flat angles P-C4'-P energy: -10.562 tors. eta vs tors. theta energy: -9.134 Dist. restrs. and SS energy: 7.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 9 Temperature: 1.346400 Total energy: -222.810820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.810820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.233293 (E_RNA) where: Base-Base interactions energy: -160.959 where: short stacking energy: -62.864 Base-Backbone interact. energy: -0.444 local terms energy: -66.830149 where: bonds (distance) C4'-P energy: -11.620 bonds (distance) P-C4' energy: -13.968 flat angles C4'-P-C4' energy: -16.644 flat angles P-C4'-P energy: -12.499 tors. eta vs tors. theta energy: -12.100 Dist. restrs. and SS energy: 5.422 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 10 Temperature: 1.345950 Total energy: -213.334686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.334686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.672803 (E_RNA) where: Base-Base interactions energy: -137.191 where: short stacking energy: -63.380 Base-Backbone interact. energy: -0.040 local terms energy: -79.441064 where: bonds (distance) C4'-P energy: -19.810 bonds (distance) P-C4' energy: -18.354 flat angles C4'-P-C4' energy: -14.035 flat angles P-C4'-P energy: -10.211 tors. eta vs tors. theta energy: -17.031 Dist. restrs. and SS energy: 3.338 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 11 Temperature: 1.345500 Total energy: -211.239321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.239321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.684138 (E_RNA) where: Base-Base interactions energy: -153.161 where: short stacking energy: -67.396 Base-Backbone interact. energy: -0.203 local terms energy: -61.319991 where: bonds (distance) C4'-P energy: -12.459 bonds (distance) P-C4' energy: -11.794 flat angles C4'-P-C4' energy: -16.621 flat angles P-C4'-P energy: -5.110 tors. eta vs tors. theta energy: -15.337 Dist. restrs. and SS energy: 3.445 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 12 Temperature: 1.345050 Total energy: -209.908070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.908070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.369803 (E_RNA) where: Base-Base interactions energy: -154.537 where: short stacking energy: -65.023 Base-Backbone interact. energy: -0.092 local terms energy: -62.740220 where: bonds (distance) C4'-P energy: -6.891 bonds (distance) P-C4' energy: -13.406 flat angles C4'-P-C4' energy: -15.128 flat angles P-C4'-P energy: -11.331 tors. eta vs tors. theta energy: -15.985 Dist. restrs. and SS energy: 7.462 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 13 Temperature: 1.344600 Total energy: -205.917793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.917793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.148687 (E_RNA) where: Base-Base interactions energy: -138.334 where: short stacking energy: -70.315 Base-Backbone interact. energy: -0.301 local terms energy: -71.513459 where: bonds (distance) C4'-P energy: -18.031 bonds (distance) P-C4' energy: -15.400 flat angles C4'-P-C4' energy: -13.196 flat angles P-C4'-P energy: -9.770 tors. eta vs tors. theta energy: -15.116 Dist. restrs. and SS energy: 4.231 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 14 Temperature: 1.344150 Total energy: -180.573840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.573840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.111311 (E_RNA) where: Base-Base interactions energy: -131.258 where: short stacking energy: -58.139 Base-Backbone interact. energy: 0.802 local terms energy: -57.654707 where: bonds (distance) C4'-P energy: -9.399 bonds (distance) P-C4' energy: -17.121 flat angles C4'-P-C4' energy: -12.308 flat angles P-C4'-P energy: -8.476 tors. eta vs tors. theta energy: -10.351 Dist. restrs. and SS energy: 7.537 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 15 Temperature: 1.343700 Total energy: -189.921875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.921875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.516814 (E_RNA) where: Base-Base interactions energy: -125.707 where: short stacking energy: -58.175 Base-Backbone interact. energy: -0.309 local terms energy: -71.501028 where: bonds (distance) C4'-P energy: -17.839 bonds (distance) P-C4' energy: -17.520 flat angles C4'-P-C4' energy: -12.968 flat angles P-C4'-P energy: -11.755 tors. eta vs tors. theta energy: -11.419 Dist. restrs. and SS energy: 7.595 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 16 Temperature: 1.343250 Total energy: -197.539591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.539591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.426379 (E_RNA) where: Base-Base interactions energy: -137.191 where: short stacking energy: -55.051 Base-Backbone interact. energy: 0.242 local terms energy: -67.477676 where: bonds (distance) C4'-P energy: -13.839 bonds (distance) P-C4' energy: -14.976 flat angles C4'-P-C4' energy: -19.888 flat angles P-C4'-P energy: -8.339 tors. eta vs tors. theta energy: -10.437 Dist. restrs. and SS energy: 6.887 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 17 Temperature: 1.342800 Total energy: -185.443338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.443338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.657293 (E_RNA) where: Base-Base interactions energy: -122.848 where: short stacking energy: -48.051 Base-Backbone interact. energy: -0.149 local terms energy: -68.660810 where: bonds (distance) C4'-P energy: -20.992 bonds (distance) P-C4' energy: -21.638 flat angles C4'-P-C4' energy: -9.254 flat angles P-C4'-P energy: -7.150 tors. eta vs tors. theta energy: -9.625 Dist. restrs. and SS energy: 6.214 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 18 Temperature: 1.342350 Total energy: -173.536816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.536816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.002660 (E_RNA) where: Base-Base interactions energy: -124.635 where: short stacking energy: -50.373 Base-Backbone interact. energy: -0.218 local terms energy: -56.150030 where: bonds (distance) C4'-P energy: -8.559 bonds (distance) P-C4' energy: -17.242 flat angles C4'-P-C4' energy: -14.375 flat angles P-C4'-P energy: -2.990 tors. eta vs tors. theta energy: -12.984 Dist. restrs. and SS energy: 7.466 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 19 Temperature: 1.341900 Total energy: -197.531136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.531136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.570286 (E_RNA) where: Base-Base interactions energy: -130.419 where: short stacking energy: -59.952 Base-Backbone interact. energy: -0.277 local terms energy: -72.874782 where: bonds (distance) C4'-P energy: -14.424 bonds (distance) P-C4' energy: -19.242 flat angles C4'-P-C4' energy: -16.748 flat angles P-C4'-P energy: -9.213 tors. eta vs tors. theta energy: -13.248 Dist. restrs. and SS energy: 6.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 20 Temperature: 1.341450 Total energy: -199.076604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.076604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.165232 (E_RNA) where: Base-Base interactions energy: -149.219 where: short stacking energy: -61.936 Base-Backbone interact. energy: -0.193 local terms energy: -54.752847 where: bonds (distance) C4'-P energy: -8.706 bonds (distance) P-C4' energy: -12.881 flat angles C4'-P-C4' energy: -14.370 flat angles P-C4'-P energy: -5.538 tors. eta vs tors. theta energy: -13.257 Dist. restrs. and SS energy: 5.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 21 Temperature: 1.341000 Total energy: -207.504428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.504428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.336562 (E_RNA) where: Base-Base interactions energy: -141.510 where: short stacking energy: -60.426 Base-Backbone interact. energy: 3.094 local terms energy: -73.919891 where: bonds (distance) C4'-P energy: -12.627 bonds (distance) P-C4' energy: -16.598 flat angles C4'-P-C4' energy: -13.622 flat angles P-C4'-P energy: -12.765 tors. eta vs tors. theta energy: -18.309 Dist. restrs. and SS energy: 4.832 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 22 Temperature: 1.340550 Total energy: -211.718387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.718387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.621841 (E_RNA) where: Base-Base interactions energy: -139.548 where: short stacking energy: -63.253 Base-Backbone interact. energy: 1.732 local terms energy: -81.806446 where: bonds (distance) C4'-P energy: -21.973 bonds (distance) P-C4' energy: -19.144 flat angles C4'-P-C4' energy: -15.110 flat angles P-C4'-P energy: -8.707 tors. eta vs tors. theta energy: -16.872 Dist. restrs. and SS energy: 7.903 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 23 Temperature: 1.340100 Total energy: -204.237488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.237488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.520668 (E_RNA) where: Base-Base interactions energy: -141.538 where: short stacking energy: -55.268 Base-Backbone interact. energy: -0.659 local terms energy: -66.324123 where: bonds (distance) C4'-P energy: -14.143 bonds (distance) P-C4' energy: -14.039 flat angles C4'-P-C4' energy: -16.117 flat angles P-C4'-P energy: -10.384 tors. eta vs tors. theta energy: -11.641 Dist. restrs. and SS energy: 4.283 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 24 Temperature: 1.339650 Total energy: -210.632663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.632663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.686462 (E_RNA) where: Base-Base interactions energy: -144.954 where: short stacking energy: -64.361 Base-Backbone interact. energy: 5.847 local terms energy: -75.579366 where: bonds (distance) C4'-P energy: -12.393 bonds (distance) P-C4' energy: -17.155 flat angles C4'-P-C4' energy: -20.504 flat angles P-C4'-P energy: -9.450 tors. eta vs tors. theta energy: -16.078 Dist. restrs. and SS energy: 4.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 25 Temperature: 1.339200 Total energy: -201.707934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.707934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.740333 (E_RNA) where: Base-Base interactions energy: -136.431 where: short stacking energy: -51.570 Base-Backbone interact. energy: -0.083 local terms energy: -71.226989 where: bonds (distance) C4'-P energy: -16.405 bonds (distance) P-C4' energy: -19.825 flat angles C4'-P-C4' energy: -13.883 flat angles P-C4'-P energy: -9.522 tors. eta vs tors. theta energy: -11.594 Dist. restrs. and SS energy: 6.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 26 Temperature: 1.338750 Total energy: -231.464792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.464792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.001353 (E_RNA) where: Base-Base interactions energy: -166.421 where: short stacking energy: -76.529 Base-Backbone interact. energy: 0.633 local terms energy: -71.212877 where: bonds (distance) C4'-P energy: -12.957 bonds (distance) P-C4' energy: -17.271 flat angles C4'-P-C4' energy: -20.109 flat angles P-C4'-P energy: -5.782 tors. eta vs tors. theta energy: -15.094 Dist. restrs. and SS energy: 5.537 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 27 Temperature: 1.338300 Total energy: -222.677051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.677051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.664987 (E_RNA) where: Base-Base interactions energy: -153.678 where: short stacking energy: -67.004 Base-Backbone interact. energy: -0.070 local terms energy: -74.917139 where: bonds (distance) C4'-P energy: -11.146 bonds (distance) P-C4' energy: -20.639 flat angles C4'-P-C4' energy: -15.358 flat angles P-C4'-P energy: -8.594 tors. eta vs tors. theta energy: -19.180 Dist. restrs. and SS energy: 5.988 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 28 Temperature: 1.337850 Total energy: -235.262966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.262966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.361845 (E_RNA) where: Base-Base interactions energy: -166.100 where: short stacking energy: -77.715 Base-Backbone interact. energy: -1.131 local terms energy: -71.131580 where: bonds (distance) C4'-P energy: -2.759 bonds (distance) P-C4' energy: -17.704 flat angles C4'-P-C4' energy: -15.846 flat angles P-C4'-P energy: -13.127 tors. eta vs tors. theta energy: -21.695 Dist. restrs. and SS energy: 3.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 29 Temperature: 1.337400 Total energy: -247.715588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.715588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.434368 (E_RNA) where: Base-Base interactions energy: -176.020 where: short stacking energy: -88.775 Base-Backbone interact. energy: -0.015 local terms energy: -74.398793 where: bonds (distance) C4'-P energy: -6.796 bonds (distance) P-C4' energy: -15.745 flat angles C4'-P-C4' energy: -15.920 flat angles P-C4'-P energy: -14.320 tors. eta vs tors. theta energy: -21.618 Dist. restrs. and SS energy: 2.719 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 30 Temperature: 1.336950 Total energy: -234.814210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.814210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.748166 (E_RNA) where: Base-Base interactions energy: -156.749 where: short stacking energy: -72.707 Base-Backbone interact. energy: -2.624 local terms energy: -78.375597 where: bonds (distance) C4'-P energy: -11.545 bonds (distance) P-C4' energy: -12.531 flat angles C4'-P-C4' energy: -19.803 flat angles P-C4'-P energy: -14.707 tors. eta vs tors. theta energy: -19.790 Dist. restrs. and SS energy: 2.934 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 31 Temperature: 1.336500 Total energy: -233.458377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.458377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.671012 (E_RNA) where: Base-Base interactions energy: -158.205 where: short stacking energy: -69.391 Base-Backbone interact. energy: -0.149 local terms energy: -81.317432 where: bonds (distance) C4'-P energy: -18.612 bonds (distance) P-C4' energy: -15.964 flat angles C4'-P-C4' energy: -14.892 flat angles P-C4'-P energy: -12.071 tors. eta vs tors. theta energy: -19.778 Dist. restrs. and SS energy: 6.213 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 32 Temperature: 1.336050 Total energy: -235.631646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.631646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.987689 (E_RNA) where: Base-Base interactions energy: -168.380 where: short stacking energy: -81.379 Base-Backbone interact. energy: -0.101 local terms energy: -71.506547 where: bonds (distance) C4'-P energy: -11.632 bonds (distance) P-C4' energy: -15.545 flat angles C4'-P-C4' energy: -11.156 flat angles P-C4'-P energy: -12.093 tors. eta vs tors. theta energy: -21.081 Dist. restrs. and SS energy: 4.356 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 33 Temperature: 1.335600 Total energy: -235.645519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.645519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.838357 (E_RNA) where: Base-Base interactions energy: -161.683 where: short stacking energy: -71.274 Base-Backbone interact. energy: -0.111 local terms energy: -76.043811 where: bonds (distance) C4'-P energy: -14.583 bonds (distance) P-C4' energy: -16.543 flat angles C4'-P-C4' energy: -15.576 flat angles P-C4'-P energy: -11.413 tors. eta vs tors. theta energy: -17.929 Dist. restrs. and SS energy: 2.193 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 34 Temperature: 1.335150 Total energy: -240.197210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.197210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.944842 (E_RNA) where: Base-Base interactions energy: -158.081 where: short stacking energy: -64.310 Base-Backbone interact. energy: -0.447 local terms energy: -83.416007 where: bonds (distance) C4'-P energy: -17.391 bonds (distance) P-C4' energy: -19.036 flat angles C4'-P-C4' energy: -14.030 flat angles P-C4'-P energy: -13.613 tors. eta vs tors. theta energy: -19.346 Dist. restrs. and SS energy: 1.748 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 35 Temperature: 1.334700 Total energy: -206.210894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.210894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.651561 (E_RNA) where: Base-Base interactions energy: -144.171 where: short stacking energy: -53.106 Base-Backbone interact. energy: -0.902 local terms energy: -67.578927 where: bonds (distance) C4'-P energy: -14.203 bonds (distance) P-C4' energy: -14.859 flat angles C4'-P-C4' energy: -15.385 flat angles P-C4'-P energy: -10.176 tors. eta vs tors. theta energy: -12.956 Dist. restrs. and SS energy: 6.441 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 36 Temperature: 1.334250 Total energy: -226.606314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.606314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.567431 (E_RNA) where: Base-Base interactions energy: -156.972 where: short stacking energy: -61.910 Base-Backbone interact. energy: -0.242 local terms energy: -73.353968 where: bonds (distance) C4'-P energy: -13.477 bonds (distance) P-C4' energy: -19.276 flat angles C4'-P-C4' energy: -14.202 flat angles P-C4'-P energy: -11.517 tors. eta vs tors. theta energy: -14.882 Dist. restrs. and SS energy: 3.961 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 37 Temperature: 1.333800 Total energy: -210.497564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.497564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.120627 (E_RNA) where: Base-Base interactions energy: -144.342 where: short stacking energy: -54.451 Base-Backbone interact. energy: -0.399 local terms energy: -68.379492 where: bonds (distance) C4'-P energy: -14.294 bonds (distance) P-C4' energy: -12.358 flat angles C4'-P-C4' energy: -15.470 flat angles P-C4'-P energy: -14.110 tors. eta vs tors. theta energy: -12.148 Dist. restrs. and SS energy: 2.623 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 38 Temperature: 1.333350 Total energy: -223.368001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.368001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.304471 (E_RNA) where: Base-Base interactions energy: -157.688 where: short stacking energy: -74.151 Base-Backbone interact. energy: -0.176 local terms energy: -69.440650 where: bonds (distance) C4'-P energy: -12.118 bonds (distance) P-C4' energy: -15.189 flat angles C4'-P-C4' energy: -16.246 flat angles P-C4'-P energy: -7.359 tors. eta vs tors. theta energy: -18.529 Dist. restrs. and SS energy: 3.936 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 39 Temperature: 1.332900 Total energy: -225.858047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.858047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.893161 (E_RNA) where: Base-Base interactions energy: -153.192 where: short stacking energy: -61.647 Base-Backbone interact. energy: -1.014 local terms energy: -75.687478 where: bonds (distance) C4'-P energy: -16.800 bonds (distance) P-C4' energy: -18.713 flat angles C4'-P-C4' energy: -8.998 flat angles P-C4'-P energy: -12.797 tors. eta vs tors. theta energy: -18.380 Dist. restrs. and SS energy: 4.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 40 Temperature: 1.332450 Total energy: -234.625713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.625713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.382266 (E_RNA) where: Base-Base interactions energy: -163.352 where: short stacking energy: -82.308 Base-Backbone interact. energy: -0.006 local terms energy: -75.024277 where: bonds (distance) C4'-P energy: -11.262 bonds (distance) P-C4' energy: -10.402 flat angles C4'-P-C4' energy: -13.356 flat angles P-C4'-P energy: -10.978 tors. eta vs tors. theta energy: -29.026 Dist. restrs. and SS energy: 3.757 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 41 Temperature: 1.332000 Total energy: -203.704669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.704669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.071901 (E_RNA) where: Base-Base interactions energy: -146.992 where: short stacking energy: -74.055 Base-Backbone interact. energy: -0.120 local terms energy: -59.959663 where: bonds (distance) C4'-P energy: -7.339 bonds (distance) P-C4' energy: -12.800 flat angles C4'-P-C4' energy: -17.827 flat angles P-C4'-P energy: -3.388 tors. eta vs tors. theta energy: -18.606 Dist. restrs. and SS energy: 3.367 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 42 Temperature: 1.331550 Total energy: -209.393475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.393475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.602321 (E_RNA) where: Base-Base interactions energy: -150.682 where: short stacking energy: -72.691 Base-Backbone interact. energy: 5.965 local terms energy: -70.884560 where: bonds (distance) C4'-P energy: -12.140 bonds (distance) P-C4' energy: -13.967 flat angles C4'-P-C4' energy: -14.906 flat angles P-C4'-P energy: -11.300 tors. eta vs tors. theta energy: -18.572 Dist. restrs. and SS energy: 6.209 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 43 Temperature: 1.331100 Total energy: -243.750524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.750524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.902142 (E_RNA) where: Base-Base interactions energy: -158.261 where: short stacking energy: -75.356 Base-Backbone interact. energy: -1.104 local terms energy: -86.537310 where: bonds (distance) C4'-P energy: -20.334 bonds (distance) P-C4' energy: -16.735 flat angles C4'-P-C4' energy: -16.299 flat angles P-C4'-P energy: -10.123 tors. eta vs tors. theta energy: -23.047 Dist. restrs. and SS energy: 2.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 44 Temperature: 1.330650 Total energy: -228.620749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.620749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.461398 (E_RNA) where: Base-Base interactions energy: -154.001 where: short stacking energy: -71.524 Base-Backbone interact. energy: -0.045 local terms energy: -79.415640 where: bonds (distance) C4'-P energy: -16.116 bonds (distance) P-C4' energy: -11.971 flat angles C4'-P-C4' energy: -18.487 flat angles P-C4'-P energy: -13.019 tors. eta vs tors. theta energy: -19.823 Dist. restrs. and SS energy: 4.841 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 45 Temperature: 1.330200 Total energy: -231.355412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.355412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.436155 (E_RNA) where: Base-Base interactions energy: -158.179 where: short stacking energy: -72.297 Base-Backbone interact. energy: -0.571 local terms energy: -76.686188 where: bonds (distance) C4'-P energy: -14.907 bonds (distance) P-C4' energy: -14.940 flat angles C4'-P-C4' energy: -17.372 flat angles P-C4'-P energy: -13.323 tors. eta vs tors. theta energy: -16.145 Dist. restrs. and SS energy: 4.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 46 Temperature: 1.329750 Total energy: -206.271361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.271361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.753888 (E_RNA) where: Base-Base interactions energy: -140.406 where: short stacking energy: -60.988 Base-Backbone interact. energy: -0.286 local terms energy: -72.061834 where: bonds (distance) C4'-P energy: -16.393 bonds (distance) P-C4' energy: -15.344 flat angles C4'-P-C4' energy: -20.017 flat angles P-C4'-P energy: -5.080 tors. eta vs tors. theta energy: -15.229 Dist. restrs. and SS energy: 6.483 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 47 Temperature: 1.329300 Total energy: -225.258939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.258939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.944725 (E_RNA) where: Base-Base interactions energy: -155.653 where: short stacking energy: -74.428 Base-Backbone interact. energy: -0.076 local terms energy: -74.215861 where: bonds (distance) C4'-P energy: -7.958 bonds (distance) P-C4' energy: -18.509 flat angles C4'-P-C4' energy: -21.336 flat angles P-C4'-P energy: -8.919 tors. eta vs tors. theta energy: -17.494 Dist. restrs. and SS energy: 4.686 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 48 Temperature: 1.328850 Total energy: -214.717690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.717690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.672388 (E_RNA) where: Base-Base interactions energy: -148.954 where: short stacking energy: -67.145 Base-Backbone interact. energy: -0.834 local terms energy: -69.884108 where: bonds (distance) C4'-P energy: -15.160 bonds (distance) P-C4' energy: -16.121 flat angles C4'-P-C4' energy: -13.779 flat angles P-C4'-P energy: -14.764 tors. eta vs tors. theta energy: -10.061 Dist. restrs. and SS energy: 4.955 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 49 Temperature: 1.328400 Total energy: -202.594025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.594025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.005315 (E_RNA) where: Base-Base interactions energy: -130.162 where: short stacking energy: -61.999 Base-Backbone interact. energy: -0.000 local terms energy: -75.842419 where: bonds (distance) C4'-P energy: -8.543 bonds (distance) P-C4' energy: -13.417 flat angles C4'-P-C4' energy: -19.303 flat angles P-C4'-P energy: -13.975 tors. eta vs tors. theta energy: -20.605 Dist. restrs. and SS energy: 3.411 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 50 Temperature: 1.327950 Total energy: -195.042629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.042629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.469597 (E_RNA) where: Base-Base interactions energy: -140.550 where: short stacking energy: -55.259 Base-Backbone interact. energy: -0.138 local terms energy: -58.781468 where: bonds (distance) C4'-P energy: -7.362 bonds (distance) P-C4' energy: -14.571 flat angles C4'-P-C4' energy: -14.456 flat angles P-C4'-P energy: -11.985 tors. eta vs tors. theta energy: -10.408 Dist. restrs. and SS energy: 4.427 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 51 Temperature: 1.327500 Total energy: -206.113415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.113415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.860421 (E_RNA) where: Base-Base interactions energy: -137.371 where: short stacking energy: -66.059 Base-Backbone interact. energy: 1.189 local terms energy: -75.678489 where: bonds (distance) C4'-P energy: -14.778 bonds (distance) P-C4' energy: -15.024 flat angles C4'-P-C4' energy: -18.191 flat angles P-C4'-P energy: -8.150 tors. eta vs tors. theta energy: -19.535 Dist. restrs. and SS energy: 5.747 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 52 Temperature: 1.327050 Total energy: -214.909802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.909802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.062413 (E_RNA) where: Base-Base interactions energy: -145.154 where: short stacking energy: -55.213 Base-Backbone interact. energy: -0.006 local terms energy: -72.902312 where: bonds (distance) C4'-P energy: -15.907 bonds (distance) P-C4' energy: -18.565 flat angles C4'-P-C4' energy: -11.257 flat angles P-C4'-P energy: -12.699 tors. eta vs tors. theta energy: -14.474 Dist. restrs. and SS energy: 3.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 53 Temperature: 1.326600 Total energy: -213.545229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.545229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.843655 (E_RNA) where: Base-Base interactions energy: -141.822 where: short stacking energy: -53.376 Base-Backbone interact. energy: -0.179 local terms energy: -75.842421 where: bonds (distance) C4'-P energy: -16.202 bonds (distance) P-C4' energy: -15.410 flat angles C4'-P-C4' energy: -21.188 flat angles P-C4'-P energy: -13.147 tors. eta vs tors. theta energy: -9.895 Dist. restrs. and SS energy: 4.298 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 54 Temperature: 1.326150 Total energy: -227.326676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.326676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.136036 (E_RNA) where: Base-Base interactions energy: -147.499 where: short stacking energy: -68.243 Base-Backbone interact. energy: -0.142 local terms energy: -82.494881 where: bonds (distance) C4'-P energy: -19.787 bonds (distance) P-C4' energy: -14.923 flat angles C4'-P-C4' energy: -20.166 flat angles P-C4'-P energy: -11.312 tors. eta vs tors. theta energy: -16.307 Dist. restrs. and SS energy: 2.809 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 55 Temperature: 1.325700 Total energy: -233.595064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.595064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.364916 (E_RNA) where: Base-Base interactions energy: -166.805 where: short stacking energy: -81.478 Base-Backbone interact. energy: -0.007 local terms energy: -69.553229 where: bonds (distance) C4'-P energy: -11.375 bonds (distance) P-C4' energy: -10.918 flat angles C4'-P-C4' energy: -17.997 flat angles P-C4'-P energy: -4.293 tors. eta vs tors. theta energy: -24.970 Dist. restrs. and SS energy: 2.770 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 56 Temperature: 1.325250 Total energy: -216.219823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.219823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.911935 (E_RNA) where: Base-Base interactions energy: -143.947 where: short stacking energy: -68.935 Base-Backbone interact. energy: 0.432 local terms energy: -75.396308 where: bonds (distance) C4'-P energy: -16.392 bonds (distance) P-C4' energy: -12.518 flat angles C4'-P-C4' energy: -17.467 flat angles P-C4'-P energy: -13.858 tors. eta vs tors. theta energy: -15.161 Dist. restrs. and SS energy: 2.692 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 57 Temperature: 1.324800 Total energy: -220.142440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.142440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.415642 (E_RNA) where: Base-Base interactions energy: -154.714 where: short stacking energy: -75.389 Base-Backbone interact. energy: -0.600 local terms energy: -71.101613 where: bonds (distance) C4'-P energy: -14.369 bonds (distance) P-C4' energy: -13.220 flat angles C4'-P-C4' energy: -19.351 flat angles P-C4'-P energy: -10.535 tors. eta vs tors. theta energy: -13.627 Dist. restrs. and SS energy: 6.273 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 58 Temperature: 1.324350 Total energy: -212.464836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.464836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.045496 (E_RNA) where: Base-Base interactions energy: -153.245 where: short stacking energy: -70.389 Base-Backbone interact. energy: -1.404 local terms energy: -61.397067 where: bonds (distance) C4'-P energy: -11.549 bonds (distance) P-C4' energy: -11.617 flat angles C4'-P-C4' energy: -14.262 flat angles P-C4'-P energy: -9.799 tors. eta vs tors. theta energy: -14.170 Dist. restrs. and SS energy: 3.581 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 59 Temperature: 1.323900 Total energy: -225.188207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.188207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.340479 (E_RNA) where: Base-Base interactions energy: -154.122 where: short stacking energy: -62.794 Base-Backbone interact. energy: -0.172 local terms energy: -78.046353 where: bonds (distance) C4'-P energy: -18.085 bonds (distance) P-C4' energy: -18.578 flat angles C4'-P-C4' energy: -19.762 flat angles P-C4'-P energy: -7.912 tors. eta vs tors. theta energy: -13.709 Dist. restrs. and SS energy: 7.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 60 Temperature: 1.323450 Total energy: -225.021961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.021961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.009613 (E_RNA) where: Base-Base interactions energy: -157.094 where: short stacking energy: -60.225 Base-Backbone interact. energy: 0.168 local terms energy: -71.082981 where: bonds (distance) C4'-P energy: -13.658 bonds (distance) P-C4' energy: -21.429 flat angles C4'-P-C4' energy: -13.895 flat angles P-C4'-P energy: -6.272 tors. eta vs tors. theta energy: -15.829 Dist. restrs. and SS energy: 2.988 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 61 Temperature: 1.323000 Total energy: -229.802768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.802768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.527334 (E_RNA) where: Base-Base interactions energy: -163.495 where: short stacking energy: -75.297 Base-Backbone interact. energy: -0.124 local terms energy: -68.908429 where: bonds (distance) C4'-P energy: -10.964 bonds (distance) P-C4' energy: -12.632 flat angles C4'-P-C4' energy: -19.557 flat angles P-C4'-P energy: -8.255 tors. eta vs tors. theta energy: -17.500 Dist. restrs. and SS energy: 2.725 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 62 Temperature: 1.322550 Total energy: -236.177530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.177530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.104602 (E_RNA) where: Base-Base interactions energy: -167.635 where: short stacking energy: -77.667 Base-Backbone interact. energy: -0.530 local terms energy: -70.940477 where: bonds (distance) C4'-P energy: -13.333 bonds (distance) P-C4' energy: -16.076 flat angles C4'-P-C4' energy: -16.634 flat angles P-C4'-P energy: -5.141 tors. eta vs tors. theta energy: -19.757 Dist. restrs. and SS energy: 2.927 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 63 Temperature: 1.322100 Total energy: -233.118712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.118712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.171217 (E_RNA) where: Base-Base interactions energy: -162.892 where: short stacking energy: -76.863 Base-Backbone interact. energy: -0.106 local terms energy: -74.173311 where: bonds (distance) C4'-P energy: -11.361 bonds (distance) P-C4' energy: -16.343 flat angles C4'-P-C4' energy: -15.820 flat angles P-C4'-P energy: -12.221 tors. eta vs tors. theta energy: -18.427 Dist. restrs. and SS energy: 4.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 64 Temperature: 1.321650 Total energy: -227.943655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.943655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.527327 (E_RNA) where: Base-Base interactions energy: -159.812 where: short stacking energy: -70.933 Base-Backbone interact. energy: 1.257 local terms energy: -70.972764 where: bonds (distance) C4'-P energy: -15.009 bonds (distance) P-C4' energy: -15.279 flat angles C4'-P-C4' energy: -13.175 flat angles P-C4'-P energy: -8.905 tors. eta vs tors. theta energy: -18.605 Dist. restrs. and SS energy: 1.584 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 65 Temperature: 1.321200 Total energy: -231.293726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.293726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.596495 (E_RNA) where: Base-Base interactions energy: -160.354 where: short stacking energy: -73.734 Base-Backbone interact. energy: 2.573 local terms energy: -79.815490 where: bonds (distance) C4'-P energy: -14.695 bonds (distance) P-C4' energy: -15.755 flat angles C4'-P-C4' energy: -16.223 flat angles P-C4'-P energy: -14.365 tors. eta vs tors. theta energy: -18.778 Dist. restrs. and SS energy: 6.303 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 66 Temperature: 1.320750 Total energy: -219.790623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.790623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.774180 (E_RNA) where: Base-Base interactions energy: -152.775 where: short stacking energy: -64.428 Base-Backbone interact. energy: -0.130 local terms energy: -69.868699 where: bonds (distance) C4'-P energy: -14.944 bonds (distance) P-C4' energy: -18.140 flat angles C4'-P-C4' energy: -16.453 flat angles P-C4'-P energy: -8.012 tors. eta vs tors. theta energy: -12.319 Dist. restrs. and SS energy: 2.984 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 67 Temperature: 1.320300 Total energy: -204.732082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.732082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.735166 (E_RNA) where: Base-Base interactions energy: -148.243 where: short stacking energy: -65.974 Base-Backbone interact. energy: -0.726 local terms energy: -60.765944 where: bonds (distance) C4'-P energy: -16.061 bonds (distance) P-C4' energy: -12.884 flat angles C4'-P-C4' energy: -15.870 flat angles P-C4'-P energy: -6.554 tors. eta vs tors. theta energy: -9.396 Dist. restrs. and SS energy: 5.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 68 Temperature: 1.319850 Total energy: -207.204431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.204431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.029352 (E_RNA) where: Base-Base interactions energy: -143.491 where: short stacking energy: -55.791 Base-Backbone interact. energy: -0.273 local terms energy: -68.265338 where: bonds (distance) C4'-P energy: -12.364 bonds (distance) P-C4' energy: -13.828 flat angles C4'-P-C4' energy: -16.654 flat angles P-C4'-P energy: -9.228 tors. eta vs tors. theta energy: -16.191 Dist. restrs. and SS energy: 4.825 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 69 Temperature: 1.319400 Total energy: -220.810371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.810371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.226752 (E_RNA) where: Base-Base interactions energy: -149.456 where: short stacking energy: -59.417 Base-Backbone interact. energy: -0.391 local terms energy: -73.379556 where: bonds (distance) C4'-P energy: -18.207 bonds (distance) P-C4' energy: -17.343 flat angles C4'-P-C4' energy: -10.089 flat angles P-C4'-P energy: -12.886 tors. eta vs tors. theta energy: -14.854 Dist. restrs. and SS energy: 2.416 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 70 Temperature: 1.318950 Total energy: -194.838940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.838940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.384061 (E_RNA) where: Base-Base interactions energy: -138.817 where: short stacking energy: -51.930 Base-Backbone interact. energy: -0.992 local terms energy: -58.574521 where: bonds (distance) C4'-P energy: -6.382 bonds (distance) P-C4' energy: -21.457 flat angles C4'-P-C4' energy: -14.135 flat angles P-C4'-P energy: -6.824 tors. eta vs tors. theta energy: -9.777 Dist. restrs. and SS energy: 3.545 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 71 Temperature: 1.318500 Total energy: -231.048483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.048483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.893321 (E_RNA) where: Base-Base interactions energy: -155.095 where: short stacking energy: -62.114 Base-Backbone interact. energy: -0.738 local terms energy: -79.060553 where: bonds (distance) C4'-P energy: -14.402 bonds (distance) P-C4' energy: -18.674 flat angles C4'-P-C4' energy: -11.448 flat angles P-C4'-P energy: -14.523 tors. eta vs tors. theta energy: -20.014 Dist. restrs. and SS energy: 3.845 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 72 Temperature: 1.318050 Total energy: -224.742315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.742315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.979529 (E_RNA) where: Base-Base interactions energy: -154.683 where: short stacking energy: -67.452 Base-Backbone interact. energy: -0.518 local terms energy: -72.778801 where: bonds (distance) C4'-P energy: -14.376 bonds (distance) P-C4' energy: -12.682 flat angles C4'-P-C4' energy: -14.448 flat angles P-C4'-P energy: -13.098 tors. eta vs tors. theta energy: -18.174 Dist. restrs. and SS energy: 3.237 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 73 Temperature: 1.317600 Total energy: -219.528716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.528716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.249065 (E_RNA) where: Base-Base interactions energy: -141.808 where: short stacking energy: -60.356 Base-Backbone interact. energy: -0.531 local terms energy: -80.910267 where: bonds (distance) C4'-P energy: -19.804 bonds (distance) P-C4' energy: -18.570 flat angles C4'-P-C4' energy: -15.570 flat angles P-C4'-P energy: -9.241 tors. eta vs tors. theta energy: -17.725 Dist. restrs. and SS energy: 3.720 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 74 Temperature: 1.317150 Total energy: -213.441918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.441918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.267587 (E_RNA) where: Base-Base interactions energy: -144.056 where: short stacking energy: -61.314 Base-Backbone interact. energy: -0.009 local terms energy: -73.202532 where: bonds (distance) C4'-P energy: -18.052 bonds (distance) P-C4' energy: -12.965 flat angles C4'-P-C4' energy: -17.076 flat angles P-C4'-P energy: -9.001 tors. eta vs tors. theta energy: -16.108 Dist. restrs. and SS energy: 3.826 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 75 Temperature: 1.316700 Total energy: -207.715555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.715555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.906325 (E_RNA) where: Base-Base interactions energy: -143.378 where: short stacking energy: -62.099 Base-Backbone interact. energy: -0.675 local terms energy: -70.853410 where: bonds (distance) C4'-P energy: -12.567 bonds (distance) P-C4' energy: -15.426 flat angles C4'-P-C4' energy: -17.715 flat angles P-C4'-P energy: -9.405 tors. eta vs tors. theta energy: -15.741 Dist. restrs. and SS energy: 7.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 76 Temperature: 1.316250 Total energy: -210.923581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.923581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.482939 (E_RNA) where: Base-Base interactions energy: -148.437 where: short stacking energy: -74.465 Base-Backbone interact. energy: -0.062 local terms energy: -69.983981 where: bonds (distance) C4'-P energy: -15.304 bonds (distance) P-C4' energy: -15.741 flat angles C4'-P-C4' energy: -14.630 flat angles P-C4'-P energy: -10.731 tors. eta vs tors. theta energy: -13.578 Dist. restrs. and SS energy: 7.559 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 77 Temperature: 1.315800 Total energy: -215.298720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.298720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.066610 (E_RNA) where: Base-Base interactions energy: -151.003 where: short stacking energy: -60.378 Base-Backbone interact. energy: -0.631 local terms energy: -67.432467 where: bonds (distance) C4'-P energy: -15.943 bonds (distance) P-C4' energy: -12.654 flat angles C4'-P-C4' energy: -18.566 flat angles P-C4'-P energy: -9.819 tors. eta vs tors. theta energy: -10.450 Dist. restrs. and SS energy: 3.768 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 78 Temperature: 1.315350 Total energy: -233.754202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.754202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.027959 (E_RNA) where: Base-Base interactions energy: -159.203 where: short stacking energy: -64.403 Base-Backbone interact. energy: -0.024 local terms energy: -77.800563 where: bonds (distance) C4'-P energy: -15.232 bonds (distance) P-C4' energy: -14.850 flat angles C4'-P-C4' energy: -17.057 flat angles P-C4'-P energy: -12.935 tors. eta vs tors. theta energy: -17.727 Dist. restrs. and SS energy: 3.274 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 79 Temperature: 1.314900 Total energy: -238.882479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.882479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.078271 (E_RNA) where: Base-Base interactions energy: -157.768 where: short stacking energy: -68.886 Base-Backbone interact. energy: -0.110 local terms energy: -84.200868 where: bonds (distance) C4'-P energy: -19.534 bonds (distance) P-C4' energy: -18.322 flat angles C4'-P-C4' energy: -15.528 flat angles P-C4'-P energy: -9.253 tors. eta vs tors. theta energy: -21.564 Dist. restrs. and SS energy: 3.196 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 80 Temperature: 1.314450 Total energy: -196.343232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.343232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.237994 (E_RNA) where: Base-Base interactions energy: -136.019 where: short stacking energy: -51.486 Base-Backbone interact. energy: -2.549 local terms energy: -60.669954 where: bonds (distance) C4'-P energy: -11.193 bonds (distance) P-C4' energy: -12.161 flat angles C4'-P-C4' energy: -17.094 flat angles P-C4'-P energy: -11.051 tors. eta vs tors. theta energy: -9.171 Dist. restrs. and SS energy: 2.895 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 81 Temperature: 1.314000 Total energy: -215.218363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.218363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.583340 (E_RNA) where: Base-Base interactions energy: -141.825 where: short stacking energy: -69.069 Base-Backbone interact. energy: -1.251 local terms energy: -77.507835 where: bonds (distance) C4'-P energy: -15.416 bonds (distance) P-C4' energy: -11.860 flat angles C4'-P-C4' energy: -16.491 flat angles P-C4'-P energy: -15.559 tors. eta vs tors. theta energy: -18.181 Dist. restrs. and SS energy: 5.365 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 82 Temperature: 1.313550 Total energy: -206.576834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.576834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.269786 (E_RNA) where: Base-Base interactions energy: -154.377 where: short stacking energy: -62.439 Base-Backbone interact. energy: -0.134 local terms energy: -55.758476 where: bonds (distance) C4'-P energy: -8.501 bonds (distance) P-C4' energy: -10.783 flat angles C4'-P-C4' energy: -16.860 flat angles P-C4'-P energy: -9.102 tors. eta vs tors. theta energy: -10.512 Dist. restrs. and SS energy: 3.693 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 83 Temperature: 1.313100 Total energy: -225.034412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.034412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.035682 (E_RNA) where: Base-Base interactions energy: -150.444 where: short stacking energy: -64.601 Base-Backbone interact. energy: -0.942 local terms energy: -77.649939 where: bonds (distance) C4'-P energy: -15.917 bonds (distance) P-C4' energy: -21.799 flat angles C4'-P-C4' energy: -13.409 flat angles P-C4'-P energy: -13.669 tors. eta vs tors. theta energy: -12.856 Dist. restrs. and SS energy: 4.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 84 Temperature: 1.312650 Total energy: -214.189459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.189459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.487836 (E_RNA) where: Base-Base interactions energy: -146.633 where: short stacking energy: -68.525 Base-Backbone interact. energy: -0.008 local terms energy: -71.847374 where: bonds (distance) C4'-P energy: -10.120 bonds (distance) P-C4' energy: -12.984 flat angles C4'-P-C4' energy: -16.842 flat angles P-C4'-P energy: -11.958 tors. eta vs tors. theta energy: -19.944 Dist. restrs. and SS energy: 4.298 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 85 Temperature: 1.312200 Total energy: -200.007364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.007364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.178210 (E_RNA) where: Base-Base interactions energy: -136.033 where: short stacking energy: -59.454 Base-Backbone interact. energy: 0.171 local terms energy: -67.315895 where: bonds (distance) C4'-P energy: -13.883 bonds (distance) P-C4' energy: -13.324 flat angles C4'-P-C4' energy: -13.573 flat angles P-C4'-P energy: -10.727 tors. eta vs tors. theta energy: -15.809 Dist. restrs. and SS energy: 3.171 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 86 Temperature: 1.311750 Total energy: -181.475162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.475162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.278373 (E_RNA) where: Base-Base interactions energy: -120.970 where: short stacking energy: -66.096 Base-Backbone interact. energy: -1.502 local terms energy: -65.807128 where: bonds (distance) C4'-P energy: -11.971 bonds (distance) P-C4' energy: -18.598 flat angles C4'-P-C4' energy: -12.251 flat angles P-C4'-P energy: -8.225 tors. eta vs tors. theta energy: -14.762 Dist. restrs. and SS energy: 6.803 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 87 Temperature: 1.311300 Total energy: -169.837640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.837640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.901785 (E_RNA) where: Base-Base interactions energy: -114.314 where: short stacking energy: -39.437 Base-Backbone interact. energy: 0.607 local terms energy: -67.194555 where: bonds (distance) C4'-P energy: -15.070 bonds (distance) P-C4' energy: -16.162 flat angles C4'-P-C4' energy: -16.582 flat angles P-C4'-P energy: -12.940 tors. eta vs tors. theta energy: -6.441 Dist. restrs. and SS energy: 11.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 88 Temperature: 1.310850 Total energy: -203.569793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.569793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.705940 (E_RNA) where: Base-Base interactions energy: -137.777 where: short stacking energy: -64.728 Base-Backbone interact. energy: -0.107 local terms energy: -70.822103 where: bonds (distance) C4'-P energy: -12.621 bonds (distance) P-C4' energy: -16.873 flat angles C4'-P-C4' energy: -14.994 flat angles P-C4'-P energy: -10.570 tors. eta vs tors. theta energy: -15.764 Dist. restrs. and SS energy: 5.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 89 Temperature: 1.310400 Total energy: -179.889736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.889736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.677029 (E_RNA) where: Base-Base interactions energy: -125.894 where: short stacking energy: -55.094 Base-Backbone interact. energy: 2.369 local terms energy: -61.151866 where: bonds (distance) C4'-P energy: -8.307 bonds (distance) P-C4' energy: -18.870 flat angles C4'-P-C4' energy: -15.610 flat angles P-C4'-P energy: -12.100 tors. eta vs tors. theta energy: -6.265 Dist. restrs. and SS energy: 4.787 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 90 Temperature: 1.309950 Total energy: -175.727169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -175.727169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.791968 (E_RNA) where: Base-Base interactions energy: -123.212 where: short stacking energy: -53.960 Base-Backbone interact. energy: -0.763 local terms energy: -60.817815 where: bonds (distance) C4'-P energy: -17.944 bonds (distance) P-C4' energy: -8.180 flat angles C4'-P-C4' energy: -14.892 flat angles P-C4'-P energy: -12.175 tors. eta vs tors. theta energy: -7.627 Dist. restrs. and SS energy: 9.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 91 Temperature: 1.309500 Total energy: -185.216869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.216869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.539869 (E_RNA) where: Base-Base interactions energy: -132.830 where: short stacking energy: -57.766 Base-Backbone interact. energy: -0.218 local terms energy: -58.491339 where: bonds (distance) C4'-P energy: -7.037 bonds (distance) P-C4' energy: -13.111 flat angles C4'-P-C4' energy: -13.816 flat angles P-C4'-P energy: -11.784 tors. eta vs tors. theta energy: -12.744 Dist. restrs. and SS energy: 6.323 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 92 Temperature: 1.309050 Total energy: -195.886757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.886757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.420876 (E_RNA) where: Base-Base interactions energy: -138.271 where: short stacking energy: -64.627 Base-Backbone interact. energy: -0.461 local terms energy: -61.689677 where: bonds (distance) C4'-P energy: -12.327 bonds (distance) P-C4' energy: -11.091 flat angles C4'-P-C4' energy: -12.598 flat angles P-C4'-P energy: -14.365 tors. eta vs tors. theta energy: -11.308 Dist. restrs. and SS energy: 4.534 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 93 Temperature: 1.308600 Total energy: -168.845664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.845664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -175.954435 (E_RNA) where: Base-Base interactions energy: -117.139 where: short stacking energy: -44.469 Base-Backbone interact. energy: 0.199 local terms energy: -59.013986 where: bonds (distance) C4'-P energy: -16.302 bonds (distance) P-C4' energy: -16.334 flat angles C4'-P-C4' energy: -14.718 flat angles P-C4'-P energy: -8.428 tors. eta vs tors. theta energy: -3.232 Dist. restrs. and SS energy: 7.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 94 Temperature: 1.308150 Total energy: -192.034599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.034599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.708474 (E_RNA) where: Base-Base interactions energy: -137.121 where: short stacking energy: -62.187 Base-Backbone interact. energy: -1.768 local terms energy: -61.820109 where: bonds (distance) C4'-P energy: -13.793 bonds (distance) P-C4' energy: -17.284 flat angles C4'-P-C4' energy: -15.565 flat angles P-C4'-P energy: -9.194 tors. eta vs tors. theta energy: -5.985 Dist. restrs. and SS energy: 8.674 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 95 Temperature: 1.307700 Total energy: -205.758362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.758362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.526418 (E_RNA) where: Base-Base interactions energy: -133.263 where: short stacking energy: -56.256 Base-Backbone interact. energy: -0.260 local terms energy: -76.003548 where: bonds (distance) C4'-P energy: -19.236 bonds (distance) P-C4' energy: -15.810 flat angles C4'-P-C4' energy: -12.967 flat angles P-C4'-P energy: -9.739 tors. eta vs tors. theta energy: -18.252 Dist. restrs. and SS energy: 3.768 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 96 Temperature: 1.307250 Total energy: -196.457653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.457653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.388088 (E_RNA) where: Base-Base interactions energy: -134.754 where: short stacking energy: -60.123 Base-Backbone interact. energy: -0.581 local terms energy: -67.053389 where: bonds (distance) C4'-P energy: -9.724 bonds (distance) P-C4' energy: -18.005 flat angles C4'-P-C4' energy: -12.847 flat angles P-C4'-P energy: -6.863 tors. eta vs tors. theta energy: -19.615 Dist. restrs. and SS energy: 5.930 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 97 Temperature: 1.306800 Total energy: -205.986397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.986397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.675792 (E_RNA) where: Base-Base interactions energy: -143.245 where: short stacking energy: -58.766 Base-Backbone interact. energy: -0.611 local terms energy: -68.820107 where: bonds (distance) C4'-P energy: -12.882 bonds (distance) P-C4' energy: -14.836 flat angles C4'-P-C4' energy: -16.036 flat angles P-C4'-P energy: -8.225 tors. eta vs tors. theta energy: -16.841 Dist. restrs. and SS energy: 6.689 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 98 Temperature: 1.306350 Total energy: -168.829655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.829655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.813684 (E_RNA) where: Base-Base interactions energy: -116.119 where: short stacking energy: -55.388 Base-Backbone interact. energy: 1.217 local terms energy: -58.912131 where: bonds (distance) C4'-P energy: -16.418 bonds (distance) P-C4' energy: -9.834 flat angles C4'-P-C4' energy: -8.925 flat angles P-C4'-P energy: -15.582 tors. eta vs tors. theta energy: -8.153 Dist. restrs. and SS energy: 4.984 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 99 Temperature: 1.305900 Total energy: -176.382715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.382715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.095463 (E_RNA) where: Base-Base interactions energy: -121.287 where: short stacking energy: -61.214 Base-Backbone interact. energy: 3.986 local terms energy: -64.794593 where: bonds (distance) C4'-P energy: -12.959 bonds (distance) P-C4' energy: -14.313 flat angles C4'-P-C4' energy: -13.248 flat angles P-C4'-P energy: -14.201 tors. eta vs tors. theta energy: -10.074 Dist. restrs. and SS energy: 5.713 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 100 Temperature: 1.305450 Total energy: -166.524204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.524204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -175.191934 (E_RNA) where: Base-Base interactions energy: -119.594 where: short stacking energy: -57.509 Base-Backbone interact. energy: 0.221 local terms energy: -55.818508 where: bonds (distance) C4'-P energy: -17.414 bonds (distance) P-C4' energy: -13.388 flat angles C4'-P-C4' energy: -14.732 flat angles P-C4'-P energy: -6.188 tors. eta vs tors. theta energy: -4.096 Dist. restrs. and SS energy: 8.668 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 101 Temperature: 1.305000 Total energy: -153.874123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.874123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.000584 (E_RNA) where: Base-Base interactions energy: -94.728 where: short stacking energy: -49.378 Base-Backbone interact. energy: -0.164 local terms energy: -66.108733 where: bonds (distance) C4'-P energy: -19.602 bonds (distance) P-C4' energy: -10.829 flat angles C4'-P-C4' energy: -14.604 flat angles P-C4'-P energy: -7.271 tors. eta vs tors. theta energy: -13.803 Dist. restrs. and SS energy: 7.126 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 102 Temperature: 1.304550 Total energy: -185.482849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.482849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.981776 (E_RNA) where: Base-Base interactions energy: -129.579 where: short stacking energy: -61.507 Base-Backbone interact. energy: 1.759 local terms energy: -64.161949 where: bonds (distance) C4'-P energy: -6.680 bonds (distance) P-C4' energy: -20.142 flat angles C4'-P-C4' energy: -14.866 flat angles P-C4'-P energy: -10.130 tors. eta vs tors. theta energy: -12.343 Dist. restrs. and SS energy: 6.499 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 103 Temperature: 1.304100 Total energy: -201.989460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.989460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.359810 (E_RNA) where: Base-Base interactions energy: -139.843 where: short stacking energy: -69.456 Base-Backbone interact. energy: -0.046 local terms energy: -74.470447 where: bonds (distance) C4'-P energy: -17.365 bonds (distance) P-C4' energy: -15.161 flat angles C4'-P-C4' energy: -16.428 flat angles P-C4'-P energy: -11.495 tors. eta vs tors. theta energy: -14.022 Dist. restrs. and SS energy: 12.370 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 104 Temperature: 1.303650 Total energy: -202.034093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.034093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.076556 (E_RNA) where: Base-Base interactions energy: -151.440 where: short stacking energy: -66.485 Base-Backbone interact. energy: 0.278 local terms energy: -59.915294 where: bonds (distance) C4'-P energy: -6.132 bonds (distance) P-C4' energy: -13.877 flat angles C4'-P-C4' energy: -15.288 flat angles P-C4'-P energy: -9.078 tors. eta vs tors. theta energy: -15.541 Dist. restrs. and SS energy: 9.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 105 Temperature: 1.303200 Total energy: -214.081082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.081082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.261036 (E_RNA) where: Base-Base interactions energy: -151.701 where: short stacking energy: -76.993 Base-Backbone interact. energy: -1.185 local terms energy: -70.375556 where: bonds (distance) C4'-P energy: -12.614 bonds (distance) P-C4' energy: -18.404 flat angles C4'-P-C4' energy: -12.075 flat angles P-C4'-P energy: -7.133 tors. eta vs tors. theta energy: -20.149 Dist. restrs. and SS energy: 9.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 106 Temperature: 1.302750 Total energy: -239.557981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.557981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.388059 (E_RNA) where: Base-Base interactions energy: -157.635 where: short stacking energy: -68.513 Base-Backbone interact. energy: -0.667 local terms energy: -90.085918 where: bonds (distance) C4'-P energy: -18.136 bonds (distance) P-C4' energy: -20.877 flat angles C4'-P-C4' energy: -16.229 flat angles P-C4'-P energy: -11.657 tors. eta vs tors. theta energy: -23.187 Dist. restrs. and SS energy: 8.830 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 107 Temperature: 1.302300 Total energy: -222.286864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.286864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.778769 (E_RNA) where: Base-Base interactions energy: -152.675 where: short stacking energy: -62.058 Base-Backbone interact. energy: 0.987 local terms energy: -78.090282 where: bonds (distance) C4'-P energy: -16.655 bonds (distance) P-C4' energy: -16.828 flat angles C4'-P-C4' energy: -16.151 flat angles P-C4'-P energy: -9.136 tors. eta vs tors. theta energy: -19.319 Dist. restrs. and SS energy: 7.492 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 108 Temperature: 1.301850 Total energy: -226.354886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.354886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.205629 (E_RNA) where: Base-Base interactions energy: -165.720 where: short stacking energy: -72.054 Base-Backbone interact. energy: -0.975 local terms energy: -64.510656 where: bonds (distance) C4'-P energy: -12.333 bonds (distance) P-C4' energy: -5.644 flat angles C4'-P-C4' energy: -19.164 flat angles P-C4'-P energy: -8.617 tors. eta vs tors. theta energy: -18.753 Dist. restrs. and SS energy: 4.851 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 109 Temperature: 1.301400 Total energy: -232.796351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.796351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.189510 (E_RNA) where: Base-Base interactions energy: -149.438 where: short stacking energy: -66.251 Base-Backbone interact. energy: -0.379 local terms energy: -89.372385 where: bonds (distance) C4'-P energy: -18.091 bonds (distance) P-C4' energy: -17.660 flat angles C4'-P-C4' energy: -20.408 flat angles P-C4'-P energy: -14.122 tors. eta vs tors. theta energy: -19.092 Dist. restrs. and SS energy: 6.393 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 110 Temperature: 1.300950 Total energy: -217.011007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.011007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.264555 (E_RNA) where: Base-Base interactions energy: -146.989 where: short stacking energy: -72.096 Base-Backbone interact. energy: -0.256 local terms energy: -77.019193 where: bonds (distance) C4'-P energy: -18.526 bonds (distance) P-C4' energy: -10.256 flat angles C4'-P-C4' energy: -17.519 flat angles P-C4'-P energy: -11.920 tors. eta vs tors. theta energy: -18.798 Dist. restrs. and SS energy: 7.254 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 111 Temperature: 1.300500 Total energy: -214.166585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.166585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.674566 (E_RNA) where: Base-Base interactions energy: -146.502 where: short stacking energy: -63.591 Base-Backbone interact. energy: -0.210 local terms energy: -75.962488 where: bonds (distance) C4'-P energy: -8.453 bonds (distance) P-C4' energy: -21.462 flat angles C4'-P-C4' energy: -16.851 flat angles P-C4'-P energy: -11.815 tors. eta vs tors. theta energy: -17.382 Dist. restrs. and SS energy: 8.508 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 112 Temperature: 1.300050 Total energy: -204.482946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.482946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.856777 (E_RNA) where: Base-Base interactions energy: -148.708 where: short stacking energy: -56.872 Base-Backbone interact. energy: -0.103 local terms energy: -62.046392 where: bonds (distance) C4'-P energy: -6.304 bonds (distance) P-C4' energy: -11.957 flat angles C4'-P-C4' energy: -18.132 flat angles P-C4'-P energy: -9.793 tors. eta vs tors. theta energy: -15.861 Dist. restrs. and SS energy: 6.374 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 113 Temperature: 1.299600 Total energy: -222.777230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.777230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.969900 (E_RNA) where: Base-Base interactions energy: -144.767 where: short stacking energy: -73.933 Base-Backbone interact. energy: -0.047 local terms energy: -84.156017 where: bonds (distance) C4'-P energy: -16.790 bonds (distance) P-C4' energy: -17.590 flat angles C4'-P-C4' energy: -16.668 flat angles P-C4'-P energy: -11.949 tors. eta vs tors. theta energy: -21.159 Dist. restrs. and SS energy: 6.193 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 114 Temperature: 1.299150 Total energy: -234.145434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.145434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.020107 (E_RNA) where: Base-Base interactions energy: -162.401 where: short stacking energy: -75.797 Base-Backbone interact. energy: -0.040 local terms energy: -76.579394 where: bonds (distance) C4'-P energy: -13.784 bonds (distance) P-C4' energy: -16.428 flat angles C4'-P-C4' energy: -17.100 flat angles P-C4'-P energy: -7.540 tors. eta vs tors. theta energy: -21.727 Dist. restrs. and SS energy: 4.875 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 115 Temperature: 1.298700 Total energy: -224.681796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.681796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.248506 (E_RNA) where: Base-Base interactions energy: -158.003 where: short stacking energy: -68.259 Base-Backbone interact. energy: -1.110 local terms energy: -71.136141 where: bonds (distance) C4'-P energy: -13.027 bonds (distance) P-C4' energy: -13.540 flat angles C4'-P-C4' energy: -17.245 flat angles P-C4'-P energy: -13.243 tors. eta vs tors. theta energy: -14.081 Dist. restrs. and SS energy: 5.567 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 116 Temperature: 1.298250 Total energy: -204.102720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.102720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.158815 (E_RNA) where: Base-Base interactions energy: -145.795 where: short stacking energy: -72.112 Base-Backbone interact. energy: -0.323 local terms energy: -65.041128 where: bonds (distance) C4'-P energy: -13.270 bonds (distance) P-C4' energy: -17.114 flat angles C4'-P-C4' energy: -15.513 flat angles P-C4'-P energy: -4.041 tors. eta vs tors. theta energy: -15.103 Dist. restrs. and SS energy: 7.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 117 Temperature: 1.297800 Total energy: -231.959558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.959558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.883821 (E_RNA) where: Base-Base interactions energy: -149.977 where: short stacking energy: -74.263 Base-Backbone interact. energy: -0.689 local terms energy: -88.217927 where: bonds (distance) C4'-P energy: -20.769 bonds (distance) P-C4' energy: -17.628 flat angles C4'-P-C4' energy: -18.732 flat angles P-C4'-P energy: -11.076 tors. eta vs tors. theta energy: -20.013 Dist. restrs. and SS energy: 6.924 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 118 Temperature: 1.297350 Total energy: -220.224987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.224987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.586193 (E_RNA) where: Base-Base interactions energy: -148.676 where: short stacking energy: -72.566 Base-Backbone interact. energy: -0.173 local terms energy: -78.736607 where: bonds (distance) C4'-P energy: -10.925 bonds (distance) P-C4' energy: -14.269 flat angles C4'-P-C4' energy: -20.725 flat angles P-C4'-P energy: -13.660 tors. eta vs tors. theta energy: -19.158 Dist. restrs. and SS energy: 7.361 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 119 Temperature: 1.296900 Total energy: -226.943429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.943429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.102499 (E_RNA) where: Base-Base interactions energy: -152.261 where: short stacking energy: -73.955 Base-Backbone interact. energy: -1.228 local terms energy: -82.614174 where: bonds (distance) C4'-P energy: -15.292 bonds (distance) P-C4' energy: -20.263 flat angles C4'-P-C4' energy: -15.717 flat angles P-C4'-P energy: -12.616 tors. eta vs tors. theta energy: -18.727 Dist. restrs. and SS energy: 9.159 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 120 Temperature: 1.296450 Total energy: -210.201176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.201176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.447049 (E_RNA) where: Base-Base interactions energy: -141.447 where: short stacking energy: -64.516 Base-Backbone interact. energy: 0.345 local terms energy: -75.344778 where: bonds (distance) C4'-P energy: -15.415 bonds (distance) P-C4' energy: -17.373 flat angles C4'-P-C4' energy: -14.294 flat angles P-C4'-P energy: -8.818 tors. eta vs tors. theta energy: -19.445 Dist. restrs. and SS energy: 6.246 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 121 Temperature: 1.296000 Total energy: -204.575147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.575147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.573795 (E_RNA) where: Base-Base interactions energy: -137.527 where: short stacking energy: -55.001 Base-Backbone interact. energy: 1.204 local terms energy: -75.250171 where: bonds (distance) C4'-P energy: -19.367 bonds (distance) P-C4' energy: -12.098 flat angles C4'-P-C4' energy: -14.636 flat angles P-C4'-P energy: -11.110 tors. eta vs tors. theta energy: -18.040 Dist. restrs. and SS energy: 6.999 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 122 Temperature: 1.295550 Total energy: -238.458669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.458669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.358248 (E_RNA) where: Base-Base interactions energy: -158.458 where: short stacking energy: -73.234 Base-Backbone interact. energy: -0.170 local terms energy: -85.730598 where: bonds (distance) C4'-P energy: -19.717 bonds (distance) P-C4' energy: -16.554 flat angles C4'-P-C4' energy: -18.541 flat angles P-C4'-P energy: -14.238 tors. eta vs tors. theta energy: -16.680 Dist. restrs. and SS energy: 5.900 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 123 Temperature: 1.295100 Total energy: -204.158304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.158304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.266751 (E_RNA) where: Base-Base interactions energy: -129.700 where: short stacking energy: -53.146 Base-Backbone interact. energy: 0.344 local terms energy: -81.910174 where: bonds (distance) C4'-P energy: -17.058 bonds (distance) P-C4' energy: -16.866 flat angles C4'-P-C4' energy: -19.061 flat angles P-C4'-P energy: -11.105 tors. eta vs tors. theta energy: -17.820 Dist. restrs. and SS energy: 7.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 124 Temperature: 1.294650 Total energy: -240.060206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.060206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.945400 (E_RNA) where: Base-Base interactions energy: -172.619 where: short stacking energy: -84.893 Base-Backbone interact. energy: -0.006 local terms energy: -73.320396 where: bonds (distance) C4'-P energy: -10.141 bonds (distance) P-C4' energy: -15.162 flat angles C4'-P-C4' energy: -15.034 flat angles P-C4'-P energy: -12.763 tors. eta vs tors. theta energy: -20.219 Dist. restrs. and SS energy: 5.885 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 125 Temperature: 1.294200 Total energy: -234.899703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.899703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.368654 (E_RNA) where: Base-Base interactions energy: -154.496 where: short stacking energy: -76.100 Base-Backbone interact. energy: -0.102 local terms energy: -84.771541 where: bonds (distance) C4'-P energy: -15.429 bonds (distance) P-C4' energy: -17.889 flat angles C4'-P-C4' energy: -16.471 flat angles P-C4'-P energy: -9.903 tors. eta vs tors. theta energy: -25.080 Dist. restrs. and SS energy: 4.469 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 126 Temperature: 1.293750 Total energy: -235.161097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.161097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.560737 (E_RNA) where: Base-Base interactions energy: -167.987 where: short stacking energy: -84.670 Base-Backbone interact. energy: 0.073 local terms energy: -71.646773 where: bonds (distance) C4'-P energy: -9.132 bonds (distance) P-C4' energy: -12.351 flat angles C4'-P-C4' energy: -20.010 flat angles P-C4'-P energy: -9.762 tors. eta vs tors. theta energy: -20.391 Dist. restrs. and SS energy: 4.