SimRNAweb2.0


SimRNA (Demo4)

RNA models for: Demo4-07d8682d (Demo4)

GCCGAGUAGUGUUGGGUCGCGAAAGGC
n steps: 1000 (~ n of SimRNA frames: 1000, curr n of frames 1000 = 100.0%)
Dec. 24, 2023, 2:33 p.m.

The best score and representatives of up to five top clusters from your simulation:

The trajectory file for the simulation can be found here (the file might be > 1GB!).

The raw output files for each step of the pipeline can be found here

Best score model:

Demo4-07d8682d

1st cluster representative:

2nd cluster representative: