SimRNAweb2.0


SimRNA (Demo2)

RNA models for: Demo2-23baa264 (Demo2)

GGCGCGGCACCGUCCGCGGAACAAACGG
n steps: 500 (~ n of SimRNA frames: 4000, curr n of frames 4000 = 100.0%)
Dec. 24, 2023, 3:40 p.m.

The best score and representatives of up to five top clusters from your simulation:

The trajectory file for the simulation can be found here (the file might be > 1GB!).

The raw output files for each step of the pipeline can be found here

Best score model:

Demo2-23baa264

1st cluster representative: