SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa: 1 curr_seq: _GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 154 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 775 n_atoms_counter: 775 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 154.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa: 1 curr_seq: _GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 154 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 775 n_atoms_counter: 775 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 154.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa: 1 curr_seq: _GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 154 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 775 n_atoms_counter: 775 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 154.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa: 1 curr_seq: _GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 154 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 775 n_atoms_counter: 775 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 154.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa: 1 curr_seq: _GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 154 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 775 n_atoms_counter: 775 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 154.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa: 1 curr_seq: _GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 154 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 775 n_atoms_counter: 775 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 154.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa: 1 curr_seq: _GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 154 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 775 n_atoms_counter: 775 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 154.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa: 1 curr_seq: _GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 154 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 775 n_atoms_counter: 775 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 154.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa: 1 curr_seq: _GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 154 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 775 n_atoms_counter: 775 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 154.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/utr4-66810518/inputs/seq.fa: 1 curr_seq: _GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCGGUGGCAAGUGCAUACAUCGACAACGAAUACCGCUGACUCCCCAAGGAAGUAAGGAUUUGUCCUGAAGCAAGUUGGGGAAAGGAAAAAAAACAACAAAUAAGAACAAAAAAAAUAGAGAAAGAAACUGCUAAGACAAGACAAGAAUGGCAA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 154 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 775 n_atoms_counter: 775 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 154.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -622.964226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.964226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.964226 (E_RNA) where: Base-Base interactions energy: -23.457 where: short stacking energy: -23.457 Base-Backbone interact. energy: -0.000 local terms energy: -599.507178 where: bonds (distance) C4'-P energy: -149.623 bonds (distance) P-C4' energy: -138.671 flat angles C4'-P-C4' energy: -113.071 flat angles P-C4'-P energy: -129.341 tors. eta vs tors. theta energy: -68.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -622.964226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.964226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.964226 (E_RNA) where: Base-Base interactions energy: -23.457 where: short stacking energy: -23.457 Base-Backbone interact. energy: -0.000 local terms energy: -599.507178 where: bonds (distance) C4'-P energy: -149.623 bonds (distance) P-C4' energy: -138.671 flat angles C4'-P-C4' energy: -113.071 flat angles P-C4'-P energy: -129.341 tors. eta vs tors. theta energy: -68.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -622.964226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.964226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.964226 (E_RNA) where: Base-Base interactions energy: -23.457 where: short stacking energy: -23.457 Base-Backbone interact. energy: -0.000 local terms energy: -599.507178 where: bonds (distance) C4'-P energy: -149.623 bonds (distance) P-C4' energy: -138.671 flat angles C4'-P-C4' energy: -113.071 flat angles P-C4'-P energy: -129.341 tors. eta vs tors. theta energy: -68.