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 127 Temperature: 1.293300 Total energy: -248.511397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.511397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.120442 (E_RNA) where: Base-Base interactions energy: -162.847 where: short stacking energy: -83.163 Base-Backbone interact. energy: -0.012 local terms energy: -91.261361 where: bonds (distance) C4'-P energy: -18.981 bonds (distance) P-C4' energy: -15.415 flat angles C4'-P-C4' energy: -15.974 flat angles P-C4'-P energy: -15.838 tors. eta vs tors. theta energy: -25.054 Dist. restrs. and SS energy: 5.609 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 128 Temperature: 1.292850 Total energy: -226.145518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.145518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.344317 (E_RNA) where: Base-Base interactions energy: -154.070 where: short stacking energy: -65.519 Base-Backbone interact. energy: -0.752 local terms energy: -76.522529 where: bonds (distance) C4'-P energy: -16.762 bonds (distance) P-C4' energy: -20.204 flat angles C4'-P-C4' energy: -18.337 flat angles P-C4'-P energy: -5.709 tors. eta vs tors. theta energy: -15.510 Dist. restrs. and SS energy: 5.199 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 129 Temperature: 1.292400 Total energy: -231.072943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.072943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.911676 (E_RNA) where: Base-Base interactions energy: -156.262 where: short stacking energy: -72.353 Base-Backbone interact. energy: -0.366 local terms energy: -81.284000 where: bonds (distance) C4'-P energy: -15.020 bonds (distance) P-C4' energy: -18.393 flat angles C4'-P-C4' energy: -15.454 flat angles P-C4'-P energy: -15.016 tors. eta vs tors. theta energy: -17.401 Dist. restrs. and SS energy: 6.839 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 130 Temperature: 1.291950 Total energy: -213.473115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.473115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.079075 (E_RNA) where: Base-Base interactions energy: -151.003 where: short stacking energy: -65.718 Base-Backbone interact. energy: 0.327 local terms energy: -68.403492 where: bonds (distance) C4'-P energy: -14.167 bonds (distance) P-C4' energy: -11.207 flat angles C4'-P-C4' energy: -11.184 flat angles P-C4'-P energy: -15.375 tors. eta vs tors. theta energy: -16.470 Dist. restrs. and SS energy: 5.606 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 131 Temperature: 1.291500 Total energy: -210.770992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.770992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.389603 (E_RNA) where: Base-Base interactions energy: -147.594 where: short stacking energy: -66.308 Base-Backbone interact. energy: -0.094 local terms energy: -68.701739 where: bonds (distance) C4'-P energy: -12.215 bonds (distance) P-C4' energy: -18.338 flat angles C4'-P-C4' energy: -16.485 flat angles P-C4'-P energy: -7.029 tors. eta vs tors. theta energy: -14.634 Dist. restrs. and SS energy: 5.619 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 132 Temperature: 1.291050 Total energy: -225.471995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.471995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.368771 (E_RNA) where: Base-Base interactions energy: -150.542 where: short stacking energy: -73.679 Base-Backbone interact. energy: -0.443 local terms energy: -82.383434 where: bonds (distance) C4'-P energy: -14.420 bonds (distance) P-C4' energy: -20.069 flat angles C4'-P-C4' energy: -15.092 flat angles P-C4'-P energy: -10.869 tors. eta vs tors. theta energy: -21.934 Dist. restrs. and SS energy: 7.897 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 133 Temperature: 1.290600 Total energy: -234.986591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.986591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.979166 (E_RNA) where: Base-Base interactions energy: -155.862 where: short stacking energy: -74.995 Base-Backbone interact. energy: -0.046 local terms energy: -86.070708 where: bonds (distance) C4'-P energy: -17.669 bonds (distance) P-C4' energy: -17.993 flat angles C4'-P-C4' energy: -18.703 flat angles P-C4'-P energy: -9.538 tors. eta vs tors. theta energy: -22.168 Dist. restrs. and SS energy: 6.993 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 134 Temperature: 1.290150 Total energy: -219.291976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.291976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.979744 (E_RNA) where: Base-Base interactions energy: -155.014 where: short stacking energy: -67.813 Base-Backbone interact. energy: -0.617 local terms energy: -69.349063 where: bonds (distance) C4'-P energy: -8.658 bonds (distance) P-C4' energy: -17.384 flat angles C4'-P-C4' energy: -16.116 flat angles P-C4'-P energy: -9.062 tors. eta vs tors. theta energy: -18.129 Dist. restrs. and SS energy: 5.688 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 135 Temperature: 1.289700 Total energy: -229.433232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.433232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.603750 (E_RNA) where: Base-Base interactions energy: -162.345 where: short stacking energy: -61.377 Base-Backbone interact. energy: -0.921 local terms energy: -73.338332 where: bonds (distance) C4'-P energy: -14.224 bonds (distance) P-C4' energy: -18.578 flat angles C4'-P-C4' energy: -18.701 flat angles P-C4'-P energy: -10.896 tors. eta vs tors. theta energy: -10.939 Dist. restrs. and SS energy: 7.171 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 136 Temperature: 1.289250 Total energy: -221.646438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.646438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.600567 (E_RNA) where: Base-Base interactions energy: -151.641 where: short stacking energy: -63.262 Base-Backbone interact. energy: -0.551 local terms energy: -74.408538 where: bonds (distance) C4'-P energy: -11.991 bonds (distance) P-C4' energy: -18.533 flat angles C4'-P-C4' energy: -14.347 flat angles P-C4'-P energy: -11.678 tors. eta vs tors. theta energy: -17.859 Dist. restrs. and SS energy: 4.954 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 137 Temperature: 1.288800 Total energy: -209.852504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.852504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.646964 (E_RNA) where: Base-Base interactions energy: -147.060 where: short stacking energy: -74.200 Base-Backbone interact. energy: 0.374 local terms energy: -69.961698 where: bonds (distance) C4'-P energy: -10.869 bonds (distance) P-C4' energy: -14.992 flat angles C4'-P-C4' energy: -14.192 flat angles P-C4'-P energy: -15.494 tors. eta vs tors. theta energy: -14.414 Dist. restrs. and SS energy: 6.794 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 138 Temperature: 1.288350 Total energy: -223.396486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.396486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.382726 (E_RNA) where: Base-Base interactions energy: -149.618 where: short stacking energy: -65.829 Base-Backbone interact. energy: 2.371 local terms energy: -85.135492 where: bonds (distance) C4'-P energy: -19.382 bonds (distance) P-C4' energy: -19.481 flat angles C4'-P-C4' energy: -19.698 flat angles P-C4'-P energy: -11.842 tors. eta vs tors. theta energy: -14.732 Dist. restrs. and SS energy: 8.986 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 139 Temperature: 1.287900 Total energy: -198.366665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.366665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.092921 (E_RNA) where: Base-Base interactions energy: -143.086 where: short stacking energy: -58.262 Base-Backbone interact. energy: -0.200 local terms energy: -64.806359 where: bonds (distance) C4'-P energy: -8.614 bonds (distance) P-C4' energy: -16.719 flat angles C4'-P-C4' energy: -14.102 flat angles P-C4'-P energy: -12.421 tors. eta vs tors. theta energy: -12.950 Dist. restrs. and SS energy: 9.726 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 140 Temperature: 1.287450 Total energy: -203.028287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.028287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.812334 (E_RNA) where: Base-Base interactions energy: -143.963 where: short stacking energy: -59.666 Base-Backbone interact. energy: -0.186 local terms energy: -70.663263 where: bonds (distance) C4'-P energy: -18.479 bonds (distance) P-C4' energy: -10.622 flat angles C4'-P-C4' energy: -20.319 flat angles P-C4'-P energy: -12.652 tors. eta vs tors. theta energy: -8.592 Dist. restrs. and SS energy: 11.784 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 141 Temperature: 1.287000 Total energy: -214.260255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.260255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.137403 (E_RNA) where: Base-Base interactions energy: -146.993 where: short stacking energy: -58.822 Base-Backbone interact. energy: -0.694 local terms energy: -75.451229 where: bonds (distance) C4'-P energy: -15.158 bonds (distance) P-C4' energy: -14.793 flat angles C4'-P-C4' energy: -19.917 flat angles P-C4'-P energy: -9.322 tors. eta vs tors. theta energy: -16.261 Dist. restrs. and SS energy: 8.877 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 142 Temperature: 1.286550 Total energy: -206.175431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.175431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.806662 (E_RNA) where: Base-Base interactions energy: -133.360 where: short stacking energy: -54.481 Base-Backbone interact. energy: -0.033 local terms energy: -81.414613 where: bonds (distance) C4'-P energy: -17.370 bonds (distance) P-C4' energy: -21.171 flat angles C4'-P-C4' energy: -16.545 flat angles P-C4'-P energy: -9.020 tors. eta vs tors. theta energy: -17.308 Dist. restrs. and SS energy: 8.631 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 143 Temperature: 1.286100 Total energy: -188.255145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.255145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.872724 (E_RNA) where: Base-Base interactions energy: -127.173 where: short stacking energy: -62.600 Base-Backbone interact. energy: -0.346 local terms energy: -68.354101 where: bonds (distance) C4'-P energy: -18.902 bonds (distance) P-C4' energy: -8.698 flat angles C4'-P-C4' energy: -10.166 flat angles P-C4'-P energy: -14.370 tors. eta vs tors. theta energy: -16.218 Dist. restrs. and SS energy: 7.618 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 144 Temperature: 1.285650 Total energy: -218.947983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.947983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.746302 (E_RNA) where: Base-Base interactions energy: -148.753 where: short stacking energy: -76.055 Base-Backbone interact. energy: -0.007 local terms energy: -75.986060 where: bonds (distance) C4'-P energy: -15.288 bonds (distance) P-C4' energy: -16.513 flat angles C4'-P-C4' energy: -17.916 flat angles P-C4'-P energy: -4.045 tors. eta vs tors. theta energy: -22.225 Dist. restrs. and SS energy: 5.798 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 145 Temperature: 1.285200 Total energy: -222.085423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.085423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.690849 (E_RNA) where: Base-Base interactions energy: -150.829 where: short stacking energy: -77.743 Base-Backbone interact. energy: -0.128 local terms energy: -77.734331 where: bonds (distance) C4'-P energy: -11.428 bonds (distance) P-C4' energy: -14.593 flat angles C4'-P-C4' energy: -18.850 flat angles P-C4'-P energy: -8.278 tors. eta vs tors. theta energy: -24.585 Dist. restrs. and SS energy: 6.605 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 146 Temperature: 1.284750 Total energy: -222.912856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.912856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.491665 (E_RNA) where: Base-Base interactions energy: -157.724 where: short stacking energy: -69.446 Base-Backbone interact. energy: -0.014 local terms energy: -72.753246 where: bonds (distance) C4'-P energy: -12.965 bonds (distance) P-C4' energy: -15.060 flat angles C4'-P-C4' energy: -17.328 flat angles P-C4'-P energy: -7.962 tors. eta vs tors. theta energy: -19.439 Dist. restrs. and SS energy: 7.579 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 147 Temperature: 1.284300 Total energy: -226.093860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.093860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.854373 (E_RNA) where: Base-Base interactions energy: -152.810 where: short stacking energy: -73.933 Base-Backbone interact. energy: -0.000 local terms energy: -82.044593 where: bonds (distance) C4'-P energy: -14.209 bonds (distance) P-C4' energy: -18.703 flat angles C4'-P-C4' energy: -14.867 flat angles P-C4'-P energy: -9.314 tors. eta vs tors. theta energy: -24.951 Dist. restrs. and SS energy: 8.761 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 148 Temperature: 1.283850 Total energy: -225.228225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.228225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.569206 (E_RNA) where: Base-Base interactions energy: -146.046 where: short stacking energy: -65.958 Base-Backbone interact. energy: -0.018 local terms energy: -82.505702 where: bonds (distance) C4'-P energy: -19.485 bonds (distance) P-C4' energy: -18.486 flat angles C4'-P-C4' energy: -15.699 flat angles P-C4'-P energy: -10.160 tors. eta vs tors. theta energy: -18.676 Dist. restrs. and SS energy: 3.341 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 149 Temperature: 1.283400 Total energy: -227.493404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.493404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.672439 (E_RNA) where: Base-Base interactions energy: -161.725 where: short stacking energy: -70.721 Base-Backbone interact. energy: -0.296 local terms energy: -69.652040 where: bonds (distance) C4'-P energy: -12.799 bonds (distance) P-C4' energy: -14.551 flat angles C4'-P-C4' energy: -14.608 flat angles P-C4'-P energy: -8.848 tors. eta vs tors. theta energy: -18.845 Dist. restrs. and SS energy: 4.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 150 Temperature: 1.282950 Total energy: -235.518993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.518993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.415261 (E_RNA) where: Base-Base interactions energy: -161.007 where: short stacking energy: -76.958 Base-Backbone interact. energy: -1.270 local terms energy: -79.137785 where: bonds (distance) C4'-P energy: -14.152 bonds (distance) P-C4' energy: -16.941 flat angles C4'-P-C4' energy: -13.647 flat angles P-C4'-P energy: -13.417 tors. eta vs tors. theta energy: -20.981 Dist. restrs. and SS energy: 5.896 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 151 Temperature: 1.282500 Total energy: -215.873493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.873493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.135502 (E_RNA) where: Base-Base interactions energy: -149.324 where: short stacking energy: -64.114 Base-Backbone interact. energy: -0.335 local terms energy: -72.476790 where: bonds (distance) C4'-P energy: -17.025 bonds (distance) P-C4' energy: -17.219 flat angles C4'-P-C4' energy: -14.182 flat angles P-C4'-P energy: -7.067 tors. eta vs tors. theta energy: -16.983 Dist. restrs. and SS energy: 6.262 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 152 Temperature: 1.282050 Total energy: -211.057943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.057943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.235896 (E_RNA) where: Base-Base interactions energy: -144.826 where: short stacking energy: -64.233 Base-Backbone interact. energy: -1.227 local terms energy: -73.183722 where: bonds (distance) C4'-P energy: -14.264 bonds (distance) P-C4' energy: -18.042 flat angles C4'-P-C4' energy: -17.203 flat angles P-C4'-P energy: -8.067 tors. eta vs tors. theta energy: -15.607 Dist. restrs. and SS energy: 8.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 153 Temperature: 1.281600 Total energy: -222.481941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.481941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.795174 (E_RNA) where: Base-Base interactions energy: -152.030 where: short stacking energy: -73.480 Base-Backbone interact. energy: -0.312 local terms energy: -76.453250 where: bonds (distance) C4'-P energy: -12.680 bonds (distance) P-C4' energy: -16.703 flat angles C4'-P-C4' energy: -17.590 flat angles P-C4'-P energy: -11.015 tors. eta vs tors. theta energy: -18.466 Dist. restrs. and SS energy: 6.313 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 154 Temperature: 1.281150 Total energy: -208.536483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.536483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.188141 (E_RNA) where: Base-Base interactions energy: -137.623 where: short stacking energy: -59.647 Base-Backbone interact. energy: -0.187 local terms energy: -76.377831 where: bonds (distance) C4'-P energy: -15.978 bonds (distance) P-C4' energy: -12.738 flat angles C4'-P-C4' energy: -18.701 flat angles P-C4'-P energy: -16.044 tors. eta vs tors. theta energy: -12.917 Dist. restrs. and SS energy: 5.652 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 155 Temperature: 1.280700 Total energy: -192.921526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.921526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.311298 (E_RNA) where: Base-Base interactions energy: -136.502 where: short stacking energy: -54.788 Base-Backbone interact. energy: -0.725 local terms energy: -60.084128 where: bonds (distance) C4'-P energy: -9.640 bonds (distance) P-C4' energy: -13.554 flat angles C4'-P-C4' energy: -16.336 flat angles P-C4'-P energy: -8.246 tors. eta vs tors. theta energy: -12.308 Dist. restrs. and SS energy: 4.390 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 156 Temperature: 1.280250 Total energy: -195.304081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.304081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.472250 (E_RNA) where: Base-Base interactions energy: -128.176 where: short stacking energy: -50.752 Base-Backbone interact. energy: -0.210 local terms energy: -73.085664 where: bonds (distance) C4'-P energy: -11.820 bonds (distance) P-C4' energy: -22.649 flat angles C4'-P-C4' energy: -16.408 flat angles P-C4'-P energy: -10.577 tors. eta vs tors. theta energy: -11.631 Dist. restrs. and SS energy: 6.168 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 157 Temperature: 1.279800 Total energy: -191.826039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.826039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.060554 (E_RNA) where: Base-Base interactions energy: -140.404 where: short stacking energy: -54.973 Base-Backbone interact. energy: -1.042 local terms energy: -60.614877 where: bonds (distance) C4'-P energy: -14.133 bonds (distance) P-C4' energy: -11.031 flat angles C4'-P-C4' energy: -18.415 flat angles P-C4'-P energy: -9.101 tors. eta vs tors. theta energy: -7.935 Dist. restrs. and SS energy: 10.235 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 158 Temperature: 1.279350 Total energy: -209.266587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.266587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.306307 (E_RNA) where: Base-Base interactions energy: -150.996 where: short stacking energy: -62.728 Base-Backbone interact. energy: -0.050 local terms energy: -65.260903 where: bonds (distance) C4'-P energy: -7.186 bonds (distance) P-C4' energy: -15.937 flat angles C4'-P-C4' energy: -12.997 flat angles P-C4'-P energy: -14.482 tors. eta vs tors. theta energy: -14.659 Dist. restrs. and SS energy: 7.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 159 Temperature: 1.278900 Total energy: -198.082950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.082950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.695516 (E_RNA) where: Base-Base interactions energy: -147.836 where: short stacking energy: -67.459 Base-Backbone interact. energy: -0.008 local terms energy: -59.851280 where: bonds (distance) C4'-P energy: -12.302 bonds (distance) P-C4' energy: -8.557 flat angles C4'-P-C4' energy: -14.585 flat angles P-C4'-P energy: -5.906 tors. eta vs tors. theta energy: -18.501 Dist. restrs. and SS energy: 9.613 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 160 Temperature: 1.278450 Total energy: -200.100685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.100685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.678588 (E_RNA) where: Base-Base interactions energy: -124.543 where: short stacking energy: -47.251 Base-Backbone interact. energy: -1.163 local terms energy: -81.971979 where: bonds (distance) C4'-P energy: -19.461 bonds (distance) P-C4' energy: -19.908 flat angles C4'-P-C4' energy: -19.578 flat angles P-C4'-P energy: -11.157 tors. eta vs tors. theta energy: -11.868 Dist. restrs. and SS energy: 7.578 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 161 Temperature: 1.278000 Total energy: -182.820236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.820236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.166059 (E_RNA) where: Base-Base interactions energy: -126.113 where: short stacking energy: -53.411 Base-Backbone interact. energy: -0.802 local terms energy: -65.251781 where: bonds (distance) C4'-P energy: -16.144 bonds (distance) P-C4' energy: -11.752 flat angles C4'-P-C4' energy: -19.917 flat angles P-C4'-P energy: -9.503 tors. eta vs tors. theta energy: -7.936 Dist. restrs. and SS energy: 9.346 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 162 Temperature: 1.277550 Total energy: -170.837280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.837280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.133346 (E_RNA) where: Base-Base interactions energy: -104.383 where: short stacking energy: -52.982 Base-Backbone interact. energy: -0.501 local terms energy: -73.249021 where: bonds (distance) C4'-P energy: -16.083 bonds (distance) P-C4' energy: -18.538 flat angles C4'-P-C4' energy: -14.620 flat angles P-C4'-P energy: -12.991 tors. eta vs tors. theta energy: -11.016 Dist. restrs. and SS energy: 7.296 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 163 Temperature: 1.277100 Total energy: -154.023197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.023197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.116318 (E_RNA) where: Base-Base interactions energy: -107.642 where: short stacking energy: -49.724 Base-Backbone interact. energy: 0.114 local terms energy: -57.587530 where: bonds (distance) C4'-P energy: -11.342 bonds (distance) P-C4' energy: -12.313 flat angles C4'-P-C4' energy: -16.917 flat angles P-C4'-P energy: -8.923 tors. eta vs tors. theta energy: -8.093 Dist. restrs. and SS energy: 11.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 164 Temperature: 1.276650 Total energy: -164.822987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.822987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -175.055990 (E_RNA) where: Base-Base interactions energy: -119.334 where: short stacking energy: -47.285 Base-Backbone interact. energy: -0.182 local terms energy: -55.539731 where: bonds (distance) C4'-P energy: -15.821 bonds (distance) P-C4' energy: -16.604 flat angles C4'-P-C4' energy: -13.064 flat angles P-C4'-P energy: -5.777 tors. eta vs tors. theta energy: -4.273 Dist. restrs. and SS energy: 10.233 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 165 Temperature: 1.276200 Total energy: -156.583468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.583468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.068070 (E_RNA) where: Base-Base interactions energy: -99.468 where: short stacking energy: -51.640 Base-Backbone interact. energy: -0.437 local terms energy: -64.162350 where: bonds (distance) C4'-P energy: -11.259 bonds (distance) P-C4' energy: -20.481 flat angles C4'-P-C4' energy: -15.943 flat angles P-C4'-P energy: -11.279 tors. eta vs tors. theta energy: -5.200 Dist. restrs. and SS energy: 7.485 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 166 Temperature: 1.275750 Total energy: -163.438005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.438005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.067440 (E_RNA) where: Base-Base interactions energy: -109.985 where: short stacking energy: -60.143 Base-Backbone interact. energy: -0.191 local terms energy: -62.890818 where: bonds (distance) C4'-P energy: -13.558 bonds (distance) P-C4' energy: -12.662 flat angles C4'-P-C4' energy: -15.152 flat angles P-C4'-P energy: -9.293 tors. eta vs tors. theta energy: -12.226 Dist. restrs. and SS energy: 9.629 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 167 Temperature: 1.275300 Total energy: -165.413434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.413434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.564452 (E_RNA) where: Base-Base interactions energy: -108.332 where: short stacking energy: -45.876 Base-Backbone interact. energy: -0.436 local terms energy: -63.796274 where: bonds (distance) C4'-P energy: -16.271 bonds (distance) P-C4' energy: -15.801 flat angles C4'-P-C4' energy: -13.410 flat angles P-C4'-P energy: -10.552 tors. eta vs tors. theta energy: -7.763 Dist. restrs. and SS energy: 7.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 168 Temperature: 1.274850 Total energy: -173.806629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.806629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.907990 (E_RNA) where: Base-Base interactions energy: -109.710 where: short stacking energy: -55.727 Base-Backbone interact. energy: -0.194 local terms energy: -74.004121 where: bonds (distance) C4'-P energy: -18.837 bonds (distance) P-C4' energy: -16.805 flat angles C4'-P-C4' energy: -14.849 flat angles P-C4'-P energy: -8.658 tors. eta vs tors. theta energy: -14.856 Dist. restrs. and SS energy: 10.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 169 Temperature: 1.274400 Total energy: -177.240759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -177.240759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.160536 (E_RNA) where: Base-Base interactions energy: -116.372 where: short stacking energy: -58.878 Base-Backbone interact. energy: 0.647 local terms energy: -70.435342 where: bonds (distance) C4'-P energy: -20.640 bonds (distance) P-C4' energy: -15.405 flat angles C4'-P-C4' energy: -18.988 flat angles P-C4'-P energy: -2.387 tors. eta vs tors. theta energy: -13.016 Dist. restrs. and SS energy: 8.920 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 170 Temperature: 1.273950 Total energy: -156.606510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.606510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.568312 (E_RNA) where: Base-Base interactions energy: -103.294 where: short stacking energy: -50.538 Base-Backbone interact. energy: -0.197 local terms energy: -63.077226 where: bonds (distance) C4'-P energy: -12.762 bonds (distance) P-C4' energy: -16.185 flat angles C4'-P-C4' energy: -10.803 flat angles P-C4'-P energy: -14.342 tors. eta vs tors. theta energy: -8.986 Dist. restrs. and SS energy: 9.962 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 171 Temperature: 1.273500 Total energy: -182.517085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.517085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.015829 (E_RNA) where: Base-Base interactions energy: -111.014 where: short stacking energy: -62.226 Base-Backbone interact. energy: -0.526 local terms energy: -75.476414 where: bonds (distance) C4'-P energy: -12.599 bonds (distance) P-C4' energy: -17.653 flat angles C4'-P-C4' energy: -16.338 flat angles P-C4'-P energy: -16.404 tors. eta vs tors. theta energy: -12.484 Dist. restrs. and SS energy: 4.499 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 172 Temperature: 1.273050 Total energy: -168.255398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.255398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.082353 (E_RNA) where: Base-Base interactions energy: -106.878 where: short stacking energy: -52.014 Base-Backbone interact. energy: -2.712 local terms energy: -67.493035 where: bonds (distance) C4'-P energy: -16.331 bonds (distance) P-C4' energy: -16.856 flat angles C4'-P-C4' energy: -16.110 flat angles P-C4'-P energy: -10.494 tors. eta vs tors. theta energy: -7.702 Dist. restrs. and SS energy: 8.827 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 173 Temperature: 1.272600 Total energy: -160.494664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.494664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.391828 (E_RNA) where: Base-Base interactions energy: -114.137 where: short stacking energy: -52.279 Base-Backbone interact. energy: -0.186 local terms energy: -55.069028 where: bonds (distance) C4'-P energy: -3.644 bonds (distance) P-C4' energy: -17.847 flat angles C4'-P-C4' energy: -15.103 flat angles P-C4'-P energy: -10.469 tors. eta vs tors. theta energy: -8.005 Dist. restrs. and SS energy: 8.897 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 174 Temperature: 1.272150 Total energy: -149.160519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.160519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.735612 (E_RNA) where: Base-Base interactions energy: -95.506 where: short stacking energy: -49.620 Base-Backbone interact. energy: -1.317 local terms energy: -60.912475 where: bonds (distance) C4'-P energy: -17.215 bonds (distance) P-C4' energy: -7.821 flat angles C4'-P-C4' energy: -19.202 flat angles P-C4'-P energy: -10.163 tors. eta vs tors. theta energy: -6.512 Dist. restrs. and SS energy: 8.575 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 175 Temperature: 1.271700 Total energy: -146.972517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.972517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.501209 (E_RNA) where: Base-Base interactions energy: -86.967 where: short stacking energy: -36.860 Base-Backbone interact. energy: -0.312 local terms energy: -67.221497 where: bonds (distance) C4'-P energy: -19.310 bonds (distance) P-C4' energy: -18.023 flat angles C4'-P-C4' energy: -16.474 flat angles P-C4'-P energy: -8.412 tors. eta vs tors. theta energy: -5.003 Dist. restrs. and SS energy: 7.529 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 176 Temperature: 1.271250 Total energy: -159.715232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.715232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.656975 (E_RNA) where: Base-Base interactions energy: -97.531 where: short stacking energy: -43.501 Base-Backbone interact. energy: 0.885 local terms energy: -70.010582 where: bonds (distance) C4'-P energy: -17.755 bonds (distance) P-C4' energy: -13.282 flat angles C4'-P-C4' energy: -17.156 flat angles P-C4'-P energy: -15.331 tors. eta vs tors. theta energy: -6.487 Dist. restrs. and SS energy: 6.942 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 177 Temperature: 1.270800 Total energy: -149.675310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.675310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.356987 (E_RNA) where: Base-Base interactions energy: -102.155 where: short stacking energy: -55.575 Base-Backbone interact. energy: 1.029 local terms energy: -57.230745 where: bonds (distance) C4'-P energy: -9.520 bonds (distance) P-C4' energy: -16.428 flat angles C4'-P-C4' energy: -13.217 flat angles P-C4'-P energy: -7.585 tors. eta vs tors. theta energy: -10.481 Dist. restrs. and SS energy: 8.682 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 178 Temperature: 1.270350 Total energy: -163.536714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.536714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.552442 (E_RNA) where: Base-Base interactions energy: -95.871 where: short stacking energy: -52.517 Base-Backbone interact. energy: -0.466 local terms energy: -75.214944 where: bonds (distance) C4'-P energy: -19.610 bonds (distance) P-C4' energy: -19.327 flat angles C4'-P-C4' energy: -17.186 flat angles P-C4'-P energy: -8.082 tors. eta vs tors. theta energy: -11.009 Dist. restrs. and SS energy: 8.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 179 Temperature: 1.269900 Total energy: -153.685350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.685350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.103685 (E_RNA) where: Base-Base interactions energy: -98.431 where: short stacking energy: -47.351 Base-Backbone interact. energy: 0.656 local terms energy: -60.328398 where: bonds (distance) C4'-P energy: -14.796 bonds (distance) P-C4' energy: -13.714 flat angles C4'-P-C4' energy: -20.295 flat angles P-C4'-P energy: -5.287 tors. eta vs tors. theta energy: -6.236 Dist. restrs. and SS energy: 4.418 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 180 Temperature: 1.269450 Total energy: -166.299983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.299983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.452866 (E_RNA) where: Base-Base interactions energy: -104.976 where: short stacking energy: -51.717 Base-Backbone interact. energy: -0.406 local terms energy: -67.070924 where: bonds (distance) C4'-P energy: -8.452 bonds (distance) P-C4' energy: -16.676 flat angles C4'-P-C4' energy: -15.352 flat angles P-C4'-P energy: -11.404 tors. eta vs tors. theta energy: -15.187 Dist. restrs. and SS energy: 6.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 181 Temperature: 1.269000 Total energy: -166.611065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.611065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.742757 (E_RNA) where: Base-Base interactions energy: -103.099 where: short stacking energy: -58.650 Base-Backbone interact. energy: -0.021 local terms energy: -70.622367 where: bonds (distance) C4'-P energy: -16.244 bonds (distance) P-C4' energy: -13.774 flat angles C4'-P-C4' energy: -17.868 flat angles P-C4'-P energy: -9.562 tors. eta vs tors. theta energy: -13.174 Dist. restrs. and SS energy: 7.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 182 Temperature: 1.268550 Total energy: -170.494975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.494975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.144253 (E_RNA) where: Base-Base interactions energy: -117.344 where: short stacking energy: -52.221 Base-Backbone interact. energy: -0.237 local terms energy: -62.563021 where: bonds (distance) C4'-P energy: -10.445 bonds (distance) P-C4' energy: -16.192 flat angles C4'-P-C4' energy: -15.328 flat angles P-C4'-P energy: -7.765 tors. eta vs tors. theta energy: -12.834 Dist. restrs. and SS energy: 9.649 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 183 Temperature: 1.268100 Total energy: -199.982909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.982909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.895703 (E_RNA) where: Base-Base interactions energy: -128.831 where: short stacking energy: -57.519 Base-Backbone interact. energy: -1.901 local terms energy: -74.164208 where: bonds (distance) C4'-P energy: -20.781 bonds (distance) P-C4' energy: -15.414 flat angles C4'-P-C4' energy: -15.461 flat angles P-C4'-P energy: -7.058 tors. eta vs tors. theta energy: -15.451 Dist. restrs. and SS energy: 4.913 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 184 Temperature: 1.267650 Total energy: -227.478448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.478448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.264512 (E_RNA) where: Base-Base interactions energy: -155.946 where: short stacking energy: -71.154 Base-Backbone interact. energy: -0.828 local terms energy: -75.490685 where: bonds (distance) C4'-P energy: -12.737 bonds (distance) P-C4' energy: -18.356 flat angles C4'-P-C4' energy: -13.520 flat angles P-C4'-P energy: -12.534 tors. eta vs tors. theta energy: -18.343 Dist. restrs. and SS energy: 4.786 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 185 Temperature: 1.267200 Total energy: -216.931276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.931276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.601959 (E_RNA) where: Base-Base interactions energy: -148.685 where: short stacking energy: -62.071 Base-Backbone interact. energy: -0.211 local terms energy: -73.705780 where: bonds (distance) C4'-P energy: -12.597 bonds (distance) P-C4' energy: -14.877 flat angles C4'-P-C4' energy: -18.902 flat angles P-C4'-P energy: -10.669 tors. eta vs tors. theta energy: -16.661 Dist. restrs. and SS energy: 5.671 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 186 Temperature: 1.266750 Total energy: -223.222458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.222458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.437094 (E_RNA) where: Base-Base interactions energy: -138.741 where: short stacking energy: -64.377 Base-Backbone interact. energy: -0.128 local terms energy: -88.568091 where: bonds (distance) C4'-P energy: -20.355 bonds (distance) P-C4' energy: -22.916 flat angles C4'-P-C4' energy: -14.400 flat angles P-C4'-P energy: -11.900 tors. eta vs tors. theta energy: -18.998 Dist. restrs. and SS energy: 4.215 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 187 Temperature: 1.266300 Total energy: -226.715486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.715486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.835367 (E_RNA) where: Base-Base interactions energy: -157.289 where: short stacking energy: -72.768 Base-Backbone interact. energy: -0.257 local terms energy: -73.289357 where: bonds (distance) C4'-P energy: -19.646 bonds (distance) P-C4' energy: -9.328 flat angles C4'-P-C4' energy: -13.766 flat angles P-C4'-P energy: -8.484 tors. eta vs tors. theta energy: -22.065 Dist. restrs. and SS energy: 4.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 188 Temperature: 1.265850 Total energy: -209.586581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.586581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.708409 (E_RNA) where: Base-Base interactions energy: -149.579 where: short stacking energy: -59.646 Base-Backbone interact. energy: -0.446 local terms energy: -66.683016 where: bonds (distance) C4'-P energy: -16.409 bonds (distance) P-C4' energy: -13.926 flat angles C4'-P-C4' energy: -14.198 flat angles P-C4'-P energy: -6.871 tors. eta vs tors. theta energy: -15.279 Dist. restrs. and SS energy: 7.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 189 Temperature: 1.265400 Total energy: -225.335354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.335354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.500143 (E_RNA) where: Base-Base interactions energy: -160.613 where: short stacking energy: -75.340 Base-Backbone interact. energy: -0.138 local terms energy: -67.749225 where: bonds (distance) C4'-P energy: -20.136 bonds (distance) P-C4' energy: -12.802 flat angles C4'-P-C4' energy: -14.531 flat angles P-C4'-P energy: -1.811 tors. eta vs tors. theta energy: -18.469 Dist. restrs. and SS energy: 3.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 190 Temperature: 1.264950 Total energy: -215.133143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.133143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.820264 (E_RNA) where: Base-Base interactions energy: -144.251 where: short stacking energy: -67.398 Base-Backbone interact. energy: -1.071 local terms energy: -72.497660 where: bonds (distance) C4'-P energy: -18.923 bonds (distance) P-C4' energy: -16.705 flat angles C4'-P-C4' energy: -10.668 flat angles P-C4'-P energy: -13.168 tors. eta vs tors. theta energy: -13.035 Dist. restrs. and SS energy: 2.687 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 191 Temperature: 1.264500 Total energy: -221.512285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.512285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.233877 (E_RNA) where: Base-Base interactions energy: -153.890 where: short stacking energy: -67.135 Base-Backbone interact. energy: 0.036 local terms energy: -70.379968 where: bonds (distance) C4'-P energy: -16.004 bonds (distance) P-C4' energy: -7.729 flat angles C4'-P-C4' energy: -15.265 flat angles P-C4'-P energy: -10.749 tors. eta vs tors. theta energy: -20.633 Dist. restrs. and SS energy: 2.722 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 192 Temperature: 1.264050 Total energy: -225.730575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.730575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.743250 (E_RNA) where: Base-Base interactions energy: -152.876 where: short stacking energy: -71.195 Base-Backbone interact. energy: -0.723 local terms energy: -74.143926 where: bonds (distance) C4'-P energy: -15.197 bonds (distance) P-C4' energy: -16.841 flat angles C4'-P-C4' energy: -14.705 flat angles P-C4'-P energy: -7.556 tors. eta vs tors. theta energy: -19.845 Dist. restrs. and SS energy: 2.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 193 Temperature: 1.263600 Total energy: -218.909777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.909777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.119892 (E_RNA) where: Base-Base interactions energy: -149.029 where: short stacking energy: -56.465 Base-Backbone interact. energy: -0.835 local terms energy: -72.256358 where: bonds (distance) C4'-P energy: -15.345 bonds (distance) P-C4' energy: -14.089 flat angles C4'-P-C4' energy: -15.759 flat angles P-C4'-P energy: -13.572 tors. eta vs tors. theta energy: -13.491 Dist. restrs. and SS energy: 3.210 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 194 Temperature: 1.263150 Total energy: -227.152871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.152871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.891305 (E_RNA) where: Base-Base interactions energy: -151.406 where: short stacking energy: -60.189 Base-Backbone interact. energy: -0.081 local terms energy: -79.404014 where: bonds (distance) C4'-P energy: -15.336 bonds (distance) P-C4' energy: -13.441 flat angles C4'-P-C4' energy: -17.774 flat angles P-C4'-P energy: -14.767 tors. eta vs tors. theta energy: -18.086 Dist. restrs. and SS energy: 3.738 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 195 Temperature: 1.262700 Total energy: -217.109004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.109004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.336083 (E_RNA) where: Base-Base interactions energy: -149.598 where: short stacking energy: -67.267 Base-Backbone interact. energy: 0.404 local terms energy: -70.142858 where: bonds (distance) C4'-P energy: -11.975 bonds (distance) P-C4' energy: -17.074 flat angles C4'-P-C4' energy: -9.990 flat angles P-C4'-P energy: -13.878 tors. eta vs tors. theta energy: -17.226 Dist. restrs. and SS energy: 2.227 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 196 Temperature: 1.262250 Total energy: -219.832045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.832045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.589791 (E_RNA) where: Base-Base interactions energy: -150.036 where: short stacking energy: -65.792 Base-Backbone interact. energy: -0.310 local terms energy: -73.243303 where: bonds (distance) C4'-P energy: -13.701 bonds (distance) P-C4' energy: -15.662 flat angles C4'-P-C4' energy: -19.224 flat angles P-C4'-P energy: -9.021 tors. eta vs tors. theta energy: -15.636 Dist. restrs. and SS energy: 3.758 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 197 Temperature: 1.261800 Total energy: -234.412208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.412208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.459398 (E_RNA) where: Base-Base interactions energy: -161.264 where: short stacking energy: -70.881 Base-Backbone interact. energy: 0.065 local terms energy: -76.260536 where: bonds (distance) C4'-P energy: -19.366 bonds (distance) P-C4' energy: -13.486 flat angles C4'-P-C4' energy: -16.457 flat angles P-C4'-P energy: -3.112 tors. eta vs tors. theta energy: -23.839 Dist. restrs. and SS energy: 3.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 198 Temperature: 1.261350 Total energy: -220.378613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.378613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.432633 (E_RNA) where: Base-Base interactions energy: -148.557 where: short stacking energy: -64.056 Base-Backbone interact. energy: -0.854 local terms energy: -74.021926 where: bonds (distance) C4'-P energy: -15.891 bonds (distance) P-C4' energy: -21.496 flat angles C4'-P-C4' energy: -14.672 flat angles P-C4'-P energy: -8.443 tors. eta vs tors. theta energy: -13.520 Dist. restrs. and SS energy: 3.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 199 Temperature: 1.260900 Total energy: -210.442079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.442079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.280693 (E_RNA) where: Base-Base interactions energy: -149.368 where: short stacking energy: -60.324 Base-Backbone interact. energy: 0.479 local terms energy: -68.392311 where: bonds (distance) C4'-P energy: -13.559 bonds (distance) P-C4' energy: -13.348 flat angles C4'-P-C4' energy: -20.749 flat angles P-C4'-P energy: -6.474 tors. eta vs tors. theta energy: -14.263 Dist. restrs. and SS energy: 6.839 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 200 Temperature: 1.260450 Total energy: -249.098667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.098667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.951324 (E_RNA) where: Base-Base interactions energy: -167.011 where: short stacking energy: -63.906 Base-Backbone interact. energy: -0.748 local terms energy: -84.191886 where: bonds (distance) C4'-P energy: -20.355 bonds (distance) P-C4' energy: -15.506 flat angles C4'-P-C4' energy: -17.975 flat angles P-C4'-P energy: -12.995 tors. eta vs tors. theta energy: -17.361 Dist. restrs. and SS energy: 2.853 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 201 Temperature: 1.260000 Total energy: -238.580441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.580441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.000070 (E_RNA) where: Base-Base interactions energy: -165.847 where: short stacking energy: -61.912 Base-Backbone interact. energy: -0.150 local terms energy: -75.002502 where: bonds (distance) C4'-P energy: -16.073 bonds (distance) P-C4' energy: -15.283 flat angles C4'-P-C4' energy: -15.881 flat angles P-C4'-P energy: -12.606 tors. eta vs tors. theta energy: -15.159 Dist. restrs. and SS energy: 2.420 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 202 Temperature: 1.259550 Total energy: -220.100205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.100205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.027543 (E_RNA) where: Base-Base interactions energy: -159.785 where: short stacking energy: -65.566 Base-Backbone interact. energy: -0.128 local terms energy: -63.114618 where: bonds (distance) C4'-P energy: -9.012 bonds (distance) P-C4' energy: -16.984 flat angles C4'-P-C4' energy: -17.291 flat angles P-C4'-P energy: -5.767 tors. eta vs tors. theta energy: -14.061 Dist. restrs. and SS energy: 2.927 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 203 Temperature: 1.259100 Total energy: -237.703971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.703971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.575300 (E_RNA) where: Base-Base interactions energy: -160.089 where: short stacking energy: -68.317 Base-Backbone interact. energy: -0.304 local terms energy: -80.182261 where: bonds (distance) C4'-P energy: -17.348 bonds (distance) P-C4' energy: -20.454 flat angles C4'-P-C4' energy: -14.726 flat angles P-C4'-P energy: -9.015 tors. eta vs tors. theta energy: -18.639 Dist. restrs. and SS energy: 2.871 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 204 Temperature: 1.258650 Total energy: -220.021231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.021231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.876825 (E_RNA) where: Base-Base interactions energy: -139.163 where: short stacking energy: -56.747 Base-Backbone interact. energy: -0.750 local terms energy: -81.963804 where: bonds (distance) C4'-P energy: -20.412 bonds (distance) P-C4' energy: -15.120 flat angles C4'-P-C4' energy: -15.272 flat angles P-C4'-P energy: -11.000 tors. eta vs tors. theta energy: -20.160 Dist. restrs. and SS energy: 1.856 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 205 Temperature: 1.258200 Total energy: -231.077276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.077276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.623538 (E_RNA) where: Base-Base interactions energy: -154.593 where: short stacking energy: -64.417 Base-Backbone interact. energy: -0.322 local terms energy: -82.708202 where: bonds (distance) C4'-P energy: -17.308 bonds (distance) P-C4' energy: -18.806 flat angles C4'-P-C4' energy: -20.311 flat angles P-C4'-P energy: -10.567 tors. eta vs tors. theta energy: -15.716 Dist. restrs. and SS energy: 6.546 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 206 Temperature: 1.257750 Total energy: -238.493899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.493899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.664774 (E_RNA) where: Base-Base interactions energy: -172.959 where: short stacking energy: -69.360 Base-Backbone interact. energy: 0.039 local terms energy: -69.745201 where: bonds (distance) C4'-P energy: -15.961 bonds (distance) P-C4' energy: -10.836 flat angles C4'-P-C4' energy: -17.555 flat angles P-C4'-P energy: -10.214 tors. eta vs tors. theta energy: -15.179 Dist. restrs. and SS energy: 4.171 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 207 Temperature: 1.257300 Total energy: -206.308723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.308723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.598810 (E_RNA) where: Base-Base interactions energy: -135.284 where: short stacking energy: -51.308 Base-Backbone interact. energy: -0.732 local terms energy: -74.583009 where: bonds (distance) C4'-P energy: -20.259 bonds (distance) P-C4' energy: -13.886 flat angles C4'-P-C4' energy: -16.980 flat angles P-C4'-P energy: -8.825 tors. eta vs tors. theta energy: -14.633 Dist. restrs. and SS energy: 4.290 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 208 Temperature: 1.256850 Total energy: -216.986852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.986852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.446976 (E_RNA) where: Base-Base interactions energy: -155.550 where: short stacking energy: -56.793 Base-Backbone interact. energy: -1.290 local terms energy: -65.607095 where: bonds (distance) C4'-P energy: -10.741 bonds (distance) P-C4' energy: -20.725 flat angles C4'-P-C4' energy: -14.692 flat angles P-C4'-P energy: -5.506 tors. eta vs tors. theta energy: -13.943 Dist. restrs. and SS energy: 5.460 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 209 Temperature: 1.256400 Total energy: -212.813967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.813967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.882496 (E_RNA) where: Base-Base interactions energy: -139.816 where: short stacking energy: -58.319 Base-Backbone interact. energy: -0.129 local terms energy: -76.937696 where: bonds (distance) C4'-P energy: -13.635 bonds (distance) P-C4' energy: -20.652 flat angles C4'-P-C4' energy: -16.675 flat angles P-C4'-P energy: -13.089 tors. eta vs tors. theta energy: -12.886 Dist. restrs. and SS energy: 4.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 210 Temperature: 1.255950 Total energy: -215.191414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.191414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.689918 (E_RNA) where: Base-Base interactions energy: -149.578 where: short stacking energy: -68.967 Base-Backbone interact. energy: -0.013 local terms energy: -70.099135 where: bonds (distance) C4'-P energy: -12.001 bonds (distance) P-C4' energy: -14.137 flat angles C4'-P-C4' energy: -14.627 flat angles P-C4'-P energy: -13.769 tors. eta vs tors. theta energy: -15.565 Dist. restrs. and SS energy: 4.499 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 211 Temperature: 1.255500 Total energy: -202.467714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.467714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.909397 (E_RNA) where: Base-Base interactions energy: -136.693 where: short stacking energy: -55.592 Base-Backbone interact. energy: -0.332 local terms energy: -70.884486 where: bonds (distance) C4'-P energy: -22.061 bonds (distance) P-C4' energy: -14.238 flat angles C4'-P-C4' energy: -14.746 flat angles P-C4'-P energy: -11.744 tors. eta vs tors. theta energy: -8.096 Dist. restrs. and SS energy: 5.442 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 212 Temperature: 1.255050 Total energy: -197.204195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.204195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.665507 (E_RNA) where: Base-Base interactions energy: -130.475 where: short stacking energy: -63.484 Base-Backbone interact. energy: -0.310 local terms energy: -71.880996 where: bonds (distance) C4'-P energy: -12.186 bonds (distance) P-C4' energy: -16.001 flat angles C4'-P-C4' energy: -15.278 flat angles P-C4'-P energy: -11.250 tors. eta vs tors. theta energy: -17.166 Dist. restrs. and SS energy: 5.461 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 213 Temperature: 1.254600 Total energy: -214.571653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.571653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.641553 (E_RNA) where: Base-Base interactions energy: -148.659 where: short stacking energy: -67.482 Base-Backbone interact. energy: -0.110 local terms energy: -69.872168 where: bonds (distance) C4'-P energy: -13.139 bonds (distance) P-C4' energy: -19.089 flat angles C4'-P-C4' energy: -14.358 flat angles P-C4'-P energy: -10.240 tors. eta vs tors. theta energy: -13.046 Dist. restrs. and SS energy: 4.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 214 Temperature: 1.254150 Total energy: -203.601827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.601827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.245462 (E_RNA) where: Base-Base interactions energy: -141.184 where: short stacking energy: -56.790 Base-Backbone interact. energy: -0.105 local terms energy: -66.956156 where: bonds (distance) C4'-P energy: -8.985 bonds (distance) P-C4' energy: -14.748 flat angles C4'-P-C4' energy: -20.073 flat angles P-C4'-P energy: -10.894 tors. eta vs tors. theta energy: -12.256 Dist. restrs. and SS energy: 4.644 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 215 Temperature: 1.253700 Total energy: -213.962781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.962781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.331679 (E_RNA) where: Base-Base interactions energy: -139.883 where: short stacking energy: -58.967 Base-Backbone interact. energy: -0.105 local terms energy: -78.344048 where: bonds (distance) C4'-P energy: -18.079 bonds (distance) P-C4' energy: -18.858 flat angles C4'-P-C4' energy: -17.425 flat angles P-C4'-P energy: -10.549 tors. eta vs tors. theta energy: -13.433 Dist. restrs. and SS energy: 4.369 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 216 Temperature: 1.253250 Total energy: -212.527860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.527860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.337446 (E_RNA) where: Base-Base interactions energy: -140.469 where: short stacking energy: -69.075 Base-Backbone interact. energy: -0.864 local terms energy: -77.004950 where: bonds (distance) C4'-P energy: -18.094 bonds (distance) P-C4' energy: -22.471 flat angles C4'-P-C4' energy: -11.820 flat angles P-C4'-P energy: -11.464 tors. eta vs tors. theta energy: -13.156 Dist. restrs. and SS energy: 5.810 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 217 Temperature: 1.252800 Total energy: -213.438137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.438137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.359290 (E_RNA) where: Base-Base interactions energy: -143.552 where: short stacking energy: -61.396 Base-Backbone interact. energy: -0.322 local terms energy: -77.485033 where: bonds (distance) C4'-P energy: -13.395 bonds (distance) P-C4' energy: -18.121 flat angles C4'-P-C4' energy: -19.054 flat angles P-C4'-P energy: -11.060 tors. eta vs tors. theta energy: -15.855 Dist. restrs. and SS energy: 7.921 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 218 Temperature: 1.252350 Total energy: -205.433339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.433339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.350911 (E_RNA) where: Base-Base interactions energy: -143.561 where: short stacking energy: -55.740 Base-Backbone interact. energy: 1.164 local terms energy: -66.954204 where: bonds (distance) C4'-P energy: -7.014 bonds (distance) P-C4' energy: -19.282 flat angles C4'-P-C4' energy: -14.040 flat angles P-C4'-P energy: -11.450 tors. eta vs tors. theta energy: -15.168 Dist. restrs. and SS energy: 3.918 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 219 Temperature: 1.251900 Total energy: -201.394973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.394973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.515734 (E_RNA) where: Base-Base interactions energy: -138.610 where: short stacking energy: -62.609 Base-Backbone interact. energy: -0.611 local terms energy: -69.294768 where: bonds (distance) C4'-P energy: -13.971 bonds (distance) P-C4' energy: -12.030 flat angles C4'-P-C4' energy: -20.665 flat angles P-C4'-P energy: -8.664 tors. eta vs tors. theta energy: -13.965 Dist. restrs. and SS energy: 7.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 220 Temperature: 1.251450 Total energy: -209.791408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.791408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.663456 (E_RNA) where: Base-Base interactions energy: -146.122 where: short stacking energy: -58.108 Base-Backbone interact. energy: -0.246 local terms energy: -67.294980 where: bonds (distance) C4'-P energy: -16.464 bonds (distance) P-C4' energy: -14.691 flat angles C4'-P-C4' energy: -13.551 flat angles P-C4'-P energy: -6.930 tors. eta vs tors. theta energy: -15.659 Dist. restrs. and SS energy: 3.872 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 221 Temperature: 1.251000 Total energy: -217.769221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.769221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.527346 (E_RNA) where: Base-Base interactions energy: -149.469 where: short stacking energy: -69.365 Base-Backbone interact. energy: -0.031 local terms energy: -73.027136 where: bonds (distance) C4'-P energy: -17.792 bonds (distance) P-C4' energy: -15.571 flat angles C4'-P-C4' energy: -17.554 flat angles P-C4'-P energy: -8.342 tors. eta vs tors. theta energy: -13.768 Dist. restrs. and SS energy: 4.758 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 222 Temperature: 1.250550 Total energy: -240.567830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.567830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.284708 (E_RNA) where: Base-Base interactions energy: -160.520 where: short stacking energy: -74.134 Base-Backbone interact. energy: -0.033 local terms energy: -81.732179 where: bonds (distance) C4'-P energy: -14.238 bonds (distance) P-C4' energy: -20.173 flat angles C4'-P-C4' energy: -11.577 flat angles P-C4'-P energy: -12.938 tors. eta vs tors. theta energy: -22.806 Dist. restrs. and SS energy: 1.717 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 223 Temperature: 1.250100 Total energy: -242.074682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.074682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.710567 (E_RNA) where: Base-Base interactions energy: -168.224 where: short stacking energy: -77.866 Base-Backbone interact. energy: -1.292 local terms energy: -75.194513 where: bonds (distance) C4'-P energy: -9.750 bonds (distance) P-C4' energy: -16.528 flat angles C4'-P-C4' energy: -19.782 flat angles P-C4'-P energy: -7.606 tors. eta vs tors. theta energy: -21.529 Dist. restrs. and SS energy: 2.636 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 224 Temperature: 1.249650 Total energy: -232.776541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.776541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.614074 (E_RNA) where: Base-Base interactions energy: -169.866 where: short stacking energy: -79.531 Base-Backbone interact. energy: -0.151 local terms energy: -68.597645 where: bonds (distance) C4'-P energy: -9.885 bonds (distance) P-C4' energy: -15.155 flat angles C4'-P-C4' energy: -13.540 flat angles P-C4'-P energy: -11.409 tors. eta vs tors. theta energy: -18.610 Dist. restrs. and SS energy: 5.838 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 225 Temperature: 1.249200 Total energy: -222.655127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.655127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.934413 (E_RNA) where: Base-Base interactions energy: -149.575 where: short stacking energy: -66.755 Base-Backbone interact. energy: -0.360 local terms energy: -77.998754 where: bonds (distance) C4'-P energy: -15.742 bonds (distance) P-C4' energy: -19.714 flat angles C4'-P-C4' energy: -12.367 flat angles P-C4'-P energy: -13.386 tors. eta vs tors. theta energy: -16.789 Dist. restrs. and SS energy: 5.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 226 Temperature: 1.248750 Total energy: -214.446992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.446992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.284599 (E_RNA) where: Base-Base interactions energy: -138.392 where: short stacking energy: -63.564 Base-Backbone interact. energy: -0.124 local terms energy: -81.768470 where: bonds (distance) C4'-P energy: -18.772 bonds (distance) P-C4' energy: -16.089 flat angles C4'-P-C4' energy: -16.793 flat angles P-C4'-P energy: -9.291 tors. eta vs tors. theta energy: -20.823 Dist. restrs. and SS energy: 5.838 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 227 Temperature: 1.248300 Total energy: -208.788496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.788496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.370117 (E_RNA) where: Base-Base interactions energy: -148.276 where: short stacking energy: -62.094 Base-Backbone interact. energy: -1.202 local terms energy: -64.891865 where: bonds (distance) C4'-P energy: -10.592 bonds (distance) P-C4' energy: -16.490 flat angles C4'-P-C4' energy: -13.841 flat angles P-C4'-P energy: -11.310 tors. eta vs tors. theta energy: -12.659 Dist. restrs. and SS energy: 5.582 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 228 Temperature: 1.247850 Total energy: -204.966915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.966915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.957924 (E_RNA) where: Base-Base interactions energy: -146.713 where: short stacking energy: -58.349 Base-Backbone interact. energy: -0.805 local terms energy: -65.439672 where: bonds (distance) C4'-P energy: -14.096 bonds (distance) P-C4' energy: -16.738 flat angles C4'-P-C4' energy: -14.838 flat angles P-C4'-P energy: -7.910 tors. eta vs tors. theta energy: -11.858 Dist. restrs. and SS energy: 7.991 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 229 Temperature: 1.247400 Total energy: -226.062457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.062457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.459311 (E_RNA) where: Base-Base interactions energy: -145.750 where: short stacking energy: -62.424 Base-Backbone interact. energy: 1.481 local terms energy: -85.190605 where: bonds (distance) C4'-P energy: -16.121 bonds (distance) P-C4' energy: -18.522 flat angles C4'-P-C4' energy: -20.100 flat angles P-C4'-P energy: -16.972 tors. eta vs tors. theta energy: -13.476 Dist. restrs. and SS energy: 3.397 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 230 Temperature: 1.246950 Total energy: -203.908575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.908575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.912959 (E_RNA) where: Base-Base interactions energy: -146.918 where: short stacking energy: -58.478 Base-Backbone interact. energy: -1.159 local terms energy: -61.835954 where: bonds (distance) C4'-P energy: -10.832 bonds (distance) P-C4' energy: -20.675 flat angles C4'-P-C4' energy: -15.285 flat angles P-C4'-P energy: -6.142 tors. eta vs tors. theta energy: -8.902 Dist. restrs. and SS energy: 6.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 231 Temperature: 1.246500 Total energy: -217.761083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.761083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.742201 (E_RNA) where: Base-Base interactions energy: -154.895 where: short stacking energy: -67.803 Base-Backbone interact. energy: -0.345 local terms energy: -66.502415 where: bonds (distance) C4'-P energy: -11.124 bonds (distance) P-C4' energy: -13.021 flat angles C4'-P-C4' energy: -15.472 flat angles P-C4'-P energy: -12.857 tors. eta vs tors. theta energy: -14.028 Dist. restrs. and SS energy: 3.981 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 232 Temperature: 1.246050 Total energy: -228.142527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.142527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.113473 (E_RNA) where: Base-Base interactions energy: -145.016 where: short stacking energy: -62.478 Base-Backbone interact. energy: -0.030 local terms energy: -85.068016 where: bonds (distance) C4'-P energy: -20.134 bonds (distance) P-C4' energy: -16.175 flat angles C4'-P-C4' energy: -20.815 flat angles P-C4'-P energy: -8.824 tors. eta vs tors. theta energy: -19.120 Dist. restrs. and SS energy: 1.971 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 233 Temperature: 1.245600 Total energy: -247.098695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.098695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.389658 (E_RNA) where: Base-Base interactions energy: -163.684 where: short stacking energy: -76.471 Base-Backbone interact. energy: -0.215 local terms energy: -85.491335 where: bonds (distance) C4'-P energy: -17.200 bonds (distance) P-C4' energy: -12.951 flat angles C4'-P-C4' energy: -19.562 flat angles P-C4'-P energy: -10.959 tors. eta vs tors. theta energy: -24.820 Dist. restrs. and SS energy: 2.291 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 234 Temperature: 1.245150 Total energy: -241.061046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.061046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.913973 (E_RNA) where: Base-Base interactions energy: -161.880 where: short stacking energy: -73.757 Base-Backbone interact. energy: -1.169 local terms energy: -79.864903 where: bonds (distance) C4'-P energy: -14.447 bonds (distance) P-C4' energy: -14.379 flat angles C4'-P-C4' energy: -20.833 flat angles P-C4'-P energy: -7.665 tors. eta vs tors. theta energy: -22.542 Dist. restrs. and SS energy: 1.853 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 235 Temperature: 1.244700 Total energy: -214.602136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.602136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.353229 (E_RNA) where: Base-Base interactions energy: -149.167 where: short stacking energy: -67.451 Base-Backbone interact. energy: -0.142 local terms energy: -71.044569 where: bonds (distance) C4'-P energy: -10.413 bonds (distance) P-C4' energy: -14.970 flat angles C4'-P-C4' energy: -16.677 flat angles P-C4'-P energy: -13.411 tors. eta vs tors. theta energy: -15.573 Dist. restrs. and SS energy: 5.751 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 236 Temperature: 1.244250 Total energy: -214.913152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.913152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.036191 (E_RNA) where: Base-Base interactions energy: -145.945 where: short stacking energy: -67.043 Base-Backbone interact. energy: -0.468 local terms energy: -77.623315 where: bonds (distance) C4'-P energy: -15.243 bonds (distance) P-C4' energy: -19.573 flat angles C4'-P-C4' energy: -18.810 flat angles P-C4'-P energy: -9.546 tors. eta vs tors. theta energy: -14.453 Dist. restrs. and SS energy: 9.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 237 Temperature: 1.243800 Total energy: -217.468778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.468778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.629836 (E_RNA) where: Base-Base interactions energy: -138.367 where: short stacking energy: -61.796 Base-Backbone interact. energy: -0.060 local terms energy: -83.203106 where: bonds (distance) C4'-P energy: -17.522 bonds (distance) P-C4' energy: -22.701 flat angles C4'-P-C4' energy: -17.243 flat angles P-C4'-P energy: -10.448 tors. eta vs tors. theta energy: -15.288 Dist. restrs. and SS energy: 4.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 238 Temperature: 1.243350 Total energy: -225.886868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.886868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.095935 (E_RNA) where: Base-Base interactions energy: -158.415 where: short stacking energy: -61.561 Base-Backbone interact. energy: -0.112 local terms energy: -70.569519 where: bonds (distance) C4'-P energy: -14.454 bonds (distance) P-C4' energy: -16.832 flat angles C4'-P-C4' energy: -15.193 flat angles P-C4'-P energy: -10.641 tors. eta vs tors. theta energy: -13.450 Dist. restrs. and SS energy: 3.209 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 239 Temperature: 1.242900 Total energy: -218.675606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.675606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.440262 (E_RNA) where: Base-Base interactions energy: -144.135 where: short stacking energy: -52.415 Base-Backbone interact. energy: -0.336 local terms energy: -77.969304 where: bonds (distance) C4'-P energy: -21.096 bonds (distance) P-C4' energy: -19.022 flat angles C4'-P-C4' energy: -18.465 flat angles P-C4'-P energy: -8.236 tors. eta vs tors. theta energy: -11.151 Dist. restrs. and SS energy: 3.765 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 240 Temperature: 1.242450 Total energy: -216.754894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.754894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.571155 (E_RNA) where: Base-Base interactions energy: -145.816 where: short stacking energy: -63.328 Base-Backbone interact. energy: -0.867 local terms energy: -75.888678 where: bonds (distance) C4'-P energy: -17.630 bonds (distance) P-C4' energy: -18.285 flat angles C4'-P-C4' energy: -12.977 flat angles P-C4'-P energy: -14.277 tors. eta vs tors. theta energy: -12.719 Dist. restrs. and SS energy: 5.816 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 241 Temperature: 1.242000 Total energy: -194.419327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.419327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.232836 (E_RNA) where: Base-Base interactions energy: -133.997 where: short stacking energy: -56.705 Base-Backbone interact. energy: -0.947 local terms energy: -63.289256 where: bonds (distance) C4'-P energy: -17.999 bonds (distance) P-C4' energy: -12.712 flat angles C4'-P-C4' energy: -15.301 flat angles P-C4'-P energy: -7.645 tors. eta vs tors. theta energy: -9.632 Dist. restrs. and SS energy: 3.814 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 242 Temperature: 1.241550 Total energy: -236.063914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.063914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.615289 (E_RNA) where: Base-Base interactions energy: -163.295 where: short stacking energy: -82.944 Base-Backbone interact. energy: 0.129 local terms energy: -78.449575 where: bonds (distance) C4'-P energy: -12.605 bonds (distance) P-C4' energy: -15.564 flat angles C4'-P-C4' energy: -16.525 flat angles P-C4'-P energy: -11.261 tors. eta vs tors. theta energy: -22.494 Dist. restrs. and SS energy: 5.551 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 243 Temperature: 1.241100 Total energy: -215.981770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.981770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.021933 (E_RNA) where: Base-Base interactions energy: -138.922 where: short stacking energy: -64.319 Base-Backbone interact. energy: -0.648 local terms energy: -82.451766 where: bonds (distance) C4'-P energy: -13.023 bonds (distance) P-C4' energy: -20.459 flat angles C4'-P-C4' energy: -18.237 flat angles P-C4'-P energy: -11.165 tors. eta vs tors. theta energy: -19.569 Dist. restrs. and SS energy: 6.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 244 Temperature: 1.240650 Total energy: -209.997151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.997151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.503839 (E_RNA) where: Base-Base interactions energy: -141.349 where: short stacking energy: -62.920 Base-Backbone interact. energy: -0.900 local terms energy: -75.255096 where: bonds (distance) C4'-P energy: -10.514 bonds (distance) P-C4' energy: -17.217 flat angles C4'-P-C4' energy: -15.952 flat angles P-C4'-P energy: -14.148 tors. eta vs tors. theta energy: -17.424 Dist. restrs. and SS energy: 7.507 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 245 Temperature: 1.240200 Total energy: -210.544036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.544036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.124569 (E_RNA) where: Base-Base interactions energy: -155.803 where: short stacking energy: -64.735 Base-Backbone interact. energy: -0.140 local terms energy: -60.182340 where: bonds (distance) C4'-P energy: -13.932 bonds (distance) P-C4' energy: -15.822 flat angles C4'-P-C4' energy: -7.392 flat angles P-C4'-P energy: -9.185 tors. eta vs tors. theta energy: -13.852 Dist. restrs. and SS energy: 5.581 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 246 Temperature: 1.239750 Total energy: -221.638279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.638279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.476491 (E_RNA) where: Base-Base interactions energy: -154.358 where: short stacking energy: -75.342 Base-Backbone interact. energy: -0.608 local terms energy: -74.510823 where: bonds (distance) C4'-P energy: -16.275 bonds (distance) P-C4' energy: -12.767 flat angles C4'-P-C4' energy: -16.480 flat angles P-C4'-P energy: -8.589 tors. eta vs tors. theta energy: -20.400 Dist. restrs. and SS energy: 7.838 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 247 Temperature: 1.239300 Total energy: -215.988567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.988567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.096381 (E_RNA) where: Base-Base interactions energy: -143.039 where: short stacking energy: -64.536 Base-Backbone interact. energy: -0.321 local terms energy: -80.735664 where: bonds (distance) C4'-P energy: -15.095 bonds (distance) P-C4' energy: -20.535 flat angles C4'-P-C4' energy: -18.167 flat angles P-C4'-P energy: -8.045 tors. eta vs tors. theta energy: -18.893 Dist. restrs. and SS energy: 8.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 248 Temperature: 1.238850 Total energy: -211.560598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.560598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.384204 (E_RNA) where: Base-Base interactions energy: -153.190 where: short stacking energy: -72.130 Base-Backbone interact. energy: -0.600 local terms energy: -64.594384 where: bonds (distance) C4'-P energy: -11.073 bonds (distance) P-C4' energy: -18.774 flat angles C4'-P-C4' energy: -12.930 flat angles P-C4'-P energy: -6.085 tors. eta vs tors. theta energy: -15.733 Dist. restrs. and SS energy: 6.824 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 249 Temperature: 1.238400 Total energy: -216.387618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.387618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.176889 (E_RNA) where: Base-Base interactions energy: -157.559 where: short stacking energy: -59.636 Base-Backbone interact. energy: -1.592 local terms energy: -64.026389 where: bonds (distance) C4'-P energy: -9.239 bonds (distance) P-C4' energy: -13.467 flat angles C4'-P-C4' energy: -17.768 flat angles P-C4'-P energy: -8.136 tors. eta vs tors. theta energy: -15.416 Dist. restrs. and SS energy: 6.789 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 250 Temperature: 1.237950 Total energy: -221.681277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.681277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.847555 (E_RNA) where: Base-Base interactions energy: -157.332 where: short stacking energy: -63.141 Base-Backbone interact. energy: -0.918 local terms energy: -68.597499 where: bonds (distance) C4'-P energy: -16.584 bonds (distance) P-C4' energy: -16.236 flat angles C4'-P-C4' energy: -16.464 flat angles P-C4'-P energy: -7.543 tors. eta vs tors. theta energy: -11.771 Dist. restrs. and SS energy: 5.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 251 Temperature: 1.237500 Total energy: -211.349939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.349939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.358488 (E_RNA) where: Base-Base interactions energy: -144.558 where: short stacking energy: -61.485 Base-Backbone interact. energy: -0.211 local terms energy: -68.589180 where: bonds (distance) C4'-P energy: -18.379 bonds (distance) P-C4' energy: -14.050 flat angles C4'-P-C4' energy: -7.624 flat angles P-C4'-P energy: -12.328 tors. eta vs tors. theta energy: -16.208 Dist. restrs. and SS energy: 2.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 252 Temperature: 1.237050 Total energy: -228.871761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.871761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.883541 (E_RNA) where: Base-Base interactions energy: -152.859 where: short stacking energy: -63.562 Base-Backbone interact. energy: 0.052 local terms energy: -80.077371 where: bonds (distance) C4'-P energy: -18.317 bonds (distance) P-C4' energy: -18.626 flat angles C4'-P-C4' energy: -14.859 flat angles P-C4'-P energy: -14.118 tors. eta vs tors. theta energy: -14.157 Dist. restrs. and SS energy: 4.