International institute of molecular and cell biology in Warzawa

Family TTC28-AS1_2


Download the aligments for this family. (.stk)

RNA Shape

Level1
(()())()

Consensus Secondary Structure representation

Comment:Consensus Secondary Structure predicted by PETfold
>predicted reference TTC28-AS1_2 
AAAAUGGCAGAAUGAAGGAAUUAUGAGGAGGACUAGAGAGUAGGAAAGACAUGAACCGACACUCAAAAGAGAAGGAAGGACAUAUAAAGAAAAAGACAAAUACACGUGAAAAAAAUAGACUAAUGGAUUAACGUCUCCAUUGUGUGACAUUUUCUU
.......(........................(.........).................................................................................((........)).....).(.........)..





Contribute: Everyone is welcome to give feedback concerning the database.
If you have any advice or suggestions for corrections or improvements, please : rnarchitecture@genesilico.pl

Copyright © Genesilico - All rights reserved