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -622.964226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.964226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.964226 (E_RNA) where: Base-Base interactions energy: -23.457 where: short stacking energy: -23.457 Base-Backbone interact. energy: -0.000 local terms energy: -599.507178 where: bonds (distance) C4'-P energy: -149.623 bonds (distance) P-C4' energy: -138.671 flat angles C4'-P-C4' energy: -113.071 flat angles P-C4'-P energy: -129.341 tors. eta vs tors. theta energy: -68.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -622.964226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.964226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.964226 (E_RNA) where: Base-Base interactions energy: -23.457 where: short stacking energy: -23.457 Base-Backbone interact. energy: -0.000 local terms energy: -599.507178 where: bonds (distance) C4'-P energy: -149.623 bonds (distance) P-C4' energy: -138.671 flat angles C4'-P-C4' energy: -113.071 flat angles P-C4'-P energy: -129.341 tors. eta vs tors. theta energy: -68.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -622.964226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.964226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.964226 (E_RNA) where: Base-Base interactions energy: -23.457 where: short stacking energy: -23.457 Base-Backbone interact. energy: -0.000 local terms energy: -599.507178 where: bonds (distance) C4'-P energy: -149.623 bonds (distance) P-C4' energy: -138.671 flat angles C4'-P-C4' energy: -113.071 flat angles P-C4'-P energy: -129.341 tors. eta vs tors. theta energy: -68.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -622.964226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.964226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.964226 (E_RNA) where: Base-Base interactions energy: -23.457 where: short stacking energy: -23.457 Base-Backbone interact. energy: -0.000 local terms energy: -599.507178 where: bonds (distance) C4'-P energy: -149.623 bonds (distance) P-C4' energy: -138.671 flat angles C4'-P-C4' energy: -113.071 flat angles P-C4'-P energy: -129.341 tors. eta vs tors. theta energy: -68.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -622.964226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.964226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.964226 (E_RNA) where: Base-Base interactions energy: -23.457 where: short stacking energy: -23.457 Base-Backbone interact. energy: -0.000 local terms energy: -599.507178 where: bonds (distance) C4'-P energy: -149.623 bonds (distance) P-C4' energy: -138.671 flat angles C4'-P-C4' energy: -113.071 flat angles P-C4'-P energy: -129.341 tors. eta vs tors. theta energy: -68.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -622.964226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.964226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.964226 (E_RNA) where: Base-Base interactions energy: -23.457 where: short stacking energy: -23.457 Base-Backbone interact. energy: -0.000 local terms energy: -599.507178 where: bonds (distance) C4'-P energy: -149.623 bonds (distance) P-C4' energy: -138.671 flat angles C4'-P-C4' energy: -113.071 flat angles P-C4'-P energy: -129.341 tors. eta vs tors. theta energy: -68.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -622.964226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.964226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.964226 (E_RNA) where: Base-Base interactions energy: -23.457 where: short stacking energy: -23.457 Base-Backbone interact. energy: -0.000 local terms energy: -599.507178 where: bonds (distance) C4'-P energy: -149.623 bonds (distance) P-C4' energy: -138.671 flat angles C4'-P-C4' energy: -113.071 flat angles P-C4'-P energy: -129.341 tors. eta vs tors. theta energy: -68.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -780.165224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -780.165224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.165224 (E_RNA) where: Base-Base interactions energy: -339.547 where: short stacking energy: -320.248 Base-Backbone interact. energy: -0.243 local terms energy: -440.375236 where: bonds (distance) C4'-P energy: -101.601 bonds (distance) P-C4' energy: -109.837 flat angles C4'-P-C4' energy: -96.383 flat angles P-C4'-P energy: -46.718 tors. eta vs tors. theta energy: -85.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -725.648426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.648426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.648426 (E_RNA) where: Base-Base interactions energy: -291.250 where: short stacking energy: -291.250 Base-Backbone interact. energy: -0.089 local terms energy: -434.309468 where: bonds (distance) C4'-P energy: -102.354 bonds (distance) P-C4' energy: -99.932 flat angles C4'-P-C4' energy: -97.432 flat angles P-C4'-P energy: -59.122 tors. eta vs tors. theta energy: -75.