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 253 Temperature: 1.236600 Total energy: -209.463765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.463765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.680210 (E_RNA) where: Base-Base interactions energy: -138.073 where: short stacking energy: -60.092 Base-Backbone interact. energy: -0.686 local terms energy: -73.921627 where: bonds (distance) C4'-P energy: -19.910 bonds (distance) P-C4' energy: -18.585 flat angles C4'-P-C4' energy: -9.987 flat angles P-C4'-P energy: -9.143 tors. eta vs tors. theta energy: -16.296 Dist. restrs. and SS energy: 3.216 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 254 Temperature: 1.236150 Total energy: -241.580653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.580653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.548379 (E_RNA) where: Base-Base interactions energy: -166.867 where: short stacking energy: -67.335 Base-Backbone interact. energy: -1.114 local terms energy: -75.567844 where: bonds (distance) C4'-P energy: -12.679 bonds (distance) P-C4' energy: -20.886 flat angles C4'-P-C4' energy: -14.088 flat angles P-C4'-P energy: -13.333 tors. eta vs tors. theta energy: -14.581 Dist. restrs. and SS energy: 1.968 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 255 Temperature: 1.235700 Total energy: -225.684756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.684756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.485978 (E_RNA) where: Base-Base interactions energy: -148.760 where: short stacking energy: -59.906 Base-Backbone interact. energy: -0.982 local terms energy: -78.744107 where: bonds (distance) C4'-P energy: -19.484 bonds (distance) P-C4' energy: -14.355 flat angles C4'-P-C4' energy: -15.030 flat angles P-C4'-P energy: -14.550 tors. eta vs tors. theta energy: -15.325 Dist. restrs. and SS energy: 2.801 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 256 Temperature: 1.235250 Total energy: -251.086759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.086759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.313619 (E_RNA) where: Base-Base interactions energy: -169.788 where: short stacking energy: -70.695 Base-Backbone interact. energy: -0.491 local terms energy: -84.035058 where: bonds (distance) C4'-P energy: -18.134 bonds (distance) P-C4' energy: -16.543 flat angles C4'-P-C4' energy: -17.487 flat angles P-C4'-P energy: -9.791 tors. eta vs tors. theta energy: -22.080 Dist. restrs. and SS energy: 3.227 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 257 Temperature: 1.234800 Total energy: -239.543640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.543640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.287209 (E_RNA) where: Base-Base interactions energy: -161.778 where: short stacking energy: -65.769 Base-Backbone interact. energy: -0.089 local terms energy: -79.419860 where: bonds (distance) C4'-P energy: -16.226 bonds (distance) P-C4' energy: -21.683 flat angles C4'-P-C4' energy: -16.497 flat angles P-C4'-P energy: -6.275 tors. eta vs tors. theta energy: -18.738 Dist. restrs. and SS energy: 1.744 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 258 Temperature: 1.234350 Total energy: -242.018839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.018839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.820067 (E_RNA) where: Base-Base interactions energy: -164.875 where: short stacking energy: -65.100 Base-Backbone interact. energy: -0.197 local terms energy: -78.747390 where: bonds (distance) C4'-P energy: -12.414 bonds (distance) P-C4' energy: -14.840 flat angles C4'-P-C4' energy: -15.967 flat angles P-C4'-P energy: -13.873 tors. eta vs tors. theta energy: -21.654 Dist. restrs. and SS energy: 1.801 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 259 Temperature: 1.233900 Total energy: -241.591499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.591499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.498918 (E_RNA) where: Base-Base interactions energy: -170.155 where: short stacking energy: -65.772 Base-Backbone interact. energy: -0.203 local terms energy: -75.141381 where: bonds (distance) C4'-P energy: -10.839 bonds (distance) P-C4' energy: -18.972 flat angles C4'-P-C4' energy: -16.500 flat angles P-C4'-P energy: -15.332 tors. eta vs tors. theta energy: -13.498 Dist. restrs. and SS energy: 3.907 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 260 Temperature: 1.233450 Total energy: -234.459602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.459602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.697873 (E_RNA) where: Base-Base interactions energy: -164.396 where: short stacking energy: -60.016 Base-Backbone interact. energy: -0.092 local terms energy: -74.209703 where: bonds (distance) C4'-P energy: -14.265 bonds (distance) P-C4' energy: -16.916 flat angles C4'-P-C4' energy: -16.109 flat angles P-C4'-P energy: -14.208 tors. eta vs tors. theta energy: -12.712 Dist. restrs. and SS energy: 4.238 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 261 Temperature: 1.233000 Total energy: -217.603831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.603831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.888280 (E_RNA) where: Base-Base interactions energy: -157.565 where: short stacking energy: -56.083 Base-Backbone interact. energy: -0.478 local terms energy: -65.845793 where: bonds (distance) C4'-P energy: -14.828 bonds (distance) P-C4' energy: -17.703 flat angles C4'-P-C4' energy: -13.913 flat angles P-C4'-P energy: -11.219 tors. eta vs tors. theta energy: -8.182 Dist. restrs. and SS energy: 6.284 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 262 Temperature: 1.232550 Total energy: -236.603413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.603413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.485526 (E_RNA) where: Base-Base interactions energy: -169.830 where: short stacking energy: -65.998 Base-Backbone interact. energy: 0.494 local terms energy: -70.148648 where: bonds (distance) C4'-P energy: -7.737 bonds (distance) P-C4' energy: -14.748 flat angles C4'-P-C4' energy: -18.853 flat angles P-C4'-P energy: -15.332 tors. eta vs tors. theta energy: -13.480 Dist. restrs. and SS energy: 2.882 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 263 Temperature: 1.232100 Total energy: -215.708897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.708897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.018274 (E_RNA) where: Base-Base interactions energy: -153.189 where: short stacking energy: -48.966 Base-Backbone interact. energy: -0.338 local terms energy: -70.491075 where: bonds (distance) C4'-P energy: -17.230 bonds (distance) P-C4' energy: -7.980 flat angles C4'-P-C4' energy: -18.789 flat angles P-C4'-P energy: -14.396 tors. eta vs tors. theta energy: -12.096 Dist. restrs. and SS energy: 8.309 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 264 Temperature: 1.231650 Total energy: -214.299507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.299507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.672899 (E_RNA) where: Base-Base interactions energy: -144.415 where: short stacking energy: -64.050 Base-Backbone interact. energy: -0.499 local terms energy: -72.758415 where: bonds (distance) C4'-P energy: -16.189 bonds (distance) P-C4' energy: -12.514 flat angles C4'-P-C4' energy: -17.626 flat angles P-C4'-P energy: -9.314 tors. eta vs tors. theta energy: -17.116 Dist. restrs. and SS energy: 3.373 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 265 Temperature: 1.231200 Total energy: -228.748315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.748315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.882196 (E_RNA) where: Base-Base interactions energy: -157.604 where: short stacking energy: -70.794 Base-Backbone interact. energy: -0.840 local terms energy: -78.438021 where: bonds (distance) C4'-P energy: -17.050 bonds (distance) P-C4' energy: -19.101 flat angles C4'-P-C4' energy: -18.002 flat angles P-C4'-P energy: -7.831 tors. eta vs tors. theta energy: -16.454 Dist. restrs. and SS energy: 8.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 266 Temperature: 1.230750 Total energy: -222.504874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.504874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.973772 (E_RNA) where: Base-Base interactions energy: -155.259 where: short stacking energy: -65.336 Base-Backbone interact. energy: 0.385 local terms energy: -72.099292 where: bonds (distance) C4'-P energy: -15.825 bonds (distance) P-C4' energy: -15.556 flat angles C4'-P-C4' energy: -17.641 flat angles P-C4'-P energy: -6.691 tors. eta vs tors. theta energy: -16.386 Dist. restrs. and SS energy: 4.469 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 267 Temperature: 1.230300 Total energy: -219.525898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.525898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.043612 (E_RNA) where: Base-Base interactions energy: -152.838 where: short stacking energy: -63.010 Base-Backbone interact. energy: -0.095 local terms energy: -74.110633 where: bonds (distance) C4'-P energy: -10.305 bonds (distance) P-C4' energy: -17.528 flat angles C4'-P-C4' energy: -18.442 flat angles P-C4'-P energy: -11.647 tors. eta vs tors. theta energy: -16.189 Dist. restrs. and SS energy: 7.518 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 268 Temperature: 1.229850 Total energy: -241.186129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.186129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.210016 (E_RNA) where: Base-Base interactions energy: -168.292 where: short stacking energy: -73.038 Base-Backbone interact. energy: -0.239 local terms energy: -74.678436 where: bonds (distance) C4'-P energy: -15.001 bonds (distance) P-C4' energy: -11.266 flat angles C4'-P-C4' energy: -19.474 flat angles P-C4'-P energy: -7.927 tors. eta vs tors. theta energy: -21.010 Dist. restrs. and SS energy: 2.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 269 Temperature: 1.229400 Total energy: -233.311959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.311959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.951541 (E_RNA) where: Base-Base interactions energy: -157.507 where: short stacking energy: -69.637 Base-Backbone interact. energy: -0.064 local terms energy: -78.381043 where: bonds (distance) C4'-P energy: -15.623 bonds (distance) P-C4' energy: -16.897 flat angles C4'-P-C4' energy: -16.432 flat angles P-C4'-P energy: -12.713 tors. eta vs tors. theta energy: -16.716 Dist. restrs. and SS energy: 2.640 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 270 Temperature: 1.228950 Total energy: -249.798584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.798584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.294473 (E_RNA) where: Base-Base interactions energy: -166.107 where: short stacking energy: -73.187 Base-Backbone interact. energy: -0.230 local terms energy: -87.958055 where: bonds (distance) C4'-P energy: -18.041 bonds (distance) P-C4' energy: -20.337 flat angles C4'-P-C4' energy: -18.291 flat angles P-C4'-P energy: -13.208 tors. eta vs tors. theta energy: -18.082 Dist. restrs. and SS energy: 4.496 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 271 Temperature: 1.228500 Total energy: -229.412084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.412084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.022845 (E_RNA) where: Base-Base interactions energy: -165.130 where: short stacking energy: -71.795 Base-Backbone interact. energy: 1.579 local terms energy: -68.472043 where: bonds (distance) C4'-P energy: -15.081 bonds (distance) P-C4' energy: -16.629 flat angles C4'-P-C4' energy: -12.177 flat angles P-C4'-P energy: -10.283 tors. eta vs tors. theta energy: -14.302 Dist. restrs. and SS energy: 2.611 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 272 Temperature: 1.228050 Total energy: -234.864590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.864590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.428233 (E_RNA) where: Base-Base interactions energy: -166.569 where: short stacking energy: -73.701 Base-Backbone interact. energy: -0.076 local terms energy: -71.782586 where: bonds (distance) C4'-P energy: -15.267 bonds (distance) P-C4' energy: -8.166 flat angles C4'-P-C4' energy: -19.309 flat angles P-C4'-P energy: -11.952 tors. eta vs tors. theta energy: -17.088 Dist. restrs. and SS energy: 3.564 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 273 Temperature: 1.227600 Total energy: -229.895540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.895540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.829675 (E_RNA) where: Base-Base interactions energy: -152.054 where: short stacking energy: -60.743 Base-Backbone interact. energy: -0.626 local terms energy: -79.149108 where: bonds (distance) C4'-P energy: -18.371 bonds (distance) P-C4' energy: -19.804 flat angles C4'-P-C4' energy: -16.918 flat angles P-C4'-P energy: -12.351 tors. eta vs tors. theta energy: -11.705 Dist. restrs. and SS energy: 1.934 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 274 Temperature: 1.227150 Total energy: -234.503508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.503508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.258380 (E_RNA) where: Base-Base interactions energy: -156.498 where: short stacking energy: -67.740 Base-Backbone interact. energy: 2.376 local terms energy: -83.136219 where: bonds (distance) C4'-P energy: -17.560 bonds (distance) P-C4' energy: -16.769 flat angles C4'-P-C4' energy: -16.446 flat angles P-C4'-P energy: -15.108 tors. eta vs tors. theta energy: -17.253 Dist. restrs. and SS energy: 2.755 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 275 Temperature: 1.226700 Total energy: -227.785771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.785771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.870110 (E_RNA) where: Base-Base interactions energy: -142.062 where: short stacking energy: -64.885 Base-Backbone interact. energy: -0.849 local terms energy: -86.958859 where: bonds (distance) C4'-P energy: -13.571 bonds (distance) P-C4' energy: -22.395 flat angles C4'-P-C4' energy: -18.810 flat angles P-C4'-P energy: -17.664 tors. eta vs tors. theta energy: -14.519 Dist. restrs. and SS energy: 2.084 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 276 Temperature: 1.226250 Total energy: -216.992659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.992659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.377502 (E_RNA) where: Base-Base interactions energy: -159.373 where: short stacking energy: -66.413 Base-Backbone interact. energy: 0.558 local terms energy: -61.562091 where: bonds (distance) C4'-P energy: -12.981 bonds (distance) P-C4' energy: -9.860 flat angles C4'-P-C4' energy: -13.439 flat angles P-C4'-P energy: -10.121 tors. eta vs tors. theta energy: -15.161 Dist. restrs. and SS energy: 3.385 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 277 Temperature: 1.225800 Total energy: -229.744221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.744221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.067304 (E_RNA) where: Base-Base interactions energy: -156.899 where: short stacking energy: -72.670 Base-Backbone interact. energy: -1.367 local terms energy: -75.801091 where: bonds (distance) C4'-P energy: -13.160 bonds (distance) P-C4' energy: -16.440 flat angles C4'-P-C4' energy: -14.127 flat angles P-C4'-P energy: -13.377 tors. eta vs tors. theta energy: -18.697 Dist. restrs. and SS energy: 4.323 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 278 Temperature: 1.225350 Total energy: -226.604831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.604831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.256161 (E_RNA) where: Base-Base interactions energy: -157.541 where: short stacking energy: -77.289 Base-Backbone interact. energy: -0.126 local terms energy: -73.589558 where: bonds (distance) C4'-P energy: -13.950 bonds (distance) P-C4' energy: -17.936 flat angles C4'-P-C4' energy: -13.227 flat angles P-C4'-P energy: -8.391 tors. eta vs tors. theta energy: -20.086 Dist. restrs. and SS energy: 4.651 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 279 Temperature: 1.224900 Total energy: -237.875909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.875909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.255551 (E_RNA) where: Base-Base interactions energy: -157.082 where: short stacking energy: -76.513 Base-Backbone interact. energy: -0.992 local terms energy: -82.181596 where: bonds (distance) C4'-P energy: -17.076 bonds (distance) P-C4' energy: -14.414 flat angles C4'-P-C4' energy: -17.612 flat angles P-C4'-P energy: -12.375 tors. eta vs tors. theta energy: -20.705 Dist. restrs. and SS energy: 2.380 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 280 Temperature: 1.224450 Total energy: -223.163831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.163831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.315686 (E_RNA) where: Base-Base interactions energy: -152.571 where: short stacking energy: -62.543 Base-Backbone interact. energy: -1.381 local terms energy: -71.363852 where: bonds (distance) C4'-P energy: -11.442 bonds (distance) P-C4' energy: -17.021 flat angles C4'-P-C4' energy: -15.822 flat angles P-C4'-P energy: -9.065 tors. eta vs tors. theta energy: -18.014 Dist. restrs. and SS energy: 2.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 281 Temperature: 1.224000 Total energy: -226.890493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.890493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.142586 (E_RNA) where: Base-Base interactions energy: -150.115 where: short stacking energy: -69.325 Base-Backbone interact. energy: -0.822 local terms energy: -79.205389 where: bonds (distance) C4'-P energy: -15.856 bonds (distance) P-C4' energy: -15.016 flat angles C4'-P-C4' energy: -17.175 flat angles P-C4'-P energy: -17.255 tors. eta vs tors. theta energy: -13.904 Dist. restrs. and SS energy: 3.252 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 282 Temperature: 1.223550 Total energy: -246.261866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.261866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.170474 (E_RNA) where: Base-Base interactions energy: -156.187 where: short stacking energy: -77.103 Base-Backbone interact. energy: -0.106 local terms energy: -94.877522 where: bonds (distance) C4'-P energy: -19.699 bonds (distance) P-C4' energy: -21.144 flat angles C4'-P-C4' energy: -17.517 flat angles P-C4'-P energy: -12.991 tors. eta vs tors. theta energy: -23.526 Dist. restrs. and SS energy: 4.909 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 283 Temperature: 1.223100 Total energy: -226.727778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.727778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.906831 (E_RNA) where: Base-Base interactions energy: -160.811 where: short stacking energy: -73.184 Base-Backbone interact. energy: -1.877 local terms energy: -68.218665 where: bonds (distance) C4'-P energy: -8.525 bonds (distance) P-C4' energy: -10.461 flat angles C4'-P-C4' energy: -17.774 flat angles P-C4'-P energy: -12.605 tors. eta vs tors. theta energy: -18.854 Dist. restrs. and SS energy: 4.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 284 Temperature: 1.222650 Total energy: -230.443211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.443211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.072312 (E_RNA) where: Base-Base interactions energy: -158.512 where: short stacking energy: -72.957 Base-Backbone interact. energy: -1.316 local terms energy: -73.244637 where: bonds (distance) C4'-P energy: -13.383 bonds (distance) P-C4' energy: -14.700 flat angles C4'-P-C4' energy: -14.396 flat angles P-C4'-P energy: -12.907 tors. eta vs tors. theta energy: -17.858 Dist. restrs. and SS energy: 2.629 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 285 Temperature: 1.222200 Total energy: -226.523555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.523555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.035139 (E_RNA) where: Base-Base interactions energy: -154.338 where: short stacking energy: -69.753 Base-Backbone interact. energy: -0.972 local terms energy: -73.725713 where: bonds (distance) C4'-P energy: -10.423 bonds (distance) P-C4' energy: -19.271 flat angles C4'-P-C4' energy: -15.707 flat angles P-C4'-P energy: -8.769 tors. eta vs tors. theta energy: -19.556 Dist. restrs. and SS energy: 2.512 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 286 Temperature: 1.221750 Total energy: -224.340150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.340150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.941054 (E_RNA) where: Base-Base interactions energy: -150.173 where: short stacking energy: -72.036 Base-Backbone interact. energy: 0.320 local terms energy: -79.088565 where: bonds (distance) C4'-P energy: -16.491 bonds (distance) P-C4' energy: -15.325 flat angles C4'-P-C4' energy: -19.437 flat angles P-C4'-P energy: -9.297 tors. eta vs tors. theta energy: -18.538 Dist. restrs. and SS energy: 4.601 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 287 Temperature: 1.221300 Total energy: -227.954133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.954133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.180099 (E_RNA) where: Base-Base interactions energy: -150.105 where: short stacking energy: -59.608 Base-Backbone interact. energy: -0.246 local terms energy: -78.829960 where: bonds (distance) C4'-P energy: -10.372 bonds (distance) P-C4' energy: -20.523 flat angles C4'-P-C4' energy: -19.740 flat angles P-C4'-P energy: -13.383 tors. eta vs tors. theta energy: -14.812 Dist. restrs. and SS energy: 1.226 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 288 Temperature: 1.220850 Total energy: -222.830408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.830408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.214612 (E_RNA) where: Base-Base interactions energy: -149.859 where: short stacking energy: -70.125 Base-Backbone interact. energy: -0.504 local terms energy: -77.851069 where: bonds (distance) C4'-P energy: -16.931 bonds (distance) P-C4' energy: -17.752 flat angles C4'-P-C4' energy: -13.429 flat angles P-C4'-P energy: -14.897 tors. eta vs tors. theta energy: -14.842 Dist. restrs. and SS energy: 5.384 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 289 Temperature: 1.220400 Total energy: -214.380451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.380451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.639250 (E_RNA) where: Base-Base interactions energy: -154.189 where: short stacking energy: -80.483 Base-Backbone interact. energy: 0.932 local terms energy: -64.382249 where: bonds (distance) C4'-P energy: -9.370 bonds (distance) P-C4' energy: -19.312 flat angles C4'-P-C4' energy: -10.721 flat angles P-C4'-P energy: -9.363 tors. eta vs tors. theta energy: -15.615 Dist. restrs. and SS energy: 3.259 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 290 Temperature: 1.219950 Total energy: -212.434745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.434745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.128548 (E_RNA) where: Base-Base interactions energy: -142.339 where: short stacking energy: -66.321 Base-Backbone interact. energy: -1.180 local terms energy: -72.608772 where: bonds (distance) C4'-P energy: -10.339 bonds (distance) P-C4' energy: -15.374 flat angles C4'-P-C4' energy: -20.690 flat angles P-C4'-P energy: -10.699 tors. eta vs tors. theta energy: -15.507 Dist. restrs. and SS energy: 3.694 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 291 Temperature: 1.219500 Total energy: -223.906947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.906947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.331513 (E_RNA) where: Base-Base interactions energy: -159.015 where: short stacking energy: -72.791 Base-Backbone interact. energy: 1.196 local terms energy: -69.512387 where: bonds (distance) C4'-P energy: -15.693 bonds (distance) P-C4' energy: -12.535 flat angles C4'-P-C4' energy: -15.640 flat angles P-C4'-P energy: -6.247 tors. eta vs tors. theta energy: -19.396 Dist. restrs. and SS energy: 3.425 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 292 Temperature: 1.219050 Total energy: -228.729603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.729603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.639006 (E_RNA) where: Base-Base interactions energy: -157.154 where: short stacking energy: -65.147 Base-Backbone interact. energy: 1.592 local terms energy: -81.077140 where: bonds (distance) C4'-P energy: -15.072 bonds (distance) P-C4' energy: -19.640 flat angles C4'-P-C4' energy: -18.435 flat angles P-C4'-P energy: -13.271 tors. eta vs tors. theta energy: -14.658 Dist. restrs. and SS energy: 7.909 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 293 Temperature: 1.218600 Total energy: -211.832331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.832331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.301173 (E_RNA) where: Base-Base interactions energy: -140.435 where: short stacking energy: -57.381 Base-Backbone interact. energy: -0.094 local terms energy: -75.771588 where: bonds (distance) C4'-P energy: -14.997 bonds (distance) P-C4' energy: -18.399 flat angles C4'-P-C4' energy: -18.434 flat angles P-C4'-P energy: -11.108 tors. eta vs tors. theta energy: -12.833 Dist. restrs. and SS energy: 4.469 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 294 Temperature: 1.218150 Total energy: -228.232158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.232158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.843979 (E_RNA) where: Base-Base interactions energy: -156.219 where: short stacking energy: -67.712 Base-Backbone interact. energy: -2.255 local terms energy: -72.369926 where: bonds (distance) C4'-P energy: -20.872 bonds (distance) P-C4' energy: -14.998 flat angles C4'-P-C4' energy: -15.541 flat angles P-C4'-P energy: -6.337 tors. eta vs tors. theta energy: -14.622 Dist. restrs. and SS energy: 2.612 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 295 Temperature: 1.217700 Total energy: -225.904296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.904296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.656642 (E_RNA) where: Base-Base interactions energy: -164.868 where: short stacking energy: -69.566 Base-Backbone interact. energy: 3.467 local terms energy: -67.255360 where: bonds (distance) C4'-P energy: -13.429 bonds (distance) P-C4' energy: -16.936 flat angles C4'-P-C4' energy: -16.291 flat angles P-C4'-P energy: -2.845 tors. eta vs tors. theta energy: -17.755 Dist. restrs. and SS energy: 2.752 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 296 Temperature: 1.217250 Total energy: -228.805647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.805647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.026618 (E_RNA) where: Base-Base interactions energy: -162.829 where: short stacking energy: -71.560 Base-Backbone interact. energy: -0.819 local terms energy: -67.378862 where: bonds (distance) C4'-P energy: -10.936 bonds (distance) P-C4' energy: -22.867 flat angles C4'-P-C4' energy: -12.639 flat angles P-C4'-P energy: -3.203 tors. eta vs tors. theta energy: -17.734 Dist. restrs. and SS energy: 2.221 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 297 Temperature: 1.216800 Total energy: -187.924081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.924081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.815263 (E_RNA) where: Base-Base interactions energy: -126.620 where: short stacking energy: -69.043 Base-Backbone interact. energy: -0.057 local terms energy: -68.139090 where: bonds (distance) C4'-P energy: -12.838 bonds (distance) P-C4' energy: -18.809 flat angles C4'-P-C4' energy: -11.484 flat angles P-C4'-P energy: -11.612 tors. eta vs tors. theta energy: -13.396 Dist. restrs. and SS energy: 6.891 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 298 Temperature: 1.216350 Total energy: -217.738391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.738391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.863733 (E_RNA) where: Base-Base interactions energy: -148.466 where: short stacking energy: -65.812 Base-Backbone interact. energy: -0.172 local terms energy: -73.226230 where: bonds (distance) C4'-P energy: -17.062 bonds (distance) P-C4' energy: -16.488 flat angles C4'-P-C4' energy: -16.039 flat angles P-C4'-P energy: -8.132 tors. eta vs tors. theta energy: -15.506 Dist. restrs. and SS energy: 4.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 299 Temperature: 1.215900 Total energy: -233.599496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.599496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.266570 (E_RNA) where: Base-Base interactions energy: -170.723 where: short stacking energy: -81.595 Base-Backbone interact. energy: 3.480 local terms energy: -71.022945 where: bonds (distance) C4'-P energy: -14.551 bonds (distance) P-C4' energy: -20.005 flat angles C4'-P-C4' energy: -12.783 flat angles P-C4'-P energy: -7.073 tors. eta vs tors. theta energy: -16.611 Dist. restrs. and SS energy: 4.667 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 300 Temperature: 1.215450 Total energy: -217.802857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.802857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.780100 (E_RNA) where: Base-Base interactions energy: -150.896 where: short stacking energy: -67.833 Base-Backbone interact. energy: 1.021 local terms energy: -73.905666 where: bonds (distance) C4'-P energy: -17.037 bonds (distance) P-C4' energy: -17.369 flat angles C4'-P-C4' energy: -12.830 flat angles P-C4'-P energy: -10.913 tors. eta vs tors. theta energy: -15.756 Dist. restrs. and SS energy: 5.977 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 301 Temperature: 1.215000 Total energy: -215.402494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.402494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.154844 (E_RNA) where: Base-Base interactions energy: -135.801 where: short stacking energy: -65.523 Base-Backbone interact. energy: -0.259 local terms energy: -84.095208 where: bonds (distance) C4'-P energy: -18.757 bonds (distance) P-C4' energy: -19.778 flat angles C4'-P-C4' energy: -19.281 flat angles P-C4'-P energy: -10.895 tors. eta vs tors. theta energy: -15.385 Dist. restrs. and SS energy: 4.752 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 302 Temperature: 1.214550 Total energy: -213.480579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.480579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.516775 (E_RNA) where: Base-Base interactions energy: -148.484 where: short stacking energy: -58.752 Base-Backbone interact. energy: 0.877 local terms energy: -67.909582 where: bonds (distance) C4'-P energy: -13.883 bonds (distance) P-C4' energy: -15.645 flat angles C4'-P-C4' energy: -18.298 flat angles P-C4'-P energy: -4.013 tors. eta vs tors. theta energy: -16.070 Dist. restrs. and SS energy: 2.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 303 Temperature: 1.214100 Total energy: -207.955879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.955879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.253598 (E_RNA) where: Base-Base interactions energy: -130.183 where: short stacking energy: -60.648 Base-Backbone interact. energy: -0.798 local terms energy: -82.272480 where: bonds (distance) C4'-P energy: -17.328 bonds (distance) P-C4' energy: -16.518 flat angles C4'-P-C4' energy: -19.779 flat angles P-C4'-P energy: -15.107 tors. eta vs tors. theta energy: -13.539 Dist. restrs. and SS energy: 5.298 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 304 Temperature: 1.213650 Total energy: -216.328228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.328228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.324846 (E_RNA) where: Base-Base interactions energy: -156.741 where: short stacking energy: -70.510 Base-Backbone interact. energy: -0.054 local terms energy: -64.529705 where: bonds (distance) C4'-P energy: -11.529 bonds (distance) P-C4' energy: -13.619 flat angles C4'-P-C4' energy: -16.393 flat angles P-C4'-P energy: -7.782 tors. eta vs tors. theta energy: -15.207 Dist. restrs. and SS energy: 4.997 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 305 Temperature: 1.213200 Total energy: -213.739237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.739237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.462965 (E_RNA) where: Base-Base interactions energy: -141.458 where: short stacking energy: -61.050 Base-Backbone interact. energy: -0.042 local terms energy: -74.962945 where: bonds (distance) C4'-P energy: -17.092 bonds (distance) P-C4' energy: -18.549 flat angles C4'-P-C4' energy: -18.607 flat angles P-C4'-P energy: -6.207 tors. eta vs tors. theta energy: -14.507 Dist. restrs. and SS energy: 2.724 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 306 Temperature: 1.212750 Total energy: -195.784321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.784321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.599217 (E_RNA) where: Base-Base interactions energy: -137.976 where: short stacking energy: -65.295 Base-Backbone interact. energy: 0.963 local terms energy: -61.585830 where: bonds (distance) C4'-P energy: -17.815 bonds (distance) P-C4' energy: -15.577 flat angles C4'-P-C4' energy: -12.759 flat angles P-C4'-P energy: -4.067 tors. eta vs tors. theta energy: -11.369 Dist. restrs. and SS energy: 2.815 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 307 Temperature: 1.212300 Total energy: -197.182868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.182868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.504381 (E_RNA) where: Base-Base interactions energy: -139.368 where: short stacking energy: -60.249 Base-Backbone interact. energy: -0.408 local terms energy: -64.728390 where: bonds (distance) C4'-P energy: -12.212 bonds (distance) P-C4' energy: -19.165 flat angles C4'-P-C4' energy: -12.310 flat angles P-C4'-P energy: -5.558 tors. eta vs tors. theta energy: -15.484 Dist. restrs. and SS energy: 7.322 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 308 Temperature: 1.211850 Total energy: -223.213955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.213955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.100053 (E_RNA) where: Base-Base interactions energy: -153.586 where: short stacking energy: -73.125 Base-Backbone interact. energy: 0.745 local terms energy: -74.259355 where: bonds (distance) C4'-P energy: -12.675 bonds (distance) P-C4' energy: -17.945 flat angles C4'-P-C4' energy: -14.765 flat angles P-C4'-P energy: -12.074 tors. eta vs tors. theta energy: -16.800 Dist. restrs. and SS energy: 3.886 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 309 Temperature: 1.211400 Total energy: -212.852527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.852527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.489154 (E_RNA) where: Base-Base interactions energy: -143.399 where: short stacking energy: -61.388 Base-Backbone interact. energy: -0.098 local terms energy: -76.992541 where: bonds (distance) C4'-P energy: -14.162 bonds (distance) P-C4' energy: -19.918 flat angles C4'-P-C4' energy: -13.882 flat angles P-C4'-P energy: -11.885 tors. eta vs tors. theta energy: -17.146 Dist. restrs. and SS energy: 7.637 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 310 Temperature: 1.210950 Total energy: -215.616258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.616258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.187940 (E_RNA) where: Base-Base interactions energy: -139.754 where: short stacking energy: -67.422 Base-Backbone interact. energy: -0.584 local terms energy: -77.850427 where: bonds (distance) C4'-P energy: -18.649 bonds (distance) P-C4' energy: -16.979 flat angles C4'-P-C4' energy: -15.392 flat angles P-C4'-P energy: -10.930 tors. eta vs tors. theta energy: -15.900 Dist. restrs. and SS energy: 2.572 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 311 Temperature: 1.210500 Total energy: -203.357223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.357223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.961667 (E_RNA) where: Base-Base interactions energy: -134.709 where: short stacking energy: -60.118 Base-Backbone interact. energy: -0.135 local terms energy: -71.117899 where: bonds (distance) C4'-P energy: -15.059 bonds (distance) P-C4' energy: -18.137 flat angles C4'-P-C4' energy: -11.791 flat angles P-C4'-P energy: -10.503 tors. eta vs tors. theta energy: -15.628 Dist. restrs. and SS energy: 2.604 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 312 Temperature: 1.210050 Total energy: -194.326975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.326975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.342812 (E_RNA) where: Base-Base interactions energy: -132.329 where: short stacking energy: -52.039 Base-Backbone interact. energy: -1.049 local terms energy: -65.965021 where: bonds (distance) C4'-P energy: -12.756 bonds (distance) P-C4' energy: -17.695 flat angles C4'-P-C4' energy: -17.816 flat angles P-C4'-P energy: -5.548 tors. eta vs tors. theta energy: -12.149 Dist. restrs. and SS energy: 5.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 313 Temperature: 1.209600 Total energy: -213.306626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.306626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.730275 (E_RNA) where: Base-Base interactions energy: -137.396 where: short stacking energy: -66.003 Base-Backbone interact. energy: -0.044 local terms energy: -81.290479 where: bonds (distance) C4'-P energy: -16.489 bonds (distance) P-C4' energy: -20.815 flat angles C4'-P-C4' energy: -13.369 flat angles P-C4'-P energy: -10.438 tors. eta vs tors. theta energy: -20.180 Dist. restrs. and SS energy: 5.424 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 314 Temperature: 1.209150 Total energy: -222.083481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.083481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.771079 (E_RNA) where: Base-Base interactions energy: -147.742 where: short stacking energy: -62.674 Base-Backbone interact. energy: 0.752 local terms energy: -79.781377 where: bonds (distance) C4'-P energy: -17.233 bonds (distance) P-C4' energy: -19.082 flat angles C4'-P-C4' energy: -20.603 flat angles P-C4'-P energy: -8.994 tors. eta vs tors. theta energy: -13.868 Dist. restrs. and SS energy: 4.688 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 315 Temperature: 1.208700 Total energy: -224.511195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.511195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.853409 (E_RNA) where: Base-Base interactions energy: -164.139 where: short stacking energy: -76.119 Base-Backbone interact. energy: -0.761 local terms energy: -62.952924 where: bonds (distance) C4'-P energy: -9.780 bonds (distance) P-C4' energy: -6.824 flat angles C4'-P-C4' energy: -13.608 flat angles P-C4'-P energy: -8.890 tors. eta vs tors. theta energy: -23.851 Dist. restrs. and SS energy: 3.342 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 316 Temperature: 1.208250 Total energy: -219.221458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.221458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.677165 (E_RNA) where: Base-Base interactions energy: -160.751 where: short stacking energy: -68.569 Base-Backbone interact. energy: 2.204 local terms energy: -65.129780 where: bonds (distance) C4'-P energy: -11.507 bonds (distance) P-C4' energy: -14.618 flat angles C4'-P-C4' energy: -12.385 flat angles P-C4'-P energy: -9.515 tors. eta vs tors. theta energy: -17.105 Dist. restrs. and SS energy: 4.456 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 317 Temperature: 1.207800 Total energy: -225.837274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.837274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.160577 (E_RNA) where: Base-Base interactions energy: -149.167 where: short stacking energy: -72.497 Base-Backbone interact. energy: -2.724 local terms energy: -81.269290 where: bonds (distance) C4'-P energy: -18.723 bonds (distance) P-C4' energy: -20.627 flat angles C4'-P-C4' energy: -16.510 flat angles P-C4'-P energy: -9.661 tors. eta vs tors. theta energy: -15.749 Dist. restrs. and SS energy: 7.323 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 318 Temperature: 1.207350 Total energy: -232.087960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.087960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.070868 (E_RNA) where: Base-Base interactions energy: -161.887 where: short stacking energy: -73.293 Base-Backbone interact. energy: -1.107 local terms energy: -75.076823 where: bonds (distance) C4'-P energy: -10.617 bonds (distance) P-C4' energy: -17.446 flat angles C4'-P-C4' energy: -16.894 flat angles P-C4'-P energy: -11.195 tors. eta vs tors. theta energy: -18.926 Dist. restrs. and SS energy: 5.983 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 319 Temperature: 1.206900 Total energy: -216.553174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.553174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.259778 (E_RNA) where: Base-Base interactions energy: -155.618 where: short stacking energy: -63.128 Base-Backbone interact. energy: -0.799 local terms energy: -63.843593 where: bonds (distance) C4'-P energy: -17.176 bonds (distance) P-C4' energy: -10.891 flat angles C4'-P-C4' energy: -12.126 flat angles P-C4'-P energy: -9.633 tors. eta vs tors. theta energy: -14.016 Dist. restrs. and SS energy: 3.707 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 320 Temperature: 1.206450 Total energy: -213.511781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.511781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.412375 (E_RNA) where: Base-Base interactions energy: -149.033 where: short stacking energy: -70.530 Base-Backbone interact. energy: -0.475 local terms energy: -72.904287 where: bonds (distance) C4'-P energy: -12.182 bonds (distance) P-C4' energy: -15.698 flat angles C4'-P-C4' energy: -16.523 flat angles P-C4'-P energy: -11.031 tors. eta vs tors. theta energy: -17.471 Dist. restrs. and SS energy: 8.901 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 321 Temperature: 1.206000 Total energy: -212.971269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.971269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.835337 (E_RNA) where: Base-Base interactions energy: -149.675 where: short stacking energy: -73.669 Base-Backbone interact. energy: -0.489 local terms energy: -71.671037 where: bonds (distance) C4'-P energy: -16.335 bonds (distance) P-C4' energy: -16.688 flat angles C4'-P-C4' energy: -17.546 flat angles P-C4'-P energy: -7.375 tors. eta vs tors. theta energy: -13.727 Dist. restrs. and SS energy: 8.864 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 322 Temperature: 1.205550 Total energy: -224.377773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.377773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.894559 (E_RNA) where: Base-Base interactions energy: -155.621 where: short stacking energy: -68.834 Base-Backbone interact. energy: -0.427 local terms energy: -71.846191 where: bonds (distance) C4'-P energy: -12.397 bonds (distance) P-C4' energy: -17.622 flat angles C4'-P-C4' energy: -13.320 flat angles P-C4'-P energy: -11.175 tors. eta vs tors. theta energy: -17.332 Dist. restrs. and SS energy: 3.517 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 323 Temperature: 1.205100 Total energy: -215.859421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.859421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.883869 (E_RNA) where: Base-Base interactions energy: -143.953 where: short stacking energy: -63.706 Base-Backbone interact. energy: -0.139 local terms energy: -75.791719 where: bonds (distance) C4'-P energy: -15.511 bonds (distance) P-C4' energy: -22.303 flat angles C4'-P-C4' energy: -15.760 flat angles P-C4'-P energy: -5.607 tors. eta vs tors. theta energy: -16.611 Dist. restrs. and SS energy: 4.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 324 Temperature: 1.204650 Total energy: -224.657509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.657509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.324763 (E_RNA) where: Base-Base interactions energy: -157.014 where: short stacking energy: -73.643 Base-Backbone interact. energy: 2.236 local terms energy: -74.546370 where: bonds (distance) C4'-P energy: -19.982 bonds (distance) P-C4' energy: -5.267 flat angles C4'-P-C4' energy: -21.960 flat angles P-C4'-P energy: -10.287 tors. eta vs tors. theta energy: -17.050 Dist. restrs. and SS energy: 4.667 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 325 Temperature: 1.204200 Total energy: -232.253436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.253436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.212453 (E_RNA) where: Base-Base interactions energy: -162.273 where: short stacking energy: -73.764 Base-Backbone interact. energy: -0.329 local terms energy: -74.610223 where: bonds (distance) C4'-P energy: -13.359 bonds (distance) P-C4' energy: -18.713 flat angles C4'-P-C4' energy: -17.709 flat angles P-C4'-P energy: -8.063 tors. eta vs tors. theta energy: -16.766 Dist. restrs. and SS energy: 4.959 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 326 Temperature: 1.203750 Total energy: -229.211438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.211438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.090989 (E_RNA) where: Base-Base interactions energy: -164.766 where: short stacking energy: -82.998 Base-Backbone interact. energy: -0.166 local terms energy: -71.158889 where: bonds (distance) C4'-P energy: -13.030 bonds (distance) P-C4' energy: -19.800 flat angles C4'-P-C4' energy: -17.259 flat angles P-C4'-P energy: -4.326 tors. eta vs tors. theta energy: -16.743 Dist. restrs. and SS energy: 6.880 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 327 Temperature: 1.203300 Total energy: -229.067893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.067893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.882687 (E_RNA) where: Base-Base interactions energy: -154.423 where: short stacking energy: -74.485 Base-Backbone interact. energy: -0.403 local terms energy: -80.056170 where: bonds (distance) C4'-P energy: -17.044 bonds (distance) P-C4' energy: -19.400 flat angles C4'-P-C4' energy: -20.734 flat angles P-C4'-P energy: -4.475 tors. eta vs tors. theta energy: -18.404 Dist. restrs. and SS energy: 5.815 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 328 Temperature: 1.202850 Total energy: -226.529496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.529496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.699200 (E_RNA) where: Base-Base interactions energy: -155.342 where: short stacking energy: -65.509 Base-Backbone interact. energy: -0.279 local terms energy: -79.078034 where: bonds (distance) C4'-P energy: -19.141 bonds (distance) P-C4' energy: -15.678 flat angles C4'-P-C4' energy: -15.572 flat angles P-C4'-P energy: -10.598 tors. eta vs tors. theta energy: -18.088 Dist. restrs. and SS energy: 8.170 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 329 Temperature: 1.202400 Total energy: -224.075777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.075777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.993931 (E_RNA) where: Base-Base interactions energy: -146.857 where: short stacking energy: -56.580 Base-Backbone interact. energy: -1.973 local terms energy: -81.163975 where: bonds (distance) C4'-P energy: -20.543 bonds (distance) P-C4' energy: -17.542 flat angles C4'-P-C4' energy: -18.476 flat angles P-C4'-P energy: -11.677 tors. eta vs tors. theta energy: -12.925 Dist. restrs. and SS energy: 5.918 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 330 Temperature: 1.201950 Total energy: -233.127794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.127794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.737112 (E_RNA) where: Base-Base interactions energy: -164.838 where: short stacking energy: -63.626 Base-Backbone interact. energy: -1.608 local terms energy: -69.291255 where: bonds (distance) C4'-P energy: -18.066 bonds (distance) P-C4' energy: -19.791 flat angles C4'-P-C4' energy: -10.158 flat angles P-C4'-P energy: -9.896 tors. eta vs tors. theta energy: -11.380 Dist. restrs. and SS energy: 2.609 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 331 Temperature: 1.201500 Total energy: -220.780332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.780332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.393664 (E_RNA) where: Base-Base interactions energy: -148.480 where: short stacking energy: -64.732 Base-Backbone interact. energy: 1.617 local terms energy: -77.530511 where: bonds (distance) C4'-P energy: -14.100 bonds (distance) P-C4' energy: -17.305 flat angles C4'-P-C4' energy: -19.071 flat angles P-C4'-P energy: -11.167 tors. eta vs tors. theta energy: -15.887 Dist. restrs. and SS energy: 3.613 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 332 Temperature: 1.201050 Total energy: -224.044242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.044242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.588732 (E_RNA) where: Base-Base interactions energy: -152.229 where: short stacking energy: -63.220 Base-Backbone interact. energy: -0.910 local terms energy: -75.450442 where: bonds (distance) C4'-P energy: -13.814 bonds (distance) P-C4' energy: -17.735 flat angles C4'-P-C4' energy: -19.077 flat angles P-C4'-P energy: -11.317 tors. eta vs tors. theta energy: -13.508 Dist. restrs. and SS energy: 4.544 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 333 Temperature: 1.200600 Total energy: -224.973514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.973514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.207806 (E_RNA) where: Base-Base interactions energy: -157.749 where: short stacking energy: -68.112 Base-Backbone interact. energy: -1.827 local terms energy: -68.631545 where: bonds (distance) C4'-P energy: -15.445 bonds (distance) P-C4' energy: -11.602 flat angles C4'-P-C4' energy: -17.803 flat angles P-C4'-P energy: -6.895 tors. eta vs tors. theta energy: -16.887 Dist. restrs. and SS energy: 3.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 334 Temperature: 1.200150 Total energy: -226.965870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.965870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.688573 (E_RNA) where: Base-Base interactions energy: -154.479 where: short stacking energy: -79.223 Base-Backbone interact. energy: 1.614 local terms energy: -80.823749 where: bonds (distance) C4'-P energy: -10.111 bonds (distance) P-C4' energy: -19.118 flat angles C4'-P-C4' energy: -18.372 flat angles P-C4'-P energy: -11.303 tors. eta vs tors. theta energy: -21.920 Dist. restrs. and SS energy: 6.723 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 335 Temperature: 1.199700 Total energy: -224.807105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.807105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.784363 (E_RNA) where: Base-Base interactions energy: -159.896 where: short stacking energy: -72.569 Base-Backbone interact. energy: -0.827 local terms energy: -69.061001 where: bonds (distance) C4'-P energy: -18.748 bonds (distance) P-C4' energy: -11.838 flat angles C4'-P-C4' energy: -15.667 flat angles P-C4'-P energy: -5.925 tors. eta vs tors. theta energy: -16.883 Dist. restrs. and SS energy: 4.977 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 336 Temperature: 1.199250 Total energy: -216.943747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.943747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.517504 (E_RNA) where: Base-Base interactions energy: -146.789 where: short stacking energy: -62.457 Base-Backbone interact. energy: -0.274 local terms energy: -76.454115 where: bonds (distance) C4'-P energy: -15.495 bonds (distance) P-C4' energy: -17.988 flat angles C4'-P-C4' energy: -16.518 flat angles P-C4'-P energy: -12.129 tors. eta vs tors. theta energy: -14.323 Dist. restrs. and SS energy: 6.574 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 337 Temperature: 1.198800 Total energy: -225.981831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.981831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.008269 (E_RNA) where: Base-Base interactions energy: -157.889 where: short stacking energy: -70.061 Base-Backbone interact. energy: -1.037 local terms energy: -70.081947 where: bonds (distance) C4'-P energy: -13.420 bonds (distance) P-C4' energy: -12.122 flat angles C4'-P-C4' energy: -15.708 flat angles P-C4'-P energy: -13.242 tors. eta vs tors. theta energy: -15.589 Dist. restrs. and SS energy: 3.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 338 Temperature: 1.198350 Total energy: -224.513270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.513270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.339809 (E_RNA) where: Base-Base interactions energy: -159.909 where: short stacking energy: -69.076 Base-Backbone interact. energy: -0.441 local terms energy: -66.989052 where: bonds (distance) C4'-P energy: -10.476 bonds (distance) P-C4' energy: -19.240 flat angles C4'-P-C4' energy: -11.661 flat angles P-C4'-P energy: -11.251 tors. eta vs tors. theta energy: -14.360 Dist. restrs. and SS energy: 2.827 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 339 Temperature: 1.197900 Total energy: -229.823992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.823992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.138326 (E_RNA) where: Base-Base interactions energy: -154.161 where: short stacking energy: -73.302 Base-Backbone interact. energy: -0.343 local terms energy: -79.634552 where: bonds (distance) C4'-P energy: -16.446 bonds (distance) P-C4' energy: -17.920 flat angles C4'-P-C4' energy: -15.662 flat angles P-C4'-P energy: -10.840 tors. eta vs tors. theta energy: -18.766 Dist. restrs. and SS energy: 4.314 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 340 Temperature: 1.197450 Total energy: -225.449286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.449286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.276223 (E_RNA) where: Base-Base interactions energy: -144.980 where: short stacking energy: -68.892 Base-Backbone interact. energy: -0.505 local terms energy: -82.790892 where: bonds (distance) C4'-P energy: -15.776 bonds (distance) P-C4' energy: -18.168 flat angles C4'-P-C4' energy: -15.751 flat angles P-C4'-P energy: -13.482 tors. eta vs tors. theta energy: -19.614 Dist. restrs. and SS energy: 2.827 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 341 Temperature: 1.197000 Total energy: -238.908523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.908523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.543886 (E_RNA) where: Base-Base interactions energy: -158.586 where: short stacking energy: -77.357 Base-Backbone interact. energy: -0.908 local terms energy: -83.050522 where: bonds (distance) C4'-P energy: -15.488 bonds (distance) P-C4' energy: -21.193 flat angles C4'-P-C4' energy: -17.691 flat angles P-C4'-P energy: -11.655 tors. eta vs tors. theta energy: -17.024 Dist. restrs. and SS energy: 3.635 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 342 Temperature: 1.196550 Total energy: -234.895171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.895171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.115797 (E_RNA) where: Base-Base interactions energy: -155.268 where: short stacking energy: -74.464 Base-Backbone interact. energy: -0.349 local terms energy: -82.498882 where: bonds (distance) C4'-P energy: -18.687 bonds (distance) P-C4' energy: -18.640 flat angles C4'-P-C4' energy: -15.561 flat angles P-C4'-P energy: -12.179 tors. eta vs tors. theta energy: -17.431 Dist. restrs. and SS energy: 3.221 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 343 Temperature: 1.196100 Total energy: -235.902305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.902305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.196002 (E_RNA) where: Base-Base interactions energy: -153.625 where: short stacking energy: -72.606 Base-Backbone interact. energy: -0.855 local terms energy: -84.716687 where: bonds (distance) C4'-P energy: -16.961 bonds (distance) P-C4' energy: -13.979 flat angles C4'-P-C4' energy: -16.606 flat angles P-C4'-P energy: -13.840 tors. eta vs tors. theta energy: -23.331 Dist. restrs. and SS energy: 3.294 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 344 Temperature: 1.195650 Total energy: -238.677908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.677908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.824699 (E_RNA) where: Base-Base interactions energy: -157.922 where: short stacking energy: -75.290 Base-Backbone interact. energy: -1.252 local terms energy: -85.650955 where: bonds (distance) C4'-P energy: -19.858 bonds (distance) P-C4' energy: -17.713 flat angles C4'-P-C4' energy: -17.776 flat angles P-C4'-P energy: -10.437 tors. eta vs tors. theta energy: -19.866 Dist. restrs. and SS energy: 6.147 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 345 Temperature: 1.195200 Total energy: -224.265028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.265028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.413307 (E_RNA) where: Base-Base interactions energy: -145.726 where: short stacking energy: -62.694 Base-Backbone interact. energy: -0.454 local terms energy: -83.233133 where: bonds (distance) C4'-P energy: -17.868 bonds (distance) P-C4' energy: -20.000 flat angles C4'-P-C4' energy: -15.727 flat angles P-C4'-P energy: -11.029 tors. eta vs tors. theta energy: -18.609 Dist. restrs. and SS energy: 5.148 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 346 Temperature: 1.194750 Total energy: -232.759081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.759081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.903154 (E_RNA) where: Base-Base interactions energy: -154.746 where: short stacking energy: -66.681 Base-Backbone interact. energy: -0.910 local terms energy: -82.246872 where: bonds (distance) C4'-P energy: -18.695 bonds (distance) P-C4' energy: -17.518 flat angles C4'-P-C4' energy: -18.946 flat angles P-C4'-P energy: -12.557 tors. eta vs tors. theta energy: -14.531 Dist. restrs. and SS energy: 5.144 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 347 Temperature: 1.194300 Total energy: -226.817594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.817594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.816663 (E_RNA) where: Base-Base interactions energy: -157.656 where: short stacking energy: -75.188 Base-Backbone interact. energy: -0.300 local terms energy: -72.861042 where: bonds (distance) C4'-P energy: -14.887 bonds (distance) P-C4' energy: -13.415 flat angles C4'-P-C4' energy: -17.273 flat angles P-C4'-P energy: -11.782 tors. eta vs tors. theta energy: -15.503 Dist. restrs. and SS energy: 3.999 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 348 Temperature: 1.193850 Total energy: -228.085131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.085131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.748890 (E_RNA) where: Base-Base interactions energy: -156.109 where: short stacking energy: -70.105 Base-Backbone interact. energy: 0.134 local terms energy: -77.773876 where: bonds (distance) C4'-P energy: -15.939 bonds (distance) P-C4' energy: -15.272 flat angles C4'-P-C4' energy: -19.404 flat angles P-C4'-P energy: -10.595 tors. eta vs tors. theta energy: -16.564 Dist. restrs. and SS energy: 5.664 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 349 Temperature: 1.193400 Total energy: -231.213840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.213840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.539362 (E_RNA) where: Base-Base interactions energy: -159.032 where: short stacking energy: -70.691 Base-Backbone interact. energy: -1.325 local terms energy: -75.182522 where: bonds (distance) C4'-P energy: -18.110 bonds (distance) P-C4' energy: -13.856 flat angles C4'-P-C4' energy: -11.600 flat angles P-C4'-P energy: -16.941 tors. eta vs tors. theta energy: -14.676 Dist. restrs. and SS energy: 4.326 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 350 Temperature: 1.192950 Total energy: -228.879095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.879095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.340745 (E_RNA) where: Base-Base interactions energy: -152.404 where: short stacking energy: -69.389 Base-Backbone interact. energy: -0.104 local terms energy: -81.832443 where: bonds (distance) C4'-P energy: -15.225 bonds (distance) P-C4' energy: -18.328 flat angles C4'-P-C4' energy: -19.683 flat angles P-C4'-P energy: -13.014 tors. eta vs tors. theta energy: -15.582 Dist. restrs. and SS energy: 5.462 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 351 Temperature: 1.192500 Total energy: -230.182305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.182305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.534952 (E_RNA) where: Base-Base interactions energy: -163.678 where: short stacking energy: -73.768 Base-Backbone interact. energy: -0.826 local terms energy: -68.031312 where: bonds (distance) C4'-P energy: -15.229 bonds (distance) P-C4' energy: -5.483 flat angles C4'-P-C4' energy: -19.544 flat angles P-C4'-P energy: -12.185 tors. eta vs tors. theta energy: -15.590 Dist. restrs. and SS energy: 2.353 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 352 Temperature: 1.192050 Total energy: -220.336618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.336618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.530644 (E_RNA) where: Base-Base interactions energy: -149.065 where: short stacking energy: -67.603 Base-Backbone interact. energy: -0.430 local terms energy: -73.035742 where: bonds (distance) C4'-P energy: -15.586 bonds (distance) P-C4' energy: -14.305 flat angles C4'-P-C4' energy: -14.301 flat angles P-C4'-P energy: -11.114 tors. eta vs tors. theta energy: -17.730 Dist. restrs. and SS energy: 2.194 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 353 Temperature: 1.191600 Total energy: -235.990170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.990170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.693688 (E_RNA) where: Base-Base interactions energy: -154.711 where: short stacking energy: -70.304 Base-Backbone interact. energy: -0.546 local terms energy: -83.436664 where: bonds (distance) C4'-P energy: -16.431 bonds (distance) P-C4' energy: -15.292 flat angles C4'-P-C4' energy: -18.311 flat angles P-C4'-P energy: -14.656 tors. eta vs tors. theta energy: -18.746 Dist. restrs. and SS energy: 2.704 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 354 Temperature: 1.191150 Total energy: -246.101401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.101401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.827221 (E_RNA) where: Base-Base interactions energy: -168.021 where: short stacking energy: -69.761 Base-Backbone interact. energy: -0.057 local terms energy: -80.749440 where: bonds (distance) C4'-P energy: -19.359 bonds (distance) P-C4' energy: -16.845 flat angles C4'-P-C4' energy: -20.379 flat angles P-C4'-P energy: -7.086 tors. eta vs tors. theta energy: -17.080 Dist. restrs. and SS energy: 2.726 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 355 Temperature: 1.190700 Total energy: -227.383693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.383693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.463800 (E_RNA) where: Base-Base interactions energy: -156.770 where: short stacking energy: -71.391 Base-Backbone interact. energy: -1.246 local terms energy: -71.447717 where: bonds (distance) C4'-P energy: -14.091 bonds (distance) P-C4' energy: -17.686 flat angles C4'-P-C4' energy: -13.624 flat angles P-C4'-P energy: -7.535 tors. eta vs tors. theta energy: -18.512 Dist. restrs. and SS energy: 2.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 356 Temperature: 1.190250 Total energy: -237.645742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.645742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.044669 (E_RNA) where: Base-Base interactions energy: -156.293 where: short stacking energy: -73.864 Base-Backbone interact. energy: -0.611 local terms energy: -85.141243 where: bonds (distance) C4'-P energy: -9.958 bonds (distance) P-C4' energy: -19.326 flat angles C4'-P-C4' energy: -16.547 flat angles P-C4'-P energy: -16.416 tors. eta vs tors. theta energy: -22.893 Dist. restrs. and SS energy: 4.399 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 357 Temperature: 1.189800 Total energy: -252.717630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.717630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.253191 (E_RNA) where: Base-Base interactions energy: -165.945 where: short stacking energy: -72.261 Base-Backbone interact. energy: -0.012 local terms energy: -90.296521 where: bonds (distance) C4'-P energy: -20.865 bonds (distance) P-C4' energy: -19.769 flat angles C4'-P-C4' energy: -18.248 flat angles P-C4'-P energy: -12.227 tors. eta vs tors. theta energy: -19.188 Dist. restrs. and SS energy: 3.536 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 358 Temperature: 1.189350 Total energy: -249.917835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.917835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.205185 (E_RNA) where: Base-Base interactions energy: -168.142 where: short stacking energy: -73.821 Base-Backbone interact. energy: 0.279 local terms energy: -84.341804 where: bonds (distance) C4'-P energy: -14.277 bonds (distance) P-C4' energy: -19.675 flat angles C4'-P-C4' energy: -20.265 flat angles P-C4'-P energy: -12.209 tors. eta vs tors. theta energy: -17.916 Dist. restrs. and SS energy: 2.287 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 359 Temperature: 1.188900 Total energy: -243.158765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.158765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.932544 (E_RNA) where: Base-Base interactions energy: -164.023 where: short stacking energy: -79.723 Base-Backbone interact. energy: -0.426 local terms energy: -81.484187 where: bonds (distance) C4'-P energy: -17.383 bonds (distance) P-C4' energy: -17.584 flat angles C4'-P-C4' energy: -19.755 flat angles P-C4'-P energy: -6.215 tors. eta vs tors. theta energy: -20.548 Dist. restrs. and SS energy: 2.774 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 360 Temperature: 1.188450 Total energy: -238.506238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.506238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.539001 (E_RNA) where: Base-Base interactions energy: -153.402 where: short stacking energy: -73.265 Base-Backbone interact. energy: -0.076 local terms energy: -87.061357 where: bonds (distance) C4'-P energy: -16.948 bonds (distance) P-C4' energy: -17.967 flat angles C4'-P-C4' energy: -17.153 flat angles P-C4'-P energy: -11.927 tors. eta vs tors. theta energy: -23.067 Dist. restrs. and SS energy: 2.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 361 Temperature: 1.188000 Total energy: -237.927844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.927844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.819319 (E_RNA) where: Base-Base interactions energy: -157.066 where: short stacking energy: -71.973 Base-Backbone interact. energy: -0.007 local terms energy: -83.745827 where: bonds (distance) C4'-P energy: -20.602 bonds (distance) P-C4' energy: -12.201 flat angles C4'-P-C4' energy: -17.506 flat angles P-C4'-P energy: -11.945 tors. eta vs tors. theta energy: -21.492 Dist. restrs. and SS energy: 2.891 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 362 Temperature: 1.187550 Total energy: -222.250001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.250001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.600634 (E_RNA) where: Base-Base interactions energy: -151.666 where: short stacking energy: -68.131 Base-Backbone interact. energy: 2.493 local terms energy: -75.427520 where: bonds (distance) C4'-P energy: -14.153 bonds (distance) P-C4' energy: -12.021 flat angles C4'-P-C4' energy: -16.289 flat angles P-C4'-P energy: -14.862 tors. eta vs tors. theta energy: -18.102 Dist. restrs. and SS energy: 2.351 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 363 Temperature: 1.187100 Total energy: -259.075422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.075422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.323598 (E_RNA) where: Base-Base interactions energy: -180.259 where: short stacking energy: -85.900 Base-Backbone interact. energy: -0.078 local terms energy: -80.986793 where: bonds (distance) C4'-P energy: -16.994 bonds (distance) P-C4' energy: -11.854 flat angles C4'-P-C4' energy: -18.655 flat angles P-C4'-P energy: -8.105 tors. eta vs tors. theta energy: -25.379 Dist. restrs. and SS energy: 2.248 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 364 Temperature: 1.186650 Total energy: -241.439458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.439458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.329805 (E_RNA) where: Base-Base interactions energy: -150.491 where: short stacking energy: -63.132 Base-Backbone interact. energy: -0.001 local terms energy: -92.837730 where: bonds (distance) C4'-P energy: -20.363 bonds (distance) P-C4' energy: -21.678 flat angles C4'-P-C4' energy: -14.971 flat angles P-C4'-P energy: -12.933 tors. eta vs tors. theta energy: -22.892 Dist. restrs. and SS energy: 1.890 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 365 Temperature: 1.186200 Total energy: -254.180045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.180045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.551157 (E_RNA) where: Base-Base interactions energy: -175.872 where: short stacking energy: -81.320 Base-Backbone interact. energy: -0.985 local terms energy: -79.694442 where: bonds (distance) C4'-P energy: -14.637 bonds (distance) P-C4' energy: -11.177 flat angles C4'-P-C4' energy: -20.987 flat angles P-C4'-P energy: -8.878 tors. eta vs tors. theta energy: -24.015 Dist. restrs. and SS energy: 2.371 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 366 Temperature: 1.185750 Total energy: -243.138520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.138520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.214892 (E_RNA) where: Base-Base interactions energy: -173.316 where: short stacking energy: -90.616 Base-Backbone interact. energy: -0.182 local terms energy: -71.717558 where: bonds (distance) C4'-P energy: -13.968 bonds (distance) P-C4' energy: -14.665 flat angles C4'-P-C4' energy: -11.897 flat angles P-C4'-P energy: -7.570 tors. eta vs tors. theta energy: -23.617 Dist. restrs. and SS energy: 2.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 367 Temperature: 1.185300 Total energy: -261.456653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.456653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.523424 (E_RNA) where: Base-Base interactions energy: -171.630 where: short stacking energy: -79.789 Base-Backbone interact. energy: -0.301 local terms energy: -91.591816 where: bonds (distance) C4'-P energy: -13.953 bonds (distance) P-C4' energy: -17.103 flat angles C4'-P-C4' energy: -23.263 flat angles P-C4'-P energy: -15.511 tors. eta vs tors. theta energy: -21.761 Dist. restrs. and SS energy: 2.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 368 Temperature: 1.184850 Total energy: -228.485960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.485960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.184697 (E_RNA) where: Base-Base interactions energy: -157.915 where: short stacking energy: -78.895 Base-Backbone interact. energy: -0.596 local terms energy: -74.673465 where: bonds (distance) C4'-P energy: -13.569 bonds (distance) P-C4' energy: -12.730 flat angles C4'-P-C4' energy: -16.013 flat angles P-C4'-P energy: -13.712 tors. eta vs tors. theta energy: -18.650 Dist. restrs. and SS energy: 4.699 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 369 Temperature: 1.184400 Total energy: -240.455413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.455413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.611345 (E_RNA) where: Base-Base interactions energy: -166.723 where: short stacking energy: -70.119 Base-Backbone interact. energy: -0.111 local terms energy: -75.777115 where: bonds (distance) C4'-P energy: -11.193 bonds (distance) P-C4' energy: -15.068 flat angles C4'-P-C4' energy: -20.090 flat angles P-C4'-P energy: -13.848 tors. eta vs tors. theta energy: -15.579 Dist. restrs. and SS energy: 2.156 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 370 Temperature: 1.183950 Total energy: -250.028801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.028801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.428340 (E_RNA) where: Base-Base interactions energy: -164.917 where: short stacking energy: -61.603 Base-Backbone interact. energy: -1.115 local terms energy: -86.396268 where: bonds (distance) C4'-P energy: -14.502 bonds (distance) P-C4' energy: -20.414 flat angles C4'-P-C4' energy: -19.189 flat angles P-C4'-P energy: -15.086 tors. eta vs tors. theta energy: -17.204 Dist. restrs. and SS energy: 2.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 371 Temperature: 1.183500 Total energy: -235.408972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.408972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.546443 (E_RNA) where: Base-Base interactions energy: -159.808 where: short stacking energy: -67.982 Base-Backbone interact. energy: -0.675 local terms energy: -78.063672 where: bonds (distance) C4'-P energy: -18.802 bonds (distance) P-C4' energy: -8.205 flat angles C4'-P-C4' energy: -17.472 flat angles P-C4'-P energy: -13.724 tors. eta vs tors. theta energy: -19.862 Dist. restrs. and SS energy: 3.137 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 372 Temperature: 1.183050 Total energy: -244.545156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.545156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.109669 (E_RNA) where: Base-Base interactions energy: -170.821 where: short stacking energy: -77.609 Base-Backbone interact. energy: -0.115 local terms energy: -75.173812 where: bonds (distance) C4'-P energy: -11.103 bonds (distance) P-C4' energy: -17.898 flat angles C4'-P-C4' energy: -17.197 flat angles P-C4'-P energy: -10.492 tors. eta vs tors. theta energy: -18.483 Dist. restrs. and SS energy: 1.565 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 373 Temperature: 1.182600 Total energy: -231.025816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.025816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.545946 (E_RNA) where: Base-Base interactions energy: -148.296 where: short stacking energy: -63.310 Base-Backbone interact. energy: -0.446 local terms energy: -84.804014 where: bonds (distance) C4'-P energy: -19.741 bonds (distance) P-C4' energy: -20.217 flat angles C4'-P-C4' energy: -16.678 flat angles P-C4'-P energy: -9.526 tors. eta vs tors. theta energy: -18.642 Dist. restrs. and SS energy: 2.520 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 374 Temperature: 1.182150 Total energy: -230.037912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.037912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.860793 (E_RNA) where: Base-Base interactions energy: -158.337 where: short stacking energy: -70.157 Base-Backbone interact. energy: -0.917 local terms energy: -75.606416 where: bonds (distance) C4'-P energy: -12.693 bonds (distance) P-C4' energy: -19.972 flat angles C4'-P-C4' energy: -17.954 flat angles P-C4'-P energy: -7.816 tors. eta vs tors. theta energy: -17.172 Dist. restrs. and SS energy: 4.823 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 375 Temperature: 1.181700 Total energy: -240.054724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.054724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.021443 (E_RNA) where: Base-Base interactions energy: -165.623 where: short stacking energy: -69.477 Base-Backbone interact. energy: -0.469 local terms energy: -75.929533 where: bonds (distance) C4'-P energy: -15.126 bonds (distance) P-C4' energy: -16.319 flat angles C4'-P-C4' energy: -17.396 flat angles P-C4'-P energy: -9.849 tors. eta vs tors. theta energy: -17.239 Dist. restrs. and SS energy: 1.967 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 376 Temperature: 1.181250 Total energy: -259.612511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.612511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.585704 (E_RNA) where: Base-Base interactions energy: -177.624 where: short stacking energy: -79.132 Base-Backbone interact. energy: -0.204 local terms energy: -83.757738 where: bonds (distance) C4'-P energy: -12.342 bonds (distance) P-C4' energy: -17.782 flat angles C4'-P-C4' energy: -15.582 flat angles P-C4'-P energy: -14.799 tors. eta vs tors. theta energy: -23.253 Dist. restrs. and SS energy: 1.973 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 377 Temperature: 1.180800 Total energy: -252.880921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.880921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.265315 (E_RNA) where: Base-Base interactions energy: -168.848 where: short stacking energy: -74.058 Base-Backbone interact. energy: -2.193 local terms energy: -84.225096 where: bonds (distance) C4'-P energy: -15.105 bonds (distance) P-C4' energy: -18.657 flat angles C4'-P-C4' energy: -17.252 flat angles P-C4'-P energy: -13.506 tors. eta vs tors. theta energy: -19.705 Dist. restrs. and SS energy: 2.384 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 378 Temperature: 1.180350 Total energy: -242.387379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.387379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.942722 (E_RNA) where: Base-Base interactions energy: -170.560 where: short stacking energy: -79.286 Base-Backbone interact. energy: -0.922 local terms energy: -73.460464 where: bonds (distance) C4'-P energy: -8.381 bonds (distance) P-C4' energy: -14.888 flat angles C4'-P-C4' energy: -16.065 flat angles P-C4'-P energy: -13.756 tors. eta vs tors. theta energy: -20.370 Dist. restrs. and SS energy: 2.555 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 379 Temperature: 1.179900 Total energy: -247.209605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.209605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.545063 (E_RNA) where: Base-Base interactions energy: -165.344 where: short stacking energy: -72.798 Base-Backbone interact. energy: -0.236 local terms energy: -84.964711 where: bonds (distance) C4'-P energy: -13.595 bonds (distance) P-C4' energy: -18.246 flat angles C4'-P-C4' energy: -18.566 flat angles P-C4'-P energy: -15.929 tors. eta vs tors. theta energy: -18.629 Dist. restrs. and SS energy: 3.335 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 380 Temperature: 1.179450 Total energy: -248.195456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.195456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.526859 (E_RNA) where: Base-Base interactions energy: -182.928 where: short stacking energy: -77.905 Base-Backbone interact. energy: -0.384 local terms energy: -67.215061 where: bonds (distance) C4'-P energy: -11.255 bonds (distance) P-C4' energy: -11.901 flat angles C4'-P-C4' energy: -13.653 flat angles P-C4'-P energy: -12.218 tors. eta vs tors. theta energy: -18.188 Dist. restrs. and SS energy: 2.331 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 381 Temperature: 1.179000 Total energy: -261.560375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.560375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.681169 (E_RNA) where: Base-Base interactions energy: -179.485 where: short stacking energy: -81.689 Base-Backbone interact. energy: 0.093 local terms energy: -83.288666 where: bonds (distance) C4'-P energy: -11.539 bonds (distance) P-C4' energy: -19.209 flat angles C4'-P-C4' energy: -20.118 flat angles P-C4'-P energy: -11.924 tors. eta vs tors. theta energy: -20.498 Dist. restrs. and SS energy: 1.