International institute of molecular and cell biology in Warzawa

Family PreQ1-III


Download the aligments for this family. (.stk)

RNA Shape

Level1
[(]()(([)))]
Level2
[(]()([))]

Consensus Secondary Structure representation

Comment:Note that due to crystal packing there is no intramolecular L4-RBS pseudoknot formation in the 4RZD structure, instead there is an intermolecular L4-RBS interaction (Liberman et. al doi:10.1073/pnas.1503955112).
>predicted reference PreQ1-III
GAGCAACUUAGGAUUUUAGGCUCCCCGGCGCGUCUCGAACCGCGCCGGGCCAAACCCCCCGGGGCUGGCGGCCCCGGGGCGGUCAAAAUCCAUCCGCUGGAG
[[[[......(((((((..]]]](((((((((........)))))))))....(((.((((((([[[[[[[)))))))..))).)))))))..]]]]]]]..





Contribute: Everyone is welcome to give feedback concerning the database.
If you have any advice or suggestions for corrections or improvements, please : rnarchitecture@genesilico.pl

Copyright © Genesilico - All rights reserved