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -666.732086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.732086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.732086 (E_RNA) where: Base-Base interactions energy: -265.682 where: short stacking energy: -252.152 Base-Backbone interact. energy: -0.659 local terms energy: -400.390816 where: bonds (distance) C4'-P energy: -91.279 bonds (distance) P-C4' energy: -109.715 flat angles C4'-P-C4' energy: -95.752 flat angles P-C4'-P energy: -58.024 tors. eta vs tors. theta energy: -45.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -622.967024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.967024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.967024 (E_RNA) where: Base-Base interactions energy: -26.052 where: short stacking energy: -26.052 Base-Backbone interact. energy: -0.000 local terms energy: -596.914534 where: bonds (distance) C4'-P energy: -149.052 bonds (distance) P-C4' energy: -137.467 flat angles C4'-P-C4' energy: -111.879 flat angles P-C4'-P energy: -128.588 tors. eta vs tors. theta energy: -69.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -628.125993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.125993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.125993 (E_RNA) where: Base-Base interactions energy: -50.380 where: short stacking energy: -50.380 Base-Backbone interact. energy: -0.000 local terms energy: -577.745430 where: bonds (distance) C4'-P energy: -135.330 bonds (distance) P-C4' energy: -129.212 flat angles C4'-P-C4' energy: -114.701 flat angles P-C4'-P energy: -124.827 tors. eta vs tors. theta energy: -73.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -626.733728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.733728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.733728 (E_RNA) where: Base-Base interactions energy: -29.213 where: short stacking energy: -29.213 Base-Backbone interact. energy: -0.000 local terms energy: -597.520900 where: bonds (distance) C4'-P energy: -148.198 bonds (distance) P-C4' energy: -137.964 flat angles C4'-P-C4' energy: -112.510 flat angles P-C4'-P energy: -129.032 tors. eta vs tors. theta energy: -69.817 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -637.617495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -637.617495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.617495 (E_RNA) where: Base-Base interactions energy: -73.242 where: short stacking energy: -73.242 Base-Backbone interact. energy: -0.000 local terms energy: -564.374894 where: bonds (distance) C4'-P energy: -131.163 bonds (distance) P-C4' energy: -119.157 flat angles C4'-P-C4' energy: -115.019 flat angles P-C4'-P energy: -124.801 tors. eta vs tors. theta energy: -74.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -626.643524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.643524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.643524 (E_RNA) where: Base-Base interactions energy: -29.277 where: short stacking energy: -29.277 Base-Backbone interact. energy: -0.000 local terms energy: -597.366207 where: bonds (distance) C4'-P energy: -147.975 bonds (distance) P-C4' energy: -137.957 flat angles C4'-P-C4' energy: -112.457 flat angles P-C4'-P energy: -128.939 tors. eta vs tors. theta energy: -70.038 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -626.643594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.643594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.643594 (E_RNA) where: Base-Base interactions energy: -29.277 where: short stacking energy: -29.277 Base-Backbone interact. energy: -0.000 local terms energy: -597.366207 where: bonds (distance) C4'-P energy: -147.975 bonds (distance) P-C4' energy: -137.957 flat angles C4'-P-C4' energy: -112.457 flat angles P-C4'-P energy: -128.939 tors. eta vs tors. theta energy: -70.038 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -622.373159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.373159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.373159 (E_RNA) where: Base-Base interactions energy: -23.457 where: short stacking energy: -23.457 Base-Backbone interact. energy: -0.000 local terms energy: -598.916110 where: bonds (distance) C4'-P energy: -149.507 bonds (distance) P-C4' energy: -138.664 flat angles C4'-P-C4' energy: -112.486 flat angles P-C4'-P energy: -129.304 tors. eta vs tors. theta energy: -68.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -806.394420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.394420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -806.394420 (E_RNA) where: Base-Base interactions energy: -376.047 where: short stacking energy: -368.969 Base-Backbone interact. energy: 1.314 local terms energy: -431.660748 where: bonds (distance) C4'-P energy: -84.631 bonds (distance) P-C4' energy: -97.131 flat angles C4'-P-C4' energy: -90.169 flat angles P-C4'-P energy: -71.608 tors. eta vs tors. theta energy: -88.