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 382 Temperature: 1.178550 Total energy: -246.018168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.018168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.785775 (E_RNA) where: Base-Base interactions energy: -161.613 where: short stacking energy: -75.762 Base-Backbone interact. energy: -1.331 local terms energy: -84.841804 where: bonds (distance) C4'-P energy: -14.567 bonds (distance) P-C4' energy: -21.407 flat angles C4'-P-C4' energy: -16.681 flat angles P-C4'-P energy: -13.633 tors. eta vs tors. theta energy: -18.553 Dist. restrs. and SS energy: 1.768 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 383 Temperature: 1.178100 Total energy: -255.040840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.040840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.161902 (E_RNA) where: Base-Base interactions energy: -173.183 where: short stacking energy: -71.629 Base-Backbone interact. energy: -0.065 local terms energy: -83.914294 where: bonds (distance) C4'-P energy: -14.684 bonds (distance) P-C4' energy: -17.320 flat angles C4'-P-C4' energy: -16.102 flat angles P-C4'-P energy: -15.380 tors. eta vs tors. theta energy: -20.428 Dist. restrs. and SS energy: 2.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 384 Temperature: 1.177650 Total energy: -252.958463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.958463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.621355 (E_RNA) where: Base-Base interactions energy: -170.557 where: short stacking energy: -68.924 Base-Backbone interact. energy: -0.060 local terms energy: -84.004319 where: bonds (distance) C4'-P energy: -17.398 bonds (distance) P-C4' energy: -21.422 flat angles C4'-P-C4' energy: -15.279 flat angles P-C4'-P energy: -13.872 tors. eta vs tors. theta energy: -16.033 Dist. restrs. and SS energy: 1.663 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 385 Temperature: 1.177200 Total energy: -238.723785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.723785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.355336 (E_RNA) where: Base-Base interactions energy: -157.209 where: short stacking energy: -80.113 Base-Backbone interact. energy: -0.002 local terms energy: -86.144276 where: bonds (distance) C4'-P energy: -15.861 bonds (distance) P-C4' energy: -19.254 flat angles C4'-P-C4' energy: -16.800 flat angles P-C4'-P energy: -11.706 tors. eta vs tors. theta energy: -22.523 Dist. restrs. and SS energy: 4.632 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 386 Temperature: 1.176750 Total energy: -234.833330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.833330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.608935 (E_RNA) where: Base-Base interactions energy: -162.039 where: short stacking energy: -79.081 Base-Backbone interact. energy: -0.710 local terms energy: -76.859350 where: bonds (distance) C4'-P energy: -8.647 bonds (distance) P-C4' energy: -18.171 flat angles C4'-P-C4' energy: -16.964 flat angles P-C4'-P energy: -15.115 tors. eta vs tors. theta energy: -17.962 Dist. restrs. and SS energy: 4.776 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 387 Temperature: 1.176300 Total energy: -243.568367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.568367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.056395 (E_RNA) where: Base-Base interactions energy: -165.575 where: short stacking energy: -77.078 Base-Backbone interact. energy: -1.607 local terms energy: -80.874364 where: bonds (distance) C4'-P energy: -18.235 bonds (distance) P-C4' energy: -16.564 flat angles C4'-P-C4' energy: -15.166 flat angles P-C4'-P energy: -12.835 tors. eta vs tors. theta energy: -18.075 Dist. restrs. and SS energy: 4.488 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 388 Temperature: 1.175850 Total energy: -229.503930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.503930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.309035 (E_RNA) where: Base-Base interactions energy: -150.686 where: short stacking energy: -74.724 Base-Backbone interact. energy: -0.921 local terms energy: -82.701553 where: bonds (distance) C4'-P energy: -19.310 bonds (distance) P-C4' energy: -15.790 flat angles C4'-P-C4' energy: -16.600 flat angles P-C4'-P energy: -10.873 tors. eta vs tors. theta energy: -20.128 Dist. restrs. and SS energy: 4.805 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 389 Temperature: 1.175400 Total energy: -243.436595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.436595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.414246 (E_RNA) where: Base-Base interactions energy: -162.070 where: short stacking energy: -71.350 Base-Backbone interact. energy: -0.923 local terms energy: -83.420633 where: bonds (distance) C4'-P energy: -18.034 bonds (distance) P-C4' energy: -20.673 flat angles C4'-P-C4' energy: -14.115 flat angles P-C4'-P energy: -14.977 tors. eta vs tors. theta energy: -15.621 Dist. restrs. and SS energy: 2.978 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 390 Temperature: 1.174950 Total energy: -237.184230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.184230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.430124 (E_RNA) where: Base-Base interactions energy: -163.587 where: short stacking energy: -71.534 Base-Backbone interact. energy: -0.009 local terms energy: -78.834309 where: bonds (distance) C4'-P energy: -17.120 bonds (distance) P-C4' energy: -16.573 flat angles C4'-P-C4' energy: -16.581 flat angles P-C4'-P energy: -12.321 tors. eta vs tors. theta energy: -16.239 Dist. restrs. and SS energy: 5.246 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 391 Temperature: 1.174500 Total energy: -228.009814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.009814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.999435 (E_RNA) where: Base-Base interactions energy: -145.954 where: short stacking energy: -66.494 Base-Backbone interact. energy: -0.447 local terms energy: -86.598333 where: bonds (distance) C4'-P energy: -17.721 bonds (distance) P-C4' energy: -20.897 flat angles C4'-P-C4' energy: -16.846 flat angles P-C4'-P energy: -14.675 tors. eta vs tors. theta energy: -16.459 Dist. restrs. and SS energy: 4.990 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 392 Temperature: 1.174050 Total energy: -248.644149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.644149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.210629 (E_RNA) where: Base-Base interactions energy: -167.357 where: short stacking energy: -80.162 Base-Backbone interact. energy: -0.914 local terms energy: -82.939141 where: bonds (distance) C4'-P energy: -9.764 bonds (distance) P-C4' energy: -19.681 flat angles C4'-P-C4' energy: -15.928 flat angles P-C4'-P energy: -16.670 tors. eta vs tors. theta energy: -20.896 Dist. restrs. and SS energy: 2.566 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 393 Temperature: 1.173600 Total energy: -237.895467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.895467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.523851 (E_RNA) where: Base-Base interactions energy: -160.422 where: short stacking energy: -72.359 Base-Backbone interact. energy: -0.029 local terms energy: -82.072545 where: bonds (distance) C4'-P energy: -11.983 bonds (distance) P-C4' energy: -20.896 flat angles C4'-P-C4' energy: -19.703 flat angles P-C4'-P energy: -12.115 tors. eta vs tors. theta energy: -17.375 Dist. restrs. and SS energy: 4.628 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 394 Temperature: 1.173150 Total energy: -221.982301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.982301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.253851 (E_RNA) where: Base-Base interactions energy: -145.290 where: short stacking energy: -65.361 Base-Backbone interact. energy: -0.303 local terms energy: -79.660951 where: bonds (distance) C4'-P energy: -14.063 bonds (distance) P-C4' energy: -18.125 flat angles C4'-P-C4' energy: -19.841 flat angles P-C4'-P energy: -12.053 tors. eta vs tors. theta energy: -15.579 Dist. restrs. and SS energy: 3.272 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 395 Temperature: 1.172700 Total energy: -235.083390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.083390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.690297 (E_RNA) where: Base-Base interactions energy: -166.198 where: short stacking energy: -63.996 Base-Backbone interact. energy: -0.088 local terms energy: -71.403735 where: bonds (distance) C4'-P energy: -15.759 bonds (distance) P-C4' energy: -13.193 flat angles C4'-P-C4' energy: -15.696 flat angles P-C4'-P energy: -13.246 tors. eta vs tors. theta energy: -13.511 Dist. restrs. and SS energy: 2.607 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 396 Temperature: 1.172250 Total energy: -219.527866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.527866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.600999 (E_RNA) where: Base-Base interactions energy: -162.520 where: short stacking energy: -77.658 Base-Backbone interact. energy: -1.131 local terms energy: -58.950704 where: bonds (distance) C4'-P energy: -12.497 bonds (distance) P-C4' energy: -14.976 flat angles C4'-P-C4' energy: -7.829 flat angles P-C4'-P energy: -7.848 tors. eta vs tors. theta energy: -15.801 Dist. restrs. and SS energy: 3.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 397 Temperature: 1.171800 Total energy: -238.431678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.431678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.984996 (E_RNA) where: Base-Base interactions energy: -165.919 where: short stacking energy: -81.437 Base-Backbone interact. energy: -0.024 local terms energy: -75.041940 where: bonds (distance) C4'-P energy: -7.769 bonds (distance) P-C4' energy: -20.923 flat angles C4'-P-C4' energy: -18.640 flat angles P-C4'-P energy: -9.028 tors. eta vs tors. theta energy: -18.682 Dist. restrs. and SS energy: 2.553 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 398 Temperature: 1.171350 Total energy: -232.576506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.576506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.375389 (E_RNA) where: Base-Base interactions energy: -158.394 where: short stacking energy: -72.451 Base-Backbone interact. energy: 0.022 local terms energy: -78.002858 where: bonds (distance) C4'-P energy: -13.794 bonds (distance) P-C4' energy: -20.366 flat angles C4'-P-C4' energy: -15.290 flat angles P-C4'-P energy: -13.614 tors. eta vs tors. theta energy: -14.938 Dist. restrs. and SS energy: 3.799 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 399 Temperature: 1.170900 Total energy: -218.096239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.096239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.960530 (E_RNA) where: Base-Base interactions energy: -151.515 where: short stacking energy: -69.067 Base-Backbone interact. energy: 0.533 local terms energy: -72.978173 where: bonds (distance) C4'-P energy: -16.312 bonds (distance) P-C4' energy: -17.874 flat angles C4'-P-C4' energy: -15.791 flat angles P-C4'-P energy: -10.813 tors. eta vs tors. theta energy: -12.189 Dist. restrs. and SS energy: 5.864 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 400 Temperature: 1.170450 Total energy: -219.789674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.789674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.046653 (E_RNA) where: Base-Base interactions energy: -147.268 where: short stacking energy: -69.225 Base-Backbone interact. energy: -1.116 local terms energy: -75.662181 where: bonds (distance) C4'-P energy: -20.611 bonds (distance) P-C4' energy: -15.341 flat angles C4'-P-C4' energy: -15.670 flat angles P-C4'-P energy: -12.306 tors. eta vs tors. theta energy: -11.734 Dist. restrs. and SS energy: 4.257 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 401 Temperature: 1.170000 Total energy: -237.463048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.463048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.629009 (E_RNA) where: Base-Base interactions energy: -155.198 where: short stacking energy: -69.585 Base-Backbone interact. energy: 0.024 local terms energy: -86.454296 where: bonds (distance) C4'-P energy: -14.327 bonds (distance) P-C4' energy: -18.094 flat angles C4'-P-C4' energy: -20.608 flat angles P-C4'-P energy: -13.871 tors. eta vs tors. theta energy: -19.555 Dist. restrs. and SS energy: 4.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 402 Temperature: 1.169550 Total energy: -236.090688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.090688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.227613 (E_RNA) where: Base-Base interactions energy: -152.311 where: short stacking energy: -68.337 Base-Backbone interact. energy: -1.253 local terms energy: -87.664236 where: bonds (distance) C4'-P energy: -18.023 bonds (distance) P-C4' energy: -21.392 flat angles C4'-P-C4' energy: -19.993 flat angles P-C4'-P energy: -12.113 tors. eta vs tors. theta energy: -16.143 Dist. restrs. and SS energy: 5.137 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 403 Temperature: 1.169100 Total energy: -237.450270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.450270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.402765 (E_RNA) where: Base-Base interactions energy: -159.288 where: short stacking energy: -63.455 Base-Backbone interact. energy: -0.099 local terms energy: -81.015151 where: bonds (distance) C4'-P energy: -16.629 bonds (distance) P-C4' energy: -19.587 flat angles C4'-P-C4' energy: -16.294 flat angles P-C4'-P energy: -9.979 tors. eta vs tors. theta energy: -18.526 Dist. restrs. and SS energy: 2.952 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 404 Temperature: 1.168650 Total energy: -239.255799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.255799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.518996 (E_RNA) where: Base-Base interactions energy: -155.233 where: short stacking energy: -71.762 Base-Backbone interact. energy: -0.213 local terms energy: -91.072581 where: bonds (distance) C4'-P energy: -20.378 bonds (distance) P-C4' energy: -18.714 flat angles C4'-P-C4' energy: -20.935 flat angles P-C4'-P energy: -11.554 tors. eta vs tors. theta energy: -19.492 Dist. restrs. and SS energy: 7.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 405 Temperature: 1.168200 Total energy: -221.970763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.970763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.194816 (E_RNA) where: Base-Base interactions energy: -164.633 where: short stacking energy: -70.754 Base-Backbone interact. energy: -0.701 local terms energy: -64.861223 where: bonds (distance) C4'-P energy: -14.816 bonds (distance) P-C4' energy: -15.515 flat angles C4'-P-C4' energy: -13.324 flat angles P-C4'-P energy: -6.617 tors. eta vs tors. theta energy: -14.589 Dist. restrs. and SS energy: 8.224 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 406 Temperature: 1.167750 Total energy: -221.946006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.946006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.383009 (E_RNA) where: Base-Base interactions energy: -145.522 where: short stacking energy: -57.991 Base-Backbone interact. energy: -0.542 local terms energy: -77.318307 where: bonds (distance) C4'-P energy: -14.133 bonds (distance) P-C4' energy: -18.105 flat angles C4'-P-C4' energy: -18.971 flat angles P-C4'-P energy: -13.694 tors. eta vs tors. theta energy: -12.416 Dist. restrs. and SS energy: 1.437 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 407 Temperature: 1.167300 Total energy: -226.476233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.476233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.670225 (E_RNA) where: Base-Base interactions energy: -163.796 where: short stacking energy: -65.601 Base-Backbone interact. energy: -0.863 local terms energy: -66.010832 where: bonds (distance) C4'-P energy: -17.155 bonds (distance) P-C4' energy: -13.819 flat angles C4'-P-C4' energy: -12.910 flat angles P-C4'-P energy: -9.518 tors. eta vs tors. theta energy: -12.609 Dist. restrs. and SS energy: 4.194 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 408 Temperature: 1.166850 Total energy: -229.169870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.169870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.886831 (E_RNA) where: Base-Base interactions energy: -160.330 where: short stacking energy: -73.661 Base-Backbone interact. energy: 4.491 local terms energy: -77.048043 where: bonds (distance) C4'-P energy: -14.712 bonds (distance) P-C4' energy: -13.417 flat angles C4'-P-C4' energy: -19.610 flat angles P-C4'-P energy: -14.538 tors. eta vs tors. theta energy: -14.771 Dist. restrs. and SS energy: 3.717 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 409 Temperature: 1.166400 Total energy: -237.568467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.568467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.092612 (E_RNA) where: Base-Base interactions energy: -154.818 where: short stacking energy: -64.753 Base-Backbone interact. energy: -0.101 local terms energy: -85.172960 where: bonds (distance) C4'-P energy: -21.601 bonds (distance) P-C4' energy: -19.768 flat angles C4'-P-C4' energy: -18.241 flat angles P-C4'-P energy: -10.840 tors. eta vs tors. theta energy: -14.724 Dist. restrs. and SS energy: 2.524 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 410 Temperature: 1.165950 Total energy: -248.242886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.242886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.208852 (E_RNA) where: Base-Base interactions energy: -164.787 where: short stacking energy: -74.734 Base-Backbone interact. energy: -0.029 local terms energy: -85.392876 where: bonds (distance) C4'-P energy: -14.509 bonds (distance) P-C4' energy: -21.945 flat angles C4'-P-C4' energy: -16.409 flat angles P-C4'-P energy: -12.692 tors. eta vs tors. theta energy: -19.837 Dist. restrs. and SS energy: 1.966 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 411 Temperature: 1.165500 Total energy: -236.747904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.747904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.166219 (E_RNA) where: Base-Base interactions energy: -158.802 where: short stacking energy: -70.269 Base-Backbone interact. energy: -0.475 local terms energy: -84.889185 where: bonds (distance) C4'-P energy: -20.160 bonds (distance) P-C4' energy: -19.560 flat angles C4'-P-C4' energy: -17.981 flat angles P-C4'-P energy: -13.363 tors. eta vs tors. theta energy: -13.824 Dist. restrs. and SS energy: 7.418 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 412 Temperature: 1.165050 Total energy: -229.409224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.409224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.463727 (E_RNA) where: Base-Base interactions energy: -147.879 where: short stacking energy: -70.996 Base-Backbone interact. energy: -0.161 local terms energy: -84.423104 where: bonds (distance) C4'-P energy: -12.526 bonds (distance) P-C4' energy: -21.039 flat angles C4'-P-C4' energy: -19.354 flat angles P-C4'-P energy: -10.051 tors. eta vs tors. theta energy: -21.454 Dist. restrs. and SS energy: 3.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 413 Temperature: 1.164600 Total energy: -242.730660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.730660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.538634 (E_RNA) where: Base-Base interactions energy: -161.874 where: short stacking energy: -78.591 Base-Backbone interact. energy: -0.162 local terms energy: -83.502346 where: bonds (distance) C4'-P energy: -13.726 bonds (distance) P-C4' energy: -19.936 flat angles C4'-P-C4' energy: -18.239 flat angles P-C4'-P energy: -10.882 tors. eta vs tors. theta energy: -20.720 Dist. restrs. and SS energy: 2.808 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 414 Temperature: 1.164150 Total energy: -265.296804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.296804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.905484 (E_RNA) where: Base-Base interactions energy: -175.381 where: short stacking energy: -86.631 Base-Backbone interact. energy: -0.801 local terms energy: -91.724303 where: bonds (distance) C4'-P energy: -18.226 bonds (distance) P-C4' energy: -15.981 flat angles C4'-P-C4' energy: -19.579 flat angles P-C4'-P energy: -12.917 tors. eta vs tors. theta energy: -25.021 Dist. restrs. and SS energy: 2.609 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 415 Temperature: 1.163700 Total energy: -254.654618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.654618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.385663 (E_RNA) where: Base-Base interactions energy: -176.838 where: short stacking energy: -80.067 Base-Backbone interact. energy: -0.248 local terms energy: -80.299693 where: bonds (distance) C4'-P energy: -13.752 bonds (distance) P-C4' energy: -15.309 flat angles C4'-P-C4' energy: -16.843 flat angles P-C4'-P energy: -11.901 tors. eta vs tors. theta energy: -22.495 Dist. restrs. and SS energy: 2.731 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 416 Temperature: 1.163250 Total energy: -235.869264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.869264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.009111 (E_RNA) where: Base-Base interactions energy: -156.767 where: short stacking energy: -73.069 Base-Backbone interact. energy: -1.662 local terms energy: -80.579892 where: bonds (distance) C4'-P energy: -19.442 bonds (distance) P-C4' energy: -14.220 flat angles C4'-P-C4' energy: -14.630 flat angles P-C4'-P energy: -9.520 tors. eta vs tors. theta energy: -22.768 Dist. restrs. and SS energy: 3.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 417 Temperature: 1.162800 Total energy: -237.371265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.371265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.471454 (E_RNA) where: Base-Base interactions energy: -158.077 where: short stacking energy: -81.600 Base-Backbone interact. energy: -0.805 local terms energy: -82.589915 where: bonds (distance) C4'-P energy: -14.292 bonds (distance) P-C4' energy: -20.478 flat angles C4'-P-C4' energy: -15.240 flat angles P-C4'-P energy: -12.856 tors. eta vs tors. theta energy: -19.724 Dist. restrs. and SS energy: 4.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 418 Temperature: 1.162350 Total energy: -237.990778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.990778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.771496 (E_RNA) where: Base-Base interactions energy: -165.575 where: short stacking energy: -82.108 Base-Backbone interact. energy: 0.468 local terms energy: -75.664631 where: bonds (distance) C4'-P energy: -11.831 bonds (distance) P-C4' energy: -19.910 flat angles C4'-P-C4' energy: -14.642 flat angles P-C4'-P energy: -12.777 tors. eta vs tors. theta energy: -16.503 Dist. restrs. and SS energy: 2.781 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 419 Temperature: 1.161900 Total energy: -236.696294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.696294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.972838 (E_RNA) where: Base-Base interactions energy: -163.810 where: short stacking energy: -70.796 Base-Backbone interact. energy: -0.649 local terms energy: -74.513770 where: bonds (distance) C4'-P energy: -13.333 bonds (distance) P-C4' energy: -12.850 flat angles C4'-P-C4' energy: -19.146 flat angles P-C4'-P energy: -11.503 tors. eta vs tors. theta energy: -17.682 Dist. restrs. and SS energy: 2.277 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 420 Temperature: 1.161450 Total energy: -231.192342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.192342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.746611 (E_RNA) where: Base-Base interactions energy: -161.108 where: short stacking energy: -65.614 Base-Backbone interact. energy: -1.077 local terms energy: -72.562102 where: bonds (distance) C4'-P energy: -16.601 bonds (distance) P-C4' energy: -20.756 flat angles C4'-P-C4' energy: -11.229 flat angles P-C4'-P energy: -8.352 tors. eta vs tors. theta energy: -15.626 Dist. restrs. and SS energy: 3.554 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 421 Temperature: 1.161000 Total energy: -250.352292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.352292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.556347 (E_RNA) where: Base-Base interactions energy: -175.962 where: short stacking energy: -78.530 Base-Backbone interact. energy: -0.006 local terms energy: -77.588482 where: bonds (distance) C4'-P energy: -11.863 bonds (distance) P-C4' energy: -15.576 flat angles C4'-P-C4' energy: -17.756 flat angles P-C4'-P energy: -9.794 tors. eta vs tors. theta energy: -22.599 Dist. restrs. and SS energy: 3.204 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 422 Temperature: 1.160550 Total energy: -253.271420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.271420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.900987 (E_RNA) where: Base-Base interactions energy: -175.197 where: short stacking energy: -84.136 Base-Backbone interact. energy: -0.515 local terms energy: -80.188680 where: bonds (distance) C4'-P energy: -15.608 bonds (distance) P-C4' energy: -13.856 flat angles C4'-P-C4' energy: -15.309 flat angles P-C4'-P energy: -16.083 tors. eta vs tors. theta energy: -19.333 Dist. restrs. and SS energy: 2.630 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 423 Temperature: 1.160100 Total energy: -253.588231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.588231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.048068 (E_RNA) where: Base-Base interactions energy: -173.961 where: short stacking energy: -77.472 Base-Backbone interact. energy: -0.133 local terms energy: -81.953739 where: bonds (distance) C4'-P energy: -16.949 bonds (distance) P-C4' energy: -15.843 flat angles C4'-P-C4' energy: -19.306 flat angles P-C4'-P energy: -11.309 tors. eta vs tors. theta energy: -18.548 Dist. restrs. and SS energy: 2.460 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 424 Temperature: 1.159650 Total energy: -246.330239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.330239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.801544 (E_RNA) where: Base-Base interactions energy: -155.866 where: short stacking energy: -68.130 Base-Backbone interact. energy: -0.818 local terms energy: -93.117647 where: bonds (distance) C4'-P energy: -14.061 bonds (distance) P-C4' energy: -19.561 flat angles C4'-P-C4' energy: -20.265 flat angles P-C4'-P energy: -14.528 tors. eta vs tors. theta energy: -24.703 Dist. restrs. and SS energy: 3.471 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 425 Temperature: 1.159200 Total energy: -242.978213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.978213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.576064 (E_RNA) where: Base-Base interactions energy: -170.317 where: short stacking energy: -74.823 Base-Backbone interact. energy: -0.070 local terms energy: -76.189421 where: bonds (distance) C4'-P energy: -11.794 bonds (distance) P-C4' energy: -16.498 flat angles C4'-P-C4' energy: -16.058 flat angles P-C4'-P energy: -11.438 tors. eta vs tors. theta energy: -20.400 Dist. restrs. and SS energy: 3.598 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 426 Temperature: 1.158750 Total energy: -256.946065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.946065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.388007 (E_RNA) where: Base-Base interactions energy: -173.402 where: short stacking energy: -73.814 Base-Backbone interact. energy: 1.673 local terms energy: -88.658419 where: bonds (distance) C4'-P energy: -13.533 bonds (distance) P-C4' energy: -20.211 flat angles C4'-P-C4' energy: -17.081 flat angles P-C4'-P energy: -16.866 tors. eta vs tors. theta energy: -20.967 Dist. restrs. and SS energy: 3.442 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 427 Temperature: 1.158300 Total energy: -256.310008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.310008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.217459 (E_RNA) where: Base-Base interactions energy: -175.696 where: short stacking energy: -76.189 Base-Backbone interact. energy: -0.003 local terms energy: -82.518161 where: bonds (distance) C4'-P energy: -14.438 bonds (distance) P-C4' energy: -18.967 flat angles C4'-P-C4' energy: -16.655 flat angles P-C4'-P energy: -10.352 tors. eta vs tors. theta energy: -22.106 Dist. restrs. and SS energy: 1.907 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 428 Temperature: 1.157850 Total energy: -249.972730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.972730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.755634 (E_RNA) where: Base-Base interactions energy: -166.623 where: short stacking energy: -80.888 Base-Backbone interact. energy: -0.300 local terms energy: -84.832573 where: bonds (distance) C4'-P energy: -12.426 bonds (distance) P-C4' energy: -21.195 flat angles C4'-P-C4' energy: -15.068 flat angles P-C4'-P energy: -14.652 tors. eta vs tors. theta energy: -21.492 Dist. restrs. and SS energy: 1.783 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 429 Temperature: 1.157400 Total energy: -246.992730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.992730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.833549 (E_RNA) where: Base-Base interactions energy: -158.141 where: short stacking energy: -76.880 Base-Backbone interact. energy: -1.156 local terms energy: -92.536179 where: bonds (distance) C4'-P energy: -20.011 bonds (distance) P-C4' energy: -16.854 flat angles C4'-P-C4' energy: -20.781 flat angles P-C4'-P energy: -17.149 tors. eta vs tors. theta energy: -17.742 Dist. restrs. and SS energy: 4.841 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 430 Temperature: 1.156950 Total energy: -232.074585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.074585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.044619 (E_RNA) where: Base-Base interactions energy: -163.823 where: short stacking energy: -73.727 Base-Backbone interact. energy: -0.103 local terms energy: -72.118103 where: bonds (distance) C4'-P energy: -13.986 bonds (distance) P-C4' energy: -14.063 flat angles C4'-P-C4' energy: -15.435 flat angles P-C4'-P energy: -11.744 tors. eta vs tors. theta energy: -16.891 Dist. restrs. and SS energy: 3.970 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 431 Temperature: 1.156500 Total energy: -249.982750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.982750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.078186 (E_RNA) where: Base-Base interactions energy: -172.155 where: short stacking energy: -78.880 Base-Backbone interact. energy: -0.009 local terms energy: -80.914698 where: bonds (distance) C4'-P energy: -13.979 bonds (distance) P-C4' energy: -17.612 flat angles C4'-P-C4' energy: -17.489 flat angles P-C4'-P energy: -11.722 tors. eta vs tors. theta energy: -20.111 Dist. restrs. and SS energy: 3.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 432 Temperature: 1.156050 Total energy: -264.529934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.529934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.635984 (E_RNA) where: Base-Base interactions energy: -186.838 where: short stacking energy: -83.341 Base-Backbone interact. energy: -0.491 local terms energy: -80.306282 where: bonds (distance) C4'-P energy: -14.721 bonds (distance) P-C4' energy: -17.923 flat angles C4'-P-C4' energy: -12.915 flat angles P-C4'-P energy: -11.874 tors. eta vs tors. theta energy: -22.874 Dist. restrs. and SS energy: 3.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 433 Temperature: 1.155600 Total energy: -257.713647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.713647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.145329 (E_RNA) where: Base-Base interactions energy: -173.757 where: short stacking energy: -86.138 Base-Backbone interact. energy: -0.008 local terms energy: -86.380372 where: bonds (distance) C4'-P energy: -13.684 bonds (distance) P-C4' energy: -15.405 flat angles C4'-P-C4' energy: -18.381 flat angles P-C4'-P energy: -14.116 tors. eta vs tors. theta energy: -24.794 Dist. restrs. and SS energy: 2.432 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 434 Temperature: 1.155150 Total energy: -251.903154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.903154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.013262 (E_RNA) where: Base-Base interactions energy: -162.968 where: short stacking energy: -80.005 Base-Backbone interact. energy: -0.250 local terms energy: -91.795375 where: bonds (distance) C4'-P energy: -17.630 bonds (distance) P-C4' energy: -22.251 flat angles C4'-P-C4' energy: -14.433 flat angles P-C4'-P energy: -15.367 tors. eta vs tors. theta energy: -22.114 Dist. restrs. and SS energy: 3.110 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 435 Temperature: 1.154700 Total energy: -254.589655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.589655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.120622 (E_RNA) where: Base-Base interactions energy: -175.329 where: short stacking energy: -80.702 Base-Backbone interact. energy: 0.731 local terms energy: -82.522878 where: bonds (distance) C4'-P energy: -13.445 bonds (distance) P-C4' energy: -19.194 flat angles C4'-P-C4' energy: -16.492 flat angles P-C4'-P energy: -11.227 tors. eta vs tors. theta energy: -22.166 Dist. restrs. and SS energy: 2.531 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 436 Temperature: 1.154250 Total energy: -256.138798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.138798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.597866 (E_RNA) where: Base-Base interactions energy: -173.608 where: short stacking energy: -76.087 Base-Backbone interact. energy: -0.677 local terms energy: -85.312871 where: bonds (distance) C4'-P energy: -14.435 bonds (distance) P-C4' energy: -17.270 flat angles C4'-P-C4' energy: -14.531 flat angles P-C4'-P energy: -15.343 tors. eta vs tors. theta energy: -23.734 Dist. restrs. and SS energy: 3.459 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 437 Temperature: 1.153800 Total energy: -241.852273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.852273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.667209 (E_RNA) where: Base-Base interactions energy: -158.218 where: short stacking energy: -72.308 Base-Backbone interact. energy: -2.483 local terms energy: -83.965856 where: bonds (distance) C4'-P energy: -16.521 bonds (distance) P-C4' energy: -14.844 flat angles C4'-P-C4' energy: -16.435 flat angles P-C4'-P energy: -16.576 tors. eta vs tors. theta energy: -19.590 Dist. restrs. and SS energy: 2.815 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 438 Temperature: 1.153350 Total energy: -249.961796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.961796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.192915 (E_RNA) where: Base-Base interactions energy: -165.756 where: short stacking energy: -82.337 Base-Backbone interact. energy: -0.896 local terms energy: -85.540638 where: bonds (distance) C4'-P energy: -17.547 bonds (distance) P-C4' energy: -20.986 flat angles C4'-P-C4' energy: -18.015 flat angles P-C4'-P energy: -11.390 tors. eta vs tors. theta energy: -17.602 Dist. restrs. and SS energy: 2.231 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 439 Temperature: 1.152900 Total energy: -259.212527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.212527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.807600 (E_RNA) where: Base-Base interactions energy: -171.902 where: short stacking energy: -78.755 Base-Backbone interact. energy: -0.043 local terms energy: -89.862338 where: bonds (distance) C4'-P energy: -16.790 bonds (distance) P-C4' energy: -20.055 flat angles C4'-P-C4' energy: -17.584 flat angles P-C4'-P energy: -12.708 tors. eta vs tors. theta energy: -22.725 Dist. restrs. and SS energy: 2.595 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 440 Temperature: 1.152450 Total energy: -246.193200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.193200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.417117 (E_RNA) where: Base-Base interactions energy: -163.056 where: short stacking energy: -73.745 Base-Backbone interact. energy: -0.100 local terms energy: -85.261157 where: bonds (distance) C4'-P energy: -15.801 bonds (distance) P-C4' energy: -14.487 flat angles C4'-P-C4' energy: -20.806 flat angles P-C4'-P energy: -9.705 tors. eta vs tors. theta energy: -24.461 Dist. restrs. and SS energy: 2.224 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 441 Temperature: 1.152000 Total energy: -245.697986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.697986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.762521 (E_RNA) where: Base-Base interactions energy: -167.400 where: short stacking energy: -72.553 Base-Backbone interact. energy: -1.001 local terms energy: -79.362244 where: bonds (distance) C4'-P energy: -16.404 bonds (distance) P-C4' energy: -14.741 flat angles C4'-P-C4' energy: -15.707 flat angles P-C4'-P energy: -9.909 tors. eta vs tors. theta energy: -22.601 Dist. restrs. and SS energy: 2.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 442 Temperature: 1.151550 Total energy: -257.588612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.588612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.226009 (E_RNA) where: Base-Base interactions energy: -177.727 where: short stacking energy: -79.727 Base-Backbone interact. energy: -0.003 local terms energy: -82.495650 where: bonds (distance) C4'-P energy: -16.226 bonds (distance) P-C4' energy: -14.668 flat angles C4'-P-C4' energy: -16.640 flat angles P-C4'-P energy: -7.742 tors. eta vs tors. theta energy: -27.219 Dist. restrs. and SS energy: 2.637 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 443 Temperature: 1.151100 Total energy: -253.678583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.678583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.676417 (E_RNA) where: Base-Base interactions energy: -178.149 where: short stacking energy: -72.895 Base-Backbone interact. energy: -0.008 local terms energy: -77.519630 where: bonds (distance) C4'-P energy: -16.334 bonds (distance) P-C4' energy: -16.779 flat angles C4'-P-C4' energy: -13.935 flat angles P-C4'-P energy: -11.791 tors. eta vs tors. theta energy: -18.681 Dist. restrs. and SS energy: 1.998 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 444 Temperature: 1.150650 Total energy: -254.313416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.313416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.786717 (E_RNA) where: Base-Base interactions energy: -176.700 where: short stacking energy: -82.899 Base-Backbone interact. energy: 0.473 local terms energy: -81.559912 where: bonds (distance) C4'-P energy: -11.804 bonds (distance) P-C4' energy: -19.453 flat angles C4'-P-C4' energy: -11.527 flat angles P-C4'-P energy: -12.182 tors. eta vs tors. theta energy: -26.594 Dist. restrs. and SS energy: 3.473 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 445 Temperature: 1.150200 Total energy: -259.868121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.868121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.778069 (E_RNA) where: Base-Base interactions energy: -171.781 where: short stacking energy: -75.686 Base-Backbone interact. energy: -0.031 local terms energy: -90.966437 where: bonds (distance) C4'-P energy: -18.611 bonds (distance) P-C4' energy: -21.296 flat angles C4'-P-C4' energy: -15.271 flat angles P-C4'-P energy: -10.015 tors. eta vs tors. theta energy: -25.773 Dist. restrs. and SS energy: 2.910 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 446 Temperature: 1.149750 Total energy: -253.331915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.331915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.860241 (E_RNA) where: Base-Base interactions energy: -174.385 where: short stacking energy: -82.466 Base-Backbone interact. energy: -0.001 local terms energy: -81.473852 where: bonds (distance) C4'-P energy: -13.521 bonds (distance) P-C4' energy: -18.238 flat angles C4'-P-C4' energy: -13.029 flat angles P-C4'-P energy: -10.419 tors. eta vs tors. theta energy: -26.267 Dist. restrs. and SS energy: 2.528 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 447 Temperature: 1.149300 Total energy: -253.184799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.184799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.954275 (E_RNA) where: Base-Base interactions energy: -172.775 where: short stacking energy: -82.900 Base-Backbone interact. energy: 0.099 local terms energy: -83.278538 where: bonds (distance) C4'-P energy: -19.402 bonds (distance) P-C4' energy: -18.270 flat angles C4'-P-C4' energy: -12.712 flat angles P-C4'-P energy: -9.215 tors. eta vs tors. theta energy: -23.680 Dist. restrs. and SS energy: 2.769 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 448 Temperature: 1.148850 Total energy: -261.364172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.364172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.983088 (E_RNA) where: Base-Base interactions energy: -183.282 where: short stacking energy: -74.708 Base-Backbone interact. energy: 0.969 local terms energy: -81.669965 where: bonds (distance) C4'-P energy: -19.354 bonds (distance) P-C4' energy: -16.532 flat angles C4'-P-C4' energy: -15.327 flat angles P-C4'-P energy: -10.255 tors. eta vs tors. theta energy: -20.202 Dist. restrs. and SS energy: 2.619 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 449 Temperature: 1.148400 Total energy: -270.001340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.001340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.254209 (E_RNA) where: Base-Base interactions energy: -190.394 where: short stacking energy: -87.398 Base-Backbone interact. energy: -0.061 local terms energy: -82.799328 where: bonds (distance) C4'-P energy: -13.815 bonds (distance) P-C4' energy: -13.649 flat angles C4'-P-C4' energy: -17.866 flat angles P-C4'-P energy: -9.323 tors. eta vs tors. theta energy: -28.146 Dist. restrs. and SS energy: 3.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 450 Temperature: 1.147950 Total energy: -271.797149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.797149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.911674 (E_RNA) where: Base-Base interactions energy: -188.301 where: short stacking energy: -88.245 Base-Backbone interact. energy: -0.023 local terms energy: -86.587348 where: bonds (distance) C4'-P energy: -11.075 bonds (distance) P-C4' energy: -17.727 flat angles C4'-P-C4' energy: -18.461 flat angles P-C4'-P energy: -11.278 tors. eta vs tors. theta energy: -28.046 Dist. restrs. and SS energy: 3.115 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 451 Temperature: 1.147500 Total energy: -266.608789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.608789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.494993 (E_RNA) where: Base-Base interactions energy: -180.052 where: short stacking energy: -86.621 Base-Backbone interact. energy: -0.447 local terms energy: -88.995981 where: bonds (distance) C4'-P energy: -16.301 bonds (distance) P-C4' energy: -15.001 flat angles C4'-P-C4' energy: -18.876 flat angles P-C4'-P energy: -11.848 tors. eta vs tors. theta energy: -26.970 Dist. restrs. and SS energy: 2.886 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 452 Temperature: 1.147050 Total energy: -257.456638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.456638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.095967 (E_RNA) where: Base-Base interactions energy: -175.579 where: short stacking energy: -86.491 Base-Backbone interact. energy: -0.239 local terms energy: -83.278158 where: bonds (distance) C4'-P energy: -12.866 bonds (distance) P-C4' energy: -17.438 flat angles C4'-P-C4' energy: -19.353 flat angles P-C4'-P energy: -9.463 tors. eta vs tors. theta energy: -24.158 Dist. restrs. and SS energy: 1.639 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 453 Temperature: 1.146600 Total energy: -258.863195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.863195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.695145 (E_RNA) where: Base-Base interactions energy: -168.341 where: short stacking energy: -69.396 Base-Backbone interact. energy: -0.028 local terms energy: -92.326309 where: bonds (distance) C4'-P energy: -15.084 bonds (distance) P-C4' energy: -21.582 flat angles C4'-P-C4' energy: -18.058 flat angles P-C4'-P energy: -13.817 tors. eta vs tors. theta energy: -23.786 Dist. restrs. and SS energy: 1.832 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 454 Temperature: 1.146150 Total energy: -266.254534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.254534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.724525 (E_RNA) where: Base-Base interactions energy: -178.730 where: short stacking energy: -85.804 Base-Backbone interact. energy: -0.564 local terms energy: -90.430974 where: bonds (distance) C4'-P energy: -18.731 bonds (distance) P-C4' energy: -16.163 flat angles C4'-P-C4' energy: -21.938 flat angles P-C4'-P energy: -10.550 tors. eta vs tors. theta energy: -23.049 Dist. restrs. and SS energy: 3.470 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 455 Temperature: 1.145700 Total energy: -251.035293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.035293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.128252 (E_RNA) where: Base-Base interactions energy: -170.918 where: short stacking energy: -78.775 Base-Backbone interact. energy: -0.872 local terms energy: -81.338143 where: bonds (distance) C4'-P energy: -18.256 bonds (distance) P-C4' energy: -11.677 flat angles C4'-P-C4' energy: -17.907 flat angles P-C4'-P energy: -12.541 tors. eta vs tors. theta energy: -20.958 Dist. restrs. and SS energy: 2.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 456 Temperature: 1.145250 Total energy: -253.157271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.157271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.038130 (E_RNA) where: Base-Base interactions energy: -170.949 where: short stacking energy: -78.798 Base-Backbone interact. energy: -0.288 local terms energy: -84.801167 where: bonds (distance) C4'-P energy: -14.638 bonds (distance) P-C4' energy: -18.818 flat angles C4'-P-C4' energy: -17.313 flat angles P-C4'-P energy: -11.801 tors. eta vs tors. theta energy: -22.231 Dist. restrs. and SS energy: 2.881 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 457 Temperature: 1.144800 Total energy: -263.188253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.188253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.992833 (E_RNA) where: Base-Base interactions energy: -182.992 where: short stacking energy: -85.123 Base-Backbone interact. energy: -0.083 local terms energy: -82.917725 where: bonds (distance) C4'-P energy: -10.506 bonds (distance) P-C4' energy: -8.369 flat angles C4'-P-C4' energy: -21.957 flat angles P-C4'-P energy: -16.348 tors. eta vs tors. theta energy: -25.737 Dist. restrs. and SS energy: 2.805 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 458 Temperature: 1.144350 Total energy: -256.514930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.514930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.124999 (E_RNA) where: Base-Base interactions energy: -170.700 where: short stacking energy: -75.860 Base-Backbone interact. energy: -0.014 local terms energy: -89.410614 where: bonds (distance) C4'-P energy: -15.234 bonds (distance) P-C4' energy: -18.464 flat angles C4'-P-C4' energy: -19.369 flat angles P-C4'-P energy: -13.042 tors. eta vs tors. theta energy: -23.301 Dist. restrs. and SS energy: 3.610 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 459 Temperature: 1.143900 Total energy: -252.774401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.774401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.661627 (E_RNA) where: Base-Base interactions energy: -179.463 where: short stacking energy: -79.436 Base-Backbone interact. energy: -0.466 local terms energy: -76.732723 where: bonds (distance) C4'-P energy: -10.882 bonds (distance) P-C4' energy: -13.960 flat angles C4'-P-C4' energy: -14.270 flat angles P-C4'-P energy: -12.962 tors. eta vs tors. theta energy: -24.659 Dist. restrs. and SS energy: 3.887 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 460 Temperature: 1.143450 Total energy: -255.125380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.125380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.516764 (E_RNA) where: Base-Base interactions energy: -173.476 where: short stacking energy: -75.084 Base-Backbone interact. energy: -0.237 local terms energy: -84.803450 where: bonds (distance) C4'-P energy: -13.683 bonds (distance) P-C4' energy: -16.614 flat angles C4'-P-C4' energy: -20.818 flat angles P-C4'-P energy: -14.103 tors. eta vs tors. theta energy: -19.586 Dist. restrs. and SS energy: 3.391 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 461 Temperature: 1.143000 Total energy: -261.709564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.709564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.906727 (E_RNA) where: Base-Base interactions energy: -186.033 where: short stacking energy: -80.220 Base-Backbone interact. energy: -0.108 local terms energy: -78.766028 where: bonds (distance) C4'-P energy: -18.019 bonds (distance) P-C4' energy: -13.894 flat angles C4'-P-C4' energy: -16.154 flat angles P-C4'-P energy: -12.730 tors. eta vs tors. theta energy: -17.969 Dist. restrs. and SS energy: 3.197 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 462 Temperature: 1.142550 Total energy: -245.564795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.564795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.226643 (E_RNA) where: Base-Base interactions energy: -173.894 where: short stacking energy: -72.548 Base-Backbone interact. energy: -0.592 local terms energy: -73.740863 where: bonds (distance) C4'-P energy: -12.434 bonds (distance) P-C4' energy: -14.055 flat angles C4'-P-C4' energy: -16.929 flat angles P-C4'-P energy: -11.731 tors. eta vs tors. theta energy: -18.591 Dist. restrs. and SS energy: 2.662 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 463 Temperature: 1.142100 Total energy: -252.435167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.435167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.335416 (E_RNA) where: Base-Base interactions energy: -167.860 where: short stacking energy: -86.766 Base-Backbone interact. energy: -0.286 local terms energy: -87.188799 where: bonds (distance) C4'-P energy: -19.699 bonds (distance) P-C4' energy: -15.282 flat angles C4'-P-C4' energy: -18.949 flat angles P-C4'-P energy: -9.717 tors. eta vs tors. theta energy: -23.541 Dist. restrs. and SS energy: 2.900 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 464 Temperature: 1.141650 Total energy: -263.844861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.844861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.733889 (E_RNA) where: Base-Base interactions energy: -175.374 where: short stacking energy: -76.996 Base-Backbone interact. energy: -1.186 local terms energy: -90.174409 where: bonds (distance) C4'-P energy: -15.175 bonds (distance) P-C4' energy: -17.443 flat angles C4'-P-C4' energy: -18.191 flat angles P-C4'-P energy: -12.878 tors. eta vs tors. theta energy: -26.487 Dist. restrs. and SS energy: 2.889 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 465 Temperature: 1.141200 Total energy: -263.484896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.484896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.204171 (E_RNA) where: Base-Base interactions energy: -185.379 where: short stacking energy: -94.442 Base-Backbone interact. energy: -0.003 local terms energy: -80.822599 where: bonds (distance) C4'-P energy: -9.483 bonds (distance) P-C4' energy: -15.614 flat angles C4'-P-C4' energy: -19.672 flat angles P-C4'-P energy: -8.353 tors. eta vs tors. theta energy: -27.700 Dist. restrs. and SS energy: 2.719 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 466 Temperature: 1.140750 Total energy: -246.273949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.273949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.223654 (E_RNA) where: Base-Base interactions energy: -165.438 where: short stacking energy: -70.807 Base-Backbone interact. energy: -0.679 local terms energy: -82.107078 where: bonds (distance) C4'-P energy: -14.901 bonds (distance) P-C4' energy: -23.533 flat angles C4'-P-C4' energy: -18.207 flat angles P-C4'-P energy: -0.587 tors. eta vs tors. theta energy: -24.880 Dist. restrs. and SS energy: 1.950 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 467 Temperature: 1.140300 Total energy: -246.725351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.725351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.572928 (E_RNA) where: Base-Base interactions energy: -159.213 where: short stacking energy: -79.646 Base-Backbone interact. energy: -0.444 local terms energy: -89.915533 where: bonds (distance) C4'-P energy: -20.333 bonds (distance) P-C4' energy: -18.565 flat angles C4'-P-C4' energy: -23.037 flat angles P-C4'-P energy: -5.642 tors. eta vs tors. theta energy: -22.339 Dist. restrs. and SS energy: 2.848 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 468 Temperature: 1.139850 Total energy: -256.104877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.104877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.075299 (E_RNA) where: Base-Base interactions energy: -172.939 where: short stacking energy: -79.747 Base-Backbone interact. energy: -0.007 local terms energy: -86.129330 where: bonds (distance) C4'-P energy: -15.515 bonds (distance) P-C4' energy: -19.784 flat angles C4'-P-C4' energy: -16.233 flat angles P-C4'-P energy: -10.748 tors. eta vs tors. theta energy: -23.849 Dist. restrs. and SS energy: 2.970 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 469 Temperature: 1.139400 Total energy: -251.716057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.716057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.148648 (E_RNA) where: Base-Base interactions energy: -163.581 where: short stacking energy: -76.357 Base-Backbone interact. energy: -0.136 local terms energy: -91.431311 where: bonds (distance) C4'-P energy: -19.532 bonds (distance) P-C4' energy: -16.824 flat angles C4'-P-C4' energy: -22.324 flat angles P-C4'-P energy: -11.061 tors. eta vs tors. theta energy: -21.690 Dist. restrs. and SS energy: 3.433 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 470 Temperature: 1.138950 Total energy: -250.924785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.924785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.419004 (E_RNA) where: Base-Base interactions energy: -173.504 where: short stacking energy: -76.937 Base-Backbone interact. energy: 0.181 local terms energy: -82.096548 where: bonds (distance) C4'-P energy: -14.413 bonds (distance) P-C4' energy: -17.821 flat angles C4'-P-C4' energy: -16.600 flat angles P-C4'-P energy: -12.451 tors. eta vs tors. theta energy: -20.812 Dist. restrs. and SS energy: 4.494 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 471 Temperature: 1.138500 Total energy: -257.943795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.943795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.876883 (E_RNA) where: Base-Base interactions energy: -185.086 where: short stacking energy: -77.895 Base-Backbone interact. energy: -1.050 local terms energy: -74.740898 where: bonds (distance) C4'-P energy: -11.615 bonds (distance) P-C4' energy: -17.260 flat angles C4'-P-C4' energy: -14.355 flat angles P-C4'-P energy: -12.310 tors. eta vs tors. theta energy: -19.202 Dist. restrs. and SS energy: 2.933 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 472 Temperature: 1.138050 Total energy: -261.983736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.983736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.756647 (E_RNA) where: Base-Base interactions energy: -175.608 where: short stacking energy: -75.942 Base-Backbone interact. energy: -0.385 local terms energy: -88.763849 where: bonds (distance) C4'-P energy: -13.697 bonds (distance) P-C4' energy: -22.678 flat angles C4'-P-C4' energy: -18.273 flat angles P-C4'-P energy: -12.641 tors. eta vs tors. theta energy: -21.476 Dist. restrs. and SS energy: 2.773 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 473 Temperature: 1.137600 Total energy: -244.372678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.372678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.015847 (E_RNA) where: Base-Base interactions energy: -177.974 where: short stacking energy: -74.434 Base-Backbone interact. energy: -0.305 local terms energy: -72.736891 where: bonds (distance) C4'-P energy: -9.764 bonds (distance) P-C4' energy: -13.703 flat angles C4'-P-C4' energy: -20.723 flat angles P-C4'-P energy: -5.881 tors. eta vs tors. theta energy: -22.665 Dist. restrs. and SS energy: 6.643 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 474 Temperature: 1.137150 Total energy: -233.281954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.281954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.289401 (E_RNA) where: Base-Base interactions energy: -150.636 where: short stacking energy: -64.266 Base-Backbone interact. energy: -0.337 local terms energy: -87.317204 where: bonds (distance) C4'-P energy: -18.057 bonds (distance) P-C4' energy: -19.054 flat angles C4'-P-C4' energy: -20.240 flat angles P-C4'-P energy: -9.018 tors. eta vs tors. theta energy: -20.949 Dist. restrs. and SS energy: 5.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 475 Temperature: 1.136700 Total energy: -241.820172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.820172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.050432 (E_RNA) where: Base-Base interactions energy: -168.711 where: short stacking energy: -78.532 Base-Backbone interact. energy: -0.059 local terms energy: -78.280631 where: bonds (distance) C4'-P energy: -16.352 bonds (distance) P-C4' energy: -16.118 flat angles C4'-P-C4' energy: -16.952 flat angles P-C4'-P energy: -7.366 tors. eta vs tors. theta energy: -21.493 Dist. restrs. and SS energy: 5.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 476 Temperature: 1.136250 Total energy: -249.699846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.699846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.415425 (E_RNA) where: Base-Base interactions energy: -165.855 where: short stacking energy: -81.222 Base-Backbone interact. energy: -0.339 local terms energy: -87.221515 where: bonds (distance) C4'-P energy: -18.821 bonds (distance) P-C4' energy: -16.071 flat angles C4'-P-C4' energy: -17.406 flat angles P-C4'-P energy: -12.310 tors. eta vs tors. theta energy: -22.614 Dist. restrs. and SS energy: 3.716 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 477 Temperature: 1.135800 Total energy: -257.883203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.883203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.839553 (E_RNA) where: Base-Base interactions energy: -174.010 where: short stacking energy: -78.728 Base-Backbone interact. energy: 0.184 local terms energy: -90.013837 where: bonds (distance) C4'-P energy: -15.297 bonds (distance) P-C4' energy: -22.778 flat angles C4'-P-C4' energy: -20.398 flat angles P-C4'-P energy: -12.805 tors. eta vs tors. theta energy: -18.736 Dist. restrs. and SS energy: 5.956 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 478 Temperature: 1.135350 Total energy: -235.491217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.491217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.343551 (E_RNA) where: Base-Base interactions energy: -167.721 where: short stacking energy: -65.050 Base-Backbone interact. energy: 0.430 local terms energy: -73.052623 where: bonds (distance) C4'-P energy: -17.349 bonds (distance) P-C4' energy: -17.671 flat angles C4'-P-C4' energy: -14.858 flat angles P-C4'-P energy: -5.374 tors. eta vs tors. theta energy: -17.800 Dist. restrs. and SS energy: 4.852 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 479 Temperature: 1.134900 Total energy: -241.512448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.512448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.112594 (E_RNA) where: Base-Base interactions energy: -180.175 where: short stacking energy: -68.926 Base-Backbone interact. energy: -0.093 local terms energy: -63.844353 where: bonds (distance) C4'-P energy: -9.490 bonds (distance) P-C4' energy: -14.057 flat angles C4'-P-C4' energy: -14.978 flat angles P-C4'-P energy: -10.014 tors. eta vs tors. theta energy: -15.305 Dist. restrs. and SS energy: 2.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 480 Temperature: 1.134450 Total energy: -249.747025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.747025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.122230 (E_RNA) where: Base-Base interactions energy: -184.508 where: short stacking energy: -71.790 Base-Backbone interact. energy: -0.734 local terms energy: -67.880255 where: bonds (distance) C4'-P energy: -13.055 bonds (distance) P-C4' energy: -14.575 flat angles C4'-P-C4' energy: -15.443 flat angles P-C4'-P energy: -7.881 tors. eta vs tors. theta energy: -16.927 Dist. restrs. and SS energy: 3.375 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 481 Temperature: 1.134000 Total energy: -232.082278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.082278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.463693 (E_RNA) where: Base-Base interactions energy: -162.767 where: short stacking energy: -72.677 Base-Backbone interact. energy: -0.515 local terms energy: -71.182110 where: bonds (distance) C4'-P energy: -15.826 bonds (distance) P-C4' energy: -11.943 flat angles C4'-P-C4' energy: -15.349 flat angles P-C4'-P energy: -9.323 tors. eta vs tors. theta energy: -18.741 Dist. restrs. and SS energy: 2.381 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 482 Temperature: 1.133550 Total energy: -246.081777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.081777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.950735 (E_RNA) where: Base-Base interactions energy: -171.517 where: short stacking energy: -67.732 Base-Backbone interact. energy: -0.348 local terms energy: -77.085490 where: bonds (distance) C4'-P energy: -18.288 bonds (distance) P-C4' energy: -15.356 flat angles C4'-P-C4' energy: -14.660 flat angles P-C4'-P energy: -12.274 tors. eta vs tors. theta energy: -16.506 Dist. restrs. and SS energy: 2.869 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 483 Temperature: 1.133100 Total energy: -226.733020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.733020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.481996 (E_RNA) where: Base-Base interactions energy: -156.650 where: short stacking energy: -68.932 Base-Backbone interact. energy: -0.383 local terms energy: -75.449969 where: bonds (distance) C4'-P energy: -20.367 bonds (distance) P-C4' energy: -18.684 flat angles C4'-P-C4' energy: -17.660 flat angles P-C4'-P energy: -7.141 tors. eta vs tors. theta energy: -11.598 Dist. restrs. and SS energy: 5.749 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 484 Temperature: 1.132650 Total energy: -241.931984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.931984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.064691 (E_RNA) where: Base-Base interactions energy: -174.880 where: short stacking energy: -71.044 Base-Backbone interact. energy: -0.353 local terms energy: -71.831262 where: bonds (distance) C4'-P energy: -11.551 bonds (distance) P-C4' energy: -15.008 flat angles C4'-P-C4' energy: -17.751 flat angles P-C4'-P energy: -13.235 tors. eta vs tors. theta energy: -14.287 Dist. restrs. and SS energy: 5.133 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 485 Temperature: 1.132200 Total energy: -234.631582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.631582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.496174 (E_RNA) where: Base-Base interactions energy: -171.042 where: short stacking energy: -69.535 Base-Backbone interact. energy: -0.382 local terms energy: -72.072301 where: bonds (distance) C4'-P energy: -16.894 bonds (distance) P-C4' energy: -17.601 flat angles C4'-P-C4' energy: -15.417 flat angles P-C4'-P energy: -6.311 tors. eta vs tors. theta energy: -15.849 Dist. restrs. and SS energy: 8.865 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 486 Temperature: 1.131750 Total energy: -235.455445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.455445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.532370 (E_RNA) where: Base-Base interactions energy: -167.940 where: short stacking energy: -66.918 Base-Backbone interact. energy: -0.337 local terms energy: -71.255155 where: bonds (distance) C4'-P energy: -15.760 bonds (distance) P-C4' energy: -16.553 flat angles C4'-P-C4' energy: -16.813 flat angles P-C4'-P energy: -5.574 tors. eta vs tors. theta energy: -16.556 Dist. restrs. and SS energy: 4.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 487 Temperature: 1.131300 Total energy: -245.172836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.172836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.678188 (E_RNA) where: Base-Base interactions energy: -165.259 where: short stacking energy: -66.880 Base-Backbone interact. energy: -0.330 local terms energy: -84.089567 where: bonds (distance) C4'-P energy: -14.096 bonds (distance) P-C4' energy: -16.691 flat angles C4'-P-C4' energy: -19.364 flat angles P-C4'-P energy: -14.518 tors. eta vs tors. theta energy: -19.421 Dist. restrs. and SS energy: 4.505 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 488 Temperature: 1.130850 Total energy: -231.493221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.493221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.696569 (E_RNA) where: Base-Base interactions energy: -158.333 where: short stacking energy: -65.114 Base-Backbone interact. energy: -0.060 local terms energy: -78.303719 where: bonds (distance) C4'-P energy: -13.765 bonds (distance) P-C4' energy: -20.616 flat angles C4'-P-C4' energy: -13.903 flat angles P-C4'-P energy: -10.465 tors. eta vs tors. theta energy: -19.556 Dist. restrs. and SS energy: 5.203 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 489 Temperature: 1.130400 Total energy: -243.854318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.854318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.813496 (E_RNA) where: Base-Base interactions energy: -159.727 where: short stacking energy: -77.134 Base-Backbone interact. energy: -1.187 local terms energy: -86.899524 where: bonds (distance) C4'-P energy: -18.521 bonds (distance) P-C4' energy: -18.863 flat angles C4'-P-C4' energy: -11.171 flat angles P-C4'-P energy: -14.545 tors. eta vs tors. theta energy: -23.800 Dist. restrs. and SS energy: 3.959 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 490 Temperature: 1.129950 Total energy: -246.450769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.450769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.567470 (E_RNA) where: Base-Base interactions energy: -168.803 where: short stacking energy: -77.665 Base-Backbone interact. energy: -0.079 local terms energy: -83.684937 where: bonds (distance) C4'-P energy: -7.586 bonds (distance) P-C4' energy: -18.771 flat angles C4'-P-C4' energy: -18.174 flat angles P-C4'-P energy: -17.032 tors. eta vs tors. theta energy: -22.122 Dist. restrs. and SS energy: 6.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 491 Temperature: 1.129500 Total energy: -237.361807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.361807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.649124 (E_RNA) where: Base-Base interactions energy: -173.610 where: short stacking energy: -79.014 Base-Backbone interact. energy: -0.044 local terms energy: -68.994637 where: bonds (distance) C4'-P energy: -14.298 bonds (distance) P-C4' energy: -13.227 flat angles C4'-P-C4' energy: -12.098 flat angles P-C4'-P energy: -4.348 tors. eta vs tors. theta energy: -25.024 Dist. restrs. and SS energy: 5.287 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 492 Temperature: 1.129050 Total energy: -240.172600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.172600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.627991 (E_RNA) where: Base-Base interactions energy: -162.668 where: short stacking energy: -71.266 Base-Backbone interact. energy: -0.101 local terms energy: -82.858776 where: bonds (distance) C4'-P energy: -16.098 bonds (distance) P-C4' energy: -16.646 flat angles C4'-P-C4' energy: -18.765 flat angles P-C4'-P energy: -8.414 tors. eta vs tors. theta energy: -22.936 Dist. restrs. and SS energy: 5.455 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 493 Temperature: 1.128600 Total energy: -227.991782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.991782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.116267 (E_RNA) where: Base-Base interactions energy: -164.190 where: short stacking energy: -78.796 Base-Backbone interact. energy: -0.066 local terms energy: -69.860419 where: bonds (distance) C4'-P energy: -10.895 bonds (distance) P-C4' energy: -14.111 flat angles C4'-P-C4' energy: -18.939 flat angles P-C4'-P energy: -8.119 tors. eta vs tors. theta energy: -17.797 Dist. restrs. and SS energy: 6.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 494 Temperature: 1.128150 Total energy: -225.470138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.470138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.989221 (E_RNA) where: Base-Base interactions energy: -160.543 where: short stacking energy: -73.285 Base-Backbone interact. energy: -0.016 local terms energy: -71.429987 where: bonds (distance) C4'-P energy: -13.262 bonds (distance) P-C4' energy: -16.367 flat angles C4'-P-C4' energy: -14.644 flat angles P-C4'-P energy: -11.827 tors. eta vs tors. theta energy: -15.329 Dist. restrs. and SS energy: 6.519 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 495 Temperature: 1.127700 Total energy: -232.683823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.683823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.036486 (E_RNA) where: Base-Base interactions energy: -155.832 where: short stacking energy: -68.659 Base-Backbone interact. energy: -0.527 local terms energy: -78.677085 where: bonds (distance) C4'-P energy: -9.297 bonds (distance) P-C4' energy: -16.216 flat angles C4'-P-C4' energy: -18.739 flat angles P-C4'-P energy: -14.260 tors. eta vs tors. theta energy: -20.165 Dist. restrs. and SS energy: 2.353 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 496 Temperature: 1.127250 Total energy: -225.954054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.954054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.700134 (E_RNA) where: Base-Base interactions energy: -146.125 where: short stacking energy: -60.565 Base-Backbone interact. energy: -1.168 local terms energy: -80.407484 where: bonds (distance) C4'-P energy: -15.717 bonds (distance) P-C4' energy: -16.539 flat angles C4'-P-C4' energy: -15.645 flat angles P-C4'-P energy: -9.467 tors. eta vs tors. theta energy: -23.039 Dist. restrs. and SS energy: 1.746 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 497 Temperature: 1.126800 Total energy: -237.240011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.240011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.324632 (E_RNA) where: Base-Base interactions energy: -157.593 where: short stacking energy: -75.081 Base-Backbone interact. energy: -0.232 local terms energy: -80.500413 where: bonds (distance) C4'-P energy: -14.790 bonds (distance) P-C4' energy: -21.278 flat angles C4'-P-C4' energy: -15.874 flat angles P-C4'-P energy: -7.722 tors. eta vs tors. theta energy: -20.836 Dist. restrs. and SS energy: 1.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 498 Temperature: 1.126350 Total energy: -233.431223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.431223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.710737 (E_RNA) where: Base-Base interactions energy: -153.224 where: short stacking energy: -73.130 Base-Backbone interact. energy: -1.809 local terms energy: -79.677564 where: bonds (distance) C4'-P energy: -15.626 bonds (distance) P-C4' energy: -17.620 flat angles C4'-P-C4' energy: -17.986 flat angles P-C4'-P energy: -11.224 tors. eta vs tors. theta energy: -17.223 Dist. restrs. and SS energy: 1.280 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 499 Temperature: 1.125900 Total energy: -230.079768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.079768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.113035 (E_RNA) where: Base-Base interactions energy: -151.854 where: short stacking energy: -70.106 Base-Backbone interact. energy: -0.273 local terms energy: -83.985908 where: bonds (distance) C4'-P energy: -20.231 bonds (distance) P-C4' energy: -18.913 flat angles C4'-P-C4' energy: -18.668 flat angles P-C4'-P energy: -12.865 tors. eta vs tors. theta energy: -13.309 Dist. restrs. and SS energy: 6.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 500 Temperature: 1.125450 Total energy: -216.431088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.431088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.342144 (E_RNA) where: Base-Base interactions energy: -155.238 where: short stacking energy: -61.396 Base-Backbone interact. energy: 0.287 local terms energy: -65.391184 where: bonds (distance) C4'-P energy: -18.165 bonds (distance) P-C4' energy: -16.671 flat angles C4'-P-C4' energy: -6.632 flat angles P-C4'-P energy: -11.231 tors. eta vs tors. theta energy: -12.692 Dist. restrs. and SS energy: 3.911 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 501 Temperature: 1.125000 Total energy: -229.439688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.439688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.484813 (E_RNA) where: Base-Base interactions energy: -153.787 where: short stacking energy: -70.375 Base-Backbone interact. energy: -0.383 local terms energy: -79.314000 where: bonds (distance) C4'-P energy: -14.488 bonds (distance) P-C4' energy: -19.483 flat angles C4'-P-C4' energy: -16.573 flat angles P-C4'-P energy: -15.464 tors. eta vs tors. theta energy: -13.306 Dist. restrs. and SS energy: 4.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 502 Temperature: 1.124550 Total energy: -231.744078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.744078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.329669 (E_RNA) where: Base-Base interactions energy: -157.269 where: short stacking energy: -70.857 Base-Backbone interact. energy: -0.221 local terms energy: -77.839651 where: bonds (distance) C4'-P energy: -15.014 bonds (distance) P-C4' energy: -19.385 flat angles C4'-P-C4' energy: -11.737 flat angles P-C4'-P energy: -11.380 tors. eta vs tors. theta energy: -20.324 Dist. restrs. and SS energy: 3.586 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 503 Temperature: 1.124100 Total energy: -251.475867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.475867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.610002 (E_RNA) where: Base-Base interactions energy: -172.798 where: short stacking energy: -81.993 Base-Backbone interact. energy: -0.569 local terms energy: -82.243237 where: bonds (distance) C4'-P energy: -16.092 bonds (distance) P-C4' energy: -15.388 flat angles C4'-P-C4' energy: -19.613 flat angles P-C4'-P energy: -8.274 tors. eta vs tors. theta energy: -22.875 Dist. restrs. and SS energy: 4.