ClaRNA

Classifier, supplementary materials, evaluation

Group: fp-cis-vs-trans

bp

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
WW_cis 5 10 35 10 1 4 26
WW_tran 20 1 1 2 21
WH_cis 2 1 3
HW_cis 1 3 4
WH_tran 21 4 1 26
HW_tran 28 12 5 9 4 1 59
WS_cis 19 11 3 5 2 2 1 43
SW_cis 5 3 11 1 1 21
WS_tran 2 5 7
SW_tran 1 2 2 5
HH_cis 0
HH_tran 1 3 29 2 33
HS_cis 1 1
SH_cis 2 7 1 1 11
HS_tran 6 2 8
SH_tran 6 6
SS_cis 4 4
SS_tran 0
Sum 44 26 44 42 26 26 14 5 7 30 13 16 2 16 191

This is the default dialog which is useful for displaying information. The dialog window can be moved, resized and closed with the 'x' icon.

repr:
Show:
download PDB download JSON