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -789.988576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.988576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.988576 (E_RNA) where: Base-Base interactions energy: -365.853 where: short stacking energy: -338.856 Base-Backbone interact. energy: -1.116 local terms energy: -423.019193 where: bonds (distance) C4'-P energy: -99.053 bonds (distance) P-C4' energy: -89.291 flat angles C4'-P-C4' energy: -87.726 flat angles P-C4'-P energy: -69.903 tors. eta vs tors. theta energy: -77.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -681.683516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.683516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.683516 (E_RNA) where: Base-Base interactions energy: -289.511 where: short stacking energy: -272.165 Base-Backbone interact. energy: -2.259 local terms energy: -389.913445 where: bonds (distance) C4'-P energy: -86.195 bonds (distance) P-C4' energy: -94.008 flat angles C4'-P-C4' energy: -94.968 flat angles P-C4'-P energy: -56.695 tors. eta vs tors. theta energy: -58.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -633.514101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.514101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.514101 (E_RNA) where: Base-Base interactions energy: -262.210 where: short stacking energy: -217.602 Base-Backbone interact. energy: -1.052 local terms energy: -370.252452 where: bonds (distance) C4'-P energy: -104.210 bonds (distance) P-C4' energy: -88.656 flat angles C4'-P-C4' energy: -90.757 flat angles P-C4'-P energy: -47.125 tors. eta vs tors. theta energy: -39.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -570.766961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.766961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.766961 (E_RNA) where: Base-Base interactions energy: -235.053 where: short stacking energy: -230.275 Base-Backbone interact. energy: 1.954 local terms energy: -337.668055 where: bonds (distance) C4'-P energy: -66.539 bonds (distance) P-C4' energy: -91.442 flat angles C4'-P-C4' energy: -80.002 flat angles P-C4'-P energy: -54.209 tors. eta vs tors. theta energy: -45.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -555.128966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.128966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.128966 (E_RNA) where: Base-Base interactions energy: -216.758 where: short stacking energy: -198.836 Base-Backbone interact. energy: -1.365 local terms energy: -337.005675 where: bonds (distance) C4'-P energy: -87.830 bonds (distance) P-C4' energy: -74.880 flat angles C4'-P-C4' energy: -82.487 flat angles P-C4'-P energy: -52.738 tors. eta vs tors. theta energy: -39.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -529.439963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.439963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.439963 (E_RNA) where: Base-Base interactions energy: -189.751 where: short stacking energy: -140.044 Base-Backbone interact. energy: -0.642 local terms energy: -339.046895 where: bonds (distance) C4'-P energy: -80.481 bonds (distance) P-C4' energy: -95.053 flat angles C4'-P-C4' energy: -89.833 flat angles P-C4'-P energy: -53.713 tors. eta vs tors. theta energy: -19.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -494.039359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.039359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.039359 (E_RNA) where: Base-Base interactions energy: -193.619 where: short stacking energy: -128.837 Base-Backbone interact. energy: -1.451 local terms energy: -298.968991 where: bonds (distance) C4'-P energy: -86.713 bonds (distance) P-C4' energy: -99.909 flat angles C4'-P-C4' energy: -72.294 flat angles P-C4'-P energy: -39.581 tors. eta vs tors. theta energy: -0.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -427.628400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.628400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.628400 (E_RNA) where: Base-Base interactions energy: -162.525 where: short stacking energy: -141.587 Base-Backbone interact. energy: -1.586 local terms energy: -263.517710 where: bonds (distance) C4'-P energy: -61.408 bonds (distance) P-C4' energy: -77.822 flat angles C4'-P-C4' energy: -70.752 flat angles P-C4'-P energy: -49.961 tors. eta vs tors. theta energy: -3.