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 504 Temperature: 1.123650 Total energy: -262.724068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.724068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.550507 (E_RNA) where: Base-Base interactions energy: -186.499 where: short stacking energy: -86.425 Base-Backbone interact. energy: 0.164 local terms energy: -80.216206 where: bonds (distance) C4'-P energy: -6.353 bonds (distance) P-C4' energy: -18.048 flat angles C4'-P-C4' energy: -18.076 flat angles P-C4'-P energy: -14.919 tors. eta vs tors. theta energy: -22.821 Dist. restrs. and SS energy: 3.826 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 505 Temperature: 1.123200 Total energy: -262.926223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.926223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.681955 (E_RNA) where: Base-Base interactions energy: -183.011 where: short stacking energy: -85.492 Base-Backbone interact. energy: -0.065 local terms energy: -82.606642 where: bonds (distance) C4'-P energy: -8.753 bonds (distance) P-C4' energy: -18.022 flat angles C4'-P-C4' energy: -18.158 flat angles P-C4'-P energy: -13.323 tors. eta vs tors. theta energy: -24.351 Dist. restrs. and SS energy: 2.756 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 506 Temperature: 1.122750 Total energy: -265.043674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.043674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.842608 (E_RNA) where: Base-Base interactions energy: -181.397 where: short stacking energy: -86.315 Base-Backbone interact. energy: -0.051 local terms energy: -87.394472 where: bonds (distance) C4'-P energy: -15.466 bonds (distance) P-C4' energy: -16.060 flat angles C4'-P-C4' energy: -19.922 flat angles P-C4'-P energy: -11.382 tors. eta vs tors. theta energy: -24.564 Dist. restrs. and SS energy: 3.799 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 507 Temperature: 1.122300 Total energy: -266.717047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.717047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.214780 (E_RNA) where: Base-Base interactions energy: -185.886 where: short stacking energy: -96.627 Base-Backbone interact. energy: -0.630 local terms energy: -82.698976 where: bonds (distance) C4'-P energy: -6.929 bonds (distance) P-C4' energy: -15.201 flat angles C4'-P-C4' energy: -19.255 flat angles P-C4'-P energy: -12.691 tors. eta vs tors. theta energy: -28.624 Dist. restrs. and SS energy: 2.498 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 508 Temperature: 1.121850 Total energy: -259.306488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.306488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.400738 (E_RNA) where: Base-Base interactions energy: -180.860 where: short stacking energy: -94.016 Base-Backbone interact. energy: -0.073 local terms energy: -81.467946 where: bonds (distance) C4'-P energy: -13.479 bonds (distance) P-C4' energy: -19.554 flat angles C4'-P-C4' energy: -14.481 flat angles P-C4'-P energy: -8.024 tors. eta vs tors. theta energy: -25.931 Dist. restrs. and SS energy: 3.094 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 509 Temperature: 1.121400 Total energy: -264.711907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.711907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.979562 (E_RNA) where: Base-Base interactions energy: -177.853 where: short stacking energy: -83.087 Base-Backbone interact. energy: 0.632 local terms energy: -90.758897 where: bonds (distance) C4'-P energy: -19.606 bonds (distance) P-C4' energy: -19.508 flat angles C4'-P-C4' energy: -16.146 flat angles P-C4'-P energy: -11.048 tors. eta vs tors. theta energy: -24.450 Dist. restrs. and SS energy: 3.268 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 510 Temperature: 1.120950 Total energy: -251.365017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.365017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.219157 (E_RNA) where: Base-Base interactions energy: -170.646 where: short stacking energy: -85.549 Base-Backbone interact. energy: 0.496 local terms energy: -84.068513 where: bonds (distance) C4'-P energy: -12.891 bonds (distance) P-C4' energy: -16.168 flat angles C4'-P-C4' energy: -17.581 flat angles P-C4'-P energy: -11.012 tors. eta vs tors. theta energy: -26.416 Dist. restrs. and SS energy: 2.854 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 511 Temperature: 1.120500 Total energy: -252.654932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.654932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.724445 (E_RNA) where: Base-Base interactions energy: -175.826 where: short stacking energy: -73.639 Base-Backbone interact. energy: -2.231 local terms energy: -77.666854 where: bonds (distance) C4'-P energy: -13.573 bonds (distance) P-C4' energy: -8.382 flat angles C4'-P-C4' energy: -19.411 flat angles P-C4'-P energy: -13.667 tors. eta vs tors. theta energy: -22.633 Dist. restrs. and SS energy: 3.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 512 Temperature: 1.120050 Total energy: -271.754716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.754716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.024719 (E_RNA) where: Base-Base interactions energy: -188.277 where: short stacking energy: -89.331 Base-Backbone interact. energy: -0.961 local terms energy: -84.786579 where: bonds (distance) C4'-P energy: -15.193 bonds (distance) P-C4' energy: -14.097 flat angles C4'-P-C4' energy: -18.049 flat angles P-C4'-P energy: -14.104 tors. eta vs tors. theta energy: -23.345 Dist. restrs. and SS energy: 2.270 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 513 Temperature: 1.119600 Total energy: -268.765843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.765843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.455568 (E_RNA) where: Base-Base interactions energy: -194.163 where: short stacking energy: -91.689 Base-Backbone interact. energy: -1.216 local terms energy: -76.076075 where: bonds (distance) C4'-P energy: -14.145 bonds (distance) P-C4' energy: -14.155 flat angles C4'-P-C4' energy: -15.843 flat angles P-C4'-P energy: -9.634 tors. eta vs tors. theta energy: -22.299 Dist. restrs. and SS energy: 2.690 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 514 Temperature: 1.119150 Total energy: -270.403443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.403443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.809493 (E_RNA) where: Base-Base interactions energy: -183.687 where: short stacking energy: -85.825 Base-Backbone interact. energy: -0.003 local terms energy: -90.119764 where: bonds (distance) C4'-P energy: -20.293 bonds (distance) P-C4' energy: -17.539 flat angles C4'-P-C4' energy: -18.979 flat angles P-C4'-P energy: -9.732 tors. eta vs tors. theta energy: -23.577 Dist. restrs. and SS energy: 3.406 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 515 Temperature: 1.118700 Total energy: -273.513306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.513306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.833521 (E_RNA) where: Base-Base interactions energy: -187.304 where: short stacking energy: -84.698 Base-Backbone interact. energy: -0.579 local terms energy: -88.950333 where: bonds (distance) C4'-P energy: -14.483 bonds (distance) P-C4' energy: -19.890 flat angles C4'-P-C4' energy: -17.165 flat angles P-C4'-P energy: -14.827 tors. eta vs tors. theta energy: -22.585 Dist. restrs. and SS energy: 3.320 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 516 Temperature: 1.118250 Total energy: -272.687041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.687041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.251494 (E_RNA) where: Base-Base interactions energy: -195.888 where: short stacking energy: -83.190 Base-Backbone interact. energy: -0.020 local terms energy: -80.344189 where: bonds (distance) C4'-P energy: -16.624 bonds (distance) P-C4' energy: -19.665 flat angles C4'-P-C4' energy: -17.527 flat angles P-C4'-P energy: -4.890 tors. eta vs tors. theta energy: -21.638 Dist. restrs. and SS energy: 3.564 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 517 Temperature: 1.117800 Total energy: -266.110314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.110314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.866285 (E_RNA) where: Base-Base interactions energy: -181.237 where: short stacking energy: -77.110 Base-Backbone interact. energy: 0.026 local terms energy: -86.655406 where: bonds (distance) C4'-P energy: -18.413 bonds (distance) P-C4' energy: -18.437 flat angles C4'-P-C4' energy: -19.432 flat angles P-C4'-P energy: -10.037 tors. eta vs tors. theta energy: -20.337 Dist. restrs. and SS energy: 1.756 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 518 Temperature: 1.117350 Total energy: -255.761654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.761654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.518067 (E_RNA) where: Base-Base interactions energy: -177.007 where: short stacking energy: -81.066 Base-Backbone interact. energy: -0.021 local terms energy: -81.489804 where: bonds (distance) C4'-P energy: -16.960 bonds (distance) P-C4' energy: -14.724 flat angles C4'-P-C4' energy: -18.290 flat angles P-C4'-P energy: -14.518 tors. eta vs tors. theta energy: -16.999 Dist. restrs. and SS energy: 2.756 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 519 Temperature: 1.116900 Total energy: -280.493689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.493689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.712920 (E_RNA) where: Base-Base interactions energy: -190.426 where: short stacking energy: -89.016 Base-Backbone interact. energy: -0.012 local terms energy: -93.275123 where: bonds (distance) C4'-P energy: -20.399 bonds (distance) P-C4' energy: -18.173 flat angles C4'-P-C4' energy: -18.401 flat angles P-C4'-P energy: -10.741 tors. eta vs tors. theta energy: -25.560 Dist. restrs. and SS energy: 3.219 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 520 Temperature: 1.116450 Total energy: -266.044104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.044104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.819005 (E_RNA) where: Base-Base interactions energy: -189.615 where: short stacking energy: -89.732 Base-Backbone interact. energy: -0.007 local terms energy: -79.196697 where: bonds (distance) C4'-P energy: -10.990 bonds (distance) P-C4' energy: -10.781 flat angles C4'-P-C4' energy: -17.294 flat angles P-C4'-P energy: -16.209 tors. eta vs tors. theta energy: -23.922 Dist. restrs. and SS energy: 2.775 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 521 Temperature: 1.116000 Total energy: -254.405742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.405742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.604616 (E_RNA) where: Base-Base interactions energy: -175.960 where: short stacking energy: -85.206 Base-Backbone interact. energy: -0.793 local terms energy: -79.851822 where: bonds (distance) C4'-P energy: -15.121 bonds (distance) P-C4' energy: -17.667 flat angles C4'-P-C4' energy: -12.247 flat angles P-C4'-P energy: -11.242 tors. eta vs tors. theta energy: -23.574 Dist. restrs. and SS energy: 2.199 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 522 Temperature: 1.115550 Total energy: -260.341891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.341891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.474723 (E_RNA) where: Base-Base interactions energy: -172.267 where: short stacking energy: -79.806 Base-Backbone interact. energy: -0.004 local terms energy: -90.203738 where: bonds (distance) C4'-P energy: -17.969 bonds (distance) P-C4' energy: -20.195 flat angles C4'-P-C4' energy: -16.619 flat angles P-C4'-P energy: -12.567 tors. eta vs tors. theta energy: -22.853 Dist. restrs. and SS energy: 2.133 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 523 Temperature: 1.115100 Total energy: -244.954165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.954165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.368838 (E_RNA) where: Base-Base interactions energy: -174.968 where: short stacking energy: -77.420 Base-Backbone interact. energy: -0.238 local terms energy: -73.162551 where: bonds (distance) C4'-P energy: -11.001 bonds (distance) P-C4' energy: -17.071 flat angles C4'-P-C4' energy: -18.509 flat angles P-C4'-P energy: -9.340 tors. eta vs tors. theta energy: -17.242 Dist. restrs. and SS energy: 3.415 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 524 Temperature: 1.114650 Total energy: -245.446350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.446350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.599845 (E_RNA) where: Base-Base interactions energy: -160.335 where: short stacking energy: -74.153 Base-Backbone interact. energy: -0.155 local terms energy: -87.110346 where: bonds (distance) C4'-P energy: -11.416 bonds (distance) P-C4' energy: -20.152 flat angles C4'-P-C4' energy: -19.169 flat angles P-C4'-P energy: -13.402 tors. eta vs tors. theta energy: -22.971 Dist. restrs. and SS energy: 2.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 525 Temperature: 1.114200 Total energy: -262.153591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.153591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.798586 (E_RNA) where: Base-Base interactions energy: -181.780 where: short stacking energy: -89.884 Base-Backbone interact. energy: -0.092 local terms energy: -84.926631 where: bonds (distance) C4'-P energy: -13.442 bonds (distance) P-C4' energy: -20.503 flat angles C4'-P-C4' energy: -21.118 flat angles P-C4'-P energy: -8.947 tors. eta vs tors. theta energy: -20.917 Dist. restrs. and SS energy: 4.645 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 526 Temperature: 1.113750 Total energy: -259.424842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.424842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.165845 (E_RNA) where: Base-Base interactions energy: -175.371 where: short stacking energy: -72.261 Base-Backbone interact. energy: -0.697 local terms energy: -87.097832 where: bonds (distance) C4'-P energy: -19.829 bonds (distance) P-C4' energy: -16.758 flat angles C4'-P-C4' energy: -19.242 flat angles P-C4'-P energy: -9.593 tors. eta vs tors. theta energy: -21.676 Dist. restrs. and SS energy: 3.741 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 527 Temperature: 1.113300 Total energy: -258.628328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.628328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.239445 (E_RNA) where: Base-Base interactions energy: -184.007 where: short stacking energy: -84.184 Base-Backbone interact. energy: -0.156 local terms energy: -80.077067 where: bonds (distance) C4'-P energy: -12.452 bonds (distance) P-C4' energy: -19.857 flat angles C4'-P-C4' energy: -18.793 flat angles P-C4'-P energy: -3.656 tors. eta vs tors. theta energy: -25.319 Dist. restrs. and SS energy: 5.611 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 528 Temperature: 1.112850 Total energy: -269.775657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.775657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.598329 (E_RNA) where: Base-Base interactions energy: -187.429 where: short stacking energy: -89.246 Base-Backbone interact. energy: -0.469 local terms energy: -84.700562 where: bonds (distance) C4'-P energy: -16.739 bonds (distance) P-C4' energy: -15.971 flat angles C4'-P-C4' energy: -14.692 flat angles P-C4'-P energy: -8.918 tors. eta vs tors. theta energy: -28.381 Dist. restrs. and SS energy: 2.823 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 529 Temperature: 1.112400 Total energy: -267.655083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.655083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.408365 (E_RNA) where: Base-Base interactions energy: -184.808 where: short stacking energy: -91.991 Base-Backbone interact. energy: -0.055 local terms energy: -85.545490 where: bonds (distance) C4'-P energy: -15.828 bonds (distance) P-C4' energy: -17.425 flat angles C4'-P-C4' energy: -14.650 flat angles P-C4'-P energy: -11.294 tors. eta vs tors. theta energy: -26.348 Dist. restrs. and SS energy: 2.753 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 530 Temperature: 1.111950 Total energy: -270.429088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.429088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.244994 (E_RNA) where: Base-Base interactions energy: -184.754 where: short stacking energy: -89.999 Base-Backbone interact. energy: -0.366 local terms energy: -88.125086 where: bonds (distance) C4'-P energy: -14.519 bonds (distance) P-C4' energy: -18.779 flat angles C4'-P-C4' energy: -19.472 flat angles P-C4'-P energy: -8.749 tors. eta vs tors. theta energy: -26.607 Dist. restrs. and SS energy: 2.816 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 531 Temperature: 1.111500 Total energy: -275.849760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.849760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.409490 (E_RNA) where: Base-Base interactions energy: -184.850 where: short stacking energy: -92.651 Base-Backbone interact. energy: -0.220 local terms energy: -94.339280 where: bonds (distance) C4'-P energy: -13.438 bonds (distance) P-C4' energy: -18.505 flat angles C4'-P-C4' energy: -20.218 flat angles P-C4'-P energy: -16.706 tors. eta vs tors. theta energy: -25.471 Dist. restrs. and SS energy: 3.560 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 532 Temperature: 1.111050 Total energy: -264.882443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.882443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.853861 (E_RNA) where: Base-Base interactions energy: -176.267 where: short stacking energy: -81.961 Base-Backbone interact. energy: -1.473 local terms energy: -90.114313 where: bonds (distance) C4'-P energy: -14.062 bonds (distance) P-C4' energy: -17.681 flat angles C4'-P-C4' energy: -20.613 flat angles P-C4'-P energy: -13.132 tors. eta vs tors. theta energy: -24.627 Dist. restrs. and SS energy: 2.971 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 533 Temperature: 1.110600 Total energy: -276.273226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.273226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.754823 (E_RNA) where: Base-Base interactions energy: -189.313 where: short stacking energy: -90.149 Base-Backbone interact. energy: -0.007 local terms energy: -89.433914 where: bonds (distance) C4'-P energy: -21.460 bonds (distance) P-C4' energy: -18.296 flat angles C4'-P-C4' energy: -13.368 flat angles P-C4'-P energy: -11.317 tors. eta vs tors. theta energy: -24.992 Dist. restrs. and SS energy: 2.482 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 534 Temperature: 1.110150 Total energy: -276.807128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.807128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.348253 (E_RNA) where: Base-Base interactions energy: -185.183 where: short stacking energy: -86.520 Base-Backbone interact. energy: -0.001 local terms energy: -94.163645 where: bonds (distance) C4'-P energy: -18.822 bonds (distance) P-C4' energy: -18.998 flat angles C4'-P-C4' energy: -19.564 flat angles P-C4'-P energy: -14.409 tors. eta vs tors. theta energy: -22.372 Dist. restrs. and SS energy: 2.541 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 535 Temperature: 1.109700 Total energy: -279.736448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.736448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.577717 (E_RNA) where: Base-Base interactions energy: -195.958 where: short stacking energy: -89.732 Base-Backbone interact. energy: -0.242 local terms energy: -86.377800 where: bonds (distance) C4'-P energy: -13.954 bonds (distance) P-C4' energy: -18.075 flat angles C4'-P-C4' energy: -19.006 flat angles P-C4'-P energy: -9.945 tors. eta vs tors. theta energy: -25.398 Dist. restrs. and SS energy: 2.841 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 536 Temperature: 1.109250 Total energy: -285.302996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.302996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.757425 (E_RNA) where: Base-Base interactions energy: -190.185 where: short stacking energy: -85.358 Base-Backbone interact. energy: -0.730 local terms energy: -97.842849 where: bonds (distance) C4'-P energy: -17.366 bonds (distance) P-C4' energy: -20.753 flat angles C4'-P-C4' energy: -20.391 flat angles P-C4'-P energy: -12.060 tors. eta vs tors. theta energy: -27.273 Dist. restrs. and SS energy: 3.454 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 537 Temperature: 1.108800 Total energy: -279.469847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.469847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.645663 (E_RNA) where: Base-Base interactions energy: -192.090 where: short stacking energy: -93.701 Base-Backbone interact. energy: -0.340 local terms energy: -90.215157 where: bonds (distance) C4'-P energy: -15.585 bonds (distance) P-C4' energy: -19.850 flat angles C4'-P-C4' energy: -18.980 flat angles P-C4'-P energy: -12.491 tors. eta vs tors. theta energy: -23.309 Dist. restrs. and SS energy: 3.176 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 538 Temperature: 1.108350 Total energy: -259.500011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.500011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.855787 (E_RNA) where: Base-Base interactions energy: -177.235 where: short stacking energy: -72.310 Base-Backbone interact. energy: -0.767 local terms energy: -84.854212 where: bonds (distance) C4'-P energy: -20.081 bonds (distance) P-C4' energy: -20.548 flat angles C4'-P-C4' energy: -19.105 flat angles P-C4'-P energy: -1.956 tors. eta vs tors. theta energy: -23.165 Dist. restrs. and SS energy: 3.356 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 539 Temperature: 1.107900 Total energy: -271.559539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.559539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.028700 (E_RNA) where: Base-Base interactions energy: -188.457 where: short stacking energy: -86.094 Base-Backbone interact. energy: -0.615 local terms energy: -85.956598 where: bonds (distance) C4'-P energy: -10.497 bonds (distance) P-C4' energy: -15.414 flat angles C4'-P-C4' energy: -18.350 flat angles P-C4'-P energy: -16.248 tors. eta vs tors. theta energy: -25.447 Dist. restrs. and SS energy: 3.469 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 540 Temperature: 1.107450 Total energy: -278.969684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.969684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.371425 (E_RNA) where: Base-Base interactions energy: -193.133 where: short stacking energy: -86.878 Base-Backbone interact. energy: -0.092 local terms energy: -88.146783 where: bonds (distance) C4'-P energy: -16.495 bonds (distance) P-C4' energy: -18.134 flat angles C4'-P-C4' energy: -17.294 flat angles P-C4'-P energy: -13.671 tors. eta vs tors. theta energy: -22.552 Dist. restrs. and SS energy: 2.402 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 541 Temperature: 1.107000 Total energy: -275.467729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.467729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.100680 (E_RNA) where: Base-Base interactions energy: -194.318 where: short stacking energy: -88.546 Base-Backbone interact. energy: -0.107 local terms energy: -83.675804 where: bonds (distance) C4'-P energy: -17.379 bonds (distance) P-C4' energy: -15.155 flat angles C4'-P-C4' energy: -16.303 flat angles P-C4'-P energy: -11.197 tors. eta vs tors. theta energy: -23.642 Dist. restrs. and SS energy: 2.633 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 542 Temperature: 1.106550 Total energy: -275.765473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.765473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.251832 (E_RNA) where: Base-Base interactions energy: -183.742 where: short stacking energy: -88.681 Base-Backbone interact. energy: -0.110 local terms energy: -94.400418 where: bonds (distance) C4'-P energy: -14.184 bonds (distance) P-C4' energy: -18.246 flat angles C4'-P-C4' energy: -21.930 flat angles P-C4'-P energy: -15.466 tors. eta vs tors. theta energy: -24.574 Dist. restrs. and SS energy: 2.486 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 543 Temperature: 1.106100 Total energy: -264.803521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.803521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.791415 (E_RNA) where: Base-Base interactions energy: -175.867 where: short stacking energy: -84.340 Base-Backbone interact. energy: -0.175 local terms energy: -91.749083 where: bonds (distance) C4'-P energy: -15.904 bonds (distance) P-C4' energy: -18.586 flat angles C4'-P-C4' energy: -19.823 flat angles P-C4'-P energy: -12.125 tors. eta vs tors. theta energy: -25.311 Dist. restrs. and SS energy: 2.988 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 544 Temperature: 1.105650 Total energy: -260.056086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.056086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.589365 (E_RNA) where: Base-Base interactions energy: -177.772 where: short stacking energy: -85.376 Base-Backbone interact. energy: -0.053 local terms energy: -86.764079 where: bonds (distance) C4'-P energy: -16.561 bonds (distance) P-C4' energy: -14.354 flat angles C4'-P-C4' energy: -19.156 flat angles P-C4'-P energy: -10.267 tors. eta vs tors. theta energy: -26.426 Dist. restrs. and SS energy: 4.533 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 545 Temperature: 1.105200 Total energy: -263.370572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.370572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.409451 (E_RNA) where: Base-Base interactions energy: -168.782 where: short stacking energy: -79.653 Base-Backbone interact. energy: -0.019 local terms energy: -96.608223 where: bonds (distance) C4'-P energy: -17.033 bonds (distance) P-C4' energy: -20.176 flat angles C4'-P-C4' energy: -20.209 flat angles P-C4'-P energy: -15.091 tors. eta vs tors. theta energy: -24.099 Dist. restrs. and SS energy: 2.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 546 Temperature: 1.104750 Total energy: -254.946138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.946138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.236118 (E_RNA) where: Base-Base interactions energy: -179.450 where: short stacking energy: -87.269 Base-Backbone interact. energy: -0.145 local terms energy: -77.641017 where: bonds (distance) C4'-P energy: -15.917 bonds (distance) P-C4' energy: -14.897 flat angles C4'-P-C4' energy: -19.420 flat angles P-C4'-P energy: -7.745 tors. eta vs tors. theta energy: -19.662 Dist. restrs. and SS energy: 2.290 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 547 Temperature: 1.104300 Total energy: -245.365903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.365903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.723933 (E_RNA) where: Base-Base interactions energy: -171.873 where: short stacking energy: -75.536 Base-Backbone interact. energy: 1.408 local terms energy: -77.259466 where: bonds (distance) C4'-P energy: -17.834 bonds (distance) P-C4' energy: -10.943 flat angles C4'-P-C4' energy: -17.135 flat angles P-C4'-P energy: -11.493 tors. eta vs tors. theta energy: -19.855 Dist. restrs. and SS energy: 2.358 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 548 Temperature: 1.103850 Total energy: -235.414751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.414751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.211022 (E_RNA) where: Base-Base interactions energy: -168.096 where: short stacking energy: -72.204 Base-Backbone interact. energy: 0.212 local terms energy: -73.327945 where: bonds (distance) C4'-P energy: -15.958 bonds (distance) P-C4' energy: -11.408 flat angles C4'-P-C4' energy: -19.083 flat angles P-C4'-P energy: -10.833 tors. eta vs tors. theta energy: -16.045 Dist. restrs. and SS energy: 5.796 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 549 Temperature: 1.103400 Total energy: -256.273934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.273934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.686194 (E_RNA) where: Base-Base interactions energy: -184.132 where: short stacking energy: -69.470 Base-Backbone interact. energy: 0.400 local terms energy: -75.953694 where: bonds (distance) C4'-P energy: -13.927 bonds (distance) P-C4' energy: -19.773 flat angles C4'-P-C4' energy: -14.589 flat angles P-C4'-P energy: -13.110 tors. eta vs tors. theta energy: -14.554 Dist. restrs. and SS energy: 3.412 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 550 Temperature: 1.102950 Total energy: -231.960991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.960991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.372932 (E_RNA) where: Base-Base interactions energy: -159.093 where: short stacking energy: -67.236 Base-Backbone interact. energy: -0.135 local terms energy: -76.145188 where: bonds (distance) C4'-P energy: -16.153 bonds (distance) P-C4' energy: -18.269 flat angles C4'-P-C4' energy: -12.679 flat angles P-C4'-P energy: -15.128 tors. eta vs tors. theta energy: -13.916 Dist. restrs. and SS energy: 3.412 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 551 Temperature: 1.102500 Total energy: -230.126546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.126546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.672059 (E_RNA) where: Base-Base interactions energy: -165.137 where: short stacking energy: -74.157 Base-Backbone interact. energy: -0.204 local terms energy: -70.331586 where: bonds (distance) C4'-P energy: -15.168 bonds (distance) P-C4' energy: -13.591 flat angles C4'-P-C4' energy: -17.914 flat angles P-C4'-P energy: -9.045 tors. eta vs tors. theta energy: -14.614 Dist. restrs. and SS energy: 5.546 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 552 Temperature: 1.102050 Total energy: -239.810982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.810982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.539075 (E_RNA) where: Base-Base interactions energy: -169.841 where: short stacking energy: -67.043 Base-Backbone interact. energy: 0.033 local terms energy: -73.731010 where: bonds (distance) C4'-P energy: -13.396 bonds (distance) P-C4' energy: -20.000 flat angles C4'-P-C4' energy: -14.911 flat angles P-C4'-P energy: -9.671 tors. eta vs tors. theta energy: -15.753 Dist. restrs. and SS energy: 3.728 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 553 Temperature: 1.101600 Total energy: -246.946820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.946820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.799990 (E_RNA) where: Base-Base interactions energy: -162.096 where: short stacking energy: -65.864 Base-Backbone interact. energy: -2.307 local terms energy: -85.396960 where: bonds (distance) C4'-P energy: -12.542 bonds (distance) P-C4' energy: -19.791 flat angles C4'-P-C4' energy: -18.630 flat angles P-C4'-P energy: -13.120 tors. eta vs tors. theta energy: -21.314 Dist. restrs. and SS energy: 2.853 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 554 Temperature: 1.101150 Total energy: -224.923301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.923301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.508482 (E_RNA) where: Base-Base interactions energy: -160.583 where: short stacking energy: -65.913 Base-Backbone interact. energy: -0.196 local terms energy: -66.729350 where: bonds (distance) C4'-P energy: -16.591 bonds (distance) P-C4' energy: -15.458 flat angles C4'-P-C4' energy: -13.573 flat angles P-C4'-P energy: -3.403 tors. eta vs tors. theta energy: -17.705 Dist. restrs. and SS energy: 2.585 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 555 Temperature: 1.100700 Total energy: -236.253304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.253304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.211600 (E_RNA) where: Base-Base interactions energy: -165.005 where: short stacking energy: -62.745 Base-Backbone interact. energy: -0.210 local terms energy: -74.997125 where: bonds (distance) C4'-P energy: -14.775 bonds (distance) P-C4' energy: -20.569 flat angles C4'-P-C4' energy: -12.812 flat angles P-C4'-P energy: -10.402 tors. eta vs tors. theta energy: -16.439 Dist. restrs. and SS energy: 3.958 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 556 Temperature: 1.100250 Total energy: -247.876472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.876472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.058258 (E_RNA) where: Base-Base interactions energy: -170.370 where: short stacking energy: -78.025 Base-Backbone interact. energy: -0.085 local terms energy: -79.603352 where: bonds (distance) C4'-P energy: -13.793 bonds (distance) P-C4' energy: -18.264 flat angles C4'-P-C4' energy: -18.088 flat angles P-C4'-P energy: -11.748 tors. eta vs tors. theta energy: -17.711 Dist. restrs. and SS energy: 2.182 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 557 Temperature: 1.099800 Total energy: -257.643647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.643647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.664425 (E_RNA) where: Base-Base interactions energy: -177.045 where: short stacking energy: -72.933 Base-Backbone interact. energy: -1.110 local terms energy: -83.509749 where: bonds (distance) C4'-P energy: -17.584 bonds (distance) P-C4' energy: -17.403 flat angles C4'-P-C4' energy: -19.276 flat angles P-C4'-P energy: -10.781 tors. eta vs tors. theta energy: -18.465 Dist. restrs. and SS energy: 4.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 558 Temperature: 1.099350 Total energy: -251.110763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.110763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.850512 (E_RNA) where: Base-Base interactions energy: -181.937 where: short stacking energy: -81.396 Base-Backbone interact. energy: 0.756 local terms energy: -72.669835 where: bonds (distance) C4'-P energy: -15.392 bonds (distance) P-C4' energy: -12.881 flat angles C4'-P-C4' energy: -15.783 flat angles P-C4'-P energy: -8.293 tors. eta vs tors. theta energy: -20.320 Dist. restrs. and SS energy: 2.740 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 559 Temperature: 1.098900 Total energy: -240.544459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.544459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.938941 (E_RNA) where: Base-Base interactions energy: -173.932 where: short stacking energy: -71.357 Base-Backbone interact. energy: -1.603 local terms energy: -69.403990 where: bonds (distance) C4'-P energy: -14.605 bonds (distance) P-C4' energy: -20.264 flat angles C4'-P-C4' energy: -9.430 flat angles P-C4'-P energy: -11.411 tors. eta vs tors. theta energy: -13.695 Dist. restrs. and SS energy: 4.394 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 560 Temperature: 1.098450 Total energy: -266.942585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.942585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.350973 (E_RNA) where: Base-Base interactions energy: -188.107 where: short stacking energy: -75.716 Base-Backbone interact. energy: -0.378 local terms energy: -82.866423 where: bonds (distance) C4'-P energy: -18.793 bonds (distance) P-C4' energy: -14.646 flat angles C4'-P-C4' energy: -17.469 flat angles P-C4'-P energy: -16.500 tors. eta vs tors. theta energy: -15.459 Dist. restrs. and SS energy: 4.408 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 561 Temperature: 1.098000 Total energy: -252.282084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.282084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.616242 (E_RNA) where: Base-Base interactions energy: -177.244 where: short stacking energy: -76.140 Base-Backbone interact. energy: -1.479 local terms energy: -76.893199 where: bonds (distance) C4'-P energy: -15.774 bonds (distance) P-C4' energy: -15.130 flat angles C4'-P-C4' energy: -17.169 flat angles P-C4'-P energy: -10.377 tors. eta vs tors. theta energy: -18.444 Dist. restrs. and SS energy: 3.334 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 562 Temperature: 1.097550 Total energy: -267.780341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.780341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.010837 (E_RNA) where: Base-Base interactions energy: -195.225 where: short stacking energy: -86.156 Base-Backbone interact. energy: -0.477 local terms energy: -76.309655 where: bonds (distance) C4'-P energy: -17.945 bonds (distance) P-C4' energy: -12.171 flat angles C4'-P-C4' energy: -19.670 flat angles P-C4'-P energy: -9.956 tors. eta vs tors. theta energy: -16.567 Dist. restrs. and SS energy: 4.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 563 Temperature: 1.097100 Total energy: -265.740421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.740421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.335821 (E_RNA) where: Base-Base interactions energy: -186.020 where: short stacking energy: -82.072 Base-Backbone interact. energy: 0.378 local terms energy: -84.693912 where: bonds (distance) C4'-P energy: -19.448 bonds (distance) P-C4' energy: -14.550 flat angles C4'-P-C4' energy: -19.348 flat angles P-C4'-P energy: -12.256 tors. eta vs tors. theta energy: -19.092 Dist. restrs. and SS energy: 4.595 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 564 Temperature: 1.096650 Total energy: -266.527879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.527879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.943066 (E_RNA) where: Base-Base interactions energy: -186.993 where: short stacking energy: -72.358 Base-Backbone interact. energy: -1.312 local terms energy: -80.638538 where: bonds (distance) C4'-P energy: -16.653 bonds (distance) P-C4' energy: -16.038 flat angles C4'-P-C4' energy: -14.076 flat angles P-C4'-P energy: -9.853 tors. eta vs tors. theta energy: -24.019 Dist. restrs. and SS energy: 2.415 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 565 Temperature: 1.096200 Total energy: -263.101270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.101270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.306201 (E_RNA) where: Base-Base interactions energy: -189.338 where: short stacking energy: -83.209 Base-Backbone interact. energy: -0.505 local terms energy: -76.463591 where: bonds (distance) C4'-P energy: -19.850 bonds (distance) P-C4' energy: -8.681 flat angles C4'-P-C4' energy: -13.899 flat angles P-C4'-P energy: -15.359 tors. eta vs tors. theta energy: -18.675 Dist. restrs. and SS energy: 3.205 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 566 Temperature: 1.095750 Total energy: -272.452756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.452756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.794748 (E_RNA) where: Base-Base interactions energy: -187.241 where: short stacking energy: -77.852 Base-Backbone interact. energy: -0.773 local terms energy: -86.781156 where: bonds (distance) C4'-P energy: -16.765 bonds (distance) P-C4' energy: -20.214 flat angles C4'-P-C4' energy: -17.262 flat angles P-C4'-P energy: -11.157 tors. eta vs tors. theta energy: -21.384 Dist. restrs. and SS energy: 2.342 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 567 Temperature: 1.095300 Total energy: -272.182831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.182831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.420033 (E_RNA) where: Base-Base interactions energy: -188.338 where: short stacking energy: -85.349 Base-Backbone interact. energy: -0.946 local terms energy: -86.135203 where: bonds (distance) C4'-P energy: -14.196 bonds (distance) P-C4' energy: -21.781 flat angles C4'-P-C4' energy: -19.826 flat angles P-C4'-P energy: -9.843 tors. eta vs tors. theta energy: -20.489 Dist. restrs. and SS energy: 3.237 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 568 Temperature: 1.094850 Total energy: -275.865393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.865393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.895906 (E_RNA) where: Base-Base interactions energy: -195.416 where: short stacking energy: -86.414 Base-Backbone interact. energy: -2.215 local terms energy: -82.264797 where: bonds (distance) C4'-P energy: -11.888 bonds (distance) P-C4' energy: -19.879 flat angles C4'-P-C4' energy: -15.393 flat angles P-C4'-P energy: -11.013 tors. eta vs tors. theta energy: -24.091 Dist. restrs. and SS energy: 4.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 569 Temperature: 1.094400 Total energy: -274.164796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.164796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.423028 (E_RNA) where: Base-Base interactions energy: -187.386 where: short stacking energy: -80.281 Base-Backbone interact. energy: -0.158 local terms energy: -88.878836 where: bonds (distance) C4'-P energy: -17.329 bonds (distance) P-C4' energy: -18.310 flat angles C4'-P-C4' energy: -18.087 flat angles P-C4'-P energy: -11.755 tors. eta vs tors. theta energy: -23.398 Dist. restrs. and SS energy: 2.258 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 570 Temperature: 1.093950 Total energy: -272.019254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.019254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.336791 (E_RNA) where: Base-Base interactions energy: -189.397 where: short stacking energy: -88.504 Base-Backbone interact. energy: -0.016 local terms energy: -85.923851 where: bonds (distance) C4'-P energy: -15.395 bonds (distance) P-C4' energy: -12.721 flat angles C4'-P-C4' energy: -21.283 flat angles P-C4'-P energy: -13.108 tors. eta vs tors. theta energy: -23.418 Dist. restrs. and SS energy: 3.318 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 571 Temperature: 1.093500 Total energy: -275.808819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.808819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.318271 (E_RNA) where: Base-Base interactions energy: -187.667 where: short stacking energy: -90.700 Base-Backbone interact. energy: -0.005 local terms energy: -90.647031 where: bonds (distance) C4'-P energy: -18.961 bonds (distance) P-C4' energy: -17.466 flat angles C4'-P-C4' energy: -19.430 flat angles P-C4'-P energy: -11.757 tors. eta vs tors. theta energy: -23.033 Dist. restrs. and SS energy: 2.509 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 572 Temperature: 1.093050 Total energy: -265.257796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.257796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.420276 (E_RNA) where: Base-Base interactions energy: -177.425 where: short stacking energy: -77.263 Base-Backbone interact. energy: -0.004 local terms energy: -89.991859 where: bonds (distance) C4'-P energy: -18.537 bonds (distance) P-C4' energy: -20.619 flat angles C4'-P-C4' energy: -14.821 flat angles P-C4'-P energy: -11.638 tors. eta vs tors. theta energy: -24.376 Dist. restrs. and SS energy: 2.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 573 Temperature: 1.092600 Total energy: -261.270804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.270804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.918999 (E_RNA) where: Base-Base interactions energy: -173.543 where: short stacking energy: -77.319 Base-Backbone interact. energy: -2.179 local terms energy: -87.196922 where: bonds (distance) C4'-P energy: -15.099 bonds (distance) P-C4' energy: -15.830 flat angles C4'-P-C4' energy: -19.306 flat angles P-C4'-P energy: -14.419 tors. eta vs tors. theta energy: -22.543 Dist. restrs. and SS energy: 1.648 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 574 Temperature: 1.092150 Total energy: -261.422649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.422649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.958448 (E_RNA) where: Base-Base interactions energy: -178.390 where: short stacking energy: -76.493 Base-Backbone interact. energy: -1.846 local terms energy: -83.723127 where: bonds (distance) C4'-P energy: -10.323 bonds (distance) P-C4' energy: -16.914 flat angles C4'-P-C4' energy: -18.722 flat angles P-C4'-P energy: -14.066 tors. eta vs tors. theta energy: -23.699 Dist. restrs. and SS energy: 2.536 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 575 Temperature: 1.091700 Total energy: -259.626268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.626268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.661664 (E_RNA) where: Base-Base interactions energy: -178.164 where: short stacking energy: -82.754 Base-Backbone interact. energy: -0.180 local terms energy: -82.317526 where: bonds (distance) C4'-P energy: -16.301 bonds (distance) P-C4' energy: -17.815 flat angles C4'-P-C4' energy: -17.366 flat angles P-C4'-P energy: -10.665 tors. eta vs tors. theta energy: -20.170 Dist. restrs. and SS energy: 1.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 576 Temperature: 1.091250 Total energy: -266.627767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.627767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.203028 (E_RNA) where: Base-Base interactions energy: -184.579 where: short stacking energy: -93.358 Base-Backbone interact. energy: -1.607 local terms energy: -82.017335 where: bonds (distance) C4'-P energy: -16.707 bonds (distance) P-C4' energy: -12.204 flat angles C4'-P-C4' energy: -19.027 flat angles P-C4'-P energy: -11.235 tors. eta vs tors. theta energy: -22.844 Dist. restrs. and SS energy: 1.575 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 577 Temperature: 1.090800 Total energy: -253.855267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.855267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.296598 (E_RNA) where: Base-Base interactions energy: -178.554 where: short stacking energy: -75.369 Base-Backbone interact. energy: 1.139 local terms energy: -77.882401 where: bonds (distance) C4'-P energy: -16.752 bonds (distance) P-C4' energy: -17.998 flat angles C4'-P-C4' energy: -17.157 flat angles P-C4'-P energy: -4.453 tors. eta vs tors. theta energy: -21.523 Dist. restrs. and SS energy: 1.441 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 578 Temperature: 1.090350 Total energy: -253.913760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.913760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.769622 (E_RNA) where: Base-Base interactions energy: -172.046 where: short stacking energy: -77.186 Base-Backbone interact. energy: -1.409 local terms energy: -82.315118 where: bonds (distance) C4'-P energy: -17.063 bonds (distance) P-C4' energy: -19.086 flat angles C4'-P-C4' energy: -17.567 flat angles P-C4'-P energy: -9.018 tors. eta vs tors. theta energy: -19.582 Dist. restrs. and SS energy: 1.856 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 579 Temperature: 1.089900 Total energy: -267.299451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.299451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.241229 (E_RNA) where: Base-Base interactions energy: -185.468 where: short stacking energy: -86.430 Base-Backbone interact. energy: -0.688 local terms energy: -83.084715 where: bonds (distance) C4'-P energy: -15.020 bonds (distance) P-C4' energy: -11.571 flat angles C4'-P-C4' energy: -20.345 flat angles P-C4'-P energy: -11.490 tors. eta vs tors. theta energy: -24.659 Dist. restrs. and SS energy: 1.942 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 580 Temperature: 1.089450 Total energy: -268.701445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.701445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.106789 (E_RNA) where: Base-Base interactions energy: -187.297 where: short stacking energy: -91.365 Base-Backbone interact. energy: -1.236 local terms energy: -82.574271 where: bonds (distance) C4'-P energy: -13.061 bonds (distance) P-C4' energy: -16.664 flat angles C4'-P-C4' energy: -19.170 flat angles P-C4'-P energy: -11.643 tors. eta vs tors. theta energy: -22.037 Dist. restrs. and SS energy: 2.405 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 581 Temperature: 1.089000 Total energy: -276.568523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.568523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.387341 (E_RNA) where: Base-Base interactions energy: -184.579 where: short stacking energy: -85.889 Base-Backbone interact. energy: -2.842 local terms energy: -90.966351 where: bonds (distance) C4'-P energy: -15.731 bonds (distance) P-C4' energy: -21.564 flat angles C4'-P-C4' energy: -15.740 flat angles P-C4'-P energy: -12.151 tors. eta vs tors. theta energy: -25.781 Dist. restrs. and SS energy: 1.819 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 582 Temperature: 1.088550 Total energy: -275.965683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.965683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.791979 (E_RNA) where: Base-Base interactions energy: -193.189 where: short stacking energy: -91.430 Base-Backbone interact. energy: -0.388 local terms energy: -85.214371 where: bonds (distance) C4'-P energy: -10.784 bonds (distance) P-C4' energy: -17.063 flat angles C4'-P-C4' energy: -20.495 flat angles P-C4'-P energy: -16.531 tors. eta vs tors. theta energy: -20.342 Dist. restrs. and SS energy: 2.826 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 583 Temperature: 1.088100 Total energy: -271.638042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.638042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.963631 (E_RNA) where: Base-Base interactions energy: -187.383 where: short stacking energy: -82.810 Base-Backbone interact. energy: -0.627 local terms energy: -85.953442 where: bonds (distance) C4'-P energy: -17.143 bonds (distance) P-C4' energy: -12.793 flat angles C4'-P-C4' energy: -20.090 flat angles P-C4'-P energy: -14.563 tors. eta vs tors. theta energy: -21.365 Dist. restrs. and SS energy: 2.326 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 584 Temperature: 1.087650 Total energy: -281.891082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.891082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.577879 (E_RNA) where: Base-Base interactions energy: -187.525 where: short stacking energy: -91.896 Base-Backbone interact. energy: -1.080 local terms energy: -94.973186 where: bonds (distance) C4'-P energy: -16.998 bonds (distance) P-C4' energy: -18.703 flat angles C4'-P-C4' energy: -20.461 flat angles P-C4'-P energy: -12.943 tors. eta vs tors. theta energy: -25.869 Dist. restrs. and SS energy: 1.687 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 585 Temperature: 1.087200 Total energy: -271.858112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.858112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.665233 (E_RNA) where: Base-Base interactions energy: -183.318 where: short stacking energy: -94.716 Base-Backbone interact. energy: -0.881 local terms energy: -89.465915 where: bonds (distance) C4'-P energy: -17.565 bonds (distance) P-C4' energy: -18.230 flat angles C4'-P-C4' energy: -20.701 flat angles P-C4'-P energy: -7.435 tors. eta vs tors. theta energy: -25.535 Dist. restrs. and SS energy: 1.807 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 586 Temperature: 1.086750 Total energy: -256.877422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.877422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.904203 (E_RNA) where: Base-Base interactions energy: -182.798 where: short stacking energy: -78.055 Base-Backbone interact. energy: -1.326 local terms energy: -76.780182 where: bonds (distance) C4'-P energy: -15.854 bonds (distance) P-C4' energy: -13.918 flat angles C4'-P-C4' energy: -17.117 flat angles P-C4'-P energy: -11.846 tors. eta vs tors. theta energy: -18.045 Dist. restrs. and SS energy: 4.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 587 Temperature: 1.086300 Total energy: -261.773932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.773932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.834183 (E_RNA) where: Base-Base interactions energy: -172.592 where: short stacking energy: -73.623 Base-Backbone interact. energy: -2.056 local terms energy: -90.186344 where: bonds (distance) C4'-P energy: -15.763 bonds (distance) P-C4' energy: -19.821 flat angles C4'-P-C4' energy: -20.188 flat angles P-C4'-P energy: -12.944 tors. eta vs tors. theta energy: -21.471 Dist. restrs. and SS energy: 3.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 588 Temperature: 1.085850 Total energy: -256.404754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.404754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.743296 (E_RNA) where: Base-Base interactions energy: -168.286 where: short stacking energy: -74.289 Base-Backbone interact. energy: -1.073 local terms energy: -89.384427 where: bonds (distance) C4'-P energy: -16.233 bonds (distance) P-C4' energy: -17.459 flat angles C4'-P-C4' energy: -21.154 flat angles P-C4'-P energy: -12.880 tors. eta vs tors. theta energy: -21.659 Dist. restrs. and SS energy: 2.339 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 589 Temperature: 1.085400 Total energy: -264.436275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.436275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.817558 (E_RNA) where: Base-Base interactions energy: -183.297 where: short stacking energy: -83.726 Base-Backbone interact. energy: -0.034 local terms energy: -84.486728 where: bonds (distance) C4'-P energy: -16.464 bonds (distance) P-C4' energy: -18.571 flat angles C4'-P-C4' energy: -15.244 flat angles P-C4'-P energy: -8.114 tors. eta vs tors. theta energy: -26.095 Dist. restrs. and SS energy: 3.381 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 590 Temperature: 1.084950 Total energy: -263.684325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.684325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.376963 (E_RNA) where: Base-Base interactions energy: -173.129 where: short stacking energy: -95.940 Base-Backbone interact. energy: -0.155 local terms energy: -93.093684 where: bonds (distance) C4'-P energy: -20.855 bonds (distance) P-C4' energy: -20.040 flat angles C4'-P-C4' energy: -15.885 flat angles P-C4'-P energy: -11.681 tors. eta vs tors. theta energy: -24.633 Dist. restrs. and SS energy: 2.693 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 591 Temperature: 1.084500 Total energy: -276.265791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.265791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.727927 (E_RNA) where: Base-Base interactions energy: -201.984 where: short stacking energy: -95.079 Base-Backbone interact. energy: -0.003 local terms energy: -77.741219 where: bonds (distance) C4'-P energy: -7.773 bonds (distance) P-C4' energy: -17.709 flat angles C4'-P-C4' energy: -16.009 flat angles P-C4'-P energy: -10.060 tors. eta vs tors. theta energy: -26.190 Dist. restrs. and SS energy: 3.462 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 592 Temperature: 1.084050 Total energy: -278.221917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.221917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.302135 (E_RNA) where: Base-Base interactions energy: -190.502 where: short stacking energy: -88.519 Base-Backbone interact. energy: -0.796 local terms energy: -91.004318 where: bonds (distance) C4'-P energy: -15.409 bonds (distance) P-C4' energy: -17.537 flat angles C4'-P-C4' energy: -18.442 flat angles P-C4'-P energy: -12.287 tors. eta vs tors. theta energy: -27.329 Dist. restrs. and SS energy: 4.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 593 Temperature: 1.083600 Total energy: -280.724169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.724169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.777713 (E_RNA) where: Base-Base interactions energy: -190.500 where: short stacking energy: -90.289 Base-Backbone interact. energy: 0.112 local terms energy: -93.389098 where: bonds (distance) C4'-P energy: -20.851 bonds (distance) P-C4' energy: -14.759 flat angles C4'-P-C4' energy: -19.379 flat angles P-C4'-P energy: -11.126 tors. eta vs tors. theta energy: -27.274 Dist. restrs. and SS energy: 3.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 594 Temperature: 1.083150 Total energy: -286.524193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.524193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.449121 (E_RNA) where: Base-Base interactions energy: -187.479 where: short stacking energy: -89.327 Base-Backbone interact. energy: -0.182 local terms energy: -101.788105 where: bonds (distance) C4'-P energy: -18.496 bonds (distance) P-C4' energy: -19.079 flat angles C4'-P-C4' energy: -21.334 flat angles P-C4'-P energy: -13.071 tors. eta vs tors. theta energy: -29.807 Dist. restrs. and SS energy: 2.925 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 595 Temperature: 1.082700 Total energy: -273.473727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.473727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.256718 (E_RNA) where: Base-Base interactions energy: -185.282 where: short stacking energy: -88.350 Base-Backbone interact. energy: -1.040 local terms energy: -89.934846 where: bonds (distance) C4'-P energy: -12.278 bonds (distance) P-C4' energy: -20.218 flat angles C4'-P-C4' energy: -15.997 flat angles P-C4'-P energy: -13.065 tors. eta vs tors. theta energy: -28.378 Dist. restrs. and SS energy: 2.783 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 596 Temperature: 1.082250 Total energy: -287.613777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.613777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.540798 (E_RNA) where: Base-Base interactions energy: -195.210 where: short stacking energy: -98.122 Base-Backbone interact. energy: -0.002 local terms energy: -95.329075 where: bonds (distance) C4'-P energy: -17.655 bonds (distance) P-C4' energy: -20.359 flat angles C4'-P-C4' energy: -16.690 flat angles P-C4'-P energy: -15.001 tors. eta vs tors. theta energy: -25.624 Dist. restrs. and SS energy: 2.927 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 597 Temperature: 1.081800 Total energy: -272.729780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.729780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.631763 (E_RNA) where: Base-Base interactions energy: -188.964 where: short stacking energy: -88.413 Base-Backbone interact. energy: -0.191 local terms energy: -86.476360 where: bonds (distance) C4'-P energy: -11.351 bonds (distance) P-C4' energy: -19.398 flat angles C4'-P-C4' energy: -18.017 flat angles P-C4'-P energy: -13.118 tors. eta vs tors. theta energy: -24.592 Dist. restrs. and SS energy: 2.902 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 598 Temperature: 1.081350 Total energy: -275.228628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.228628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.877746 (E_RNA) where: Base-Base interactions energy: -181.343 where: short stacking energy: -94.296 Base-Backbone interact. energy: -0.021 local terms energy: -96.514113 where: bonds (distance) C4'-P energy: -16.086 bonds (distance) P-C4' energy: -21.455 flat angles C4'-P-C4' energy: -19.139 flat angles P-C4'-P energy: -12.192 tors. eta vs tors. theta energy: -27.641 Dist. restrs. and SS energy: 2.649 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 599 Temperature: 1.080900 Total energy: -277.488785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.488785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.977634 (E_RNA) where: Base-Base interactions energy: -188.293 where: short stacking energy: -84.912 Base-Backbone interact. energy: -0.003 local terms energy: -91.681397 where: bonds (distance) C4'-P energy: -13.470 bonds (distance) P-C4' energy: -18.718 flat angles C4'-P-C4' energy: -21.391 flat angles P-C4'-P energy: -10.902 tors. eta vs tors. theta energy: -27.201 Dist. restrs. and SS energy: 2.489 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 600 Temperature: 1.080450 Total energy: -295.572670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.572670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.463128 (E_RNA) where: Base-Base interactions energy: -200.379 where: short stacking energy: -100.137 Base-Backbone interact. energy: -0.013 local terms energy: -98.070607 where: bonds (distance) C4'-P energy: -12.912 bonds (distance) P-C4' energy: -19.234 flat angles C4'-P-C4' energy: -22.034 flat angles P-C4'-P energy: -15.882 tors. eta vs tors. theta energy: -28.008 Dist. restrs. and SS energy: 2.890 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 601 Temperature: 1.080000 Total energy: -278.922312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.922312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.669596 (E_RNA) where: Base-Base interactions energy: -192.385 where: short stacking energy: -90.636 Base-Backbone interact. energy: -0.081 local terms energy: -89.203496 where: bonds (distance) C4'-P energy: -17.848 bonds (distance) P-C4' energy: -16.174 flat angles C4'-P-C4' energy: -13.708 flat angles P-C4'-P energy: -13.278 tors. eta vs tors. theta energy: -28.196 Dist. restrs. and SS energy: 2.747 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 602 Temperature: 1.079550 Total energy: -281.178809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.178809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.951211 (E_RNA) where: Base-Base interactions energy: -188.522 where: short stacking energy: -83.518 Base-Backbone interact. energy: -0.051 local terms energy: -95.378140 where: bonds (distance) C4'-P energy: -16.648 bonds (distance) P-C4' energy: -18.160 flat angles C4'-P-C4' energy: -18.646 flat angles P-C4'-P energy: -15.489 tors. eta vs tors. theta energy: -26.435 Dist. restrs. and SS energy: 2.772 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 603 Temperature: 1.079100 Total energy: -275.755011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.755011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.572594 (E_RNA) where: Base-Base interactions energy: -182.147 where: short stacking energy: -92.210 Base-Backbone interact. energy: 0.080 local terms energy: -96.505886 where: bonds (distance) C4'-P energy: -17.374 bonds (distance) P-C4' energy: -18.997 flat angles C4'-P-C4' energy: -17.314 flat angles P-C4'-P energy: -18.118 tors. eta vs tors. theta energy: -24.702 Dist. restrs. and SS energy: 2.818 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 604 Temperature: 1.078650 Total energy: -283.733202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.733202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.216856 (E_RNA) where: Base-Base interactions energy: -199.889 where: short stacking energy: -95.735 Base-Backbone interact. energy: -0.013 local terms energy: -86.314672 where: bonds (distance) C4'-P energy: -16.476 bonds (distance) P-C4' energy: -21.796 flat angles C4'-P-C4' energy: -17.826 flat angles P-C4'-P energy: -8.155 tors. eta vs tors. theta energy: -22.062 Dist. restrs. and SS energy: 2.484 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 605 Temperature: 1.078200 Total energy: -280.970726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.970726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.200650 (E_RNA) where: Base-Base interactions energy: -194.321 where: short stacking energy: -83.005 Base-Backbone interact. energy: -0.216 local terms energy: -88.663212 where: bonds (distance) C4'-P energy: -19.413 bonds (distance) P-C4' energy: -15.809 flat angles C4'-P-C4' energy: -15.326 flat angles P-C4'-P energy: -13.838 tors. eta vs tors. theta energy: -24.277 Dist. restrs. and SS energy: 2.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 606 Temperature: 1.077750 Total energy: -286.583612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.583612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.032521 (E_RNA) where: Base-Base interactions energy: -197.806 where: short stacking energy: -88.831 Base-Backbone interact. energy: 0.439 local terms energy: -91.665440 where: bonds (distance) C4'-P energy: -15.009 bonds (distance) P-C4' energy: -18.668 flat angles C4'-P-C4' energy: -19.344 flat angles P-C4'-P energy: -14.253 tors. eta vs tors. theta energy: -24.391 Dist. restrs. and SS energy: 2.449 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 607 Temperature: 1.077300 Total energy: -279.004560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.004560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.799756 (E_RNA) where: Base-Base interactions energy: -186.668 where: short stacking energy: -92.605 Base-Backbone interact. energy: -0.241 local terms energy: -94.890276 where: bonds (distance) C4'-P energy: -18.458 bonds (distance) P-C4' energy: -18.004 flat angles C4'-P-C4' energy: -18.612 flat angles P-C4'-P energy: -14.290 tors. eta vs tors. theta energy: -25.526 Dist. restrs. and SS energy: 2.795 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 608 Temperature: 1.076850 Total energy: -285.798529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.798529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.798802 (E_RNA) where: Base-Base interactions energy: -192.612 where: short stacking energy: -90.595 Base-Backbone interact. energy: -0.297 local terms energy: -94.889286 where: bonds (distance) C4'-P energy: -15.819 bonds (distance) P-C4' energy: -20.375 flat angles C4'-P-C4' energy: -20.766 flat angles P-C4'-P energy: -12.738 tors. eta vs tors. theta energy: -25.191 Dist. restrs. and SS energy: 2.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 609 Temperature: 1.076400 Total energy: -271.170211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.170211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.401038 (E_RNA) where: Base-Base interactions energy: -184.649 where: short stacking energy: -85.673 Base-Backbone interact. energy: -0.656 local terms energy: -89.095122 where: bonds (distance) C4'-P energy: -12.680 bonds (distance) P-C4' energy: -22.359 flat angles C4'-P-C4' energy: -17.624 flat angles P-C4'-P energy: -13.074 tors. eta vs tors. theta energy: -23.358 Dist. restrs. and SS energy: 3.231 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 610 Temperature: 1.075950 Total energy: -283.540426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.540426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.458316 (E_RNA) where: Base-Base interactions energy: -190.879 where: short stacking energy: -87.223 Base-Backbone interact. energy: -0.688 local terms energy: -94.892100 where: bonds (distance) C4'-P energy: -14.397 bonds (distance) P-C4' energy: -18.515 flat angles C4'-P-C4' energy: -19.784 flat angles P-C4'-P energy: -16.048 tors. eta vs tors. theta energy: -26.148 Dist. restrs. and SS energy: 2.918 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 611 Temperature: 1.075500 Total energy: -268.698272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.698272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.104497 (E_RNA) where: Base-Base interactions energy: -191.755 where: short stacking energy: -84.765 Base-Backbone interact. energy: -0.383 local terms energy: -79.966990 where: bonds (distance) C4'-P energy: -16.390 bonds (distance) P-C4' energy: -15.024 flat angles C4'-P-C4' energy: -19.901 flat angles P-C4'-P energy: -9.042 tors. eta vs tors. theta energy: -19.611 Dist. restrs. and SS energy: 3.406 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 612 Temperature: 1.075050 Total energy: -278.014214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.014214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.837172 (E_RNA) where: Base-Base interactions energy: -196.090 where: short stacking energy: -88.459 Base-Backbone interact. energy: -0.250 local terms energy: -84.497709 where: bonds (distance) C4'-P energy: -11.504 bonds (distance) P-C4' energy: -19.468 flat angles C4'-P-C4' energy: -20.464 flat angles P-C4'-P energy: -10.428 tors. eta vs tors. theta energy: -22.634 Dist. restrs. and SS energy: 2.823 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 613 Temperature: 1.074600 Total energy: -282.748014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.748014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.880455 (E_RNA) where: Base-Base interactions energy: -194.451 where: short stacking energy: -80.526 Base-Backbone interact. energy: 0.452 local terms energy: -91.882254 where: bonds (distance) C4'-P energy: -17.876 bonds (distance) P-C4' energy: -16.065 flat angles C4'-P-C4' energy: -19.663 flat angles P-C4'-P energy: -13.830 tors. eta vs tors. theta energy: -24.448 Dist. restrs. and SS energy: 3.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 614 Temperature: 1.074150 Total energy: -279.802266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.802266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.836386 (E_RNA) where: Base-Base interactions energy: -193.589 where: short stacking energy: -82.468 Base-Backbone interact. energy: -0.016 local terms energy: -89.231152 where: bonds (distance) C4'-P energy: -14.132 bonds (distance) P-C4' energy: -14.366 flat angles C4'-P-C4' energy: -17.194 flat angles P-C4'-P energy: -17.649 tors. eta vs tors. theta energy: -25.891 Dist. restrs. and SS energy: 3.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 615 Temperature: 1.073700 Total energy: -278.941816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.941816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.749400 (E_RNA) where: Base-Base interactions energy: -190.627 where: short stacking energy: -94.691 Base-Backbone interact. energy: 0.520 local terms energy: -91.642637 where: bonds (distance) C4'-P energy: -17.814 bonds (distance) P-C4' energy: -15.894 flat angles C4'-P-C4' energy: -18.936 flat angles P-C4'-P energy: -12.092 tors. eta vs tors. theta energy: -26.907 Dist. restrs. and SS energy: 2.808 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 616 Temperature: 1.073250 Total energy: -286.159723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.159723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.375970 (E_RNA) where: Base-Base interactions energy: -190.121 where: short stacking energy: -94.158 Base-Backbone interact. energy: -0.005 local terms energy: -99.249747 where: bonds (distance) C4'-P energy: -15.979 bonds (distance) P-C4' energy: -21.179 flat angles C4'-P-C4' energy: -20.130 flat angles P-C4'-P energy: -15.254 tors. eta vs tors. theta energy: -26.708 Dist. restrs. and SS energy: 3.216 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 617 Temperature: 1.072800 Total energy: -287.557480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.557480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.467488 (E_RNA) where: Base-Base interactions energy: -195.028 where: short stacking energy: -96.677 Base-Backbone interact. energy: -0.248 local terms energy: -95.192098 where: bonds (distance) C4'-P energy: -16.497 bonds (distance) P-C4' energy: -15.592 flat angles C4'-P-C4' energy: -21.420 flat angles P-C4'-P energy: -14.953 tors. eta vs tors. theta energy: -26.731 Dist. restrs. and SS energy: 2.910 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 618 Temperature: 1.072350 Total energy: -284.298080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.298080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.786974 (E_RNA) where: Base-Base interactions energy: -191.425 where: short stacking energy: -90.423 Base-Backbone interact. energy: -0.075 local terms energy: -95.286719 where: bonds (distance) C4'-P energy: -16.756 bonds (distance) P-C4' energy: -17.430 flat angles C4'-P-C4' energy: -17.709 flat angles P-C4'-P energy: -15.822 tors. eta vs tors. theta energy: -27.570 Dist. restrs. and SS energy: 2.489 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 619 Temperature: 1.071900 Total energy: -277.824924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.824924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.236891 (E_RNA) where: Base-Base interactions energy: -191.847 where: short stacking energy: -88.725 Base-Backbone interact. energy: -0.220 local terms energy: -88.170522 where: bonds (distance) C4'-P energy: -13.457 bonds (distance) P-C4' energy: -19.223 flat angles C4'-P-C4' energy: -18.409 flat angles P-C4'-P energy: -11.129 tors. eta vs tors. theta energy: -25.951 Dist. restrs. and SS energy: 2.412 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 620 Temperature: 1.071450 Total energy: -286.621555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.621555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.410099 (E_RNA) where: Base-Base interactions energy: -193.601 where: short stacking energy: -98.905 Base-Backbone interact. energy: 0.420 local terms energy: -96.228329 where: bonds (distance) C4'-P energy: -20.151 bonds (distance) P-C4' energy: -17.257 flat angles C4'-P-C4' energy: -18.313 flat angles P-C4'-P energy: -14.879 tors. eta vs tors. theta energy: -25.629 Dist. restrs. and SS energy: 2.789 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 621 Temperature: 1.071000 Total energy: -287.240969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.240969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.028323 (E_RNA) where: Base-Base interactions energy: -192.531 where: short stacking energy: -96.681 Base-Backbone interact. energy: -0.002 local terms energy: -97.496053 where: bonds (distance) C4'-P energy: -14.708 bonds (distance) P-C4' energy: -17.081 flat angles C4'-P-C4' energy: -21.647 flat angles P-C4'-P energy: -15.510 tors. eta vs tors. theta energy: -28.550 Dist. restrs. and SS energy: 2.787 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 622 Temperature: 1.070550 Total energy: -290.252918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.252918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.964531 (E_RNA) where: Base-Base interactions energy: -193.107 where: short stacking energy: -86.843 Base-Backbone interact. energy: -0.137 local terms energy: -99.720307 where: bonds (distance) C4'-P energy: -19.618 bonds (distance) P-C4' energy: -19.714 flat angles C4'-P-C4' energy: -17.424 flat angles P-C4'-P energy: -16.089 tors. eta vs tors. theta energy: -26.875 Dist. restrs. and SS energy: 2.712 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 623 Temperature: 1.070100 Total energy: -284.651271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.651271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.079361 (E_RNA) where: Base-Base interactions energy: -195.010 where: short stacking energy: -88.241 Base-Backbone interact. energy: -0.794 local terms energy: -91.274938 where: bonds (distance) C4'-P energy: -16.235 bonds (distance) P-C4' energy: -18.193 flat angles C4'-P-C4' energy: -19.325 flat angles P-C4'-P energy: -12.692 tors. eta vs tors. theta energy: -24.830 Dist. restrs. and SS energy: 2.428 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 624 Temperature: 1.069650 Total energy: -285.087973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.087973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.281928 (E_RNA) where: Base-Base interactions energy: -192.500 where: short stacking energy: -93.754 Base-Backbone interact. energy: -0.008 local terms energy: -94.774329 where: bonds (distance) C4'-P energy: -18.385 bonds (distance) P-C4' energy: -20.925 flat angles C4'-P-C4' energy: -18.980 flat angles P-C4'-P energy: -10.025 tors. eta vs tors. theta energy: -26.458 Dist. restrs. and SS energy: 2.194 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 625 Temperature: 1.069200 Total energy: -272.885387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.885387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.678685 (E_RNA) where: Base-Base interactions energy: -183.679 where: short stacking energy: -89.821 Base-Backbone interact. energy: -0.034 local terms energy: -91.965271 where: bonds (distance) C4'-P energy: -17.495 bonds (distance) P-C4' energy: -18.955 flat angles C4'-P-C4' energy: -19.638 flat angles P-C4'-P energy: -13.500 tors. eta vs tors. theta energy: -22.378 Dist. restrs. and SS energy: 2.793 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 626 Temperature: 1.068750 Total energy: -277.836336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.836336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.552735 (E_RNA) where: Base-Base interactions energy: -186.898 where: short stacking energy: -90.499 Base-Backbone interact. energy: -0.214 local terms energy: -93.441200 where: bonds (distance) C4'-P energy: -17.954 bonds (distance) P-C4' energy: -20.788 flat angles C4'-P-C4' energy: -17.279 flat angles P-C4'-P energy: -12.551 tors. eta vs tors. theta energy: -24.869 Dist. restrs. and SS energy: 2.716 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 627 Temperature: 1.068300 Total energy: -277.324693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.324693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.660760 (E_RNA) where: Base-Base interactions energy: -189.803 where: short stacking energy: -91.961 Base-Backbone interact. energy: -0.000 local terms energy: -89.856988 where: bonds (distance) C4'-P energy: -14.045 bonds (distance) P-C4' energy: -17.297 flat angles C4'-P-C4' energy: -23.578 flat angles P-C4'-P energy: -7.163 tors. eta vs tors. theta energy: -27.774 Dist. restrs. and SS energy: 2.336 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 628 Temperature: 1.067850 Total energy: -280.474012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.474012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.177190 (E_RNA) where: Base-Base interactions energy: -194.633 where: short stacking energy: -99.077 Base-Backbone interact. energy: -0.073 local terms energy: -88.470318 where: bonds (distance) C4'-P energy: -16.599 bonds (distance) P-C4' energy: -16.925 flat angles C4'-P-C4' energy: -15.768 flat angles P-C4'-P energy: -13.689 tors. eta vs tors. theta energy: -25.489 Dist. restrs. and SS energy: 2.703 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 629 Temperature: 1.067400 Total energy: -274.841321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.841321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.865670 (E_RNA) where: Base-Base interactions energy: -187.466 where: short stacking energy: -83.237 Base-Backbone interact. energy: -0.028 local terms energy: -90.372142 where: bonds (distance) C4'-P energy: -15.754 bonds (distance) P-C4' energy: -21.052 flat angles C4'-P-C4' energy: -20.468 flat angles P-C4'-P energy: -13.171 tors. eta vs tors. theta energy: -19.928 Dist. restrs. and SS energy: 3.