International institute of molecular and cell biology in Warzawa

Family DLEU2_1


Download the aligments for this family. (.stk)

RNA Shape

Level1
()()

Consensus Secondary Structure representation

Comment:Consensus Secondary Structure predicted by PETfold
>predicted reference DLEU2_1 
ACUAGAGCCAAAUCUAUCUCAAAAGUUUAGGACAUUAAUUUUUCUCCUUUUUGAUAAUAUUCAAUGAGAAAUAACACUUAGAAUAAAACUUUUUCCAUGAGGAAGGGAUAGUAAUAUCCAC
...........................................(((...................))).......((.................................)).........





Contribute: Everyone is welcome to give feedback concerning the database.
If you have any advice or suggestions for corrections or improvements, please : rnarchitecture@genesilico.pl

Copyright © Genesilico - All rights reserved