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -384.021721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.021721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.021721 (E_RNA) where: Base-Base interactions energy: -158.839 where: short stacking energy: -112.701 Base-Backbone interact. energy: -5.325 local terms energy: -219.857191 where: bonds (distance) C4'-P energy: -77.947 bonds (distance) P-C4' energy: -78.404 flat angles C4'-P-C4' energy: -45.178 flat angles P-C4'-P energy: -44.177 tors. eta vs tors. theta energy: 25.848 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -862.878118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.878118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -862.878118 (E_RNA) where: Base-Base interactions energy: -412.380 where: short stacking energy: -333.348 Base-Backbone interact. energy: 0.622 local terms energy: -451.121005 where: bonds (distance) C4'-P energy: -87.365 bonds (distance) P-C4' energy: -103.976 flat angles C4'-P-C4' energy: -100.679 flat angles P-C4'-P energy: -83.072 tors. eta vs tors. theta energy: -76.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -827.035594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.035594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -827.035594 (E_RNA) where: Base-Base interactions energy: -412.613 where: short stacking energy: -301.173 Base-Backbone interact. energy: -0.952 local terms energy: -413.470947 where: bonds (distance) C4'-P energy: -99.098 bonds (distance) P-C4' energy: -93.338 flat angles C4'-P-C4' energy: -96.128 flat angles P-C4'-P energy: -56.251 tors. eta vs tors. theta energy: -68.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -739.669546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -739.669546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.669546 (E_RNA) where: Base-Base interactions energy: -358.932 where: short stacking energy: -276.825 Base-Backbone interact. energy: 1.302 local terms energy: -382.039962 where: bonds (distance) C4'-P energy: -91.697 bonds (distance) P-C4' energy: -80.252 flat angles C4'-P-C4' energy: -92.270 flat angles P-C4'-P energy: -66.954 tors. eta vs tors. theta energy: -50.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -649.316773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.316773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.316773 (E_RNA) where: Base-Base interactions energy: -291.529 where: short stacking energy: -227.027 Base-Backbone interact. energy: 0.881 local terms energy: -358.669027 where: bonds (distance) C4'-P energy: -76.804 bonds (distance) P-C4' energy: -99.370 flat angles C4'-P-C4' energy: -97.817 flat angles P-C4'-P energy: -57.983 tors. eta vs tors. theta energy: -26.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -597.082319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.082319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.082319 (E_RNA) where: Base-Base interactions energy: -232.550 where: short stacking energy: -211.595 Base-Backbone interact. energy: -2.466 local terms energy: -362.066663 where: bonds (distance) C4'-P energy: -89.577 bonds (distance) P-C4' energy: -99.897 flat angles C4'-P-C4' energy: -80.551 flat angles P-C4'-P energy: -52.960 tors. eta vs tors. theta energy: -39.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -501.134773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.134773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.134773 (E_RNA) where: Base-Base interactions energy: -187.790 where: short stacking energy: -144.345 Base-Backbone interact. energy: -0.126 local terms energy: -313.218918 where: bonds (distance) C4'-P energy: -71.870 bonds (distance) P-C4' energy: -95.222 flat angles C4'-P-C4' energy: -86.271 flat angles P-C4'-P energy: -54.329 tors. eta vs tors. theta energy: -5.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -501.757741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.757741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.757741 (E_RNA) where: Base-Base interactions energy: -193.227 where: short stacking energy: -151.502 Base-Backbone interact. energy: -0.540 local terms energy: -307.991393 where: bonds (distance) C4'-P energy: -88.138 bonds (distance) P-C4' energy: -78.001 flat angles C4'-P-C4' energy: -92.579 flat angles P-C4'-P energy: -47.379 tors. eta vs tors. theta energy: -1.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -497.359948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.359948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.359948 (E_RNA) where: Base-Base interactions energy: -213.504 where: short stacking energy: -180.268 Base-Backbone interact. energy: -1.654 local terms energy: -282.202914 where: bonds (distance) C4'-P energy: -75.237 bonds (distance) P-C4' energy: -84.525 flat angles C4'-P-C4' energy: -73.073 flat angles P-C4'-P energy: -38.047 tors. eta vs tors. theta energy: -11.