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 630 Temperature: 1.066950 Total energy: -267.381496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.381496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.604601 (E_RNA) where: Base-Base interactions energy: -189.661 where: short stacking energy: -76.954 Base-Backbone interact. energy: -1.814 local terms energy: -78.129027 where: bonds (distance) C4'-P energy: -14.354 bonds (distance) P-C4' energy: -19.493 flat angles C4'-P-C4' energy: -15.805 flat angles P-C4'-P energy: -11.525 tors. eta vs tors. theta energy: -16.951 Dist. restrs. and SS energy: 2.223 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 631 Temperature: 1.066500 Total energy: -266.925454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.925454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.193447 (E_RNA) where: Base-Base interactions energy: -193.867 where: short stacking energy: -73.169 Base-Backbone interact. energy: -0.348 local terms energy: -74.978793 where: bonds (distance) C4'-P energy: -8.781 bonds (distance) P-C4' energy: -19.136 flat angles C4'-P-C4' energy: -19.293 flat angles P-C4'-P energy: -8.758 tors. eta vs tors. theta energy: -19.011 Dist. restrs. and SS energy: 2.268 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 632 Temperature: 1.066050 Total energy: -266.360527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.360527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.804291 (E_RNA) where: Base-Base interactions energy: -180.845 where: short stacking energy: -76.080 Base-Backbone interact. energy: -0.684 local terms energy: -87.274566 where: bonds (distance) C4'-P energy: -19.395 bonds (distance) P-C4' energy: -20.144 flat angles C4'-P-C4' energy: -20.698 flat angles P-C4'-P energy: -9.174 tors. eta vs tors. theta energy: -17.864 Dist. restrs. and SS energy: 2.444 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 633 Temperature: 1.065600 Total energy: -246.641378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.641378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.197112 (E_RNA) where: Base-Base interactions energy: -176.666 where: short stacking energy: -73.764 Base-Backbone interact. energy: -0.040 local terms energy: -72.491442 where: bonds (distance) C4'-P energy: -17.465 bonds (distance) P-C4' energy: -15.728 flat angles C4'-P-C4' energy: -14.617 flat angles P-C4'-P energy: -10.104 tors. eta vs tors. theta energy: -14.578 Dist. restrs. and SS energy: 2.556 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 634 Temperature: 1.065150 Total energy: -239.879584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.879584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.638258 (E_RNA) where: Base-Base interactions energy: -165.843 where: short stacking energy: -68.471 Base-Backbone interact. energy: -0.652 local terms energy: -76.142743 where: bonds (distance) C4'-P energy: -14.073 bonds (distance) P-C4' energy: -14.039 flat angles C4'-P-C4' energy: -18.740 flat angles P-C4'-P energy: -10.980 tors. eta vs tors. theta energy: -18.311 Dist. restrs. and SS energy: 2.759 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 635 Temperature: 1.064700 Total energy: -249.101576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.101576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.033683 (E_RNA) where: Base-Base interactions energy: -174.989 where: short stacking energy: -69.863 Base-Backbone interact. energy: -0.418 local terms energy: -76.626528 where: bonds (distance) C4'-P energy: -19.432 bonds (distance) P-C4' energy: -14.631 flat angles C4'-P-C4' energy: -15.576 flat angles P-C4'-P energy: -9.910 tors. eta vs tors. theta energy: -17.077 Dist. restrs. and SS energy: 2.932 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 636 Temperature: 1.064250 Total energy: -258.800064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.800064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.130547 (E_RNA) where: Base-Base interactions energy: -167.542 where: short stacking energy: -77.966 Base-Backbone interact. energy: -0.138 local terms energy: -94.451038 where: bonds (distance) C4'-P energy: -16.554 bonds (distance) P-C4' energy: -20.559 flat angles C4'-P-C4' energy: -18.321 flat angles P-C4'-P energy: -15.553 tors. eta vs tors. theta energy: -23.464 Dist. restrs. and SS energy: 3.330 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 637 Temperature: 1.063800 Total energy: -263.362578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.362578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.555111 (E_RNA) where: Base-Base interactions energy: -173.973 where: short stacking energy: -76.477 Base-Backbone interact. energy: -0.325 local terms energy: -91.256347 where: bonds (distance) C4'-P energy: -20.259 bonds (distance) P-C4' energy: -19.232 flat angles C4'-P-C4' energy: -19.021 flat angles P-C4'-P energy: -13.717 tors. eta vs tors. theta energy: -19.027 Dist. restrs. and SS energy: 2.193 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 638 Temperature: 1.063350 Total energy: -256.522616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.522616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.580479 (E_RNA) where: Base-Base interactions energy: -171.163 where: short stacking energy: -78.097 Base-Backbone interact. energy: -0.760 local terms energy: -86.657685 where: bonds (distance) C4'-P energy: -16.757 bonds (distance) P-C4' energy: -21.214 flat angles C4'-P-C4' energy: -19.521 flat angles P-C4'-P energy: -10.672 tors. eta vs tors. theta energy: -18.493 Dist. restrs. and SS energy: 2.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 639 Temperature: 1.062900 Total energy: -251.660354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.660354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.449413 (E_RNA) where: Base-Base interactions energy: -175.752 where: short stacking energy: -73.125 Base-Backbone interact. energy: -0.206 local terms energy: -76.492234 where: bonds (distance) C4'-P energy: -17.286 bonds (distance) P-C4' energy: -13.967 flat angles C4'-P-C4' energy: -11.279 flat angles P-C4'-P energy: -13.248 tors. eta vs tors. theta energy: -20.712 Dist. restrs. and SS energy: 0.789 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 640 Temperature: 1.062450 Total energy: -257.540240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.540240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.580684 (E_RNA) where: Base-Base interactions energy: -174.501 where: short stacking energy: -77.600 Base-Backbone interact. energy: -0.022 local terms energy: -85.058119 where: bonds (distance) C4'-P energy: -17.171 bonds (distance) P-C4' energy: -17.906 flat angles C4'-P-C4' energy: -16.742 flat angles P-C4'-P energy: -11.436 tors. eta vs tors. theta energy: -21.803 Dist. restrs. and SS energy: 2.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 641 Temperature: 1.062000 Total energy: -261.024719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.024719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.594335 (E_RNA) where: Base-Base interactions energy: -177.325 where: short stacking energy: -81.511 Base-Backbone interact. energy: -1.464 local terms energy: -83.805198 where: bonds (distance) C4'-P energy: -13.699 bonds (distance) P-C4' energy: -14.525 flat angles C4'-P-C4' energy: -18.648 flat angles P-C4'-P energy: -11.635 tors. eta vs tors. theta energy: -25.298 Dist. restrs. and SS energy: 1.570 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 642 Temperature: 1.061550 Total energy: -264.337269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.337269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.161467 (E_RNA) where: Base-Base interactions energy: -178.918 where: short stacking energy: -80.844 Base-Backbone interact. energy: -0.599 local terms energy: -86.644021 where: bonds (distance) C4'-P energy: -16.865 bonds (distance) P-C4' energy: -17.047 flat angles C4'-P-C4' energy: -17.557 flat angles P-C4'-P energy: -11.344 tors. eta vs tors. theta energy: -23.830 Dist. restrs. and SS energy: 1.824 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 643 Temperature: 1.061100 Total energy: -265.670845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.670845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.488847 (E_RNA) where: Base-Base interactions energy: -174.046 where: short stacking energy: -72.087 Base-Backbone interact. energy: -0.298 local terms energy: -93.145514 where: bonds (distance) C4'-P energy: -20.194 bonds (distance) P-C4' energy: -18.785 flat angles C4'-P-C4' energy: -20.125 flat angles P-C4'-P energy: -11.439 tors. eta vs tors. theta energy: -22.603 Dist. restrs. and SS energy: 1.818 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 644 Temperature: 1.060650 Total energy: -263.524454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.524454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.772438 (E_RNA) where: Base-Base interactions energy: -173.700 where: short stacking energy: -86.864 Base-Backbone interact. energy: -0.412 local terms energy: -92.660013 where: bonds (distance) C4'-P energy: -16.607 bonds (distance) P-C4' energy: -18.836 flat angles C4'-P-C4' energy: -21.991 flat angles P-C4'-P energy: -13.150 tors. eta vs tors. theta energy: -22.076 Dist. restrs. and SS energy: 3.248 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 645 Temperature: 1.060200 Total energy: -258.046081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.046081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.932179 (E_RNA) where: Base-Base interactions energy: -173.026 where: short stacking energy: -82.575 Base-Backbone interact. energy: -0.307 local terms energy: -87.598889 where: bonds (distance) C4'-P energy: -16.327 bonds (distance) P-C4' energy: -17.582 flat angles C4'-P-C4' energy: -19.620 flat angles P-C4'-P energy: -9.365 tors. eta vs tors. theta energy: -24.704 Dist. restrs. and SS energy: 2.886 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 646 Temperature: 1.059750 Total energy: -266.889029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.889029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.304461 (E_RNA) where: Base-Base interactions energy: -185.205 where: short stacking energy: -88.837 Base-Backbone interact. energy: -0.003 local terms energy: -84.096777 where: bonds (distance) C4'-P energy: -13.714 bonds (distance) P-C4' energy: -19.358 flat angles C4'-P-C4' energy: -19.299 flat angles P-C4'-P energy: -11.726 tors. eta vs tors. theta energy: -19.999 Dist. restrs. and SS energy: 2.415 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 647 Temperature: 1.059300 Total energy: -283.633044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.633044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.536973 (E_RNA) where: Base-Base interactions energy: -185.053 where: short stacking energy: -81.663 Base-Backbone interact. energy: -0.007 local terms energy: -100.477144 where: bonds (distance) C4'-P energy: -18.346 bonds (distance) P-C4' energy: -19.501 flat angles C4'-P-C4' energy: -21.513 flat angles P-C4'-P energy: -14.268 tors. eta vs tors. theta energy: -26.849 Dist. restrs. and SS energy: 1.904 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 648 Temperature: 1.058850 Total energy: -265.165900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.165900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.362818 (E_RNA) where: Base-Base interactions energy: -183.161 where: short stacking energy: -87.922 Base-Backbone interact. energy: -0.004 local terms energy: -84.197088 where: bonds (distance) C4'-P energy: -11.535 bonds (distance) P-C4' energy: -14.290 flat angles C4'-P-C4' energy: -20.234 flat angles P-C4'-P energy: -14.992 tors. eta vs tors. theta energy: -23.147 Dist. restrs. and SS energy: 2.197 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 649 Temperature: 1.058400 Total energy: -261.969310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.969310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.160445 (E_RNA) where: Base-Base interactions energy: -182.715 where: short stacking energy: -81.741 Base-Backbone interact. energy: -0.022 local terms energy: -81.424182 where: bonds (distance) C4'-P energy: -16.471 bonds (distance) P-C4' energy: -21.504 flat angles C4'-P-C4' energy: -16.601 flat angles P-C4'-P energy: -6.923 tors. eta vs tors. theta energy: -19.926 Dist. restrs. and SS energy: 2.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 650 Temperature: 1.057950 Total energy: -275.082193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.082193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.640421 (E_RNA) where: Base-Base interactions energy: -180.029 where: short stacking energy: -83.583 Base-Backbone interact. energy: -0.075 local terms energy: -97.537184 where: bonds (distance) C4'-P energy: -19.775 bonds (distance) P-C4' energy: -20.160 flat angles C4'-P-C4' energy: -18.631 flat angles P-C4'-P energy: -12.783 tors. eta vs tors. theta energy: -26.188 Dist. restrs. and SS energy: 2.558 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 651 Temperature: 1.057500 Total energy: -283.904731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.904731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.008864 (E_RNA) where: Base-Base interactions energy: -191.237 where: short stacking energy: -90.589 Base-Backbone interact. energy: -0.029 local terms energy: -94.743117 where: bonds (distance) C4'-P energy: -14.361 bonds (distance) P-C4' energy: -15.687 flat angles C4'-P-C4' energy: -20.555 flat angles P-C4'-P energy: -17.779 tors. eta vs tors. theta energy: -26.362 Dist. restrs. and SS energy: 2.104 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 652 Temperature: 1.057050 Total energy: -271.353528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.353528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.891492 (E_RNA) where: Base-Base interactions energy: -182.426 where: short stacking energy: -99.133 Base-Backbone interact. energy: -1.118 local terms energy: -90.347564 where: bonds (distance) C4'-P energy: -14.049 bonds (distance) P-C4' energy: -16.041 flat angles C4'-P-C4' energy: -18.170 flat angles P-C4'-P energy: -11.915 tors. eta vs tors. theta energy: -30.173 Dist. restrs. and SS energy: 2.538 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 653 Temperature: 1.056600 Total energy: -272.384471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.384471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.712302 (E_RNA) where: Base-Base interactions energy: -186.208 where: short stacking energy: -85.258 Base-Backbone interact. energy: -0.002 local terms energy: -89.502109 where: bonds (distance) C4'-P energy: -16.147 bonds (distance) P-C4' energy: -18.615 flat angles C4'-P-C4' energy: -17.686 flat angles P-C4'-P energy: -9.003 tors. eta vs tors. theta energy: -28.050 Dist. restrs. and SS energy: 3.328 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 654 Temperature: 1.056150 Total energy: -260.527369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.527369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.349574 (E_RNA) where: Base-Base interactions energy: -185.458 where: short stacking energy: -86.022 Base-Backbone interact. energy: -0.326 local terms energy: -76.565100 where: bonds (distance) C4'-P energy: -16.930 bonds (distance) P-C4' energy: -17.018 flat angles C4'-P-C4' energy: -16.922 flat angles P-C4'-P energy: -4.524 tors. eta vs tors. theta energy: -21.171 Dist. restrs. and SS energy: 1.822 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 655 Temperature: 1.055700 Total energy: -285.042215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.042215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.294236 (E_RNA) where: Base-Base interactions energy: -191.723 where: short stacking energy: -93.078 Base-Backbone interact. energy: -0.046 local terms energy: -95.525629 where: bonds (distance) C4'-P energy: -14.442 bonds (distance) P-C4' energy: -20.192 flat angles C4'-P-C4' energy: -17.571 flat angles P-C4'-P energy: -14.857 tors. eta vs tors. theta energy: -28.464 Dist. restrs. and SS energy: 2.252 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 656 Temperature: 1.055250 Total energy: -279.247450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.247450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.266469 (E_RNA) where: Base-Base interactions energy: -185.694 where: short stacking energy: -91.107 Base-Backbone interact. energy: 1.512 local terms energy: -98.084745 where: bonds (distance) C4'-P energy: -20.048 bonds (distance) P-C4' energy: -19.135 flat angles C4'-P-C4' energy: -19.570 flat angles P-C4'-P energy: -14.206 tors. eta vs tors. theta energy: -25.126 Dist. restrs. and SS energy: 3.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 657 Temperature: 1.054800 Total energy: -282.088564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.088564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.011264 (E_RNA) where: Base-Base interactions energy: -194.518 where: short stacking energy: -86.200 Base-Backbone interact. energy: -0.233 local terms energy: -89.260114 where: bonds (distance) C4'-P energy: -17.058 bonds (distance) P-C4' energy: -17.843 flat angles C4'-P-C4' energy: -16.811 flat angles P-C4'-P energy: -11.901 tors. eta vs tors. theta energy: -25.647 Dist. restrs. and SS energy: 1.923 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 658 Temperature: 1.054350 Total energy: -275.896598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.896598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.071580 (E_RNA) where: Base-Base interactions energy: -191.935 where: short stacking energy: -76.605 Base-Backbone interact. energy: -1.072 local terms energy: -84.065195 where: bonds (distance) C4'-P energy: -17.891 bonds (distance) P-C4' energy: -20.380 flat angles C4'-P-C4' energy: -16.373 flat angles P-C4'-P energy: -10.116 tors. eta vs tors. theta energy: -19.306 Dist. restrs. and SS energy: 1.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 659 Temperature: 1.053900 Total energy: -265.987615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.987615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.285400 (E_RNA) where: Base-Base interactions energy: -174.860 where: short stacking energy: -79.134 Base-Backbone interact. energy: -0.602 local terms energy: -92.823181 where: bonds (distance) C4'-P energy: -20.136 bonds (distance) P-C4' energy: -17.436 flat angles C4'-P-C4' energy: -19.833 flat angles P-C4'-P energy: -7.229 tors. eta vs tors. theta energy: -28.190 Dist. restrs. and SS energy: 2.298 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 660 Temperature: 1.053450 Total energy: -268.691639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.691639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.596516 (E_RNA) where: Base-Base interactions energy: -184.060 where: short stacking energy: -84.518 Base-Backbone interact. energy: -0.431 local terms energy: -87.105192 where: bonds (distance) C4'-P energy: -13.774 bonds (distance) P-C4' energy: -16.606 flat angles C4'-P-C4' energy: -19.296 flat angles P-C4'-P energy: -12.648 tors. eta vs tors. theta energy: -24.781 Dist. restrs. and SS energy: 2.905 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 661 Temperature: 1.053000 Total energy: -285.083878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.083878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.256409 (E_RNA) where: Base-Base interactions energy: -201.439 where: short stacking energy: -98.853 Base-Backbone interact. energy: -0.060 local terms energy: -86.756898 where: bonds (distance) C4'-P energy: -9.729 bonds (distance) P-C4' energy: -17.596 flat angles C4'-P-C4' energy: -23.551 flat angles P-C4'-P energy: -10.946 tors. eta vs tors. theta energy: -24.935 Dist. restrs. and SS energy: 3.173 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 662 Temperature: 1.052550 Total energy: -286.632046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.632046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.638986 (E_RNA) where: Base-Base interactions energy: -197.865 where: short stacking energy: -91.925 Base-Backbone interact. energy: -0.005 local terms energy: -91.769427 where: bonds (distance) C4'-P energy: -19.249 bonds (distance) P-C4' energy: -16.987 flat angles C4'-P-C4' energy: -18.931 flat angles P-C4'-P energy: -12.322 tors. eta vs tors. theta energy: -24.280 Dist. restrs. and SS energy: 3.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 663 Temperature: 1.052100 Total energy: -275.225951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.225951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.751974 (E_RNA) where: Base-Base interactions energy: -198.621 where: short stacking energy: -89.792 Base-Backbone interact. energy: -0.649 local terms energy: -78.482228 where: bonds (distance) C4'-P energy: -9.859 bonds (distance) P-C4' energy: -11.335 flat angles C4'-P-C4' energy: -20.868 flat angles P-C4'-P energy: -14.365 tors. eta vs tors. theta energy: -22.055 Dist. restrs. and SS energy: 2.526 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 664 Temperature: 1.051650 Total energy: -270.456822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.456822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.418448 (E_RNA) where: Base-Base interactions energy: -181.653 where: short stacking energy: -85.702 Base-Backbone interact. energy: -0.906 local terms energy: -90.859490 where: bonds (distance) C4'-P energy: -16.505 bonds (distance) P-C4' energy: -16.408 flat angles C4'-P-C4' energy: -14.740 flat angles P-C4'-P energy: -13.248 tors. eta vs tors. theta energy: -29.958 Dist. restrs. and SS energy: 2.962 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 665 Temperature: 1.051200 Total energy: -264.168505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.168505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.799316 (E_RNA) where: Base-Base interactions energy: -179.216 where: short stacking energy: -76.770 Base-Backbone interact. energy: -0.144 local terms energy: -90.438940 where: bonds (distance) C4'-P energy: -19.510 bonds (distance) P-C4' energy: -18.932 flat angles C4'-P-C4' energy: -19.045 flat angles P-C4'-P energy: -12.383 tors. eta vs tors. theta energy: -20.569 Dist. restrs. and SS energy: 5.631 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 666 Temperature: 1.050750 Total energy: -271.280083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.280083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.076691 (E_RNA) where: Base-Base interactions energy: -182.621 where: short stacking energy: -82.501 Base-Backbone interact. energy: -0.147 local terms energy: -90.309074 where: bonds (distance) C4'-P energy: -15.321 bonds (distance) P-C4' energy: -17.896 flat angles C4'-P-C4' energy: -19.892 flat angles P-C4'-P energy: -12.353 tors. eta vs tors. theta energy: -24.847 Dist. restrs. and SS energy: 1.797 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 667 Temperature: 1.050300 Total energy: -265.885465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.885465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.632777 (E_RNA) where: Base-Base interactions energy: -172.691 where: short stacking energy: -78.351 Base-Backbone interact. energy: -0.002 local terms energy: -95.940070 where: bonds (distance) C4'-P energy: -18.509 bonds (distance) P-C4' energy: -23.065 flat angles C4'-P-C4' energy: -17.749 flat angles P-C4'-P energy: -12.511 tors. eta vs tors. theta energy: -24.106 Dist. restrs. and SS energy: 2.747 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 668 Temperature: 1.049850 Total energy: -253.653285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.653285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.956320 (E_RNA) where: Base-Base interactions energy: -179.035 where: short stacking energy: -75.862 Base-Backbone interact. energy: -0.037 local terms energy: -76.884539 where: bonds (distance) C4'-P energy: -17.034 bonds (distance) P-C4' energy: -10.462 flat angles C4'-P-C4' energy: -21.583 flat angles P-C4'-P energy: -10.397 tors. eta vs tors. theta energy: -17.409 Dist. restrs. and SS energy: 2.303 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 669 Temperature: 1.049400 Total energy: -255.149747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.149747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.835428 (E_RNA) where: Base-Base interactions energy: -173.457 where: short stacking energy: -76.068 Base-Backbone interact. energy: -1.050 local terms energy: -82.328246 where: bonds (distance) C4'-P energy: -20.731 bonds (distance) P-C4' energy: -15.944 flat angles C4'-P-C4' energy: -18.187 flat angles P-C4'-P energy: -13.837 tors. eta vs tors. theta energy: -13.628 Dist. restrs. and SS energy: 1.686 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 670 Temperature: 1.048950 Total energy: -256.034134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.034134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.235826 (E_RNA) where: Base-Base interactions energy: -179.234 where: short stacking energy: -74.841 Base-Backbone interact. energy: -0.599 local terms energy: -78.403067 where: bonds (distance) C4'-P energy: -16.512 bonds (distance) P-C4' energy: -16.204 flat angles C4'-P-C4' energy: -12.305 flat angles P-C4'-P energy: -15.167 tors. eta vs tors. theta energy: -18.216 Dist. restrs. and SS energy: 2.202 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 671 Temperature: 1.048500 Total energy: -260.801272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.801272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.666727 (E_RNA) where: Base-Base interactions energy: -178.376 where: short stacking energy: -77.134 Base-Backbone interact. energy: -0.023 local terms energy: -84.268140 where: bonds (distance) C4'-P energy: -15.169 bonds (distance) P-C4' energy: -16.622 flat angles C4'-P-C4' energy: -20.990 flat angles P-C4'-P energy: -8.746 tors. eta vs tors. theta energy: -22.741 Dist. restrs. and SS energy: 1.865 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 672 Temperature: 1.048050 Total energy: -258.997638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.997638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.011171 (E_RNA) where: Base-Base interactions energy: -176.147 where: short stacking energy: -83.215 Base-Backbone interact. energy: -1.357 local terms energy: -83.506671 where: bonds (distance) C4'-P energy: -10.613 bonds (distance) P-C4' energy: -21.267 flat angles C4'-P-C4' energy: -16.912 flat angles P-C4'-P energy: -13.958 tors. eta vs tors. theta energy: -20.755 Dist. restrs. and SS energy: 2.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 673 Temperature: 1.047600 Total energy: -269.664650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.664650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.635805 (E_RNA) where: Base-Base interactions energy: -189.336 where: short stacking energy: -83.025 Base-Backbone interact. energy: -1.360 local terms energy: -80.939052 where: bonds (distance) C4'-P energy: -16.761 bonds (distance) P-C4' energy: -17.676 flat angles C4'-P-C4' energy: -15.988 flat angles P-C4'-P energy: -10.896 tors. eta vs tors. theta energy: -19.618 Dist. restrs. and SS energy: 1.971 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 674 Temperature: 1.047150 Total energy: -264.590334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.590334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.581184 (E_RNA) where: Base-Base interactions energy: -191.543 where: short stacking energy: -84.141 Base-Backbone interact. energy: -0.669 local terms energy: -74.369590 where: bonds (distance) C4'-P energy: -18.118 bonds (distance) P-C4' energy: -9.954 flat angles C4'-P-C4' energy: -15.566 flat angles P-C4'-P energy: -7.139 tors. eta vs tors. theta energy: -23.592 Dist. restrs. and SS energy: 1.991 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 675 Temperature: 1.046700 Total energy: -269.398571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.398571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.644565 (E_RNA) where: Base-Base interactions energy: -193.064 where: short stacking energy: -85.928 Base-Backbone interact. energy: -0.162 local terms energy: -78.418886 where: bonds (distance) C4'-P energy: -13.823 bonds (distance) P-C4' energy: -15.415 flat angles C4'-P-C4' energy: -15.738 flat angles P-C4'-P energy: -11.109 tors. eta vs tors. theta energy: -22.335 Dist. restrs. and SS energy: 2.246 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 676 Temperature: 1.046250 Total energy: -278.966200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.966200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.349376 (E_RNA) where: Base-Base interactions energy: -193.445 where: short stacking energy: -85.324 Base-Backbone interact. energy: -1.356 local terms energy: -86.548937 where: bonds (distance) C4'-P energy: -16.198 bonds (distance) P-C4' energy: -14.108 flat angles C4'-P-C4' energy: -19.979 flat angles P-C4'-P energy: -8.965 tors. eta vs tors. theta energy: -27.300 Dist. restrs. and SS energy: 2.383 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 677 Temperature: 1.045800 Total energy: -276.982483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.982483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.413104 (E_RNA) where: Base-Base interactions energy: -190.474 where: short stacking energy: -91.415 Base-Backbone interact. energy: -0.165 local terms energy: -88.774575 where: bonds (distance) C4'-P energy: -13.732 bonds (distance) P-C4' energy: -22.458 flat angles C4'-P-C4' energy: -20.593 flat angles P-C4'-P energy: -7.507 tors. eta vs tors. theta energy: -24.485 Dist. restrs. and SS energy: 2.431 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 678 Temperature: 1.045350 Total energy: -274.300384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.300384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.531497 (E_RNA) where: Base-Base interactions energy: -186.792 where: short stacking energy: -77.248 Base-Backbone interact. energy: -0.545 local terms energy: -89.195130 where: bonds (distance) C4'-P energy: -21.248 bonds (distance) P-C4' energy: -15.122 flat angles C4'-P-C4' energy: -17.566 flat angles P-C4'-P energy: -14.679 tors. eta vs tors. theta energy: -20.579 Dist. restrs. and SS energy: 2.231 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 679 Temperature: 1.044900 Total energy: -272.266775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.266775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.500339 (E_RNA) where: Base-Base interactions energy: -182.582 where: short stacking energy: -86.511 Base-Backbone interact. energy: -0.486 local terms energy: -91.431542 where: bonds (distance) C4'-P energy: -16.964 bonds (distance) P-C4' energy: -18.457 flat angles C4'-P-C4' energy: -18.446 flat angles P-C4'-P energy: -12.659 tors. eta vs tors. theta energy: -24.906 Dist. restrs. and SS energy: 2.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 680 Temperature: 1.044450 Total energy: -278.249244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.249244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.205664 (E_RNA) where: Base-Base interactions energy: -186.231 where: short stacking energy: -82.350 Base-Backbone interact. energy: -0.009 local terms energy: -93.965559 where: bonds (distance) C4'-P energy: -21.538 bonds (distance) P-C4' energy: -16.375 flat angles C4'-P-C4' energy: -20.476 flat angles P-C4'-P energy: -11.780 tors. eta vs tors. theta energy: -23.798 Dist. restrs. and SS energy: 1.956 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 681 Temperature: 1.044000 Total energy: -278.234484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.234484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.907519 (E_RNA) where: Base-Base interactions energy: -187.738 where: short stacking energy: -84.383 Base-Backbone interact. energy: 1.870 local terms energy: -95.040030 where: bonds (distance) C4'-P energy: -20.678 bonds (distance) P-C4' energy: -16.677 flat angles C4'-P-C4' energy: -22.191 flat angles P-C4'-P energy: -12.760 tors. eta vs tors. theta energy: -22.734 Dist. restrs. and SS energy: 2.673 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 682 Temperature: 1.043550 Total energy: -269.895552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.895552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.200265 (E_RNA) where: Base-Base interactions energy: -180.838 where: short stacking energy: -88.920 Base-Backbone interact. energy: 0.390 local terms energy: -92.751931 where: bonds (distance) C4'-P energy: -17.601 bonds (distance) P-C4' energy: -18.037 flat angles C4'-P-C4' energy: -19.283 flat angles P-C4'-P energy: -16.578 tors. eta vs tors. theta energy: -21.253 Dist. restrs. and SS energy: 3.305 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 683 Temperature: 1.043100 Total energy: -259.442913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.442913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.460304 (E_RNA) where: Base-Base interactions energy: -187.463 where: short stacking energy: -84.689 Base-Backbone interact. energy: 0.108 local terms energy: -77.105653 where: bonds (distance) C4'-P energy: -10.975 bonds (distance) P-C4' energy: -15.476 flat angles C4'-P-C4' energy: -17.197 flat angles P-C4'-P energy: -14.785 tors. eta vs tors. theta energy: -18.673 Dist. restrs. and SS energy: 5.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 684 Temperature: 1.042650 Total energy: -261.714775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.714775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.019300 (E_RNA) where: Base-Base interactions energy: -173.291 where: short stacking energy: -79.105 Base-Backbone interact. energy: -1.272 local terms energy: -90.456637 where: bonds (distance) C4'-P energy: -11.335 bonds (distance) P-C4' energy: -20.335 flat angles C4'-P-C4' energy: -21.618 flat angles P-C4'-P energy: -15.585 tors. eta vs tors. theta energy: -21.584 Dist. restrs. and SS energy: 3.305 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 685 Temperature: 1.042200 Total energy: -261.144269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.144269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.376584 (E_RNA) where: Base-Base interactions energy: -194.320 where: short stacking energy: -85.424 Base-Backbone interact. energy: -0.064 local terms energy: -71.991972 where: bonds (distance) C4'-P energy: -13.507 bonds (distance) P-C4' energy: -13.380 flat angles C4'-P-C4' energy: -13.282 flat angles P-C4'-P energy: -9.870 tors. eta vs tors. theta energy: -21.953 Dist. restrs. and SS energy: 5.232 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 686 Temperature: 1.041750 Total energy: -268.021814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.021814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.551702 (E_RNA) where: Base-Base interactions energy: -183.890 where: short stacking energy: -85.664 Base-Backbone interact. energy: 0.894 local terms energy: -89.556143 where: bonds (distance) C4'-P energy: -11.861 bonds (distance) P-C4' energy: -20.393 flat angles C4'-P-C4' energy: -17.713 flat angles P-C4'-P energy: -13.642 tors. eta vs tors. theta energy: -25.948 Dist. restrs. and SS energy: 4.530 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 687 Temperature: 1.041300 Total energy: -263.331358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.331358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.874686 (E_RNA) where: Base-Base interactions energy: -175.815 where: short stacking energy: -79.744 Base-Backbone interact. energy: -0.084 local terms energy: -90.976279 where: bonds (distance) C4'-P energy: -21.436 bonds (distance) P-C4' energy: -14.574 flat angles C4'-P-C4' energy: -18.988 flat angles P-C4'-P energy: -9.389 tors. eta vs tors. theta energy: -26.589 Dist. restrs. and SS energy: 3.543 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 688 Temperature: 1.040850 Total energy: -278.075491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.075491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.857296 (E_RNA) where: Base-Base interactions energy: -181.865 where: short stacking energy: -83.665 Base-Backbone interact. energy: 0.672 local terms energy: -102.664144 where: bonds (distance) C4'-P energy: -20.561 bonds (distance) P-C4' energy: -21.465 flat angles C4'-P-C4' energy: -21.582 flat angles P-C4'-P energy: -12.199 tors. eta vs tors. theta energy: -26.857 Dist. restrs. and SS energy: 5.782 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 689 Temperature: 1.040400 Total energy: -285.271147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.271147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.635052 (E_RNA) where: Base-Base interactions energy: -197.549 where: short stacking energy: -84.674 Base-Backbone interact. energy: -0.089 local terms energy: -90.996848 where: bonds (distance) C4'-P energy: -15.396 bonds (distance) P-C4' energy: -18.831 flat angles C4'-P-C4' energy: -17.523 flat angles P-C4'-P energy: -14.980 tors. eta vs tors. theta energy: -24.267 Dist. restrs. and SS energy: 3.364 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 690 Temperature: 1.039950 Total energy: -268.222648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.222648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.860095 (E_RNA) where: Base-Base interactions energy: -186.809 where: short stacking energy: -83.382 Base-Backbone interact. energy: -0.048 local terms energy: -84.003186 where: bonds (distance) C4'-P energy: -17.586 bonds (distance) P-C4' energy: -10.458 flat angles C4'-P-C4' energy: -17.503 flat angles P-C4'-P energy: -12.153 tors. eta vs tors. theta energy: -26.302 Dist. restrs. and SS energy: 2.637 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 691 Temperature: 1.039500 Total energy: -267.749491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.749491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.003904 (E_RNA) where: Base-Base interactions energy: -183.913 where: short stacking energy: -81.588 Base-Backbone interact. energy: -0.166 local terms energy: -87.924129 where: bonds (distance) C4'-P energy: -18.003 bonds (distance) P-C4' energy: -14.315 flat angles C4'-P-C4' energy: -20.737 flat angles P-C4'-P energy: -11.735 tors. eta vs tors. theta energy: -23.135 Dist. restrs. and SS energy: 4.254 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 692 Temperature: 1.039050 Total energy: -265.909748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.909748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.104861 (E_RNA) where: Base-Base interactions energy: -181.828 where: short stacking energy: -83.499 Base-Backbone interact. energy: -0.729 local terms energy: -86.547550 where: bonds (distance) C4'-P energy: -16.140 bonds (distance) P-C4' energy: -19.753 flat angles C4'-P-C4' energy: -17.081 flat angles P-C4'-P energy: -11.113 tors. eta vs tors. theta energy: -22.461 Dist. restrs. and SS energy: 3.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 693 Temperature: 1.038600 Total energy: -258.816623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.816623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.422904 (E_RNA) where: Base-Base interactions energy: -173.949 where: short stacking energy: -82.019 Base-Backbone interact. energy: -0.105 local terms energy: -89.368830 where: bonds (distance) C4'-P energy: -18.602 bonds (distance) P-C4' energy: -17.150 flat angles C4'-P-C4' energy: -19.196 flat angles P-C4'-P energy: -12.172 tors. eta vs tors. theta energy: -22.248 Dist. restrs. and SS energy: 4.606 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 694 Temperature: 1.038150 Total energy: -269.797430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.797430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.118964 (E_RNA) where: Base-Base interactions energy: -186.435 where: short stacking energy: -88.296 Base-Backbone interact. energy: -0.770 local terms energy: -85.914273 where: bonds (distance) C4'-P energy: -13.979 bonds (distance) P-C4' energy: -16.561 flat angles C4'-P-C4' energy: -18.227 flat angles P-C4'-P energy: -8.245 tors. eta vs tors. theta energy: -28.903 Dist. restrs. and SS energy: 3.322 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 695 Temperature: 1.037700 Total energy: -277.543139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.543139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.065055 (E_RNA) where: Base-Base interactions energy: -192.835 where: short stacking energy: -96.234 Base-Backbone interact. energy: -0.108 local terms energy: -87.121985 where: bonds (distance) C4'-P energy: -16.235 bonds (distance) P-C4' energy: -16.736 flat angles C4'-P-C4' energy: -14.993 flat angles P-C4'-P energy: -11.345 tors. eta vs tors. theta energy: -27.812 Dist. restrs. and SS energy: 2.522 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 696 Temperature: 1.037250 Total energy: -275.623888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.623888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.204360 (E_RNA) where: Base-Base interactions energy: -189.546 where: short stacking energy: -91.735 Base-Backbone interact. energy: -0.006 local terms energy: -88.652032 where: bonds (distance) C4'-P energy: -14.682 bonds (distance) P-C4' energy: -15.429 flat angles C4'-P-C4' energy: -18.019 flat angles P-C4'-P energy: -14.686 tors. eta vs tors. theta energy: -25.836 Dist. restrs. and SS energy: 2.580 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 697 Temperature: 1.036800 Total energy: -281.026823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.026823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.741360 (E_RNA) where: Base-Base interactions energy: -198.507 where: short stacking energy: -93.202 Base-Backbone interact. energy: -0.019 local terms energy: -85.215409 where: bonds (distance) C4'-P energy: -16.075 bonds (distance) P-C4' energy: -19.500 flat angles C4'-P-C4' energy: -18.563 flat angles P-C4'-P energy: -10.942 tors. eta vs tors. theta energy: -20.135 Dist. restrs. and SS energy: 2.715 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 698 Temperature: 1.036350 Total energy: -265.385254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.385254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.160246 (E_RNA) where: Base-Base interactions energy: -184.952 where: short stacking energy: -80.963 Base-Backbone interact. energy: -0.177 local terms energy: -83.031828 where: bonds (distance) C4'-P energy: -13.822 bonds (distance) P-C4' energy: -16.688 flat angles C4'-P-C4' energy: -12.367 flat angles P-C4'-P energy: -14.138 tors. eta vs tors. theta energy: -26.017 Dist. restrs. and SS energy: 2.775 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 699 Temperature: 1.035900 Total energy: -277.426160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.426160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.903421 (E_RNA) where: Base-Base interactions energy: -194.001 where: short stacking energy: -94.908 Base-Backbone interact. energy: -0.001 local terms energy: -85.901504 where: bonds (distance) C4'-P energy: -13.825 bonds (distance) P-C4' energy: -16.770 flat angles C4'-P-C4' energy: -17.181 flat angles P-C4'-P energy: -10.919 tors. eta vs tors. theta energy: -27.207 Dist. restrs. and SS energy: 2.477 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 700 Temperature: 1.035450 Total energy: -286.803343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.803343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.971646 (E_RNA) where: Base-Base interactions energy: -197.496 where: short stacking energy: -97.325 Base-Backbone interact. energy: 3.599 local terms energy: -97.074240 where: bonds (distance) C4'-P energy: -13.452 bonds (distance) P-C4' energy: -19.335 flat angles C4'-P-C4' energy: -20.269 flat angles P-C4'-P energy: -18.117 tors. eta vs tors. theta energy: -25.902 Dist. restrs. and SS energy: 4.168 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 701 Temperature: 1.035000 Total energy: -281.307590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.307590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.583895 (E_RNA) where: Base-Base interactions energy: -189.624 where: short stacking energy: -90.513 Base-Backbone interact. energy: -1.026 local terms energy: -92.933882 where: bonds (distance) C4'-P energy: -17.236 bonds (distance) P-C4' energy: -20.393 flat angles C4'-P-C4' energy: -15.449 flat angles P-C4'-P energy: -12.483 tors. eta vs tors. theta energy: -27.373 Dist. restrs. and SS energy: 2.276 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 702 Temperature: 1.034550 Total energy: -278.762909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.762909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.175743 (E_RNA) where: Base-Base interactions energy: -195.884 where: short stacking energy: -88.369 Base-Backbone interact. energy: -0.001 local terms energy: -85.290153 where: bonds (distance) C4'-P energy: -11.512 bonds (distance) P-C4' energy: -18.861 flat angles C4'-P-C4' energy: -18.508 flat angles P-C4'-P energy: -12.214 tors. eta vs tors. theta energy: -24.195 Dist. restrs. and SS energy: 2.413 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 703 Temperature: 1.034100 Total energy: -280.835536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.835536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.149983 (E_RNA) where: Base-Base interactions energy: -189.226 where: short stacking energy: -84.626 Base-Backbone interact. energy: -0.030 local terms energy: -93.894022 where: bonds (distance) C4'-P energy: -16.848 bonds (distance) P-C4' energy: -20.626 flat angles C4'-P-C4' energy: -20.676 flat angles P-C4'-P energy: -11.793 tors. eta vs tors. theta energy: -23.951 Dist. restrs. and SS energy: 2.314 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 704 Temperature: 1.033650 Total energy: -279.824665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.824665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.479224 (E_RNA) where: Base-Base interactions energy: -187.181 where: short stacking energy: -87.199 Base-Backbone interact. energy: -0.004 local terms energy: -95.294193 where: bonds (distance) C4'-P energy: -13.777 bonds (distance) P-C4' energy: -20.365 flat angles C4'-P-C4' energy: -21.749 flat angles P-C4'-P energy: -14.565 tors. eta vs tors. theta energy: -24.839 Dist. restrs. and SS energy: 2.655 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 705 Temperature: 1.033200 Total energy: -283.632430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.632430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.942110 (E_RNA) where: Base-Base interactions energy: -189.979 where: short stacking energy: -97.160 Base-Backbone interact. energy: -1.025 local terms energy: -94.938197 where: bonds (distance) C4'-P energy: -17.569 bonds (distance) P-C4' energy: -20.065 flat angles C4'-P-C4' energy: -18.435 flat angles P-C4'-P energy: -11.411 tors. eta vs tors. theta energy: -27.459 Dist. restrs. and SS energy: 2.310 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 706 Temperature: 1.032750 Total energy: -297.765587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.765587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.156531 (E_RNA) where: Base-Base interactions energy: -202.294 where: short stacking energy: -96.156 Base-Backbone interact. energy: -0.179 local terms energy: -97.683762 where: bonds (distance) C4'-P energy: -16.378 bonds (distance) P-C4' energy: -17.735 flat angles C4'-P-C4' energy: -20.021 flat angles P-C4'-P energy: -15.025 tors. eta vs tors. theta energy: -28.524 Dist. restrs. and SS energy: 2.391 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 707 Temperature: 1.032300 Total energy: -273.069061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.069061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.548273 (E_RNA) where: Base-Base interactions energy: -193.259 where: short stacking energy: -101.476 Base-Backbone interact. energy: -0.006 local terms energy: -82.282649 where: bonds (distance) C4'-P energy: -12.505 bonds (distance) P-C4' energy: -14.957 flat angles C4'-P-C4' energy: -14.534 flat angles P-C4'-P energy: -12.126 tors. eta vs tors. theta energy: -28.162 Dist. restrs. and SS energy: 2.479 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 708 Temperature: 1.031850 Total energy: -284.936387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.936387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.648667 (E_RNA) where: Base-Base interactions energy: -193.877 where: short stacking energy: -97.833 Base-Backbone interact. energy: -0.026 local terms energy: -93.745660 where: bonds (distance) C4'-P energy: -19.066 bonds (distance) P-C4' energy: -13.661 flat angles C4'-P-C4' energy: -17.176 flat angles P-C4'-P energy: -16.503 tors. eta vs tors. theta energy: -27.339 Dist. restrs. and SS energy: 2.712 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 709 Temperature: 1.031400 Total energy: -278.609660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.609660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.860322 (E_RNA) where: Base-Base interactions energy: -187.085 where: short stacking energy: -90.214 Base-Backbone interact. energy: -0.002 local terms energy: -93.773567 where: bonds (distance) C4'-P energy: -18.609 bonds (distance) P-C4' energy: -20.890 flat angles C4'-P-C4' energy: -17.852 flat angles P-C4'-P energy: -9.325 tors. eta vs tors. theta energy: -27.098 Dist. restrs. and SS energy: 2.251 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 710 Temperature: 1.030950 Total energy: -296.391491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.391491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.813396 (E_RNA) where: Base-Base interactions energy: -201.437 where: short stacking energy: -95.363 Base-Backbone interact. energy: -0.002 local terms energy: -97.374534 where: bonds (distance) C4'-P energy: -16.762 bonds (distance) P-C4' energy: -18.956 flat angles C4'-P-C4' energy: -18.476 flat angles P-C4'-P energy: -13.112 tors. eta vs tors. theta energy: -30.069 Dist. restrs. and SS energy: 2.422 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 711 Temperature: 1.030500 Total energy: -280.627584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.627584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.149157 (E_RNA) where: Base-Base interactions energy: -187.649 where: short stacking energy: -83.988 Base-Backbone interact. energy: -0.631 local terms energy: -95.869431 where: bonds (distance) C4'-P energy: -17.693 bonds (distance) P-C4' energy: -18.454 flat angles C4'-P-C4' energy: -20.860 flat angles P-C4'-P energy: -13.660 tors. eta vs tors. theta energy: -25.203 Dist. restrs. and SS energy: 3.522 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 712 Temperature: 1.030050 Total energy: -288.281075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.281075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.370415 (E_RNA) where: Base-Base interactions energy: -198.350 where: short stacking energy: -95.819 Base-Backbone interact. energy: -0.025 local terms energy: -91.995512 where: bonds (distance) C4'-P energy: -13.974 bonds (distance) P-C4' energy: -18.949 flat angles C4'-P-C4' energy: -20.167 flat angles P-C4'-P energy: -14.133 tors. eta vs tors. theta energy: -24.773 Dist. restrs. and SS energy: 2.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 713 Temperature: 1.029600 Total energy: -288.895534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.895534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.507483 (E_RNA) where: Base-Base interactions energy: -197.117 where: short stacking energy: -88.171 Base-Backbone interact. energy: -0.088 local terms energy: -94.303171 where: bonds (distance) C4'-P energy: -16.882 bonds (distance) P-C4' energy: -20.122 flat angles C4'-P-C4' energy: -15.608 flat angles P-C4'-P energy: -13.518 tors. eta vs tors. theta energy: -28.172 Dist. restrs. and SS energy: 2.612 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 714 Temperature: 1.029150 Total energy: -274.716959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.716959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.515438 (E_RNA) where: Base-Base interactions energy: -183.765 where: short stacking energy: -78.507 Base-Backbone interact. energy: -0.457 local terms energy: -92.293329 where: bonds (distance) C4'-P energy: -18.516 bonds (distance) P-C4' energy: -17.065 flat angles C4'-P-C4' energy: -22.106 flat angles P-C4'-P energy: -12.642 tors. eta vs tors. theta energy: -21.964 Dist. restrs. and SS energy: 1.798 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 715 Temperature: 1.028700 Total energy: -275.437114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.437114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.451552 (E_RNA) where: Base-Base interactions energy: -189.645 where: short stacking energy: -83.630 Base-Backbone interact. energy: -0.572 local terms energy: -87.234160 where: bonds (distance) C4'-P energy: -17.694 bonds (distance) P-C4' energy: -13.855 flat angles C4'-P-C4' energy: -19.655 flat angles P-C4'-P energy: -13.729 tors. eta vs tors. theta energy: -22.301 Dist. restrs. and SS energy: 2.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 716 Temperature: 1.028250 Total energy: -281.354611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.354611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.089546 (E_RNA) where: Base-Base interactions energy: -189.224 where: short stacking energy: -84.385 Base-Backbone interact. energy: -0.592 local terms energy: -93.272817 where: bonds (distance) C4'-P energy: -17.165 bonds (distance) P-C4' energy: -20.404 flat angles C4'-P-C4' energy: -21.385 flat angles P-C4'-P energy: -9.356 tors. eta vs tors. theta energy: -24.963 Dist. restrs. and SS energy: 1.735 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 717 Temperature: 1.027800 Total energy: -279.669430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.669430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.588161 (E_RNA) where: Base-Base interactions energy: -185.091 where: short stacking energy: -90.284 Base-Backbone interact. energy: 0.259 local terms energy: -97.755287 where: bonds (distance) C4'-P energy: -17.651 bonds (distance) P-C4' energy: -21.436 flat angles C4'-P-C4' energy: -18.792 flat angles P-C4'-P energy: -14.354 tors. eta vs tors. theta energy: -25.523 Dist. restrs. and SS energy: 2.919 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 718 Temperature: 1.027350 Total energy: -282.181849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.181849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.267136 (E_RNA) where: Base-Base interactions energy: -191.623 where: short stacking energy: -96.508 Base-Backbone interact. energy: -0.007 local terms energy: -93.636990 where: bonds (distance) C4'-P energy: -13.776 bonds (distance) P-C4' energy: -21.096 flat angles C4'-P-C4' energy: -19.972 flat angles P-C4'-P energy: -8.887 tors. eta vs tors. theta energy: -29.906 Dist. restrs. and SS energy: 3.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 719 Temperature: 1.026900 Total energy: -281.248095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.248095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.859935 (E_RNA) where: Base-Base interactions energy: -189.925 where: short stacking energy: -89.755 Base-Backbone interact. energy: -0.384 local terms energy: -93.550388 where: bonds (distance) C4'-P energy: -19.728 bonds (distance) P-C4' energy: -15.946 flat angles C4'-P-C4' energy: -16.821 flat angles P-C4'-P energy: -14.074 tors. eta vs tors. theta energy: -26.981 Dist. restrs. and SS energy: 2.612 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 720 Temperature: 1.026450 Total energy: -278.414281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.414281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.624052 (E_RNA) where: Base-Base interactions energy: -192.896 where: short stacking energy: -91.817 Base-Backbone interact. energy: -0.570 local terms energy: -87.158127 where: bonds (distance) C4'-P energy: -12.692 bonds (distance) P-C4' energy: -15.765 flat angles C4'-P-C4' energy: -17.014 flat angles P-C4'-P energy: -17.001 tors. eta vs tors. theta energy: -24.686 Dist. restrs. and SS energy: 2.210 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 721 Temperature: 1.026000 Total energy: -283.779586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.779586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.169030 (E_RNA) where: Base-Base interactions energy: -192.665 where: short stacking energy: -88.975 Base-Backbone interact. energy: -0.343 local terms energy: -93.160236 where: bonds (distance) C4'-P energy: -15.933 bonds (distance) P-C4' energy: -17.742 flat angles C4'-P-C4' energy: -19.600 flat angles P-C4'-P energy: -14.086 tors. eta vs tors. theta energy: -25.799 Dist. restrs. and SS energy: 2.389 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 722 Temperature: 1.025550 Total energy: -285.188394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.188394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.248058 (E_RNA) where: Base-Base interactions energy: -202.200 where: short stacking energy: -95.616 Base-Backbone interact. energy: -0.254 local terms energy: -84.794008 where: bonds (distance) C4'-P energy: -15.924 bonds (distance) P-C4' energy: -13.875 flat angles C4'-P-C4' energy: -20.351 flat angles P-C4'-P energy: -8.445 tors. eta vs tors. theta energy: -26.199 Dist. restrs. and SS energy: 2.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 723 Temperature: 1.025100 Total energy: -280.455201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.455201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.620483 (E_RNA) where: Base-Base interactions energy: -187.835 where: short stacking energy: -83.343 Base-Backbone interact. energy: -0.015 local terms energy: -95.771000 where: bonds (distance) C4'-P energy: -19.260 bonds (distance) P-C4' energy: -19.486 flat angles C4'-P-C4' energy: -19.425 flat angles P-C4'-P energy: -12.980 tors. eta vs tors. theta energy: -24.620 Dist. restrs. and SS energy: 3.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 724 Temperature: 1.024650 Total energy: -286.902876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.902876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.710755 (E_RNA) where: Base-Base interactions energy: -189.018 where: short stacking energy: -90.284 Base-Backbone interact. energy: -0.007 local terms energy: -100.685801 where: bonds (distance) C4'-P energy: -20.549 bonds (distance) P-C4' energy: -19.481 flat angles C4'-P-C4' energy: -19.686 flat angles P-C4'-P energy: -10.608 tors. eta vs tors. theta energy: -30.362 Dist. restrs. and SS energy: 2.808 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 725 Temperature: 1.024200 Total energy: -292.650803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.650803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.721547 (E_RNA) where: Base-Base interactions energy: -187.044 where: short stacking energy: -102.656 Base-Backbone interact. energy: -0.032 local terms energy: -108.646226 where: bonds (distance) C4'-P energy: -20.489 bonds (distance) P-C4' energy: -22.613 flat angles C4'-P-C4' energy: -21.229 flat angles P-C4'-P energy: -15.453 tors. eta vs tors. theta energy: -28.862 Dist. restrs. and SS energy: 3.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 726 Temperature: 1.023750 Total energy: -272.420829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.420829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.844800 (E_RNA) where: Base-Base interactions energy: -179.719 where: short stacking energy: -84.541 Base-Backbone interact. energy: -0.022 local terms energy: -96.103503 where: bonds (distance) C4'-P energy: -14.972 bonds (distance) P-C4' energy: -16.314 flat angles C4'-P-C4' energy: -20.895 flat angles P-C4'-P energy: -15.176 tors. eta vs tors. theta energy: -28.747 Dist. restrs. and SS energy: 3.424 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 727 Temperature: 1.023300 Total energy: -282.134334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.134334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.242387 (E_RNA) where: Base-Base interactions energy: -191.077 where: short stacking energy: -95.870 Base-Backbone interact. energy: -0.000 local terms energy: -93.165239 where: bonds (distance) C4'-P energy: -18.755 bonds (distance) P-C4' energy: -15.969 flat angles C4'-P-C4' energy: -17.321 flat angles P-C4'-P energy: -12.355 tors. eta vs tors. theta energy: -28.765 Dist. restrs. and SS energy: 2.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 728 Temperature: 1.022850 Total energy: -273.143566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.143566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.263803 (E_RNA) where: Base-Base interactions energy: -188.327 where: short stacking energy: -88.136 Base-Backbone interact. energy: -0.009 local terms energy: -86.928511 where: bonds (distance) C4'-P energy: -11.681 bonds (distance) P-C4' energy: -20.191 flat angles C4'-P-C4' energy: -19.188 flat angles P-C4'-P energy: -11.592 tors. eta vs tors. theta energy: -24.276 Dist. restrs. and SS energy: 2.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 729 Temperature: 1.022400 Total energy: -273.479553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.479553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.486698 (E_RNA) where: Base-Base interactions energy: -188.581 where: short stacking energy: -88.924 Base-Backbone interact. energy: -0.421 local terms energy: -86.484772 where: bonds (distance) C4'-P energy: -12.365 bonds (distance) P-C4' energy: -19.618 flat angles C4'-P-C4' energy: -21.055 flat angles P-C4'-P energy: -8.120 tors. eta vs tors. theta energy: -25.327 Dist. restrs. and SS energy: 2.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 730 Temperature: 1.021950 Total energy: -277.984180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.984180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.046070 (E_RNA) where: Base-Base interactions energy: -184.526 where: short stacking energy: -86.439 Base-Backbone interact. energy: -0.404 local terms energy: -95.115260 where: bonds (distance) C4'-P energy: -16.330 bonds (distance) P-C4' energy: -20.460 flat angles C4'-P-C4' energy: -18.786 flat angles P-C4'-P energy: -15.426 tors. eta vs tors. theta energy: -24.113 Dist. restrs. and SS energy: 2.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 731 Temperature: 1.021500 Total energy: -281.495184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.495184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.624677 (E_RNA) where: Base-Base interactions energy: -186.977 where: short stacking energy: -93.915 Base-Backbone interact. energy: -0.714 local terms energy: -95.934513 where: bonds (distance) C4'-P energy: -21.278 bonds (distance) P-C4' energy: -16.986 flat angles C4'-P-C4' energy: -17.461 flat angles P-C4'-P energy: -13.218 tors. eta vs tors. theta energy: -26.992 Dist. restrs. and SS energy: 2.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 732 Temperature: 1.021050 Total energy: -277.196391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.196391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.034102 (E_RNA) where: Base-Base interactions energy: -190.566 where: short stacking energy: -88.863 Base-Backbone interact. energy: -0.844 local terms energy: -87.625062 where: bonds (distance) C4'-P energy: -17.609 bonds (distance) P-C4' energy: -16.089 flat angles C4'-P-C4' energy: -16.617 flat angles P-C4'-P energy: -11.999 tors. eta vs tors. theta energy: -25.311 Dist. restrs. and SS energy: 1.838 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 733 Temperature: 1.020600 Total energy: -276.446618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.446618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.759007 (E_RNA) where: Base-Base interactions energy: -181.143 where: short stacking energy: -85.269 Base-Backbone interact. energy: -0.746 local terms energy: -96.869072 where: bonds (distance) C4'-P energy: -18.876 bonds (distance) P-C4' energy: -14.988 flat angles C4'-P-C4' energy: -19.276 flat angles P-C4'-P energy: -13.505 tors. eta vs tors. theta energy: -30.224 Dist. restrs. and SS energy: 2.312 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 734 Temperature: 1.020150 Total energy: -280.950407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.950407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.130770 (E_RNA) where: Base-Base interactions energy: -195.863 where: short stacking energy: -98.979 Base-Backbone interact. energy: -0.016 local terms energy: -87.251012 where: bonds (distance) C4'-P energy: -13.274 bonds (distance) P-C4' energy: -17.990 flat angles C4'-P-C4' energy: -14.447 flat angles P-C4'-P energy: -14.395 tors. eta vs tors. theta energy: -27.145 Dist. restrs. and SS energy: 2.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 735 Temperature: 1.019700 Total energy: -289.283453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.283453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.814759 (E_RNA) where: Base-Base interactions energy: -200.796 where: short stacking energy: -98.557 Base-Backbone interact. energy: -0.001 local terms energy: -91.017562 where: bonds (distance) C4'-P energy: -14.815 bonds (distance) P-C4' energy: -14.529 flat angles C4'-P-C4' energy: -20.838 flat angles P-C4'-P energy: -13.978 tors. eta vs tors. theta energy: -26.859 Dist. restrs. and SS energy: 2.531 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 736 Temperature: 1.019250 Total energy: -284.679437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.679437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.873773 (E_RNA) where: Base-Base interactions energy: -195.646 where: short stacking energy: -94.908 Base-Backbone interact. energy: -1.920 local terms energy: -89.308341 where: bonds (distance) C4'-P energy: -20.541 bonds (distance) P-C4' energy: -17.821 flat angles C4'-P-C4' energy: -16.808 flat angles P-C4'-P energy: -9.718 tors. eta vs tors. theta energy: -24.420 Dist. restrs. and SS energy: 2.194 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 737 Temperature: 1.018800 Total energy: -288.741887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.741887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.183875 (E_RNA) where: Base-Base interactions energy: -195.121 where: short stacking energy: -88.247 Base-Backbone interact. energy: -0.321 local terms energy: -95.741486 where: bonds (distance) C4'-P energy: -16.791 bonds (distance) P-C4' energy: -17.852 flat angles C4'-P-C4' energy: -21.746 flat angles P-C4'-P energy: -11.491 tors. eta vs tors. theta energy: -27.863 Dist. restrs. and SS energy: 2.442 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 738 Temperature: 1.018350 Total energy: -287.721565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.721565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.778469 (E_RNA) where: Base-Base interactions energy: -199.942 where: short stacking energy: -93.744 Base-Backbone interact. energy: 0.232 local terms energy: -91.068574 where: bonds (distance) C4'-P energy: -16.520 bonds (distance) P-C4' energy: -16.256 flat angles C4'-P-C4' energy: -18.083 flat angles P-C4'-P energy: -12.790 tors. eta vs tors. theta energy: -27.419 Dist. restrs. and SS energy: 3.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 739 Temperature: 1.017900 Total energy: -269.364560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.364560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.127896 (E_RNA) where: Base-Base interactions energy: -185.903 where: short stacking energy: -80.274 Base-Backbone interact. energy: -0.555 local terms energy: -85.669279 where: bonds (distance) C4'-P energy: -14.614 bonds (distance) P-C4' energy: -18.751 flat angles C4'-P-C4' energy: -16.644 flat angles P-C4'-P energy: -12.292 tors. eta vs tors. theta energy: -23.369 Dist. restrs. and SS energy: 2.763 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 740 Temperature: 1.017450 Total energy: -283.421394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.421394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.245942 (E_RNA) where: Base-Base interactions energy: -194.769 where: short stacking energy: -92.431 Base-Backbone interact. energy: -0.419 local terms energy: -91.058493 where: bonds (distance) C4'-P energy: -14.411 bonds (distance) P-C4' energy: -14.716 flat angles C4'-P-C4' energy: -22.399 flat angles P-C4'-P energy: -12.728 tors. eta vs tors. theta energy: -26.803 Dist. restrs. and SS energy: 2.825 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 741 Temperature: 1.017000 Total energy: -281.201236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.201236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.853138 (E_RNA) where: Base-Base interactions energy: -188.905 where: short stacking energy: -94.337 Base-Backbone interact. energy: -0.013 local terms energy: -93.934531 where: bonds (distance) C4'-P energy: -13.975 bonds (distance) P-C4' energy: -21.808 flat angles C4'-P-C4' energy: -17.149 flat angles P-C4'-P energy: -14.215 tors. eta vs tors. theta energy: -26.788 Dist. restrs. and SS energy: 1.652 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 742 Temperature: 1.016550 Total energy: -290.318156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.318156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.811135 (E_RNA) where: Base-Base interactions energy: -193.834 where: short stacking energy: -92.324 Base-Backbone interact. energy: -0.406 local terms energy: -98.570705 where: bonds (distance) C4'-P energy: -14.596 bonds (distance) P-C4' energy: -19.448 flat angles C4'-P-C4' energy: -20.664 flat angles P-C4'-P energy: -15.752 tors. eta vs tors. theta energy: -28.111 Dist. restrs. and SS energy: 2.493 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 743 Temperature: 1.016100 Total energy: -299.265369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.265369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.715019 (E_RNA) where: Base-Base interactions energy: -200.291 where: short stacking energy: -102.848 Base-Backbone interact. energy: -0.011 local terms energy: -101.413185 where: bonds (distance) C4'-P energy: -16.915 bonds (distance) P-C4' energy: -16.555 flat angles C4'-P-C4' energy: -21.769 flat angles P-C4'-P energy: -17.313 tors. eta vs tors. theta energy: -28.861 Dist. restrs. and SS energy: 2.450 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 744 Temperature: 1.015650 Total energy: -281.434347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.434347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.783692 (E_RNA) where: Base-Base interactions energy: -190.458 where: short stacking energy: -94.889 Base-Backbone interact. energy: -0.165 local terms energy: -93.161296 where: bonds (distance) C4'-P energy: -16.560 bonds (distance) P-C4' energy: -16.060 flat angles C4'-P-C4' energy: -22.301 flat angles P-C4'-P energy: -13.133 tors. eta vs tors. theta energy: -25.107 Dist. restrs. and SS energy: 2.349 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 745 Temperature: 1.015200 Total energy: -279.283558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.283558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.551052 (E_RNA) where: Base-Base interactions energy: -190.707 where: short stacking energy: -90.981 Base-Backbone interact. energy: -0.098 local terms energy: -90.745798 where: bonds (distance) C4'-P energy: -15.814 bonds (distance) P-C4' energy: -19.986 flat angles C4'-P-C4' energy: -16.311 flat angles P-C4'-P energy: -14.113 tors. eta vs tors. theta energy: -24.522 Dist. restrs. and SS energy: 2.267 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 746 Temperature: 1.014750 Total energy: -293.919507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.919507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.780128 (E_RNA) where: Base-Base interactions energy: -201.549 where: short stacking energy: -97.231 Base-Backbone interact. energy: 0.509 local terms energy: -94.739560 where: bonds (distance) C4'-P energy: -18.376 bonds (distance) P-C4' energy: -14.545 flat angles C4'-P-C4' energy: -20.456 flat angles P-C4'-P energy: -14.469 tors. eta vs tors. theta energy: -26.893 Dist. restrs. and SS energy: 1.861 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 747 Temperature: 1.014300 Total energy: -277.944056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.944056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.633984 (E_RNA) where: Base-Base interactions energy: -202.619 where: short stacking energy: -103.282 Base-Backbone interact. energy: -0.007 local terms energy: -78.007582 where: bonds (distance) C4'-P energy: -17.096 bonds (distance) P-C4' energy: -11.164 flat angles C4'-P-C4' energy: -15.579 flat angles P-C4'-P energy: -9.632 tors. eta vs tors. theta energy: -24.536 Dist. restrs. and SS energy: 2.690 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 748 Temperature: 1.013850 Total energy: -273.928423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.928423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.191424 (E_RNA) where: Base-Base interactions energy: -181.725 where: short stacking energy: -95.108 Base-Backbone interact. energy: -0.741 local terms energy: -93.724541 where: bonds (distance) C4'-P energy: -18.102 bonds (distance) P-C4' energy: -21.405 flat angles C4'-P-C4' energy: -17.379 flat angles P-C4'-P energy: -13.546 tors. eta vs tors. theta energy: -23.294 Dist. restrs. and SS energy: 2.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 749 Temperature: 1.013400 Total energy: -263.666536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.666536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.436092 (E_RNA) where: Base-Base interactions energy: -179.308 where: short stacking energy: -85.531 Base-Backbone interact. energy: -0.578 local terms energy: -85.550211 where: bonds (distance) C4'-P energy: -19.597 bonds (distance) P-C4' energy: -13.916 flat angles C4'-P-C4' energy: -15.661 flat angles P-C4'-P energy: -13.955 tors. eta vs tors. theta energy: -22.422 Dist. restrs. and SS energy: 1.770 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 750 Temperature: 1.012950 Total energy: -282.037827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.037827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.815982 (E_RNA) where: Base-Base interactions energy: -188.663 where: short stacking energy: -88.235 Base-Backbone interact. energy: -0.367 local terms energy: -94.786061 where: bonds (distance) C4'-P energy: -15.647 bonds (distance) P-C4' energy: -21.855 flat angles C4'-P-C4' energy: -20.954 flat angles P-C4'-P energy: -16.059 tors. eta vs tors. theta energy: -20.271 Dist. restrs. and SS energy: 1.778 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 751 Temperature: 1.012500 Total energy: -282.856664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.856664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.302474 (E_RNA) where: Base-Base interactions energy: -195.305 where: short stacking energy: -95.409 Base-Backbone interact. energy: 0.884 local terms energy: -90.882049 where: bonds (distance) C4'-P energy: -13.556 bonds (distance) P-C4' energy: -20.261 flat angles C4'-P-C4' energy: -19.398 flat angles P-C4'-P energy: -11.964 tors. eta vs tors. theta energy: -25.703 Dist. restrs. and SS energy: 2.446 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 752 Temperature: 1.012050 Total energy: -285.561408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.561408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.216412 (E_RNA) where: Base-Base interactions energy: -197.715 where: short stacking energy: -98.030 Base-Backbone interact. energy: 0.304 local terms energy: -90.804805 where: bonds (distance) C4'-P energy: -16.806 bonds (distance) P-C4' energy: -14.330 flat angles C4'-P-C4' energy: -21.805 flat angles P-C4'-P energy: -11.728 tors. eta vs tors. theta energy: -26.135 Dist. restrs. and SS energy: 2.655 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 753 Temperature: 1.011600 Total energy: -292.086255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.086255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.935218 (E_RNA) where: Base-Base interactions energy: -196.871 where: short stacking energy: -89.573 Base-Backbone interact. energy: -0.006 local terms energy: -98.058569 where: bonds (distance) C4'-P energy: -17.220 bonds (distance) P-C4' energy: -21.951 flat angles C4'-P-C4' energy: -21.764 flat angles P-C4'-P energy: -12.942 tors. eta vs tors. theta energy: -24.182 Dist. restrs. and SS energy: 2.849 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 754 Temperature: 1.011150 Total energy: -287.023320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.023320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.081325 (E_RNA) where: Base-Base interactions energy: -193.662 where: short stacking energy: -103.193 Base-Backbone interact. energy: -0.855 local terms energy: -94.564592 where: bonds (distance) C4'-P energy: -17.840 bonds (distance) P-C4' energy: -18.346 flat angles C4'-P-C4' energy: -17.844 flat angles P-C4'-P energy: -13.774 tors. eta vs tors. theta energy: -26.761 Dist. restrs. and SS energy: 2.