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -480.467543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.467543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.467543 (E_RNA) where: Base-Base interactions energy: -220.856 where: short stacking energy: -140.851 Base-Backbone interact. energy: 5.265 local terms energy: -264.876829 where: bonds (distance) C4'-P energy: -62.461 bonds (distance) P-C4' energy: -85.324 flat angles C4'-P-C4' energy: -66.891 flat angles P-C4'-P energy: -62.117 tors. eta vs tors. theta energy: 11.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -423.171784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.171784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.171784 (E_RNA) where: Base-Base interactions energy: -178.292 where: short stacking energy: -148.662 Base-Backbone interact. energy: -1.248 local terms energy: -243.631225 where: bonds (distance) C4'-P energy: -66.376 bonds (distance) P-C4' energy: -92.612 flat angles C4'-P-C4' energy: -64.592 flat angles P-C4'-P energy: -32.035 tors. eta vs tors. theta energy: 11.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -877.079235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.079235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -877.079235 (E_RNA) where: Base-Base interactions energy: -428.810 where: short stacking energy: -347.046 Base-Backbone interact. energy: -1.686 local terms energy: -446.583298 where: bonds (distance) C4'-P energy: -91.192 bonds (distance) P-C4' energy: -101.887 flat angles C4'-P-C4' energy: -104.742 flat angles P-C4'-P energy: -64.020 tors. eta vs tors. theta energy: -84.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -889.156255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.156255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.156255 (E_RNA) where: Base-Base interactions energy: -450.721 where: short stacking energy: -331.246 Base-Backbone interact. energy: -2.100 local terms energy: -436.334639 where: bonds (distance) C4'-P energy: -96.310 bonds (distance) P-C4' energy: -102.090 flat angles C4'-P-C4' energy: -92.734 flat angles P-C4'-P energy: -64.480 tors. eta vs tors. theta energy: -80.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -756.736314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.736314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.736314 (E_RNA) where: Base-Base interactions energy: -363.668 where: short stacking energy: -268.874 Base-Backbone interact. energy: -0.099 local terms energy: -392.968993 where: bonds (distance) C4'-P energy: -92.127 bonds (distance) P-C4' energy: -91.588 flat angles C4'-P-C4' energy: -91.551 flat angles P-C4'-P energy: -55.231 tors. eta vs tors. theta energy: -62.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -643.927377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.927377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.927377 (E_RNA) where: Base-Base interactions energy: -263.790 where: short stacking energy: -225.463 Base-Backbone interact. energy: 0.907 local terms energy: -381.044592 where: bonds (distance) C4'-P energy: -75.978 bonds (distance) P-C4' energy: -99.387 flat angles C4'-P-C4' energy: -95.290 flat angles P-C4'-P energy: -66.988 tors. eta vs tors. theta energy: -43.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -621.557173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.557173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.557173 (E_RNA) where: Base-Base interactions energy: -272.186 where: short stacking energy: -208.980 Base-Backbone interact. energy: 0.291 local terms energy: -349.662260 where: bonds (distance) C4'-P energy: -84.123 bonds (distance) P-C4' energy: -93.392 flat angles C4'-P-C4' energy: -89.201 flat angles P-C4'-P energy: -51.616 tors. eta vs tors. theta energy: -31.330 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -552.020489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.020489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.020489 (E_RNA) where: Base-Base interactions energy: -245.464 where: short stacking energy: -154.987 Base-Backbone interact. energy: -2.523 local terms energy: -304.032955 where: bonds (distance) C4'-P energy: -78.730 bonds (distance) P-C4' energy: -93.006 flat angles C4'-P-C4' energy: -89.590 flat angles P-C4'-P energy: -42.110 tors. eta vs tors. theta energy: -0.597 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -537.813283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.813283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.813283 (E_RNA) where: Base-Base interactions energy: -234.501 where: short stacking energy: -200.680 Base-Backbone interact. energy: 3.544 local terms energy: -306.856100 where: bonds (distance) C4'-P energy: -79.796 bonds (distance) P-C4' energy: -87.808 flat angles C4'-P-C4' energy: -72.025 flat angles P-C4'-P energy: -38.970 tors. eta vs tors. theta energy: -28.257 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -533.758576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.758576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.758576 (E_RNA) where: Base-Base interactions energy: -251.942 where: short stacking energy: -177.527 Base-Backbone interact. energy: 1.168 local terms energy: -282.985046 where: bonds (distance) C4'-P energy: -77.200 bonds (distance) P-C4' energy: -83.675 flat angles C4'-P-C4' energy: -64.199 flat angles P-C4'-P energy: -42.991 tors. eta vs tors. theta energy: -14.