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 755 Temperature: 1.010700 Total energy: -292.314194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.314194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.621800 (E_RNA) where: Base-Base interactions energy: -197.879 where: short stacking energy: -94.433 Base-Backbone interact. energy: -0.474 local terms energy: -96.268980 where: bonds (distance) C4'-P energy: -16.200 bonds (distance) P-C4' energy: -14.786 flat angles C4'-P-C4' energy: -22.495 flat angles P-C4'-P energy: -13.965 tors. eta vs tors. theta energy: -28.823 Dist. restrs. and SS energy: 2.308 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 756 Temperature: 1.010250 Total energy: -281.354506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.354506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.714812 (E_RNA) where: Base-Base interactions energy: -184.800 where: short stacking energy: -93.174 Base-Backbone interact. energy: -0.093 local terms energy: -98.821309 where: bonds (distance) C4'-P energy: -16.100 bonds (distance) P-C4' energy: -17.109 flat angles C4'-P-C4' energy: -21.408 flat angles P-C4'-P energy: -17.632 tors. eta vs tors. theta energy: -26.572 Dist. restrs. and SS energy: 2.360 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 757 Temperature: 1.009800 Total energy: -295.807688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.807688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.464368 (E_RNA) where: Base-Base interactions energy: -196.043 where: short stacking energy: -95.929 Base-Backbone interact. energy: -0.002 local terms energy: -102.419273 where: bonds (distance) C4'-P energy: -18.341 bonds (distance) P-C4' energy: -15.959 flat angles C4'-P-C4' energy: -20.974 flat angles P-C4'-P energy: -16.742 tors. eta vs tors. theta energy: -30.403 Dist. restrs. and SS energy: 2.657 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 758 Temperature: 1.009350 Total energy: -295.304437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.304437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.978857 (E_RNA) where: Base-Base interactions energy: -199.770 where: short stacking energy: -98.823 Base-Backbone interact. energy: -0.029 local terms energy: -98.179604 where: bonds (distance) C4'-P energy: -15.580 bonds (distance) P-C4' energy: -16.186 flat angles C4'-P-C4' energy: -21.727 flat angles P-C4'-P energy: -15.672 tors. eta vs tors. theta energy: -29.014 Dist. restrs. and SS energy: 2.674 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 759 Temperature: 1.008900 Total energy: -287.265208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.265208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.782609 (E_RNA) where: Base-Base interactions energy: -191.999 where: short stacking energy: -96.622 Base-Backbone interact. energy: -0.009 local terms energy: -97.774516 where: bonds (distance) C4'-P energy: -18.654 bonds (distance) P-C4' energy: -18.138 flat angles C4'-P-C4' energy: -18.634 flat angles P-C4'-P energy: -14.124 tors. eta vs tors. theta energy: -28.225 Dist. restrs. and SS energy: 2.517 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 760 Temperature: 1.008450 Total energy: -288.435329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.435329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.359299 (E_RNA) where: Base-Base interactions energy: -189.444 where: short stacking energy: -89.856 Base-Backbone interact. energy: -0.160 local terms energy: -101.756049 where: bonds (distance) C4'-P energy: -17.256 bonds (distance) P-C4' energy: -20.659 flat angles C4'-P-C4' energy: -20.333 flat angles P-C4'-P energy: -14.877 tors. eta vs tors. theta energy: -28.630 Dist. restrs. and SS energy: 2.924 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 761 Temperature: 1.008000 Total energy: -278.060309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.060309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.340210 (E_RNA) where: Base-Base interactions energy: -180.527 where: short stacking energy: -82.477 Base-Backbone interact. energy: -2.714 local terms energy: -97.099476 where: bonds (distance) C4'-P energy: -14.372 bonds (distance) P-C4' energy: -21.146 flat angles C4'-P-C4' energy: -17.329 flat angles P-C4'-P energy: -16.125 tors. eta vs tors. theta energy: -28.128 Dist. restrs. and SS energy: 2.280 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 762 Temperature: 1.007550 Total energy: -285.124729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.124729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.465197 (E_RNA) where: Base-Base interactions energy: -188.129 where: short stacking energy: -87.922 Base-Backbone interact. energy: -0.004 local terms energy: -99.332566 where: bonds (distance) C4'-P energy: -21.290 bonds (distance) P-C4' energy: -19.582 flat angles C4'-P-C4' energy: -23.588 flat angles P-C4'-P energy: -5.330 tors. eta vs tors. theta energy: -29.542 Dist. restrs. and SS energy: 2.340 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 763 Temperature: 1.007100 Total energy: -283.248760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.248760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.703480 (E_RNA) where: Base-Base interactions energy: -186.339 where: short stacking energy: -84.105 Base-Backbone interact. energy: -0.413 local terms energy: -98.951234 where: bonds (distance) C4'-P energy: -15.490 bonds (distance) P-C4' energy: -17.829 flat angles C4'-P-C4' energy: -22.701 flat angles P-C4'-P energy: -13.980 tors. eta vs tors. theta energy: -28.951 Dist. restrs. and SS energy: 2.455 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 764 Temperature: 1.006650 Total energy: -280.388187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.388187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.647114 (E_RNA) where: Base-Base interactions energy: -183.887 where: short stacking energy: -89.778 Base-Backbone interact. energy: -0.049 local terms energy: -98.711288 where: bonds (distance) C4'-P energy: -17.558 bonds (distance) P-C4' energy: -19.942 flat angles C4'-P-C4' energy: -20.282 flat angles P-C4'-P energy: -14.493 tors. eta vs tors. theta energy: -26.435 Dist. restrs. and SS energy: 2.259 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 765 Temperature: 1.006200 Total energy: -288.657174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.657174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.288877 (E_RNA) where: Base-Base interactions energy: -194.575 where: short stacking energy: -91.790 Base-Backbone interact. energy: -0.002 local terms energy: -96.711655 where: bonds (distance) C4'-P energy: -16.532 bonds (distance) P-C4' energy: -22.872 flat angles C4'-P-C4' energy: -18.061 flat angles P-C4'-P energy: -12.954 tors. eta vs tors. theta energy: -26.293 Dist. restrs. and SS energy: 2.632 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 766 Temperature: 1.005750 Total energy: -278.763024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.763024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.076970 (E_RNA) where: Base-Base interactions energy: -200.576 where: short stacking energy: -87.555 Base-Backbone interact. energy: -0.004 local terms energy: -80.496753 where: bonds (distance) C4'-P energy: -12.183 bonds (distance) P-C4' energy: -13.590 flat angles C4'-P-C4' energy: -19.185 flat angles P-C4'-P energy: -10.502 tors. eta vs tors. theta energy: -25.036 Dist. restrs. and SS energy: 2.314 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 767 Temperature: 1.005300 Total energy: -294.162934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.162934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.068825 (E_RNA) where: Base-Base interactions energy: -201.318 where: short stacking energy: -86.507 Base-Backbone interact. energy: -0.152 local terms energy: -95.598222 where: bonds (distance) C4'-P energy: -18.972 bonds (distance) P-C4' energy: -11.405 flat angles C4'-P-C4' energy: -23.849 flat angles P-C4'-P energy: -12.798 tors. eta vs tors. theta energy: -28.575 Dist. restrs. and SS energy: 2.906 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 768 Temperature: 1.004850 Total energy: -296.763561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.763561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.054488 (E_RNA) where: Base-Base interactions energy: -206.990 where: short stacking energy: -95.699 Base-Backbone interact. energy: -0.646 local terms energy: -91.418782 where: bonds (distance) C4'-P energy: -12.956 bonds (distance) P-C4' energy: -17.977 flat angles C4'-P-C4' energy: -18.756 flat angles P-C4'-P energy: -13.717 tors. eta vs tors. theta energy: -28.012 Dist. restrs. and SS energy: 2.291 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 769 Temperature: 1.004400 Total energy: -284.238465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.238465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.651277 (E_RNA) where: Base-Base interactions energy: -193.969 where: short stacking energy: -90.201 Base-Backbone interact. energy: -0.221 local terms energy: -92.460719 where: bonds (distance) C4'-P energy: -19.891 bonds (distance) P-C4' energy: -16.551 flat angles C4'-P-C4' energy: -16.582 flat angles P-C4'-P energy: -11.950 tors. eta vs tors. theta energy: -27.486 Dist. restrs. and SS energy: 2.413 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 770 Temperature: 1.003950 Total energy: -289.246238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.246238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.613187 (E_RNA) where: Base-Base interactions energy: -192.595 where: short stacking energy: -82.307 Base-Backbone interact. energy: -0.001 local terms energy: -99.016767 where: bonds (distance) C4'-P energy: -20.244 bonds (distance) P-C4' energy: -20.883 flat angles C4'-P-C4' energy: -19.932 flat angles P-C4'-P energy: -11.500 tors. eta vs tors. theta energy: -26.458 Dist. restrs. and SS energy: 2.367 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 771 Temperature: 1.003500 Total energy: -290.039216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.039216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.692344 (E_RNA) where: Base-Base interactions energy: -202.016 where: short stacking energy: -86.445 Base-Backbone interact. energy: -0.001 local terms energy: -91.675377 where: bonds (distance) C4'-P energy: -16.944 bonds (distance) P-C4' energy: -16.509 flat angles C4'-P-C4' energy: -20.797 flat angles P-C4'-P energy: -12.218 tors. eta vs tors. theta energy: -25.208 Dist. restrs. and SS energy: 3.653 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 772 Temperature: 1.003050 Total energy: -291.050623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.050623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.511795 (E_RNA) where: Base-Base interactions energy: -200.011 where: short stacking energy: -89.875 Base-Backbone interact. energy: -0.005 local terms energy: -93.495712 where: bonds (distance) C4'-P energy: -19.245 bonds (distance) P-C4' energy: -16.037 flat angles C4'-P-C4' energy: -21.421 flat angles P-C4'-P energy: -10.142 tors. eta vs tors. theta energy: -26.650 Dist. restrs. and SS energy: 2.461 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 773 Temperature: 1.002600 Total energy: -292.528476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.528476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.235973 (E_RNA) where: Base-Base interactions energy: -192.007 where: short stacking energy: -93.284 Base-Backbone interact. energy: -0.220 local terms energy: -103.009813 where: bonds (distance) C4'-P energy: -18.232 bonds (distance) P-C4' energy: -21.306 flat angles C4'-P-C4' energy: -21.327 flat angles P-C4'-P energy: -14.169 tors. eta vs tors. theta energy: -27.976 Dist. restrs. and SS energy: 2.707 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 774 Temperature: 1.002150 Total energy: -295.253278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.253278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.616781 (E_RNA) where: Base-Base interactions energy: -207.849 where: short stacking energy: -101.413 Base-Backbone interact. energy: -0.003 local terms energy: -89.765477 where: bonds (distance) C4'-P energy: -13.814 bonds (distance) P-C4' energy: -13.997 flat angles C4'-P-C4' energy: -19.334 flat angles P-C4'-P energy: -12.471 tors. eta vs tors. theta energy: -30.149 Dist. restrs. and SS energy: 2.364 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 775 Temperature: 1.001700 Total energy: -287.652146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.652146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.930408 (E_RNA) where: Base-Base interactions energy: -198.571 where: short stacking energy: -100.521 Base-Backbone interact. energy: -0.635 local terms energy: -90.724320 where: bonds (distance) C4'-P energy: -15.052 bonds (distance) P-C4' energy: -13.384 flat angles C4'-P-C4' energy: -19.546 flat angles P-C4'-P energy: -17.140 tors. eta vs tors. theta energy: -25.601 Dist. restrs. and SS energy: 2.278 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 776 Temperature: 1.001250 Total energy: -291.556224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.556224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.132696 (E_RNA) where: Base-Base interactions energy: -201.188 where: short stacking energy: -97.445 Base-Backbone interact. energy: -0.010 local terms energy: -92.934820 where: bonds (distance) C4'-P energy: -15.575 bonds (distance) P-C4' energy: -23.554 flat angles C4'-P-C4' energy: -20.662 flat angles P-C4'-P energy: -10.474 tors. eta vs tors. theta energy: -22.670 Dist. restrs. and SS energy: 2.576 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 777 Temperature: 1.000800 Total energy: -282.959982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.959982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.294624 (E_RNA) where: Base-Base interactions energy: -188.905 where: short stacking energy: -94.809 Base-Backbone interact. energy: -0.003 local terms energy: -96.387536 where: bonds (distance) C4'-P energy: -18.065 bonds (distance) P-C4' energy: -17.050 flat angles C4'-P-C4' energy: -18.603 flat angles P-C4'-P energy: -15.467 tors. eta vs tors. theta energy: -27.202 Dist. restrs. and SS energy: 2.335 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 778 Temperature: 1.000350 Total energy: -268.367864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.367864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.941514 (E_RNA) where: Base-Base interactions energy: -171.360 where: short stacking energy: -82.287 Base-Backbone interact. energy: -0.581 local terms energy: -99.000470 where: bonds (distance) C4'-P energy: -20.164 bonds (distance) P-C4' energy: -20.964 flat angles C4'-P-C4' energy: -19.808 flat angles P-C4'-P energy: -12.799 tors. eta vs tors. theta energy: -25.265 Dist. restrs. and SS energy: 2.574 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 779 Temperature: 0.999900 Total energy: -287.330006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.330006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.249016 (E_RNA) where: Base-Base interactions energy: -192.471 where: short stacking energy: -91.590 Base-Backbone interact. energy: -1.101 local terms energy: -96.677585 where: bonds (distance) C4'-P energy: -15.785 bonds (distance) P-C4' energy: -19.967 flat angles C4'-P-C4' energy: -19.988 flat angles P-C4'-P energy: -11.984 tors. eta vs tors. theta energy: -28.954 Dist. restrs. and SS energy: 2.919 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 780 Temperature: 0.999450 Total energy: -283.606077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.606077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.220289 (E_RNA) where: Base-Base interactions energy: -195.210 where: short stacking energy: -99.248 Base-Backbone interact. energy: -0.041 local terms energy: -90.969633 where: bonds (distance) C4'-P energy: -16.603 bonds (distance) P-C4' energy: -17.404 flat angles C4'-P-C4' energy: -17.166 flat angles P-C4'-P energy: -9.996 tors. eta vs tors. theta energy: -29.801 Dist. restrs. and SS energy: 2.614 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 781 Temperature: 0.999000 Total energy: -278.703168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.703168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.703469 (E_RNA) where: Base-Base interactions energy: -194.202 where: short stacking energy: -87.349 Base-Backbone interact. energy: -0.721 local terms energy: -85.779982 where: bonds (distance) C4'-P energy: -16.235 bonds (distance) P-C4' energy: -18.656 flat angles C4'-P-C4' energy: -15.403 flat angles P-C4'-P energy: -10.496 tors. eta vs tors. theta energy: -24.989 Dist. restrs. and SS energy: 2.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 782 Temperature: 0.998550 Total energy: -283.333864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.333864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.565501 (E_RNA) where: Base-Base interactions energy: -189.455 where: short stacking energy: -87.354 Base-Backbone interact. energy: -1.134 local terms energy: -96.976337 where: bonds (distance) C4'-P energy: -17.954 bonds (distance) P-C4' energy: -21.281 flat angles C4'-P-C4' energy: -17.104 flat angles P-C4'-P energy: -16.777 tors. eta vs tors. theta energy: -23.860 Dist. restrs. and SS energy: 4.232 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 783 Temperature: 0.998100 Total energy: -285.608427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.608427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.819937 (E_RNA) where: Base-Base interactions energy: -200.203 where: short stacking energy: -91.767 Base-Backbone interact. energy: -0.091 local terms energy: -88.525620 where: bonds (distance) C4'-P energy: -14.738 bonds (distance) P-C4' energy: -20.285 flat angles C4'-P-C4' energy: -15.077 flat angles P-C4'-P energy: -13.344 tors. eta vs tors. theta energy: -25.081 Dist. restrs. and SS energy: 3.212 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 784 Temperature: 0.997650 Total energy: -285.697299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.697299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.579811 (E_RNA) where: Base-Base interactions energy: -192.367 where: short stacking energy: -94.264 Base-Backbone interact. energy: -0.892 local terms energy: -94.321065 where: bonds (distance) C4'-P energy: -19.453 bonds (distance) P-C4' energy: -18.656 flat angles C4'-P-C4' energy: -15.651 flat angles P-C4'-P energy: -13.130 tors. eta vs tors. theta energy: -27.431 Dist. restrs. and SS energy: 1.883 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 785 Temperature: 0.997200 Total energy: -291.081253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.081253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.053106 (E_RNA) where: Base-Base interactions energy: -200.862 where: short stacking energy: -93.224 Base-Backbone interact. energy: -0.663 local terms energy: -91.528004 where: bonds (distance) C4'-P energy: -17.403 bonds (distance) P-C4' energy: -15.807 flat angles C4'-P-C4' energy: -17.115 flat angles P-C4'-P energy: -15.772 tors. eta vs tors. theta energy: -25.431 Dist. restrs. and SS energy: 1.972 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 786 Temperature: 0.996750 Total energy: -294.187051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.187051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.186230 (E_RNA) where: Base-Base interactions energy: -193.312 where: short stacking energy: -91.909 Base-Backbone interact. energy: -1.935 local terms energy: -100.939127 where: bonds (distance) C4'-P energy: -15.267 bonds (distance) P-C4' energy: -22.586 flat angles C4'-P-C4' energy: -21.694 flat angles P-C4'-P energy: -13.547 tors. eta vs tors. theta energy: -27.845 Dist. restrs. and SS energy: 1.999 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 787 Temperature: 0.996300 Total energy: -281.365606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.365606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.396189 (E_RNA) where: Base-Base interactions energy: -196.037 where: short stacking energy: -91.607 Base-Backbone interact. energy: -0.188 local terms energy: -88.171477 where: bonds (distance) C4'-P energy: -12.865 bonds (distance) P-C4' energy: -17.340 flat angles C4'-P-C4' energy: -21.984 flat angles P-C4'-P energy: -10.057 tors. eta vs tors. theta energy: -25.926 Dist. restrs. and SS energy: 3.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 788 Temperature: 0.995850 Total energy: -296.789712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.789712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.423071 (E_RNA) where: Base-Base interactions energy: -198.579 where: short stacking energy: -94.000 Base-Backbone interact. energy: -1.014 local terms energy: -99.830573 where: bonds (distance) C4'-P energy: -18.896 bonds (distance) P-C4' energy: -20.140 flat angles C4'-P-C4' energy: -18.879 flat angles P-C4'-P energy: -14.975 tors. eta vs tors. theta energy: -26.940 Dist. restrs. and SS energy: 2.633 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 789 Temperature: 0.995400 Total energy: -278.130498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.130498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.480052 (E_RNA) where: Base-Base interactions energy: -194.680 where: short stacking energy: -86.752 Base-Backbone interact. energy: -0.005 local terms energy: -85.795167 where: bonds (distance) C4'-P energy: -15.491 bonds (distance) P-C4' energy: -16.487 flat angles C4'-P-C4' energy: -20.400 flat angles P-C4'-P energy: -9.386 tors. eta vs tors. theta energy: -24.032 Dist. restrs. and SS energy: 2.350 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 790 Temperature: 0.994950 Total energy: -293.197031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.197031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.546322 (E_RNA) where: Base-Base interactions energy: -196.368 where: short stacking energy: -94.615 Base-Backbone interact. energy: -2.393 local terms energy: -96.785625 where: bonds (distance) C4'-P energy: -18.447 bonds (distance) P-C4' energy: -18.009 flat angles C4'-P-C4' energy: -20.138 flat angles P-C4'-P energy: -12.339 tors. eta vs tors. theta energy: -27.852 Dist. restrs. and SS energy: 2.349 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 791 Temperature: 0.994500 Total energy: -286.566207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.566207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.286061 (E_RNA) where: Base-Base interactions energy: -196.661 where: short stacking energy: -93.564 Base-Backbone interact. energy: -2.246 local terms energy: -89.379161 where: bonds (distance) C4'-P energy: -16.572 bonds (distance) P-C4' energy: -13.723 flat angles C4'-P-C4' energy: -18.398 flat angles P-C4'-P energy: -13.425 tors. eta vs tors. theta energy: -27.260 Dist. restrs. and SS energy: 1.720 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 792 Temperature: 0.994050 Total energy: -269.435196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.435196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.084306 (E_RNA) where: Base-Base interactions energy: -182.763 where: short stacking energy: -77.257 Base-Backbone interact. energy: -0.395 local terms energy: -87.925552 where: bonds (distance) C4'-P energy: -17.345 bonds (distance) P-C4' energy: -22.234 flat angles C4'-P-C4' energy: -9.790 flat angles P-C4'-P energy: -16.635 tors. eta vs tors. theta energy: -21.922 Dist. restrs. and SS energy: 1.649 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 793 Temperature: 0.993600 Total energy: -276.278156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.278156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.820197 (E_RNA) where: Base-Base interactions energy: -196.060 where: short stacking energy: -86.823 Base-Backbone interact. energy: 0.067 local terms energy: -82.827698 where: bonds (distance) C4'-P energy: -15.772 bonds (distance) P-C4' energy: -13.676 flat angles C4'-P-C4' energy: -16.567 flat angles P-C4'-P energy: -14.465 tors. eta vs tors. theta energy: -22.348 Dist. restrs. and SS energy: 2.542 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 794 Temperature: 0.993150 Total energy: -281.827061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.827061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.977526 (E_RNA) where: Base-Base interactions energy: -195.334 where: short stacking energy: -90.135 Base-Backbone interact. energy: -0.003 local terms energy: -88.639839 where: bonds (distance) C4'-P energy: -16.131 bonds (distance) P-C4' energy: -16.711 flat angles C4'-P-C4' energy: -18.064 flat angles P-C4'-P energy: -12.226 tors. eta vs tors. theta energy: -25.507 Dist. restrs. and SS energy: 2.150 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 795 Temperature: 0.992700 Total energy: -284.691902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.691902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.819400 (E_RNA) where: Base-Base interactions energy: -200.689 where: short stacking energy: -84.434 Base-Backbone interact. energy: -0.524 local terms energy: -85.606318 where: bonds (distance) C4'-P energy: -12.269 bonds (distance) P-C4' energy: -18.636 flat angles C4'-P-C4' energy: -18.267 flat angles P-C4'-P energy: -13.032 tors. eta vs tors. theta energy: -23.401 Dist. restrs. and SS energy: 2.127 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 796 Temperature: 0.992250 Total energy: -286.048485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.048485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.354293 (E_RNA) where: Base-Base interactions energy: -198.856 where: short stacking energy: -94.366 Base-Backbone interact. energy: -0.770 local terms energy: -88.728529 where: bonds (distance) C4'-P energy: -12.919 bonds (distance) P-C4' energy: -19.558 flat angles C4'-P-C4' energy: -19.205 flat angles P-C4'-P energy: -11.795 tors. eta vs tors. theta energy: -25.251 Dist. restrs. and SS energy: 2.306 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 797 Temperature: 0.991800 Total energy: -289.373282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.373282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.740850 (E_RNA) where: Base-Base interactions energy: -194.662 where: short stacking energy: -88.255 Base-Backbone interact. energy: -0.330 local terms energy: -96.748738 where: bonds (distance) C4'-P energy: -20.207 bonds (distance) P-C4' energy: -19.999 flat angles C4'-P-C4' energy: -17.183 flat angles P-C4'-P energy: -13.092 tors. eta vs tors. theta energy: -26.268 Dist. restrs. and SS energy: 2.368 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 798 Temperature: 0.991350 Total energy: -284.197917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.197917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.348519 (E_RNA) where: Base-Base interactions energy: -196.912 where: short stacking energy: -90.860 Base-Backbone interact. energy: -0.844 local terms energy: -88.592561 where: bonds (distance) C4'-P energy: -16.503 bonds (distance) P-C4' energy: -13.653 flat angles C4'-P-C4' energy: -20.041 flat angles P-C4'-P energy: -13.276 tors. eta vs tors. theta energy: -25.120 Dist. restrs. and SS energy: 2.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 799 Temperature: 0.990900 Total energy: -286.726218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.726218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.879827 (E_RNA) where: Base-Base interactions energy: -192.479 where: short stacking energy: -83.062 Base-Backbone interact. energy: -1.273 local terms energy: -95.127440 where: bonds (distance) C4'-P energy: -20.730 bonds (distance) P-C4' energy: -20.468 flat angles C4'-P-C4' energy: -18.868 flat angles P-C4'-P energy: -12.014 tors. eta vs tors. theta energy: -23.047 Dist. restrs. and SS energy: 2.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 800 Temperature: 0.990450 Total energy: -276.924401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.924401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.592174 (E_RNA) where: Base-Base interactions energy: -199.914 where: short stacking energy: -95.323 Base-Backbone interact. energy: -0.596 local terms energy: -79.082131 where: bonds (distance) C4'-P energy: -13.032 bonds (distance) P-C4' energy: -21.429 flat angles C4'-P-C4' energy: -17.457 flat angles P-C4'-P energy: -9.817 tors. eta vs tors. theta energy: -17.348 Dist. restrs. and SS energy: 2.668 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 801 Temperature: 0.990000 Total energy: -279.783672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.783672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.386355 (E_RNA) where: Base-Base interactions energy: -187.158 where: short stacking energy: -85.646 Base-Backbone interact. energy: -0.192 local terms energy: -95.036208 where: bonds (distance) C4'-P energy: -15.767 bonds (distance) P-C4' energy: -19.497 flat angles C4'-P-C4' energy: -20.818 flat angles P-C4'-P energy: -14.835 tors. eta vs tors. theta energy: -24.120 Dist. restrs. and SS energy: 2.603 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 802 Temperature: 0.989550 Total energy: -289.021563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.021563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.465450 (E_RNA) where: Base-Base interactions energy: -201.875 where: short stacking energy: -92.403 Base-Backbone interact. energy: 0.435 local terms energy: -91.025122 where: bonds (distance) C4'-P energy: -15.140 bonds (distance) P-C4' energy: -15.719 flat angles C4'-P-C4' energy: -20.655 flat angles P-C4'-P energy: -15.451 tors. eta vs tors. theta energy: -24.059 Dist. restrs. and SS energy: 3.444 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 803 Temperature: 0.989100 Total energy: -287.400801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.400801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.247325 (E_RNA) where: Base-Base interactions energy: -197.227 where: short stacking energy: -83.616 Base-Backbone interact. energy: 0.566 local terms energy: -94.587163 where: bonds (distance) C4'-P energy: -18.792 bonds (distance) P-C4' energy: -19.547 flat angles C4'-P-C4' energy: -18.955 flat angles P-C4'-P energy: -14.296 tors. eta vs tors. theta energy: -22.997 Dist. restrs. and SS energy: 3.847 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 804 Temperature: 0.988650 Total energy: -284.624441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.624441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.238040 (E_RNA) where: Base-Base interactions energy: -197.586 where: short stacking energy: -85.501 Base-Backbone interact. energy: -0.388 local terms energy: -89.264642 where: bonds (distance) C4'-P energy: -16.502 bonds (distance) P-C4' energy: -18.266 flat angles C4'-P-C4' energy: -20.450 flat angles P-C4'-P energy: -12.291 tors. eta vs tors. theta energy: -21.755 Dist. restrs. and SS energy: 2.614 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 805 Temperature: 0.988200 Total energy: -284.740436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.740436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.463824 (E_RNA) where: Base-Base interactions energy: -199.799 where: short stacking energy: -81.455 Base-Backbone interact. energy: -0.294 local terms energy: -87.371667 where: bonds (distance) C4'-P energy: -15.618 bonds (distance) P-C4' energy: -17.753 flat angles C4'-P-C4' energy: -20.207 flat angles P-C4'-P energy: -10.333 tors. eta vs tors. theta energy: -23.460 Dist. restrs. and SS energy: 2.723 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 806 Temperature: 0.987750 Total energy: -286.109170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.109170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.900333 (E_RNA) where: Base-Base interactions energy: -193.400 where: short stacking energy: -84.132 Base-Backbone interact. energy: -0.076 local terms energy: -95.424169 where: bonds (distance) C4'-P energy: -16.939 bonds (distance) P-C4' energy: -16.721 flat angles C4'-P-C4' energy: -20.506 flat angles P-C4'-P energy: -16.087 tors. eta vs tors. theta energy: -25.172 Dist. restrs. and SS energy: 2.791 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 807 Temperature: 0.987300 Total energy: -291.710063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.710063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.860200 (E_RNA) where: Base-Base interactions energy: -199.779 where: short stacking energy: -85.259 Base-Backbone interact. energy: -0.025 local terms energy: -94.056938 where: bonds (distance) C4'-P energy: -13.706 bonds (distance) P-C4' energy: -19.365 flat angles C4'-P-C4' energy: -20.113 flat angles P-C4'-P energy: -14.244 tors. eta vs tors. theta energy: -26.629 Dist. restrs. and SS energy: 2.150 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 808 Temperature: 0.986850 Total energy: -288.762642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.762642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.103254 (E_RNA) where: Base-Base interactions energy: -198.405 where: short stacking energy: -94.518 Base-Backbone interact. energy: 1.457 local terms energy: -94.155417 where: bonds (distance) C4'-P energy: -18.077 bonds (distance) P-C4' energy: -16.052 flat angles C4'-P-C4' energy: -19.290 flat angles P-C4'-P energy: -16.726 tors. eta vs tors. theta energy: -24.010 Dist. restrs. and SS energy: 2.341 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 809 Temperature: 0.986400 Total energy: -293.356791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.356791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.460056 (E_RNA) where: Base-Base interactions energy: -207.324 where: short stacking energy: -97.221 Base-Backbone interact. energy: -0.007 local terms energy: -88.129296 where: bonds (distance) C4'-P energy: -11.033 bonds (distance) P-C4' energy: -18.178 flat angles C4'-P-C4' energy: -18.053 flat angles P-C4'-P energy: -13.666 tors. eta vs tors. theta energy: -27.199 Dist. restrs. and SS energy: 2.103 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 810 Temperature: 0.985950 Total energy: -288.430902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.430902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.946960 (E_RNA) where: Base-Base interactions energy: -201.583 where: short stacking energy: -96.948 Base-Backbone interact. energy: 1.184 local terms energy: -90.548424 where: bonds (distance) C4'-P energy: -10.041 bonds (distance) P-C4' energy: -19.063 flat angles C4'-P-C4' energy: -21.132 flat angles P-C4'-P energy: -13.483 tors. eta vs tors. theta energy: -26.829 Dist. restrs. and SS energy: 2.516 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 811 Temperature: 0.985500 Total energy: -287.706373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.706373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.595655 (E_RNA) where: Base-Base interactions energy: -194.451 where: short stacking energy: -88.751 Base-Backbone interact. energy: -2.977 local terms energy: -92.167320 where: bonds (distance) C4'-P energy: -17.845 bonds (distance) P-C4' energy: -18.818 flat angles C4'-P-C4' energy: -15.676 flat angles P-C4'-P energy: -16.042 tors. eta vs tors. theta energy: -23.786 Dist. restrs. and SS energy: 1.889 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 812 Temperature: 0.985050 Total energy: -283.254640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.254640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.925292 (E_RNA) where: Base-Base interactions energy: -197.228 where: short stacking energy: -90.752 Base-Backbone interact. energy: -0.610 local terms energy: -87.088065 where: bonds (distance) C4'-P energy: -18.500 bonds (distance) P-C4' energy: -12.310 flat angles C4'-P-C4' energy: -19.990 flat angles P-C4'-P energy: -10.475 tors. eta vs tors. theta energy: -25.814 Dist. restrs. and SS energy: 1.671 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 813 Temperature: 0.984600 Total energy: -293.874649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.874649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.939411 (E_RNA) where: Base-Base interactions energy: -206.935 where: short stacking energy: -94.454 Base-Backbone interact. energy: -0.080 local terms energy: -88.924100 where: bonds (distance) C4'-P energy: -9.832 bonds (distance) P-C4' energy: -18.399 flat angles C4'-P-C4' energy: -17.774 flat angles P-C4'-P energy: -14.120 tors. eta vs tors. theta energy: -28.799 Dist. restrs. and SS energy: 2.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 814 Temperature: 0.984150 Total energy: -292.233400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.233400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.927293 (E_RNA) where: Base-Base interactions energy: -198.173 where: short stacking energy: -96.746 Base-Backbone interact. energy: -0.040 local terms energy: -96.713964 where: bonds (distance) C4'-P energy: -17.608 bonds (distance) P-C4' energy: -17.675 flat angles C4'-P-C4' energy: -17.097 flat angles P-C4'-P energy: -15.418 tors. eta vs tors. theta energy: -28.915 Dist. restrs. and SS energy: 2.694 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 815 Temperature: 0.983700 Total energy: -280.879468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.879468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.987877 (E_RNA) where: Base-Base interactions energy: -190.848 where: short stacking energy: -90.452 Base-Backbone interact. energy: -0.019 local terms energy: -92.120595 where: bonds (distance) C4'-P energy: -15.573 bonds (distance) P-C4' energy: -19.703 flat angles C4'-P-C4' energy: -20.144 flat angles P-C4'-P energy: -11.607 tors. eta vs tors. theta energy: -25.094 Dist. restrs. and SS energy: 2.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 816 Temperature: 0.983250 Total energy: -284.372272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.372272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.354955 (E_RNA) where: Base-Base interactions energy: -190.166 where: short stacking energy: -86.902 Base-Backbone interact. energy: -0.267 local terms energy: -97.921990 where: bonds (distance) C4'-P energy: -23.120 bonds (distance) P-C4' energy: -16.386 flat angles C4'-P-C4' energy: -18.446 flat angles P-C4'-P energy: -16.120 tors. eta vs tors. theta energy: -23.850 Dist. restrs. and SS energy: 3.983 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 817 Temperature: 0.982800 Total energy: -281.241059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.241059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.526336 (E_RNA) where: Base-Base interactions energy: -191.604 where: short stacking energy: -84.223 Base-Backbone interact. energy: 0.378 local terms energy: -93.300617 where: bonds (distance) C4'-P energy: -18.462 bonds (distance) P-C4' energy: -16.437 flat angles C4'-P-C4' energy: -18.003 flat angles P-C4'-P energy: -15.011 tors. eta vs tors. theta energy: -25.387 Dist. restrs. and SS energy: 3.285 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 818 Temperature: 0.982350 Total energy: -284.216043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.216043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.948865 (E_RNA) where: Base-Base interactions energy: -192.763 where: short stacking energy: -97.332 Base-Backbone interact. energy: -0.008 local terms energy: -94.177426 where: bonds (distance) C4'-P energy: -16.769 bonds (distance) P-C4' energy: -20.055 flat angles C4'-P-C4' energy: -19.245 flat angles P-C4'-P energy: -8.341 tors. eta vs tors. theta energy: -29.768 Dist. restrs. and SS energy: 2.733 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 819 Temperature: 0.981900 Total energy: -292.968042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.968042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.750731 (E_RNA) where: Base-Base interactions energy: -189.436 where: short stacking energy: -95.338 Base-Backbone interact. energy: -0.434 local terms energy: -105.880429 where: bonds (distance) C4'-P energy: -20.382 bonds (distance) P-C4' energy: -17.426 flat angles C4'-P-C4' energy: -20.521 flat angles P-C4'-P energy: -18.113 tors. eta vs tors. theta energy: -29.438 Dist. restrs. and SS energy: 2.783 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 820 Temperature: 0.981450 Total energy: -286.328779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.328779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.025051 (E_RNA) where: Base-Base interactions energy: -193.529 where: short stacking energy: -92.353 Base-Backbone interact. energy: -0.255 local terms energy: -95.240372 where: bonds (distance) C4'-P energy: -11.689 bonds (distance) P-C4' energy: -21.312 flat angles C4'-P-C4' energy: -17.649 flat angles P-C4'-P energy: -14.149 tors. eta vs tors. theta energy: -30.441 Dist. restrs. and SS energy: 2.696 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 821 Temperature: 0.981000 Total energy: -277.449285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.449285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.684177 (E_RNA) where: Base-Base interactions energy: -193.363 where: short stacking energy: -92.921 Base-Backbone interact. energy: -0.005 local terms energy: -86.316201 where: bonds (distance) C4'-P energy: -19.206 bonds (distance) P-C4' energy: -13.138 flat angles C4'-P-C4' energy: -14.899 flat angles P-C4'-P energy: -11.191 tors. eta vs tors. theta energy: -27.882 Dist. restrs. and SS energy: 2.235 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 822 Temperature: 0.980550 Total energy: -293.132982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.132982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.232489 (E_RNA) where: Base-Base interactions energy: -191.249 where: short stacking energy: -92.669 Base-Backbone interact. energy: -0.031 local terms energy: -103.952203 where: bonds (distance) C4'-P energy: -18.205 bonds (distance) P-C4' energy: -19.031 flat angles C4'-P-C4' energy: -21.723 flat angles P-C4'-P energy: -16.123 tors. eta vs tors. theta energy: -28.870 Dist. restrs. and SS energy: 2.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 823 Temperature: 0.980100 Total energy: -293.025651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.025651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.118158 (E_RNA) where: Base-Base interactions energy: -198.109 where: short stacking energy: -96.737 Base-Backbone interact. energy: -0.008 local terms energy: -97.001703 where: bonds (distance) C4'-P energy: -15.879 bonds (distance) P-C4' energy: -13.067 flat angles C4'-P-C4' energy: -21.148 flat angles P-C4'-P energy: -15.513 tors. eta vs tors. theta energy: -31.395 Dist. restrs. and SS energy: 2.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 824 Temperature: 0.979650 Total energy: -285.891828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.891828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.789886 (E_RNA) where: Base-Base interactions energy: -195.644 where: short stacking energy: -102.908 Base-Backbone interact. energy: -0.008 local terms energy: -93.138069 where: bonds (distance) C4'-P energy: -17.958 bonds (distance) P-C4' energy: -16.741 flat angles C4'-P-C4' energy: -13.329 flat angles P-C4'-P energy: -16.235 tors. eta vs tors. theta energy: -28.875 Dist. restrs. and SS energy: 2.898 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 825 Temperature: 0.979200 Total energy: -292.442718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.442718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.478363 (E_RNA) where: Base-Base interactions energy: -196.392 where: short stacking energy: -92.246 Base-Backbone interact. energy: -0.650 local terms energy: -97.435669 where: bonds (distance) C4'-P energy: -16.348 bonds (distance) P-C4' energy: -17.523 flat angles C4'-P-C4' energy: -19.896 flat angles P-C4'-P energy: -14.305 tors. eta vs tors. theta energy: -29.364 Dist. restrs. and SS energy: 2.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 826 Temperature: 0.978750 Total energy: -293.444163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.444163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.598063 (E_RNA) where: Base-Base interactions energy: -186.995 where: short stacking energy: -91.431 Base-Backbone interact. energy: -0.292 local terms energy: -108.310773 where: bonds (distance) C4'-P energy: -20.469 bonds (distance) P-C4' energy: -20.855 flat angles C4'-P-C4' energy: -22.920 flat angles P-C4'-P energy: -15.774 tors. eta vs tors. theta energy: -28.293 Dist. restrs. and SS energy: 2.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 827 Temperature: 0.978300 Total energy: -274.898925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.898925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.929303 (E_RNA) where: Base-Base interactions energy: -184.990 where: short stacking energy: -84.722 Base-Backbone interact. energy: -0.612 local terms energy: -91.326776 where: bonds (distance) C4'-P energy: -13.560 bonds (distance) P-C4' energy: -18.713 flat angles C4'-P-C4' energy: -17.102 flat angles P-C4'-P energy: -15.947 tors. eta vs tors. theta energy: -26.005 Dist. restrs. and SS energy: 2.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 828 Temperature: 0.977850 Total energy: -287.065676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.065676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.637885 (E_RNA) where: Base-Base interactions energy: -190.187 where: short stacking energy: -91.454 Base-Backbone interact. energy: 0.569 local terms energy: -100.019479 where: bonds (distance) C4'-P energy: -17.313 bonds (distance) P-C4' energy: -21.991 flat angles C4'-P-C4' energy: -19.079 flat angles P-C4'-P energy: -14.729 tors. eta vs tors. theta energy: -26.908 Dist. restrs. and SS energy: 2.572 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 829 Temperature: 0.977400 Total energy: -281.817488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.817488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.780967 (E_RNA) where: Base-Base interactions energy: -189.701 where: short stacking energy: -89.729 Base-Backbone interact. energy: -0.126 local terms energy: -93.953938 where: bonds (distance) C4'-P energy: -13.496 bonds (distance) P-C4' energy: -20.511 flat angles C4'-P-C4' energy: -17.553 flat angles P-C4'-P energy: -14.601 tors. eta vs tors. theta energy: -27.792 Dist. restrs. and SS energy: 1.963 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 830 Temperature: 0.976950 Total energy: -297.972422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.972422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.554161 (E_RNA) where: Base-Base interactions energy: -195.860 where: short stacking energy: -97.797 Base-Backbone interact. energy: -0.026 local terms energy: -104.667902 where: bonds (distance) C4'-P energy: -19.784 bonds (distance) P-C4' energy: -16.816 flat angles C4'-P-C4' energy: -23.252 flat angles P-C4'-P energy: -15.515 tors. eta vs tors. theta energy: -29.302 Dist. restrs. and SS energy: 2.582 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 831 Temperature: 0.976500 Total energy: -290.052769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.052769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.520239 (E_RNA) where: Base-Base interactions energy: -194.181 where: short stacking energy: -96.863 Base-Backbone interact. energy: -0.428 local terms energy: -97.911315 where: bonds (distance) C4'-P energy: -13.587 bonds (distance) P-C4' energy: -20.244 flat angles C4'-P-C4' energy: -20.102 flat angles P-C4'-P energy: -16.601 tors. eta vs tors. theta energy: -27.377 Dist. restrs. and SS energy: 2.467 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 832 Temperature: 0.976050 Total energy: -270.987449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.987449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.765420 (E_RNA) where: Base-Base interactions energy: -179.963 where: short stacking energy: -77.811 Base-Backbone interact. energy: -0.490 local terms energy: -92.312114 where: bonds (distance) C4'-P energy: -16.487 bonds (distance) P-C4' energy: -17.294 flat angles C4'-P-C4' energy: -20.856 flat angles P-C4'-P energy: -12.201 tors. eta vs tors. theta energy: -25.474 Dist. restrs. and SS energy: 1.778 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 833 Temperature: 0.975600 Total energy: -274.645791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.645791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.668222 (E_RNA) where: Base-Base interactions energy: -188.733 where: short stacking energy: -86.928 Base-Backbone interact. energy: -0.007 local terms energy: -87.928234 where: bonds (distance) C4'-P energy: -15.693 bonds (distance) P-C4' energy: -11.574 flat angles C4'-P-C4' energy: -20.698 flat angles P-C4'-P energy: -15.019 tors. eta vs tors. theta energy: -24.944 Dist. restrs. and SS energy: 2.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 834 Temperature: 0.975150 Total energy: -286.165574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.165574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.047118 (E_RNA) where: Base-Base interactions energy: -186.304 where: short stacking energy: -97.722 Base-Backbone interact. energy: -0.083 local terms energy: -101.659586 where: bonds (distance) C4'-P energy: -20.346 bonds (distance) P-C4' energy: -12.576 flat angles C4'-P-C4' energy: -21.311 flat angles P-C4'-P energy: -16.774 tors. eta vs tors. theta energy: -30.652 Dist. restrs. and SS energy: 1.882 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 835 Temperature: 0.974700 Total energy: -281.841959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.841959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.537554 (E_RNA) where: Base-Base interactions energy: -183.201 where: short stacking energy: -88.228 Base-Backbone interact. energy: -0.533 local terms energy: -100.804002 where: bonds (distance) C4'-P energy: -18.884 bonds (distance) P-C4' energy: -19.082 flat angles C4'-P-C4' energy: -21.477 flat angles P-C4'-P energy: -14.524 tors. eta vs tors. theta energy: -26.837 Dist. restrs. and SS energy: 2.696 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 836 Temperature: 0.974250 Total energy: -282.327530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.327530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.872928 (E_RNA) where: Base-Base interactions energy: -189.989 where: short stacking energy: -93.066 Base-Backbone interact. energy: -0.051 local terms energy: -94.833504 where: bonds (distance) C4'-P energy: -17.698 bonds (distance) P-C4' energy: -13.390 flat angles C4'-P-C4' energy: -20.914 flat angles P-C4'-P energy: -16.054 tors. eta vs tors. theta energy: -26.777 Dist. restrs. and SS energy: 2.545 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 837 Temperature: 0.973800 Total energy: -281.805031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.805031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.832845 (E_RNA) where: Base-Base interactions energy: -188.881 where: short stacking energy: -97.560 Base-Backbone interact. energy: -0.001 local terms energy: -95.951417 where: bonds (distance) C4'-P energy: -15.830 bonds (distance) P-C4' energy: -20.417 flat angles C4'-P-C4' energy: -21.205 flat angles P-C4'-P energy: -8.740 tors. eta vs tors. theta energy: -29.759 Dist. restrs. and SS energy: 3.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 838 Temperature: 0.973350 Total energy: -273.841623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.841623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.679198 (E_RNA) where: Base-Base interactions energy: -185.306 where: short stacking energy: -81.444 Base-Backbone interact. energy: -0.002 local terms energy: -93.370611 where: bonds (distance) C4'-P energy: -17.709 bonds (distance) P-C4' energy: -17.807 flat angles C4'-P-C4' energy: -17.642 flat angles P-C4'-P energy: -13.715 tors. eta vs tors. theta energy: -26.497 Dist. restrs. and SS energy: 4.838 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 839 Temperature: 0.972900 Total energy: -287.126593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.126593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.828423 (E_RNA) where: Base-Base interactions energy: -199.928 where: short stacking energy: -90.573 Base-Backbone interact. energy: -0.479 local terms energy: -88.421647 where: bonds (distance) C4'-P energy: -15.386 bonds (distance) P-C4' energy: -18.994 flat angles C4'-P-C4' energy: -14.294 flat angles P-C4'-P energy: -12.592 tors. eta vs tors. theta energy: -27.156 Dist. restrs. and SS energy: 1.702 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 840 Temperature: 0.972450 Total energy: -289.264442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.264442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.103316 (E_RNA) where: Base-Base interactions energy: -201.243 where: short stacking energy: -90.269 Base-Backbone interact. energy: -0.003 local terms energy: -89.856842 where: bonds (distance) C4'-P energy: -16.074 bonds (distance) P-C4' energy: -15.595 flat angles C4'-P-C4' energy: -18.260 flat angles P-C4'-P energy: -12.656 tors. eta vs tors. theta energy: -27.273 Dist. restrs. and SS energy: 1.839 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 841 Temperature: 0.972000 Total energy: -292.491138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.491138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.113108 (E_RNA) where: Base-Base interactions energy: -203.291 where: short stacking energy: -82.582 Base-Backbone interact. energy: -0.025 local terms energy: -90.797084 where: bonds (distance) C4'-P energy: -15.924 bonds (distance) P-C4' energy: -15.004 flat angles C4'-P-C4' energy: -19.845 flat angles P-C4'-P energy: -17.307 tors. eta vs tors. theta energy: -22.717 Dist. restrs. and SS energy: 1.622 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 842 Temperature: 0.971550 Total energy: -292.384763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.384763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.216767 (E_RNA) where: Base-Base interactions energy: -201.762 where: short stacking energy: -87.115 Base-Backbone interact. energy: -0.017 local terms energy: -92.438309 where: bonds (distance) C4'-P energy: -19.231 bonds (distance) P-C4' energy: -17.215 flat angles C4'-P-C4' energy: -20.617 flat angles P-C4'-P energy: -11.381 tors. eta vs tors. theta energy: -23.993 Dist. restrs. and SS energy: 1.832 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 843 Temperature: 0.971100 Total energy: -290.628963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.628963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.548096 (E_RNA) where: Base-Base interactions energy: -202.119 where: short stacking energy: -90.315 Base-Backbone interact. energy: -0.957 local terms energy: -89.472262 where: bonds (distance) C4'-P energy: -17.432 bonds (distance) P-C4' energy: -18.227 flat angles C4'-P-C4' energy: -20.298 flat angles P-C4'-P energy: -11.998 tors. eta vs tors. theta energy: -21.517 Dist. restrs. and SS energy: 1.919 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 844 Temperature: 0.970650 Total energy: -292.492336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.492336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.112018 (E_RNA) where: Base-Base interactions energy: -205.994 where: short stacking energy: -88.786 Base-Backbone interact. energy: -0.011 local terms energy: -88.106460 where: bonds (distance) C4'-P energy: -10.439 bonds (distance) P-C4' energy: -18.314 flat angles C4'-P-C4' energy: -20.274 flat angles P-C4'-P energy: -15.175 tors. eta vs tors. theta energy: -23.904 Dist. restrs. and SS energy: 1.620 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 845 Temperature: 0.970200 Total energy: -300.499338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.499338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.350049 (E_RNA) where: Base-Base interactions energy: -196.243 where: short stacking energy: -89.786 Base-Backbone interact. energy: -1.889 local terms energy: -104.218065 where: bonds (distance) C4'-P energy: -19.577 bonds (distance) P-C4' energy: -20.789 flat angles C4'-P-C4' energy: -20.908 flat angles P-C4'-P energy: -15.319 tors. eta vs tors. theta energy: -27.626 Dist. restrs. and SS energy: 1.851 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 846 Temperature: 0.969750 Total energy: -286.400655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.400655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.941406 (E_RNA) where: Base-Base interactions energy: -192.725 where: short stacking energy: -87.403 Base-Backbone interact. energy: -3.080 local terms energy: -92.137243 where: bonds (distance) C4'-P energy: -12.104 bonds (distance) P-C4' energy: -19.774 flat angles C4'-P-C4' energy: -20.703 flat angles P-C4'-P energy: -12.498 tors. eta vs tors. theta energy: -27.057 Dist. restrs. and SS energy: 1.541 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 847 Temperature: 0.969300 Total energy: -285.698873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.698873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.790315 (E_RNA) where: Base-Base interactions energy: -192.229 where: short stacking energy: -87.469 Base-Backbone interact. energy: -0.094 local terms energy: -95.466866 where: bonds (distance) C4'-P energy: -16.298 bonds (distance) P-C4' energy: -20.914 flat angles C4'-P-C4' energy: -19.840 flat angles P-C4'-P energy: -12.134 tors. eta vs tors. theta energy: -26.280 Dist. restrs. and SS energy: 2.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 848 Temperature: 0.968850 Total energy: -274.149442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.149442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.748793 (E_RNA) where: Base-Base interactions energy: -186.851 where: short stacking energy: -81.661 Base-Backbone interact. energy: -0.040 local terms energy: -88.857637 where: bonds (distance) C4'-P energy: -17.913 bonds (distance) P-C4' energy: -14.650 flat angles C4'-P-C4' energy: -20.344 flat angles P-C4'-P energy: -11.418 tors. eta vs tors. theta energy: -24.532 Dist. restrs. and SS energy: 1.599 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 849 Temperature: 0.968400 Total energy: -282.873585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.873585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.365924 (E_RNA) where: Base-Base interactions energy: -195.357 where: short stacking energy: -86.455 Base-Backbone interact. energy: -0.316 local terms energy: -88.692866 where: bonds (distance) C4'-P energy: -15.023 bonds (distance) P-C4' energy: -18.328 flat angles C4'-P-C4' energy: -19.417 flat angles P-C4'-P energy: -14.076 tors. eta vs tors. theta energy: -21.850 Dist. restrs. and SS energy: 1.492 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 850 Temperature: 0.967950 Total energy: -280.271658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.271658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.214505 (E_RNA) where: Base-Base interactions energy: -193.303 where: short stacking energy: -85.831 Base-Backbone interact. energy: -0.103 local terms energy: -88.808319 where: bonds (distance) C4'-P energy: -17.951 bonds (distance) P-C4' energy: -18.052 flat angles C4'-P-C4' energy: -16.728 flat angles P-C4'-P energy: -13.667 tors. eta vs tors. theta energy: -22.411 Dist. restrs. and SS energy: 1.943 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 851 Temperature: 0.967500 Total energy: -280.072328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.072328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.957222 (E_RNA) where: Base-Base interactions energy: -192.034 where: short stacking energy: -92.994 Base-Backbone interact. energy: -0.305 local terms energy: -89.618650 where: bonds (distance) C4'-P energy: -17.398 bonds (distance) P-C4' energy: -13.746 flat angles C4'-P-C4' energy: -18.436 flat angles P-C4'-P energy: -13.343 tors. eta vs tors. theta energy: -26.696 Dist. restrs. and SS energy: 1.885 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 852 Temperature: 0.967050 Total energy: -295.886023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.886023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.989039 (E_RNA) where: Base-Base interactions energy: -194.898 where: short stacking energy: -97.941 Base-Backbone interact. energy: -0.004 local terms energy: -103.086146 where: bonds (distance) C4'-P energy: -21.014 bonds (distance) P-C4' energy: -17.854 flat angles C4'-P-C4' energy: -21.329 flat angles P-C4'-P energy: -15.184 tors. eta vs tors. theta energy: -27.706 Dist. restrs. and SS energy: 2.103 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 853 Temperature: 0.966600 Total energy: -298.149982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.149982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.640321 (E_RNA) where: Base-Base interactions energy: -201.563 where: short stacking energy: -95.742 Base-Backbone interact. energy: -0.002 local terms energy: -99.074694 where: bonds (distance) C4'-P energy: -18.124 bonds (distance) P-C4' energy: -20.672 flat angles C4'-P-C4' energy: -15.469 flat angles P-C4'-P energy: -15.907 tors. eta vs tors. theta energy: -28.903 Dist. restrs. and SS energy: 2.490 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 854 Temperature: 0.966150 Total energy: -287.934212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.934212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.971302 (E_RNA) where: Base-Base interactions energy: -199.777 where: short stacking energy: -96.114 Base-Backbone interact. energy: -0.602 local terms energy: -89.592926 where: bonds (distance) C4'-P energy: -17.664 bonds (distance) P-C4' energy: -16.737 flat angles C4'-P-C4' energy: -15.161 flat angles P-C4'-P energy: -14.909 tors. eta vs tors. theta energy: -25.122 Dist. restrs. and SS energy: 2.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 855 Temperature: 0.965700 Total energy: -288.919947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.919947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.507425 (E_RNA) where: Base-Base interactions energy: -197.768 where: short stacking energy: -92.207 Base-Backbone interact. energy: 0.200 local terms energy: -93.939025 where: bonds (distance) C4'-P energy: -18.521 bonds (distance) P-C4' energy: -16.297 flat angles C4'-P-C4' energy: -19.666 flat angles P-C4'-P energy: -12.374 tors. eta vs tors. theta energy: -27.081 Dist. restrs. and SS energy: 2.587 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 856 Temperature: 0.965250 Total energy: -284.520128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.520128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.109699 (E_RNA) where: Base-Base interactions energy: -194.132 where: short stacking energy: -94.131 Base-Backbone interact. energy: -0.582 local terms energy: -92.396268 where: bonds (distance) C4'-P energy: -19.468 bonds (distance) P-C4' energy: -20.531 flat angles C4'-P-C4' energy: -18.379 flat angles P-C4'-P energy: -11.570 tors. eta vs tors. theta energy: -22.449 Dist. restrs. and SS energy: 2.590 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 857 Temperature: 0.964800 Total energy: -277.492173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.492173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.361473 (E_RNA) where: Base-Base interactions energy: -184.480 where: short stacking energy: -93.209 Base-Backbone interact. energy: -0.891 local terms energy: -94.990726 where: bonds (distance) C4'-P energy: -18.947 bonds (distance) P-C4' energy: -14.325 flat angles C4'-P-C4' energy: -21.595 flat angles P-C4'-P energy: -17.144 tors. eta vs tors. theta energy: -22.980 Dist. restrs. and SS energy: 2.869 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 858 Temperature: 0.964350 Total energy: -293.140375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.140375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.751486 (E_RNA) where: Base-Base interactions energy: -203.120 where: short stacking energy: -96.275 Base-Backbone interact. energy: -0.008 local terms energy: -92.623393 where: bonds (distance) C4'-P energy: -13.694 bonds (distance) P-C4' energy: -19.745 flat angles C4'-P-C4' energy: -22.080 flat angles P-C4'-P energy: -12.540 tors. eta vs tors. theta energy: -24.565 Dist. restrs. and SS energy: 2.611 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 859 Temperature: 0.963900 Total energy: -288.693819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.693819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.006988 (E_RNA) where: Base-Base interactions energy: -193.351 where: short stacking energy: -94.516 Base-Backbone interact. energy: -0.001 local terms energy: -97.654890 where: bonds (distance) C4'-P energy: -13.843 bonds (distance) P-C4' energy: -21.177 flat angles C4'-P-C4' energy: -20.222 flat angles P-C4'-P energy: -16.599 tors. eta vs tors. theta energy: -25.814 Dist. restrs. and SS energy: 2.313 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 860 Temperature: 0.963450 Total energy: -292.245005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.245005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.614289 (E_RNA) where: Base-Base interactions energy: -194.558 where: short stacking energy: -96.585 Base-Backbone interact. energy: -0.001 local terms energy: -100.055287 where: bonds (distance) C4'-P energy: -15.816 bonds (distance) P-C4' energy: -20.404 flat angles C4'-P-C4' energy: -20.565 flat angles P-C4'-P energy: -17.582 tors. eta vs tors. theta energy: -25.688 Dist. restrs. and SS energy: 2.369 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 861 Temperature: 0.963000 Total energy: -293.748318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.748318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.053694 (E_RNA) where: Base-Base interactions energy: -196.453 where: short stacking energy: -96.594 Base-Backbone interact. energy: -0.005 local terms energy: -99.595934 where: bonds (distance) C4'-P energy: -14.864 bonds (distance) P-C4' energy: -20.721 flat angles C4'-P-C4' energy: -22.689 flat angles P-C4'-P energy: -15.350 tors. eta vs tors. theta energy: -25.972 Dist. restrs. and SS energy: 2.305 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 862 Temperature: 0.962550 Total energy: -285.175561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.175561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.869477 (E_RNA) where: Base-Base interactions energy: -195.031 where: short stacking energy: -95.623 Base-Backbone interact. energy: -0.396 local terms energy: -91.441861 where: bonds (distance) C4'-P energy: -15.792 bonds (distance) P-C4' energy: -21.682 flat angles C4'-P-C4' energy: -20.512 flat angles P-C4'-P energy: -8.458 tors. eta vs tors. theta energy: -24.999 Dist. restrs. and SS energy: 1.694 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 863 Temperature: 0.962100 Total energy: -289.332142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.332142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.693338 (E_RNA) where: Base-Base interactions energy: -193.336 where: short stacking energy: -90.419 Base-Backbone interact. energy: -0.003 local terms energy: -98.354756 where: bonds (distance) C4'-P energy: -18.657 bonds (distance) P-C4' energy: -20.929 flat angles C4'-P-C4' energy: -18.898 flat angles P-C4'-P energy: -14.655 tors. eta vs tors. theta energy: -25.217 Dist. restrs. and SS energy: 2.361 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 864 Temperature: 0.961650 Total energy: -286.743893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.743893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.656537 (E_RNA) where: Base-Base interactions energy: -201.628 where: short stacking energy: -97.546 Base-Backbone interact. energy: -0.007 local terms energy: -87.020907 where: bonds (distance) C4'-P energy: -11.018 bonds (distance) P-C4' energy: -20.873 flat angles C4'-P-C4' energy: -17.995 flat angles P-C4'-P energy: -12.723 tors. eta vs tors. theta energy: -24.411 Dist. restrs. and SS energy: 1.913 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 865 Temperature: 0.961200 Total energy: -283.642544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.642544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.058246 (E_RNA) where: Base-Base interactions energy: -186.290 where: short stacking energy: -88.954 Base-Backbone interact. energy: -0.241 local terms energy: -99.526991 where: bonds (distance) C4'-P energy: -21.925 bonds (distance) P-C4' energy: -19.037 flat angles C4'-P-C4' energy: -18.431 flat angles P-C4'-P energy: -15.395 tors. eta vs tors. theta energy: -24.739 Dist. restrs. and SS energy: 2.416 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 866 Temperature: 0.960750 Total energy: -287.332058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.332058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.674470 (E_RNA) where: Base-Base interactions energy: -195.900 where: short stacking energy: -88.390 Base-Backbone interact. energy: -0.926 local terms energy: -92.849059 where: bonds (distance) C4'-P energy: -14.664 bonds (distance) P-C4' energy: -17.457 flat angles C4'-P-C4' energy: -19.552 flat angles P-C4'-P energy: -14.183 tors. eta vs tors. theta energy: -26.992 Dist. restrs. and SS energy: 2.342 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 867 Temperature: 0.960300 Total energy: -295.827073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.827073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.750379 (E_RNA) where: Base-Base interactions energy: -199.866 where: short stacking energy: -94.621 Base-Backbone interact. energy: 0.437 local terms energy: -98.321644 where: bonds (distance) C4'-P energy: -16.183 bonds (distance) P-C4' energy: -18.132 flat angles C4'-P-C4' energy: -20.751 flat angles P-C4'-P energy: -14.925 tors. eta vs tors. theta energy: -28.331 Dist. restrs. and SS energy: 1.923 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 868 Temperature: 0.959850 Total energy: -293.370416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.370416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.469269 (E_RNA) where: Base-Base interactions energy: -193.453 where: short stacking energy: -89.584 Base-Backbone interact. energy: -0.697 local terms energy: -101.319566 where: bonds (distance) C4'-P energy: -21.679 bonds (distance) P-C4' energy: -21.916 flat angles C4'-P-C4' energy: -18.147 flat angles P-C4'-P energy: -10.478 tors. eta vs tors. theta energy: -29.099 Dist. restrs. and SS energy: 2.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 869 Temperature: 0.959400 Total energy: -284.294817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.294817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.751280 (E_RNA) where: Base-Base interactions energy: -188.060 where: short stacking energy: -82.346 Base-Backbone interact. energy: -1.275 local terms energy: -97.416475 where: bonds (distance) C4'-P energy: -19.565 bonds (distance) P-C4' energy: -21.991 flat angles C4'-P-C4' energy: -15.830 flat angles P-C4'-P energy: -12.128 tors. eta vs tors. theta energy: -27.903 Dist. restrs. and SS energy: 2.456 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 870 Temperature: 0.958950 Total energy: -284.853153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.853153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.971790 (E_RNA) where: Base-Base interactions energy: -194.041 where: short stacking energy: -87.909 Base-Backbone interact. energy: -0.001 local terms energy: -92.930333 where: bonds (distance) C4'-P energy: -17.548 bonds (distance) P-C4' energy: -18.426 flat angles C4'-P-C4' energy: -21.039 flat angles P-C4'-P energy: -10.889 tors. eta vs tors. theta energy: -25.028 Dist. restrs. and SS energy: 2.119 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 871 Temperature: 0.958500 Total energy: -293.007423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.007423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.445658 (E_RNA) where: Base-Base interactions energy: -202.451 where: short stacking energy: -91.966 Base-Backbone interact. energy: -0.136 local terms energy: -92.858141 where: bonds (distance) C4'-P energy: -19.187 bonds (distance) P-C4' energy: -17.206 flat angles C4'-P-C4' energy: -19.910 flat angles P-C4'-P energy: -10.445 tors. eta vs tors. theta energy: -26.110 Dist. restrs. and SS energy: 2.438 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 872 Temperature: 0.958050 Total energy: -287.788518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.788518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.423630 (E_RNA) where: Base-Base interactions energy: -194.509 where: short stacking energy: -96.561 Base-Backbone interact. energy: -0.091 local terms energy: -95.823578 where: bonds (distance) C4'-P energy: -18.024 bonds (distance) P-C4' energy: -20.021 flat angles C4'-P-C4' energy: -18.766 flat angles P-C4'-P energy: -13.234 tors. eta vs tors. theta energy: -25.779 Dist. restrs. and SS energy: 2.635 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 873 Temperature: 0.957600 Total energy: -293.300932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.300932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.784079 (E_RNA) where: Base-Base interactions energy: -197.885 where: short stacking energy: -90.221 Base-Backbone interact. energy: -0.081 local terms energy: -97.818269 where: bonds (distance) C4'-P energy: -16.459 bonds (distance) P-C4' energy: -22.067 flat angles C4'-P-C4' energy: -18.714 flat angles P-C4'-P energy: -14.706 tors. eta vs tors. theta energy: -25.872 Dist. restrs. and SS energy: 2.483 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 874 Temperature: 0.957150 Total energy: -293.767710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.767710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.972239 (E_RNA) where: Base-Base interactions energy: -200.721 where: short stacking energy: -92.297 Base-Backbone interact. energy: -0.002 local terms energy: -95.248870 where: bonds (distance) C4'-P energy: -19.133 bonds (distance) P-C4' energy: -16.442 flat angles C4'-P-C4' energy: -21.858 flat angles P-C4'-P energy: -14.323 tors. eta vs tors. theta energy: -23.493 Dist. restrs. and SS energy: 2.205 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 875 Temperature: 0.956700 Total energy: -291.586210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.586210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.715051 (E_RNA) where: Base-Base interactions energy: -197.705 where: short stacking energy: -90.773 Base-Backbone interact. energy: -0.002 local terms energy: -96.008008 where: bonds (distance) C4'-P energy: -19.058 bonds (distance) P-C4' energy: -19.703 flat angles C4'-P-C4' energy: -19.343 flat angles P-C4'-P energy: -14.441 tors. eta vs tors. theta energy: -23.462 Dist. restrs. and SS energy: 2.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 876 Temperature: 0.956250 Total energy: -297.292947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.292947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.727684 (E_RNA) where: Base-Base interactions energy: -194.827 where: short stacking energy: -99.208 Base-Backbone interact. energy: -0.048 local terms energy: -104.852862 where: bonds (distance) C4'-P energy: -19.994 bonds (distance) P-C4' energy: -15.745 flat angles C4'-P-C4' energy: -22.335 flat angles P-C4'-P energy: -16.260 tors. eta vs tors. theta energy: -30.519 Dist. restrs. and SS energy: 2.435 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 877 Temperature: 0.955800 Total energy: -292.421962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.421962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.067238 (E_RNA) where: Base-Base interactions energy: -199.468 where: short stacking energy: -96.082 Base-Backbone interact. energy: -0.002 local terms energy: -95.596664 where: bonds (distance) C4'-P energy: -17.485 bonds (distance) P-C4' energy: -14.992 flat angles C4'-P-C4' energy: -22.122 flat angles P-C4'-P energy: -12.117 tors. eta vs tors. theta energy: -28.882 Dist. restrs. and SS energy: 2.645 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 878 Temperature: 0.955350 Total energy: -287.724623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.724623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.732113 (E_RNA) where: Base-Base interactions energy: -190.406 where: short stacking energy: -94.664 Base-Backbone interact. energy: -0.076 local terms energy: -100.250254 where: bonds (distance) C4'-P energy: -19.545 bonds (distance) P-C4' energy: -19.747 flat angles C4'-P-C4' energy: -21.800 flat angles P-C4'-P energy: -11.122 tors. eta vs tors. theta energy: -28.036 Dist. restrs. and SS energy: 3.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 879 Temperature: 0.954900 Total energy: -297.588735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.588735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.479805 (E_RNA) where: Base-Base interactions energy: -200.247 where: short stacking energy: -99.035 Base-Backbone interact. energy: -0.035 local terms energy: -100.197610 where: bonds (distance) C4'-P energy: -14.705 bonds (distance) P-C4' energy: -20.467 flat angles C4'-P-C4' energy: -20.430 flat angles P-C4'-P energy: -15.460 tors. eta vs tors. theta energy: -29.136 Dist. restrs. and SS energy: 2.891 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 880 Temperature: 0.954450 Total energy: -291.530518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.530518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.495503 (E_RNA) where: Base-Base interactions energy: -200.671 where: short stacking energy: -87.782 Base-Backbone interact. energy: -0.030 local terms energy: -92.794112 where: bonds (distance) C4'-P energy: -17.855 bonds (distance) P-C4' energy: -19.337 flat angles C4'-P-C4' energy: -15.726 flat angles P-C4'-P energy: -12.931 tors. eta vs tors. theta energy: -26.946 Dist. restrs. and SS energy: 1.965 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 881 Temperature: 0.954000 Total energy: -292.301425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.301425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.272093 (E_RNA) where: Base-Base interactions energy: -195.455 where: short stacking energy: -97.132 Base-Backbone interact. energy: -0.434 local terms energy: -99.383337 where: bonds (distance) C4'-P energy: -16.541 bonds (distance) P-C4' energy: -16.863 flat angles C4'-P-C4' energy: -18.518 flat angles P-C4'-P energy: -16.607 tors. eta vs tors. theta energy: -30.854 Dist. restrs. and SS energy: 2.971 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 882 Temperature: 0.953550 Total energy: -273.671661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.671661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.121626 (E_RNA) where: Base-Base interactions energy: -177.129 where: short stacking energy: -80.754 Base-Backbone interact. energy: -0.052 local terms energy: -98.941221 where: bonds (distance) C4'-P energy: -19.005 bonds (distance) P-C4' energy: -17.170 flat angles C4'-P-C4' energy: -22.090 flat angles P-C4'-P energy: -13.865 tors. eta vs tors. theta energy: -26.812 Dist. restrs. and SS energy: 2.450 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 883 Temperature: 0.953100 Total energy: -276.246458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.246458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.550244 (E_RNA) where: Base-Base interactions energy: -185.818 where: short stacking energy: -89.093 Base-Backbone interact. energy: -1.051 local terms energy: -90.681274 where: bonds (distance) C4'-P energy: -19.954 bonds (distance) P-C4' energy: -20.662 flat angles C4'-P-C4' energy: -10.562 flat angles P-C4'-P energy: -14.263 tors. eta vs tors. theta energy: -25.239 Dist. restrs. and SS energy: 1.304 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 884 Temperature: 0.952650 Total energy: -283.989778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.989778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.596131 (E_RNA) where: Base-Base interactions energy: -191.430 where: short stacking energy: -88.153 Base-Backbone interact. energy: -2.768 local terms energy: -91.398375 where: bonds (distance) C4'-P energy: -11.905 bonds (distance) P-C4' energy: -18.738 flat angles C4'-P-C4' energy: -15.997 flat angles P-C4'-P energy: -17.298 tors. eta vs tors. theta energy: -27.461 Dist. restrs. and SS energy: 1.606 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 885 Temperature: 0.952200 Total energy: -282.068251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.068251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.933911 (E_RNA) where: Base-Base interactions energy: -192.863 where: short stacking energy: -89.204 Base-Backbone interact. energy: -2.958 local terms energy: -88.113250 where: bonds (distance) C4'-P energy: -18.367 bonds (distance) P-C4' energy: -18.652 flat angles C4'-P-C4' energy: -15.112 flat angles P-C4'-P energy: -10.493 tors. eta vs tors. theta energy: -25.488 Dist. restrs. and SS energy: 1.866 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 886 Temperature: 0.951750 Total energy: -290.173289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.173289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.508340 (E_RNA) where: Base-Base interactions energy: -196.293 where: short stacking energy: -89.711 Base-Backbone interact. energy: -2.361 local terms energy: -92.855052 where: bonds (distance) C4'-P energy: -17.540 bonds (distance) P-C4' energy: -20.880 flat angles C4'-P-C4' energy: -19.833 flat angles P-C4'-P energy: -8.357 tors. eta vs tors. theta energy: -26.244 Dist. restrs. and SS energy: 1.335 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 887 Temperature: 0.951300 Total energy: -290.105902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.105902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.402141 (E_RNA) where: Base-Base interactions energy: -190.269 where: short stacking energy: -81.804 Base-Backbone interact. energy: -2.108 local terms energy: -100.024868 where: bonds (distance) C4'-P energy: -18.322 bonds (distance) P-C4' energy: -17.869 flat angles C4'-P-C4' energy: -22.442 flat angles P-C4'-P energy: -15.959 tors. eta vs tors. theta energy: -25.433 Dist. restrs. and SS energy: 2.296 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 888 Temperature: 0.950850 Total energy: -280.698220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.698220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.173220 (E_RNA) where: Base-Base interactions energy: -190.278 where: short stacking energy: -92.017 Base-Backbone interact. energy: -1.688 local terms energy: -90.207065 where: bonds (distance) C4'-P energy: -17.883 bonds (distance) P-C4' energy: -16.084 flat angles C4'-P-C4' energy: -21.649 flat angles P-C4'-P energy: -11.776 tors. eta vs tors. theta energy: -22.815 Dist. restrs. and SS energy: 1.475 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 889 Temperature: 0.950400 Total energy: -280.808480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.808480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.239552 (E_RNA) where: Base-Base interactions energy: -189.854 where: short stacking energy: -86.058 Base-Backbone interact. energy: -2.464 local terms energy: -89.921667 where: bonds (distance) C4'-P energy: -18.508 bonds (distance) P-C4' energy: -15.945 flat angles C4'-P-C4' energy: -17.366 flat angles P-C4'-P energy: -12.905 tors. eta vs tors. theta energy: -25.197 Dist. restrs. and SS energy: 1.431 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 890 Temperature: 0.949950 Total energy: -287.939062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.939062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.317559 (E_RNA) where: Base-Base interactions energy: -196.317 where: short stacking energy: -95.305 Base-Backbone interact. energy: 0.706 local terms energy: -93.707159 where: bonds (distance) C4'-P energy: -20.028 bonds (distance) P-C4' energy: -18.002 flat angles C4'-P-C4' energy: -17.717 flat angles P-C4'-P energy: -13.434 tors. eta vs tors. theta energy: -24.526 Dist. restrs. and SS energy: 1.378 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 891 Temperature: 0.949500 Total energy: -280.468134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.468134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.371618 (E_RNA) where: Base-Base interactions energy: -192.304 where: short stacking energy: -84.778 Base-Backbone interact. energy: -1.295 local terms energy: -89.772897 where: bonds (distance) C4'-P energy: -16.965 bonds (distance) P-C4' energy: -19.084 flat angles C4'-P-C4' energy: -18.876 flat angles P-C4'-P energy: -12.421 tors. eta vs tors. theta energy: -22.428 Dist. restrs. and SS energy: 2.903 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 892 Temperature: 0.949050 Total energy: -280.995346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.995346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.307476 (E_RNA) where: Base-Base interactions energy: -187.044 where: short stacking energy: -82.186 Base-Backbone interact. energy: -2.221 local terms energy: -93.042804 where: bonds (distance) C4'-P energy: -15.238 bonds (distance) P-C4' energy: -20.313 flat angles C4'-P-C4' energy: -18.636 flat angles P-C4'-P energy: -11.514 tors. eta vs tors. theta energy: -27.342 Dist. restrs. and SS energy: 1.312 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 893 Temperature: 0.948600 Total energy: -276.701728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.701728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.130267 (E_RNA) where: Base-Base interactions energy: -190.120 where: short stacking energy: -81.518 Base-Backbone interact. energy: -2.459 local terms energy: -85.551565 where: bonds (distance) C4'-P energy: -13.122 bonds (distance) P-C4' energy: -18.055 flat angles C4'-P-C4' energy: -20.921 flat angles P-C4'-P energy: -10.797 tors. eta vs tors. theta energy: -22.656 Dist. restrs. and SS energy: 1.429 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 894 Temperature: 0.948150 Total energy: -285.529372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.529372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.086034 (E_RNA) where: Base-Base interactions energy: -196.128 where: short stacking energy: -94.014 Base-Backbone interact. energy: -1.576 local terms energy: -89.382572 where: bonds (distance) C4'-P energy: -14.936 bonds (distance) P-C4' energy: -20.949 flat angles C4'-P-C4' energy: -19.468 flat angles P-C4'-P energy: -8.085 tors. eta vs tors. theta energy: -25.945 Dist. restrs. and SS energy: 1.557 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 895 Temperature: 0.947700 Total energy: -289.469880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.469880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.099023 (E_RNA) where: Base-Base interactions energy: -200.253 where: short stacking energy: -99.236 Base-Backbone interact. energy: -3.535 local terms energy: -87.311579 where: bonds (distance) C4'-P energy: -9.147 bonds (distance) P-C4' energy: -18.967 flat angles C4'-P-C4' energy: -19.459 flat angles P-C4'-P energy: -12.388 tors. eta vs tors. theta energy: -27.350 Dist. restrs. and SS energy: 1.629 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 896 Temperature: 0.947250 Total energy: -304.334191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.334191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.975094 (E_RNA) where: Base-Base interactions energy: -202.690 where: short stacking energy: -94.838 Base-Backbone interact. energy: -0.698 local terms energy: -102.587343 where: bonds (distance) C4'-P energy: -18.895 bonds (distance) P-C4' energy: -19.327 flat angles C4'-P-C4' energy: -22.885 flat angles P-C4'-P energy: -15.463 tors. eta vs tors. theta energy: -26.017 Dist. restrs. and SS energy: 1.641 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 897 Temperature: 0.946800 Total energy: -290.618339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.618339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.954488 (E_RNA) where: Base-Base interactions energy: -193.019 where: short stacking energy: -91.919 Base-Backbone interact. energy: -1.109 local terms energy: -97.826876 where: bonds (distance) C4'-P energy: -19.427 bonds (distance) P-C4' energy: -19.999 flat angles C4'-P-C4' energy: -18.726 flat angles P-C4'-P energy: -12.710 tors. eta vs tors. theta energy: -26.964 Dist. restrs. and SS energy: 1.336 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 898 Temperature: 0.946350 Total energy: -285.918607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.918607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.389238 (E_RNA) where: Base-Base interactions energy: -194.057 where: short stacking energy: -92.811 Base-Backbone interact. energy: -0.011 local terms energy: -94.321309 where: bonds (distance) C4'-P energy: -20.260 bonds (distance) P-C4' energy: -17.114 flat angles C4'-P-C4' energy: -20.471 flat angles P-C4'-P energy: -10.556 tors. eta vs tors. theta energy: -25.920 Dist. restrs. and SS energy: 2.471 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 899 Temperature: 0.945900 Total energy: -278.112106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.112106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.929568 (E_RNA) where: Base-Base interactions energy: -185.943 where: short stacking energy: -92.254 Base-Backbone interact. energy: -1.772 local terms energy: -93.214336 where: bonds (distance) C4'-P energy: -16.583 bonds (distance) P-C4' energy: -18.128 flat angles C4'-P-C4' energy: -21.564 flat angles P-C4'-P energy: -9.872 tors. eta vs tors. theta energy: -27.068 Dist. restrs. and SS energy: 2.817 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 900 Temperature: 0.945450 Total energy: -297.249114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.249114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.279930 (E_RNA) where: Base-Base interactions energy: -202.033 where: short stacking energy: -99.605 Base-Backbone interact. energy: -0.639 local terms energy: -96.608110 where: bonds (distance) C4'-P energy: -11.726 bonds (distance) P-C4' energy: -20.492 flat angles C4'-P-C4' energy: -20.128 flat angles P-C4'-P energy: -15.384 tors. eta vs tors. theta energy: -28.878 Dist. restrs. and SS energy: 2.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 901 Temperature: 0.945000 Total energy: -299.623111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.623111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.648062 (E_RNA) where: Base-Base interactions energy: -206.436 where: short stacking energy: -102.572 Base-Backbone interact. energy: -0.001 local terms energy: -95.211287 where: bonds (distance) C4'-P energy: -14.836 bonds (distance) P-C4' energy: -17.486 flat angles C4'-P-C4' energy: -18.891 flat angles P-C4'-P energy: -14.043 tors. eta vs tors. theta energy: -29.955 Dist. restrs. and SS energy: 2.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 902 Temperature: 0.944550 Total energy: -296.383237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.383237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.535781 (E_RNA) where: Base-Base interactions energy: -202.322 where: short stacking energy: -99.757 Base-Backbone interact. energy: -0.136 local terms energy: -96.077705 where: bonds (distance) C4'-P energy: -16.223 bonds (distance) P-C4' energy: -17.499 flat angles C4'-P-C4' energy: -20.023 flat angles P-C4'-P energy: -14.564 tors. eta vs tors. theta energy: -27.769 Dist. restrs. and SS energy: 2.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 903 Temperature: 0.944100 Total energy: -302.228444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.228444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.918787 (E_RNA) where: Base-Base interactions energy: -204.664 where: short stacking energy: -98.219 Base-Backbone interact. energy: -0.006 local terms energy: -100.248564 where: bonds (distance) C4'-P energy: -16.671 bonds (distance) P-C4' energy: -20.147 flat angles C4'-P-C4' energy: -22.779 flat angles P-C4'-P energy: -15.098 tors. eta vs tors. theta energy: -25.554 Dist. restrs. and SS energy: 2.690 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 904 Temperature: 0.943650 Total energy: -294.370489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.370489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.037036 (E_RNA) where: Base-Base interactions energy: -198.835 where: short stacking energy: -98.446 Base-Backbone interact. energy: -0.073 local terms energy: -98.128557 where: bonds (distance) C4'-P energy: -16.492 bonds (distance) P-C4' energy: -21.296 flat angles C4'-P-C4' energy: -19.812 flat angles P-C4'-P energy: -13.552 tors. eta vs tors. theta energy: -26.976 Dist. restrs. and SS energy: 2.667 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 905 Temperature: 0.943200 Total energy: -291.012264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.012264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.534022 (E_RNA) where: Base-Base interactions energy: -198.078 where: short stacking energy: -94.819 Base-Backbone interact. energy: -0.226 local terms energy: -95.229720 where: bonds (distance) C4'-P energy: -19.726 bonds (distance) P-C4' energy: -17.220 flat angles C4'-P-C4' energy: -20.148 flat angles P-C4'-P energy: -14.281 tors. eta vs tors. theta energy: -23.854 Dist. restrs. and SS energy: 2.522 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 906 Temperature: 0.942750 Total energy: -288.677146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.677146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.630429 (E_RNA) where: Base-Base interactions energy: -198.777 where: short stacking energy: -96.385 Base-Backbone interact. energy: -0.237 local terms energy: -92.616788 where: bonds (distance) C4'-P energy: -16.749 bonds (distance) P-C4' energy: -19.086 flat angles C4'-P-C4' energy: -19.080 flat angles P-C4'-P energy: -12.845 tors. eta vs tors. theta energy: -24.857 Dist. restrs. and SS energy: 2.953 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 907 Temperature: 0.942300 Total energy: -284.773344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.773344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.585719 (E_RNA) where: Base-Base interactions energy: -191.194 where: short stacking energy: -93.779 Base-Backbone interact. energy: -0.024 local terms energy: -96.368046 where: bonds (distance) C4'-P energy: -16.802 bonds (distance) P-C4' energy: -21.035 flat angles C4'-P-C4' energy: -19.972 flat angles P-C4'-P energy: -13.791 tors. eta vs tors. theta energy: -24.767 Dist. restrs. and SS energy: 2.812 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 908 Temperature: 0.941850 Total energy: -292.586771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.586771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.260656 (E_RNA) where: Base-Base interactions energy: -197.817 where: short stacking energy: -93.713 Base-Backbone interact. energy: 0.346 local terms energy: -97.789896 where: bonds (distance) C4'-P energy: -21.845 bonds (distance) P-C4' energy: -18.923 flat angles C4'-P-C4' energy: -17.507 flat angles P-C4'-P energy: -12.833 tors. eta vs tors. theta energy: -26.682 Dist. restrs. and SS energy: 2.674 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 909 Temperature: 0.941400 Total energy: -281.047550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.047550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.695367 (E_RNA) where: Base-Base interactions energy: -187.265 where: short stacking energy: -94.993 Base-Backbone interact. energy: -0.048 local terms energy: -96.382353 where: bonds (distance) C4'-P energy: -20.392 bonds (distance) P-C4' energy: -21.790 flat angles C4'-P-C4' energy: -19.131 flat angles P-C4'-P energy: -11.228 tors. eta vs tors. theta energy: -23.841 Dist. restrs. and SS energy: 2.648 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 910 Temperature: 0.940950 Total energy: -285.205783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.205783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.585955 (E_RNA) where: Base-Base interactions energy: -200.035 where: short stacking energy: -100.154 Base-Backbone interact. energy: -0.042 local terms energy: -87.508527 where: bonds (distance) C4'-P energy: -11.387 bonds (distance) P-C4' energy: -18.868 flat angles C4'-P-C4' energy: -16.705 flat angles P-C4'-P energy: -12.488 tors. eta vs tors. theta energy: -28.060 Dist. restrs. and SS energy: 2.380 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 911 Temperature: 0.940500 Total energy: -289.378108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.378108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.640580 (E_RNA) where: Base-Base interactions energy: -192.635 where: short stacking energy: -91.418 Base-Backbone interact. energy: -0.021 local terms energy: -98.983928 where: bonds (distance) C4'-P energy: -21.878 bonds (distance) P-C4' energy: -15.197 flat angles C4'-P-C4' energy: -22.310 flat angles P-C4'-P energy: -12.043 tors. eta vs tors. theta energy: -27.557 Dist. restrs. and SS energy: 2.262 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 912 Temperature: 0.940050 Total energy: -297.264681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.264681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.558977 (E_RNA) where: Base-Base interactions energy: -202.709 where: short stacking energy: -92.584 Base-Backbone interact. energy: -1.377 local terms energy: -95.473372 where: bonds (distance) C4'-P energy: -12.418 bonds (distance) P-C4' energy: -18.741 flat angles C4'-P-C4' energy: -22.638 flat angles P-C4'-P energy: -14.624 tors. eta vs tors. theta energy: -27.053 Dist. restrs. and SS energy: 2.294 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 913 Temperature: 0.939600 Total energy: -285.642210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.642210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.737315 (E_RNA) where: Base-Base interactions energy: -191.316 where: short stacking energy: -89.050 Base-Backbone interact. energy: -0.010 local terms energy: -97.411416 where: bonds (distance) C4'-P energy: -19.385 bonds (distance) P-C4' energy: -18.700 flat angles C4'-P-C4' energy: -21.161 flat angles P-C4'-P energy: -14.807 tors. eta vs tors. theta energy: -23.357 Dist. restrs. and SS energy: 3.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 914 Temperature: 0.939150 Total energy: -277.639573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.639573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.735620 (E_RNA) where: Base-Base interactions energy: -181.771 where: short stacking energy: -87.900 Base-Backbone interact. energy: -0.094 local terms energy: -97.870823 where: bonds (distance) C4'-P energy: -17.471 bonds (distance) P-C4' energy: -21.309 flat angles C4'-P-C4' energy: -21.833 flat angles P-C4'-P energy: -7.711 tors. eta vs tors. theta energy: -29.547 Dist. restrs. and SS energy: 2.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 915 Temperature: 0.938700 Total energy: -299.108636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.108636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.469949 (E_RNA) where: Base-Base interactions energy: -196.248 where: short stacking energy: -94.540 Base-Backbone interact. energy: -0.033 local terms energy: -106.188314 where: bonds (distance) C4'-P energy: -21.891 bonds (distance) P-C4' energy: -18.923 flat angles C4'-P-C4' energy: -21.789 flat angles P-C4'-P energy: -15.942 tors. eta vs tors. theta energy: -27.643 Dist. restrs. and SS energy: 3.361 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 916 Temperature: 0.938250 Total energy: -291.177547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.177547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.227766 (E_RNA) where: Base-Base interactions energy: -193.468 where: short stacking energy: -93.420 Base-Backbone interact. energy: -0.668 local terms energy: -99.092754 where: bonds (distance) C4'-P energy: -17.081 bonds (distance) P-C4' energy: -21.264 flat angles C4'-P-C4' energy: -20.151 flat angles P-C4'-P energy: -13.514 tors. eta vs tors. theta energy: -27.083 Dist. restrs. and SS energy: 2.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 917 Temperature: 0.937800 Total energy: -284.375797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.375797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.875132 (E_RNA) where: Base-Base interactions energy: -196.922 where: short stacking energy: -88.299 Base-Backbone interact. energy: -0.007 local terms energy: -88.946308 where: bonds (distance) C4'-P energy: -16.923 bonds (distance) P-C4' energy: -15.971 flat angles C4'-P-C4' energy: -19.589 flat angles P-C4'-P energy: -8.873 tors. eta vs tors. theta energy: -27.591 Dist. restrs. and SS energy: 1.499 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 918 Temperature: 0.937350 Total energy: -289.060000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.060000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.541798 (E_RNA) where: Base-Base interactions energy: -201.514 where: short stacking energy: -91.890 Base-Backbone interact. energy: -0.007 local terms energy: -89.020446 where: bonds (distance) C4'-P energy: -14.082 bonds (distance) P-C4' energy: -17.163 flat angles C4'-P-C4' energy: -18.347 flat angles P-C4'-P energy: -13.798 tors. eta vs tors. theta energy: -25.631 Dist. restrs. and SS energy: 1.482 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 919 Temperature: 0.936900 Total energy: -289.222043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.222043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.058846 (E_RNA) where: Base-Base interactions energy: -193.186 where: short stacking energy: -86.960 Base-Backbone interact. energy: -1.316 local terms energy: -96.556555 where: bonds (distance) C4'-P energy: -17.974 bonds (distance) P-C4' energy: -19.519 flat angles C4'-P-C4' energy: -20.197 flat angles P-C4'-P energy: -14.239 tors. eta vs tors. theta energy: -24.627 Dist. restrs. and SS energy: 1.837 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 920 Temperature: 0.936450 Total energy: -271.405947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.405947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.118192 (E_RNA) where: Base-Base interactions energy: -190.682 where: short stacking energy: -87.414 Base-Backbone interact. energy: -0.015 local terms energy: -83.420332 where: bonds (distance) C4'-P energy: -16.243 bonds (distance) P-C4' energy: -15.569 flat angles C4'-P-C4' energy: -21.810 flat angles P-C4'-P energy: -8.313 tors. eta vs tors. theta energy: -21.486 Dist. restrs. and SS energy: 2.712 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 921 Temperature: 0.936000 Total energy: -279.885600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.885600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.229379 (E_RNA) where: Base-Base interactions energy: -183.970 where: short stacking energy: -90.132 Base-Backbone interact. energy: -0.651 local terms energy: -97.609152 where: bonds (distance) C4'-P energy: -19.573 bonds (distance) P-C4' energy: -19.089 flat angles C4'-P-C4' energy: -20.589 flat angles P-C4'-P energy: -11.266 tors. eta vs tors. theta energy: -27.092 Dist. restrs. and SS energy: 2.344 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 922 Temperature: 0.935550 Total energy: -285.086200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.086200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.620189 (E_RNA) where: Base-Base interactions energy: -191.658 where: short stacking energy: -92.028 Base-Backbone interact. energy: -0.167 local terms energy: -95.794427 where: bonds (distance) C4'-P energy: -18.248 bonds (distance) P-C4' energy: -18.040 flat angles C4'-P-C4' energy: -21.004 flat angles P-C4'-P energy: -11.714 tors. eta vs tors. theta energy: -26.789 Dist. restrs. and SS energy: 2.534 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 923 Temperature: 0.935100 Total energy: -289.919341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.919341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.126510 (E_RNA) where: Base-Base interactions energy: -195.089 where: short stacking energy: -92.075 Base-Backbone interact. energy: -0.004 local terms energy: -97.033571 where: bonds (distance) C4'-P energy: -17.945 bonds (distance) P-C4' energy: -18.565 flat angles C4'-P-C4' energy: -19.075 flat angles P-C4'-P energy: -12.293 tors. eta vs tors. theta energy: -29.156 Dist. restrs. and SS energy: 2.207 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 924 Temperature: 0.934650 Total energy: -293.968156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.968156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.092566 (E_RNA) where: Base-Base interactions energy: -199.495 where: short stacking energy: -93.440 Base-Backbone interact. energy: -0.004 local terms energy: -96.593869 where: bonds (distance) C4'-P energy: -19.921 bonds (distance) P-C4' energy: -19.098 flat angles C4'-P-C4' energy: -16.308 flat angles P-C4'-P energy: -12.652 tors. eta vs tors. theta energy: -28.615 Dist. restrs. and SS energy: 2.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 925 Temperature: 0.934200 Total energy: -296.773561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.773561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.242148 (E_RNA) where: Base-Base interactions energy: -201.685 where: short stacking energy: -90.703 Base-Backbone interact. energy: -0.001 local terms energy: -97.556123 where: bonds (distance) C4'-P energy: -17.350 bonds (distance) P-C4' energy: -19.373 flat angles C4'-P-C4' energy: -21.500 flat angles P-C4'-P energy: -14.514 tors. eta vs tors. theta energy: -24.820 Dist. restrs. and SS energy: 2.469 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 926 Temperature: 0.933750 Total energy: -290.335649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.335649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.374535 (E_RNA) where: Base-Base interactions energy: -194.101 where: short stacking energy: -93.915 Base-Backbone interact. energy: -0.067 local terms energy: -98.206697 where: bonds (distance) C4'-P energy: -17.299 bonds (distance) P-C4' energy: -16.393 flat angles C4'-P-C4' energy: -22.622 flat angles P-C4'-P energy: -12.740 tors. eta vs tors. theta energy: -29.153 Dist. restrs. and SS energy: 2.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 927 Temperature: 0.933300 Total energy: -274.028120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.028120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.774512 (E_RNA) where: Base-Base interactions energy: -183.190 where: short stacking energy: -83.932 Base-Backbone interact. energy: -0.000 local terms energy: -92.584550 where: bonds (distance) C4'-P energy: -18.632 bonds (distance) P-C4' energy: -14.865 flat angles C4'-P-C4' energy: -20.089 flat angles P-C4'-P energy: -15.991 tors. eta vs tors. theta energy: -23.009 Dist. restrs. and SS energy: 1.746 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 928 Temperature: 0.932850 Total energy: -294.394392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.394392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.668726 (E_RNA) where: Base-Base interactions energy: -200.960 where: short stacking energy: -94.677 Base-Backbone interact. energy: -0.094 local terms energy: -95.614870 where: bonds (distance) C4'-P energy: -12.339 bonds (distance) P-C4' energy: -18.465 flat angles C4'-P-C4' energy: -19.080 flat angles P-C4'-P energy: -17.045 tors. eta vs tors. theta energy: -28.685 Dist. restrs. and SS energy: 2.274 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 929 Temperature: 0.932400 Total energy: -295.776600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.776600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.023513 (E_RNA) where: Base-Base interactions energy: -198.866 where: short stacking energy: -98.689 Base-Backbone interact. energy: -1.047 local terms energy: -98.110403 where: bonds (distance) C4'-P energy: -18.331 bonds (distance) P-C4' energy: -18.499 flat angles C4'-P-C4' energy: -18.095 flat angles P-C4'-P energy: -14.482 tors. eta vs tors. theta energy: -28.704 Dist. restrs. and SS energy: 2.247 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 930 Temperature: 0.931950 Total energy: -285.643999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.643999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.901705 (E_RNA) where: Base-Base interactions energy: -193.384 where: short stacking energy: -99.563 Base-Backbone interact. energy: -0.006 local terms energy: -94.512308 where: bonds (distance) C4'-P energy: -19.674 bonds (distance) P-C4' energy: -20.134 flat angles C4'-P-C4' energy: -17.270 flat angles P-C4'-P energy: -9.120 tors. eta vs tors. theta energy: -28.314 Dist. restrs. and SS energy: 2.258 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 931 Temperature: 0.931500 Total energy: -292.130643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.130643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.465457 (E_RNA) where: Base-Base interactions energy: -196.859 where: short stacking energy: -97.964 Base-Backbone interact. energy: 1.256 local terms energy: -98.862339 where: bonds (distance) C4'-P energy: -17.452 bonds (distance) P-C4' energy: -19.565 flat angles C4'-P-C4' energy: -19.872 flat angles P-C4'-P energy: -13.739 tors. eta vs tors. theta energy: -28.235 Dist. restrs. and SS energy: 2.335 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 932 Temperature: 0.931050 Total energy: -291.829153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.829153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.299734 (E_RNA) where: Base-Base interactions energy: -197.760 where: short stacking energy: -98.787 Base-Backbone interact. energy: 1.336 local terms energy: -97.875729 where: bonds (distance) C4'-P energy: -15.240 bonds (distance) P-C4' energy: -21.088 flat angles C4'-P-C4' energy: -21.413 flat angles P-C4'-P energy: -11.988 tors. eta vs tors. theta energy: -28.146 Dist. restrs. and SS energy: 2.471 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 933 Temperature: 0.930600 Total energy: -288.803520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.803520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.092064 (E_RNA) where: Base-Base interactions energy: -190.494 where: short stacking energy: -93.846 Base-Backbone interact. energy: -0.000 local terms energy: -100.597741 where: bonds (distance) C4'-P energy: -19.907 bonds (distance) P-C4' energy: -21.085 flat angles C4'-P-C4' energy: -18.745 flat angles P-C4'-P energy: -13.414 tors. eta vs tors. theta energy: -27.447 Dist. restrs. and SS energy: 2.289 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 934 Temperature: 0.930150 Total energy: -281.302004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.302004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.399665 (E_RNA) where: Base-Base interactions energy: -187.720 where: short stacking energy: -86.429 Base-Backbone interact. energy: 0.155 local terms energy: -95.834731 where: bonds (distance) C4'-P energy: -13.959 bonds (distance) P-C4' energy: -20.158 flat angles C4'-P-C4' energy: -20.270 flat angles P-C4'-P energy: -14.374 tors. eta vs tors. theta energy: -27.074 Dist. restrs. and SS energy: 2.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 935 Temperature: 0.929700 Total energy: -285.885254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.885254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.963531 (E_RNA) where: Base-Base interactions energy: -189.621 where: short stacking energy: -88.985 Base-Backbone interact. energy: -0.090 local terms energy: -98.252429 where: bonds (distance) C4'-P energy: -15.950 bonds (distance) P-C4' energy: -19.391 flat angles C4'-P-C4' energy: -21.094 flat angles P-C4'-P energy: -13.888 tors. eta vs tors. theta energy: -27.930 Dist. restrs. and SS energy: 2.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 936 Temperature: 0.929250 Total energy: -293.322884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.322884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.233226 (E_RNA) where: Base-Base interactions energy: -196.410 where: short stacking energy: -99.871 Base-Backbone interact. energy: -0.004 local terms energy: -98.819594 where: bonds (distance) C4'-P energy: -13.114 bonds (distance) P-C4' energy: -20.147 flat angles C4'-P-C4' energy: -18.888 flat angles P-C4'-P energy: -17.466 tors. eta vs tors. theta energy: -29.205 Dist. restrs. and SS energy: 1.910 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 937 Temperature: 0.928800 Total energy: -287.528987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.528987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.674958 (E_RNA) where: Base-Base interactions energy: -191.213 where: short stacking energy: -84.660 Base-Backbone interact. energy: -0.663 local terms energy: -97.798875 where: bonds (distance) C4'-P energy: -20.115 bonds (distance) P-C4' energy: -17.236 flat angles C4'-P-C4' energy: -20.288 flat angles P-C4'-P energy: -15.620 tors. eta vs tors. theta energy: -24.540 Dist. restrs. and SS energy: 2.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 938 Temperature: 0.928350 Total energy: -296.872111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.872111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.933583 (E_RNA) where: Base-Base interactions energy: -204.271 where: short stacking energy: -96.509 Base-Backbone interact. energy: -0.004 local terms energy: -94.658406 where: bonds (distance) C4'-P energy: -12.564 bonds (distance) P-C4' energy: -20.119 flat angles C4'-P-C4' energy: -21.775 flat angles P-C4'-P energy: -11.966 tors. eta vs tors. theta energy: -28.234 Dist. restrs. and SS energy: 2.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 939 Temperature: 0.927900 Total energy: -286.077696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.077696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.712300 (E_RNA) where: Base-Base interactions energy: -193.000 where: short stacking energy: -98.509 Base-Backbone interact. energy: -0.049 local terms energy: -95.663260 where: bonds (distance) C4'-P energy: -21.741 bonds (distance) P-C4' energy: -11.697 flat angles C4'-P-C4' energy: -19.248 flat angles P-C4'-P energy: -15.414 tors. eta vs tors. theta energy: -27.563 Dist. restrs. and SS energy: 2.635 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 940 Temperature: 0.927450 Total energy: -293.864506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.864506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.266907 (E_RNA) where: Base-Base interactions energy: -195.784 where: short stacking energy: -99.171 Base-Backbone interact. energy: -0.003 local terms energy: -100.480423 where: bonds (distance) C4'-P energy: -19.108 bonds (distance) P-C4' energy: -17.280 flat angles C4'-P-C4' energy: -18.549 flat angles P-C4'-P energy: -16.878 tors. eta vs tors. theta energy: -28.665 Dist. restrs. and SS energy: 2.402 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 941 Temperature: 0.927000 Total energy: -288.657139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.657139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.986668 (E_RNA) where: Base-Base interactions energy: -190.766 where: short stacking energy: -96.739 Base-Backbone interact. energy: -0.640 local terms energy: -99.580825 where: bonds (distance) C4'-P energy: -14.743 bonds (distance) P-C4' energy: -18.014 flat angles C4'-P-C4' energy: -20.698 flat angles P-C4'-P energy: -16.077 tors. eta vs tors. theta energy: -30.048 Dist. restrs. and SS energy: 2.330 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 942 Temperature: 0.926550 Total energy: -290.643949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.643949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.727427 (E_RNA) where: Base-Base interactions energy: -188.444 where: short stacking energy: -91.532 Base-Backbone interact. energy: -0.874 local terms energy: -103.409815 where: bonds (distance) C4'-P energy: -17.863 bonds (distance) P-C4' energy: -19.957 flat angles C4'-P-C4' energy: -22.101 flat angles P-C4'-P energy: -14.678 tors. eta vs tors. theta energy: -28.810 Dist. restrs. and SS energy: 2.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 943 Temperature: 0.926100 Total energy: -295.625430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.625430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.648365 (E_RNA) where: Base-Base interactions energy: -200.091 where: short stacking energy: -100.770 Base-Backbone interact. energy: -0.124 local terms energy: -97.432961 where: bonds (distance) C4'-P energy: -18.785 bonds (distance) P-C4' energy: -15.052 flat angles C4'-P-C4' energy: -21.154 flat angles P-C4'-P energy: -13.354 tors. eta vs tors. theta energy: -29.088 Dist. restrs. and SS energy: 2.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 944 Temperature: 0.925650 Total energy: -300.718526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.718526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.543757 (E_RNA) where: Base-Base interactions energy: -208.272 where: short stacking energy: -97.675 Base-Backbone interact. energy: -0.413 local terms energy: -94.859733 where: bonds (distance) C4'-P energy: -15.454 bonds (distance) P-C4' energy: -17.080 flat angles C4'-P-C4' energy: -18.633 flat angles P-C4'-P energy: -13.063 tors. eta vs tors. theta energy: -30.630 Dist. restrs. and SS energy: 2.825 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 945 Temperature: 0.925200 Total energy: -301.604686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.604686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.646759 (E_RNA) where: Base-Base interactions energy: -206.373 where: short stacking energy: -100.941 Base-Backbone interact. energy: -0.000 local terms energy: -98.273433 where: bonds (distance) C4'-P energy: -13.359 bonds (distance) P-C4' energy: -21.802 flat angles C4'-P-C4' energy: -20.556 flat angles P-C4'-P energy: -13.423 tors. eta vs tors. theta energy: -29.133 Dist. restrs. and SS energy: 3.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 946 Temperature: 0.924750 Total energy: -296.921478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.921478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.325676 (E_RNA) where: Base-Base interactions energy: -203.219 where: short stacking energy: -91.277 Base-Backbone interact. energy: -0.450 local terms energy: -95.656852 where: bonds (distance) C4'-P energy: -17.008 bonds (distance) P-C4' energy: -19.897 flat angles C4'-P-C4' energy: -18.978 flat angles P-C4'-P energy: -13.729 tors. eta vs tors. theta energy: -26.045 Dist. restrs. and SS energy: 2.404 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 947 Temperature: 0.924300 Total energy: -288.681881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.681881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.093542 (E_RNA) where: Base-Base interactions energy: -191.357 where: short stacking energy: -94.335 Base-Backbone interact. energy: -1.679 local terms energy: -98.058516 where: bonds (distance) C4'-P energy: -18.422 bonds (distance) P-C4' energy: -17.698 flat angles C4'-P-C4' energy: -20.691 flat angles P-C4'-P energy: -13.919 tors. eta vs tors. theta energy: -27.329 Dist. restrs. and SS energy: 2.412 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 948 Temperature: 0.923850 Total energy: -285.994342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.994342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.749236 (E_RNA) where: Base-Base interactions energy: -196.177 where: short stacking energy: -91.721 Base-Backbone interact. energy: 0.847 local terms energy: -93.419742 where: bonds (distance) C4'-P energy: -13.875 bonds (distance) P-C4' energy: -19.467 flat angles C4'-P-C4' energy: -18.660 flat angles P-C4'-P energy: -14.105 tors. eta vs tors. theta energy: -27.313 Dist. restrs. and SS energy: 2.755 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 949 Temperature: 0.923400 Total energy: -289.796058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.796058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.959928 (E_RNA) where: Base-Base interactions energy: -196.890 where: short stacking energy: -90.315 Base-Backbone interact. energy: -0.371 local terms energy: -94.698412 where: bonds (distance) C4'-P energy: -18.550 bonds (distance) P-C4' energy: -15.106 flat angles C4'-P-C4' energy: -19.511 flat angles P-C4'-P energy: -12.855 tors. eta vs tors. theta energy: -28.676 Dist. restrs. and SS energy: 2.164 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 950 Temperature: 0.922950 Total energy: -291.304267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.304267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.359047 (E_RNA) where: Base-Base interactions energy: -195.691 where: short stacking energy: -93.831 Base-Backbone interact. energy: -0.047 local terms energy: -97.621347 where: bonds (distance) C4'-P energy: -14.135 bonds (distance) P-C4' energy: -20.519 flat angles C4'-P-C4' energy: -21.293 flat angles P-C4'-P energy: -15.163 tors. eta vs tors. theta energy: -26.512 Dist. restrs. and SS energy: 2.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 951 Temperature: 0.922500 Total energy: -296.189006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.189006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.359735 (E_RNA) where: Base-Base interactions energy: -198.301 where: short stacking energy: -102.518 Base-Backbone interact. energy: -0.003 local terms energy: -100.055504 where: bonds (distance) C4'-P energy: -16.876 bonds (distance) P-C4' energy: -19.439 flat angles C4'-P-C4' energy: -17.859 flat angles P-C4'-P energy: -15.980 tors. eta vs tors. theta energy: -29.901 Dist. restrs. and SS energy: 2.171 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 952 Temperature: 0.922050 Total energy: -289.967663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.967663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.011856 (E_RNA) where: Base-Base interactions energy: -196.840 where: short stacking energy: -98.120 Base-Backbone interact. energy: -0.022 local terms energy: -95.149426 where: bonds (distance) C4'-P energy: -16.590 bonds (distance) P-C4' energy: -17.976 flat angles C4'-P-C4' energy: -19.197 flat angles P-C4'-P energy: -13.344 tors. eta vs tors. theta energy: -28.042 Dist. restrs. and SS energy: 2.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 953 Temperature: 0.921600 Total energy: -290.722113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.722113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.373774 (E_RNA) where: Base-Base interactions energy: -190.064 where: short stacking energy: -93.474 Base-Backbone interact. energy: -0.002 local terms energy: -102.307488 where: bonds (distance) C4'-P energy: -17.448 bonds (distance) P-C4' energy: -18.840 flat angles C4'-P-C4' energy: -21.447 flat angles P-C4'-P energy: -17.071 tors. eta vs tors. theta energy: -27.501 Dist. restrs. and SS energy: 1.652 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 954 Temperature: 0.921150 Total energy: -293.385497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.385497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.330544 (E_RNA) where: Base-Base interactions energy: -197.654 where: short stacking energy: -98.451 Base-Backbone interact. energy: -0.387 local terms energy: -97.290186 where: bonds (distance) C4'-P energy: -14.988 bonds (distance) P-C4' energy: -16.257 flat angles C4'-P-C4' energy: -23.104 flat angles P-C4'-P energy: -15.733 tors. eta vs tors. theta energy: -27.208 Dist. restrs. and SS energy: 1.945 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 955 Temperature: 0.920700 Total energy: -300.172139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.172139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.043287 (E_RNA) where: Base-Base interactions energy: -196.435 where: short stacking energy: -92.172 Base-Backbone interact. energy: -0.005 local terms energy: -105.602751 where: bonds (distance) C4'-P energy: -20.992 bonds (distance) P-C4' energy: -20.657 flat angles C4'-P-C4' energy: -20.044 flat angles P-C4'-P energy: -17.633 tors. eta vs tors. theta energy: -26.276 Dist. restrs. and SS energy: 1.871 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 956 Temperature: 0.920250 Total energy: -282.133858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.133858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.977947 (E_RNA) where: Base-Base interactions energy: -189.009 where: short stacking energy: -92.475 Base-Backbone interact. energy: -0.013 local terms energy: -94.956083 where: bonds (distance) C4'-P energy: -15.313 bonds (distance) P-C4' energy: -18.540 flat angles C4'-P-C4' energy: -21.641 flat angles P-C4'-P energy: -12.676 tors. eta vs tors. theta energy: -26.786 Dist. restrs. and SS energy: 1.844 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 957 Temperature: 0.919800 Total energy: -285.008389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.008389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.035803 (E_RNA) where: Base-Base interactions energy: -192.408 where: short stacking energy: -82.723 Base-Backbone interact. energy: -1.612 local terms energy: -92.016377 where: bonds (distance) C4'-P energy: -14.795 bonds (distance) P-C4' energy: -15.594 flat angles C4'-P-C4' energy: -21.394 flat angles P-C4'-P energy: -15.013 tors. eta vs tors. theta energy: -25.221 Dist. restrs. and SS energy: 1.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 958 Temperature: 0.919350 Total energy: -286.621625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.621625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.873401 (E_RNA) where: Base-Base interactions energy: -193.623 where: short stacking energy: -88.854 Base-Backbone interact. energy: -0.009 local terms energy: -95.241299 where: bonds (distance) C4'-P energy: -17.878 bonds (distance) P-C4' energy: -16.356 flat angles C4'-P-C4' energy: -18.247 flat angles P-C4'-P energy: -15.702 tors. eta vs tors. theta energy: -27.058 Dist. restrs. and SS energy: 2.252 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 959 Temperature: 0.918900 Total energy: -280.206847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.206847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.279441 (E_RNA) where: Base-Base interactions energy: -183.268 where: short stacking energy: -88.729 Base-Backbone interact. energy: 0.672 local terms energy: -98.683420 where: bonds (distance) C4'-P energy: -21.513 bonds (distance) P-C4' energy: -18.988 flat angles C4'-P-C4' energy: -18.864 flat angles P-C4'-P energy: -10.506 tors. eta vs tors. theta energy: -28.812 Dist. restrs. and SS energy: 1.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 960 Temperature: 0.918450 Total energy: -277.605263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.605263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.849542 (E_RNA) where: Base-Base interactions energy: -183.101 where: short stacking energy: -90.107 Base-Backbone interact. energy: -0.836 local terms energy: -94.912487 where: bonds (distance) C4'-P energy: -21.696 bonds (distance) P-C4' energy: -19.568 flat angles C4'-P-C4' energy: -17.900 flat angles P-C4'-P energy: -9.831 tors. eta vs tors. theta energy: -25.917 Dist. restrs. and SS energy: 1.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 961 Temperature: 0.918000 Total energy: -272.689755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.689755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.696913 (E_RNA) where: Base-Base interactions energy: -183.998 where: short stacking energy: -79.694 Base-Backbone interact. energy: -0.154 local terms energy: -89.545140 where: bonds (distance) C4'-P energy: -18.700 bonds (distance) P-C4' energy: -17.848 flat angles C4'-P-C4' energy: -20.355 flat angles P-C4'-P energy: -9.782 tors. eta vs tors. theta energy: -22.860 Dist. restrs. and SS energy: 1.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 962 Temperature: 0.917550 Total energy: -270.689632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.689632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.995478 (E_RNA) where: Base-Base interactions energy: -187.221 where: short stacking energy: -78.636 Base-Backbone interact. energy: -0.296 local terms energy: -84.478615 where: bonds (distance) C4'-P energy: -22.018 bonds (distance) P-C4' energy: -14.859 flat angles C4'-P-C4' energy: -19.242 flat angles P-C4'-P energy: -7.377 tors. eta vs tors. theta energy: -20.983 Dist. restrs. and SS energy: 1.306 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 963 Temperature: 0.917100 Total energy: -269.734186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.734186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.111011 (E_RNA) where: Base-Base interactions energy: -180.150 where: short stacking energy: -86.675 Base-Backbone interact. energy: -0.612 local terms energy: -90.349500 where: bonds (distance) C4'-P energy: -18.173 bonds (distance) P-C4' energy: -20.302 flat angles C4'-P-C4' energy: -19.768 flat angles P-C4'-P energy: -9.380 tors. eta vs tors. theta energy: -22.726 Dist. restrs. and SS energy: 1.377 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 964 Temperature: 0.916650 Total energy: -274.267452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.267452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.378297 (E_RNA) where: Base-Base interactions energy: -189.359 where: short stacking energy: -86.844 Base-Backbone interact. energy: -0.057 local terms energy: -87.962558 where: bonds (distance) C4'-P energy: -21.452 bonds (distance) P-C4' energy: -20.068 flat angles C4'-P-C4' energy: -19.663 flat angles P-C4'-P energy: -9.601 tors. eta vs tors. theta energy: -17.179 Dist. restrs. and SS energy: 3.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 965 Temperature: 0.916200 Total energy: -273.181367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.181367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.464000 (E_RNA) where: Base-Base interactions energy: -180.663 where: short stacking energy: -82.916 Base-Backbone interact. energy: -0.442 local terms energy: -93.358112 where: bonds (distance) C4'-P energy: -17.054 bonds (distance) P-C4' energy: -20.584 flat angles C4'-P-C4' energy: -20.363 flat angles P-C4'-P energy: -14.402 tors. eta vs tors. theta energy: -20.955 Dist. restrs. and SS energy: 1.283 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 966 Temperature: 0.915750 Total energy: -265.426711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.426711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.837598 (E_RNA) where: Base-Base interactions energy: -172.754 where: short stacking energy: -85.739 Base-Backbone interact. energy: -0.046 local terms energy: -95.037403 where: bonds (distance) C4'-P energy: -18.976 bonds (distance) P-C4' energy: -18.668 flat angles C4'-P-C4' energy: -22.143 flat angles P-C4'-P energy: -16.091 tors. eta vs tors. theta energy: -19.160 Dist. restrs. and SS energy: 2.411 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 967 Temperature: 0.915300 Total energy: -264.759959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.759959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.198897 (E_RNA) where: Base-Base interactions energy: -181.914 where: short stacking energy: -87.604 Base-Backbone interact. energy: -0.016 local terms energy: -85.268887 where: bonds (distance) C4'-P energy: -20.140 bonds (distance) P-C4' energy: -19.098 flat angles C4'-P-C4' energy: -13.147 flat angles P-C4'-P energy: -12.635 tors. eta vs tors. theta energy: -20.250 Dist. restrs. and SS energy: 2.439 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 968 Temperature: 0.914850 Total energy: -259.035755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.035755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.759537 (E_RNA) where: Base-Base interactions energy: -177.921 where: short stacking energy: -88.950 Base-Backbone interact. energy: -0.813 local terms energy: -82.025681 where: bonds (distance) C4'-P energy: -15.282 bonds (distance) P-C4' energy: -8.168 flat angles C4'-P-C4' energy: -18.264 flat angles P-C4'-P energy: -14.616 tors. eta vs tors. theta energy: -25.695 Dist. restrs. and SS energy: 1.724 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 969 Temperature: 0.914400 Total energy: -264.980942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.980942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.981773 (E_RNA) where: Base-Base interactions energy: -178.720 where: short stacking energy: -84.878 Base-Backbone interact. energy: -0.266 local terms energy: -86.995251 where: bonds (distance) C4'-P energy: -12.170 bonds (distance) P-C4' energy: -21.285 flat angles C4'-P-C4' energy: -19.774 flat angles P-C4'-P energy: -12.314 tors. eta vs tors. theta energy: -21.453 Dist. restrs. and SS energy: 1.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 970 Temperature: 0.913950 Total energy: -268.972292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.972292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.603039 (E_RNA) where: Base-Base interactions energy: -177.274 where: short stacking energy: -87.538 Base-Backbone interact. energy: -0.492 local terms energy: -92.837005 where: bonds (distance) C4'-P energy: -20.383 bonds (distance) P-C4' energy: -15.772 flat angles C4'-P-C4' energy: -19.767 flat angles P-C4'-P energy: -14.906 tors. eta vs tors. theta energy: -22.009 Dist. restrs. and SS energy: 1.631 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 971 Temperature: 0.913500 Total energy: -263.625400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.625400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.780078 (E_RNA) where: Base-Base interactions energy: -177.106 where: short stacking energy: -81.417 Base-Backbone interact. energy: -0.366 local terms energy: -87.307911 where: bonds (distance) C4'-P energy: -16.265 bonds (distance) P-C4' energy: -18.487 flat angles C4'-P-C4' energy: -19.061 flat angles P-C4'-P energy: -13.686 tors. eta vs tors. theta energy: -19.808 Dist. restrs. and SS energy: 1.155 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 972 Temperature: 0.913050 Total energy: -256.675867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.675867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.574834 (E_RNA) where: Base-Base interactions energy: -170.304 where: short stacking energy: -76.555 Base-Backbone interact. energy: -1.550 local terms energy: -86.721105 where: bonds (distance) C4'-P energy: -12.165 bonds (distance) P-C4' energy: -20.253 flat angles C4'-P-C4' energy: -18.779 flat angles P-C4'-P energy: -15.017 tors. eta vs tors. theta energy: -20.508 Dist. restrs. and SS energy: 1.899 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 973 Temperature: 0.912600 Total energy: -262.317648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.317648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.349584 (E_RNA) where: Base-Base interactions energy: -179.456 where: short stacking energy: -92.773 Base-Backbone interact. energy: -0.051 local terms energy: -83.842663 where: bonds (distance) C4'-P energy: -16.504 bonds (distance) P-C4' energy: -16.523 flat angles C4'-P-C4' energy: -15.420 flat angles P-C4'-P energy: -12.516 tors. eta vs tors. theta energy: -22.880 Dist. restrs. and SS energy: 1.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 974 Temperature: 0.912150 Total energy: -258.886180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.886180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.281218 (E_RNA) where: Base-Base interactions energy: -164.074 where: short stacking energy: -78.963 Base-Backbone interact. energy: -0.240 local terms energy: -95.967898 where: bonds (distance) C4'-P energy: -17.449 bonds (distance) P-C4' energy: -19.830 flat angles C4'-P-C4' energy: -20.835 flat angles P-C4'-P energy: -12.261 tors. eta vs tors. theta energy: -25.593 Dist. restrs. and SS energy: 1.395 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 975 Temperature: 0.911700 Total energy: -262.581637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.581637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.165530 (E_RNA) where: Base-Base interactions energy: -165.994 where: short stacking energy: -80.896 Base-Backbone interact. energy: -0.006 local terms energy: -98.165558 where: bonds (distance) C4'-P energy: -17.623 bonds (distance) P-C4' energy: -20.574 flat angles C4'-P-C4' energy: -16.718 flat angles P-C4'-P energy: -16.113 tors. eta vs tors. theta energy: -27.138 Dist. restrs. and SS energy: 1.584 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 976 Temperature: 0.911250 Total energy: -273.442190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.442190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.483867 (E_RNA) where: Base-Base interactions energy: -176.884 where: short stacking energy: -88.828 Base-Backbone interact. energy: -0.951 local terms energy: -97.648539 where: bonds (distance) C4'-P energy: -17.499 bonds (distance) P-C4' energy: -19.929 flat angles C4'-P-C4' energy: -20.627 flat angles P-C4'-P energy: -12.796 tors. eta vs tors. theta energy: -26.798 Dist. restrs. and SS energy: 2.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 977 Temperature: 0.910800 Total energy: -272.868199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.868199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.265067 (E_RNA) where: Base-Base interactions energy: -182.863 where: short stacking energy: -94.156 Base-Backbone interact. energy: -0.721 local terms energy: -90.681043 where: bonds (distance) C4'-P energy: -17.940 bonds (distance) P-C4' energy: -13.483 flat angles C4'-P-C4' energy: -21.827 flat angles P-C4'-P energy: -11.172 tors. eta vs tors. theta energy: -26.259 Dist. restrs. and SS energy: 1.397 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 978 Temperature: 0.910350 Total energy: -272.620208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.620208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.365426 (E_RNA) where: Base-Base interactions energy: -186.125 where: short stacking energy: -75.018 Base-Backbone interact. energy: -0.410 local terms energy: -86.830277 where: bonds (distance) C4'-P energy: -20.060 bonds (distance) P-C4' energy: -15.364 flat angles C4'-P-C4' energy: -14.380 flat angles P-C4'-P energy: -10.571 tors. eta vs tors. theta energy: -26.456 Dist. restrs. and SS energy: 0.745 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 979 Temperature: 0.909900 Total energy: -279.091601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.091601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.868191 (E_RNA) where: Base-Base interactions energy: -180.201 where: short stacking energy: -84.592 Base-Backbone interact. energy: -1.265 local terms energy: -99.402308 where: bonds (distance) C4'-P energy: -21.154 bonds (distance) P-C4' energy: -19.866 flat angles C4'-P-C4' energy: -20.586 flat angles P-C4'-P energy: -14.096 tors. eta vs tors. theta energy: -23.700 Dist. restrs. and SS energy: 1.777 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 980 Temperature: 0.909450 Total energy: -273.722797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.722797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.608545 (E_RNA) where: Base-Base interactions energy: -179.456 where: short stacking energy: -77.904 Base-Backbone interact. energy: -0.784 local terms energy: -94.368195 where: bonds (distance) C4'-P energy: -19.111 bonds (distance) P-C4' energy: -18.929 flat angles C4'-P-C4' energy: -14.555 flat angles P-C4'-P energy: -15.883 tors. eta vs tors. theta energy: -25.891 Dist. restrs. and SS energy: 0.886 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 981 Temperature: 0.909000 Total energy: -276.868644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.868644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.670796 (E_RNA) where: Base-Base interactions energy: -179.017 where: short stacking energy: -81.067 Base-Backbone interact. energy: -2.489 local terms energy: -97.164636 where: bonds (distance) C4'-P energy: -23.554 bonds (distance) P-C4' energy: -19.356 flat angles C4'-P-C4' energy: -18.992 flat angles P-C4'-P energy: -11.790 tors. eta vs tors. theta energy: -23.472 Dist. restrs. and SS energy: 1.802 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 982 Temperature: 0.908550 Total energy: -269.094815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.094815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.959161 (E_RNA) where: Base-Base interactions energy: -178.957 where: short stacking energy: -84.017 Base-Backbone interact. energy: -0.291 local terms energy: -91.711433 where: bonds (distance) C4'-P energy: -18.591 bonds (distance) P-C4' energy: -19.786 flat angles C4'-P-C4' energy: -21.948 flat angles P-C4'-P energy: -9.957 tors. eta vs tors. theta energy: -21.429 Dist. restrs. and SS energy: 1.864 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 983 Temperature: 0.908100 Total energy: -256.656037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.656037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.646355 (E_RNA) where: Base-Base interactions energy: -176.532 where: short stacking energy: -72.536 Base-Backbone interact. energy: -0.757 local terms energy: -80.357645 where: bonds (distance) C4'-P energy: -16.600 bonds (distance) P-C4' energy: -21.700 flat angles C4'-P-C4' energy: -15.461 flat angles P-C4'-P energy: -8.730 tors. eta vs tors. theta energy: -17.866 Dist. restrs. and SS energy: 0.990 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 984 Temperature: 0.907650 Total energy: -263.600324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.600324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.144867 (E_RNA) where: Base-Base interactions energy: -183.411 where: short stacking energy: -77.520 Base-Backbone interact. energy: 2.073 local terms energy: -83.806675 where: bonds (distance) C4'-P energy: -15.862 bonds (distance) P-C4' energy: -14.986 flat angles C4'-P-C4' energy: -18.180 flat angles P-C4'-P energy: -15.357 tors. eta vs tors. theta energy: -19.422 Dist. restrs. and SS energy: 1.545 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 985 Temperature: 0.907200 Total energy: -273.636224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.636224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.629380 (E_RNA) where: Base-Base interactions energy: -191.068 where: short stacking energy: -78.973 Base-Backbone interact. energy: -0.525 local terms energy: -83.036296 where: bonds (distance) C4'-P energy: -14.954 bonds (distance) P-C4' energy: -19.499 flat angles C4'-P-C4' energy: -20.363 flat angles P-C4'-P energy: -9.756 tors. eta vs tors. theta energy: -18.465 Dist. restrs. and SS energy: 0.993 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 986 Temperature: 0.906750 Total energy: -275.875451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.875451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.675039 (E_RNA) where: Base-Base interactions energy: -187.190 where: short stacking energy: -84.736 Base-Backbone interact. energy: -1.668 local terms energy: -88.816925 where: bonds (distance) C4'-P energy: -20.851 bonds (distance) P-C4' energy: -19.164 flat angles C4'-P-C4' energy: -19.968 flat angles P-C4'-P energy: -8.664 tors. eta vs tors. theta energy: -20.170 Dist. restrs. and SS energy: 1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 987 Temperature: 0.906300 Total energy: -270.504796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.504796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.935828 (E_RNA) where: Base-Base interactions energy: -190.285 where: short stacking energy: -81.160 Base-Backbone interact. energy: -0.551 local terms energy: -81.100196 where: bonds (distance) C4'-P energy: -15.864 bonds (distance) P-C4' energy: -16.310 flat angles C4'-P-C4' energy: -17.709 flat angles P-C4'-P energy: -11.873 tors. eta vs tors. theta energy: -19.344 Dist. restrs. and SS energy: 1.431 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 988 Temperature: 0.905850 Total energy: -275.551160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.551160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.016219 (E_RNA) where: Base-Base interactions energy: -194.392 where: short stacking energy: -88.594 Base-Backbone interact. energy: -0.007 local terms energy: -82.617478 where: bonds (distance) C4'-P energy: -19.299 bonds (distance) P-C4' energy: -19.073 flat angles C4'-P-C4' energy: -10.877 flat angles P-C4'-P energy: -13.869 tors. eta vs tors. theta energy: -19.499 Dist. restrs. and SS energy: 1.465 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 989 Temperature: 0.905400 Total energy: -269.947104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.947104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.333776 (E_RNA) where: Base-Base interactions energy: -189.575 where: short stacking energy: -88.223 Base-Backbone interact. energy: -1.515 local terms energy: -80.244582 where: bonds (distance) C4'-P energy: -14.185 bonds (distance) P-C4' energy: -15.899 flat angles C4'-P-C4' energy: -15.782 flat angles P-C4'-P energy: -15.202 tors. eta vs tors. theta energy: -19.177 Dist. restrs. and SS energy: 1.387 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 990 Temperature: 0.904950 Total energy: -275.111839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.111839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.152638 (E_RNA) where: Base-Base interactions energy: -186.706 where: short stacking energy: -92.255 Base-Backbone interact. energy: -0.571 local terms energy: -89.876094 where: bonds (distance) C4'-P energy: -18.693 bonds (distance) P-C4' energy: -17.937 flat angles C4'-P-C4' energy: -19.446 flat angles P-C4'-P energy: -9.268 tors. eta vs tors. theta energy: -24.533 Dist. restrs. and SS energy: 2.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 991 Temperature: 0.904500 Total energy: -267.751307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.751307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.525282 (E_RNA) where: Base-Base interactions energy: -173.717 where: short stacking energy: -77.660 Base-Backbone interact. energy: -0.590 local terms energy: -95.217988 where: bonds (distance) C4'-P energy: -21.654 bonds (distance) P-C4' energy: -22.331 flat angles C4'-P-C4' energy: -18.992 flat angles P-C4'-P energy: -8.782 tors. eta vs tors. theta energy: -23.459 Dist. restrs. and SS energy: 1.774 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 992 Temperature: 0.904050 Total energy: -267.602083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.602083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.473327 (E_RNA) where: Base-Base interactions energy: -181.116 where: short stacking energy: -84.004 Base-Backbone interact. energy: -0.020 local terms energy: -88.336943 where: bonds (distance) C4'-P energy: -16.674 bonds (distance) P-C4' energy: -18.225 flat angles C4'-P-C4' energy: -19.198 flat angles P-C4'-P energy: -10.791 tors. eta vs tors. theta energy: -23.450 Dist. restrs. and SS energy: 1.871 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 993 Temperature: 0.903600 Total energy: -259.436423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.436423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.108460 (E_RNA) where: Base-Base interactions energy: -176.139 where: short stacking energy: -67.297 Base-Backbone interact. energy: -0.076 local terms energy: -84.893464 where: bonds (distance) C4'-P energy: -21.327 bonds (distance) P-C4' energy: -14.943 flat angles C4'-P-C4' energy: -16.971 flat angles P-C4'-P energy: -12.755 tors. eta vs tors. theta energy: -18.897 Dist. restrs. and SS energy: 1.672 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 994 Temperature: 0.903150 Total energy: -257.076235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.076235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.607159 (E_RNA) where: Base-Base interactions energy: -175.433 where: short stacking energy: -80.173 Base-Backbone interact. energy: -0.192 local terms energy: -84.981691 where: bonds (distance) C4'-P energy: -12.103 bonds (distance) P-C4' energy: -21.359 flat angles C4'-P-C4' energy: -18.796 flat angles P-C4'-P energy: -12.943 tors. eta vs tors. theta energy: -19.782 Dist. restrs. and SS energy: 3.531 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 995 Temperature: 0.902700 Total energy: -277.718609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.718609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.678376 (E_RNA) where: Base-Base interactions energy: -179.242 where: short stacking energy: -79.492 Base-Backbone interact. energy: -2.518 local terms energy: -97.918994 where: bonds (distance) C4'-P energy: -20.131 bonds (distance) P-C4' energy: -21.576 flat angles C4'-P-C4' energy: -19.153 flat angles P-C4'-P energy: -14.010 tors. eta vs tors. theta energy: -23.049 Dist. restrs. and SS energy: 1.960 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 996 Temperature: 0.902250 Total energy: -287.119488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.119488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.860529 (E_RNA) where: Base-Base interactions energy: -202.268 where: short stacking energy: -86.914 Base-Backbone interact. energy: -0.089 local terms energy: -87.503544 where: bonds (distance) C4'-P energy: -18.757 bonds (distance) P-C4' energy: -17.371 flat angles C4'-P-C4' energy: -18.862 flat angles P-C4'-P energy: -12.900 tors. eta vs tors. theta energy: -19.613 Dist. restrs. and SS energy: 2.741 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 997 Temperature: 0.901800 Total energy: -281.601783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.601783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.929749 (E_RNA) where: Base-Base interactions energy: -201.441 where: short stacking energy: -82.997 Base-Backbone interact. energy: -0.024 local terms energy: -83.463873 where: bonds (distance) C4'-P energy: -16.405 bonds (distance) P-C4' energy: -18.542 flat angles C4'-P-C4' energy: -19.041 flat angles P-C4'-P energy: -12.676 tors. eta vs tors. theta energy: -16.799 Dist. restrs. and SS energy: 3.328 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 998 Temperature: 0.901350 Total energy: -276.039492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.039492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.962401 (E_RNA) where: Base-Base interactions energy: -186.737 where: short stacking energy: -84.441 Base-Backbone interact. energy: -0.162 local terms energy: -92.063682 where: bonds (distance) C4'-P energy: -21.490 bonds (distance) P-C4' energy: -22.054 flat angles C4'-P-C4' energy: -19.808 flat angles P-C4'-P energy: -13.439 tors. eta vs tors. theta energy: -15.272 Dist. restrs. and SS energy: 2.923 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 999 Temperature: 0.900900 Total energy: -280.752045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.752045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.662832 (E_RNA) where: Base-Base interactions energy: -189.243 where: short stacking energy: -84.302 Base-Backbone interact. energy: -0.459 local terms energy: -92.960600 where: bonds (distance) C4'-P energy: -18.081 bonds (distance) P-C4' energy: -20.548 flat angles C4'-P-C4' energy: -18.689 flat angles P-C4'-P energy: -11.481 tors. eta vs tors. theta energy: -24.162 Dist. restrs. and SS energy: 1.911 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 1000 Temperature: 0.900450 Total energy: -280.419999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.419999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.757065 (E_RNA) where: Base-Base interactions energy: -191.202 where: short stacking energy: -87.354 Base-Backbone interact. energy: -0.131 local terms energy: -90.423697 where: bonds (distance) C4'-P energy: -17.267 bonds (distance) P-C4' energy: -20.937 flat angles C4'-P-C4' energy: -17.162 flat angles P-C4'-P energy: -13.546 tors. eta vs tors. theta energy: -21.511 Dist. restrs. and SS energy: 1.337 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 1001 Temperature: 0.900000 Total energy: -280.407867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.407867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.959350 (E_RNA) where: Base-Base interactions energy: -196.212 where: short stacking energy: -84.769 Base-Backbone interact. energy: -0.129 local terms energy: -85.618305 where: bonds (distance) C4'-P energy: -17.196 bonds (distance) P-C4' energy: -12.149 flat angles C4'-P-C4' energy: -19.991 flat angles P-C4'-P energy: -14.100 tors. eta vs tors. theta energy: -22.182 Dist. restrs. and SS energy: 1.551 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) .writing output current total energy: -266.653776 recalc. total energy: -265.711682 numberOfNucleotides: 27 initial temperature kT: 1.350000 moves confirmed at first: 2980114 moves confirmed later: 3128833 all moves confirmed: 6108947 percent of confirmed moves: 3.818092 nucl1: 0, chain1: A, <---> nucl2: 26, chain2: A type of interaction: GC_WWc nucl1: 1, chain1: A, <---> nucl2: 25, chain2: A type of interaction: CG_WWc nucl1: 2, chain1: A, <---> nucl2: 24, chain2: A type of interaction: CG_WWc nucl1: 8, chain1: A, <---> nucl2: 19, chain2: A type of interaction: GC_WWc nucl1: 9, chain1: A, <---> nucl2: 18, chain2: A type of interaction: UG_WWc nucl1: 10, chain1: A, <---> nucl2: 17, chain2: A type of interaction: GC_WWc nucl1: 3, chain1: A, <---> nucl2: 23, chain2: A type of interaction: GA_SHt nucl1: 4, chain1: A, <---> nucl2: 22, chain2: A type of interaction: AA_HHt nucl1: 5, chain1: A, <---> nucl2: 6, chain2: A type of interaction: GU_SHc nucl1: 6, chain1: A, <---> nucl2: 21, chain2: A type of interaction: UA_WHt nucl1: 7, chain1: A, <---> nucl2: 20, chain2: A type of interaction: AG_HSt nucl1: 11, chain1: A, <---> nucl2: 15, chain2: A type of interaction: UG_WWt Stiffness is set Stiffness is set Stiffness is set Stiffness is set Stiffness is set Stiffness is set Time of doing 1600000 iterations: 369.993 seconds