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -471.341428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.341428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.341428 (E_RNA) where: Base-Base interactions energy: -201.670 where: short stacking energy: -154.374 Base-Backbone interact. energy: -1.418 local terms energy: -268.252734 where: bonds (distance) C4'-P energy: -80.325 bonds (distance) P-C4' energy: -78.394 flat angles C4'-P-C4' energy: -62.915 flat angles P-C4'-P energy: -54.271 tors. eta vs tors. theta energy: 7.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -374.376536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.376536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.376536 (E_RNA) where: Base-Base interactions energy: -109.391 where: short stacking energy: -107.691 Base-Backbone interact. energy: 9.590 local terms energy: -274.575656 where: bonds (distance) C4'-P energy: -74.715 bonds (distance) P-C4' energy: -91.691 flat angles C4'-P-C4' energy: -69.095 flat angles P-C4'-P energy: -44.893 tors. eta vs tors. theta energy: 5.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -911.276409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -911.276409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.276409 (E_RNA) where: Base-Base interactions energy: -476.555 where: short stacking energy: -359.794 Base-Backbone interact. energy: -2.055 local terms energy: -432.666448 where: bonds (distance) C4'-P energy: -96.492 bonds (distance) P-C4' energy: -102.423 flat angles C4'-P-C4' energy: -94.281 flat angles P-C4'-P energy: -64.213 tors. eta vs tors. theta energy: -75.257 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -893.364322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.364322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -893.364322 (E_RNA) where: Base-Base interactions energy: -478.594 where: short stacking energy: -328.836 Base-Backbone interact. energy: -0.644 local terms energy: -414.125777 where: bonds (distance) C4'-P energy: -90.294 bonds (distance) P-C4' energy: -98.017 flat angles C4'-P-C4' energy: -89.057 flat angles P-C4'-P energy: -72.853 tors. eta vs tors. theta energy: -63.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -833.713063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.713063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.713063 (E_RNA) where: Base-Base interactions energy: -416.954 where: short stacking energy: -264.614 Base-Backbone interact. energy: 0.432 local terms energy: -417.191218 where: bonds (distance) C4'-P energy: -98.667 bonds (distance) P-C4' energy: -94.104 flat angles C4'-P-C4' energy: -106.141 flat angles P-C4'-P energy: -54.312 tors. eta vs tors. theta energy: -63.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -629.552927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.552927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.552927 (E_RNA) where: Base-Base interactions energy: -286.966 where: short stacking energy: -212.562 Base-Backbone interact. energy: -3.208 local terms energy: -339.378859 where: bonds (distance) C4'-P energy: -85.584 bonds (distance) P-C4' energy: -97.115 flat angles C4'-P-C4' energy: -78.520 flat angles P-C4'-P energy: -50.215 tors. eta vs tors. theta energy: -27.944 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -680.482235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.482235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.482235 (E_RNA) where: Base-Base interactions energy: -349.842 where: short stacking energy: -230.442 Base-Backbone interact. energy: 0.463 local terms energy: -331.103477 where: bonds (distance) C4'-P energy: -82.899 bonds (distance) P-C4' energy: -98.762 flat angles C4'-P-C4' energy: -67.110 flat angles P-C4'-P energy: -46.027 tors. eta vs tors. theta energy: -36.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -621.357240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.357240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.357240 (E_RNA) where: Base-Base interactions energy: -293.298 where: short stacking energy: -181.866 Base-Backbone interact. energy: -0.039 local terms energy: -328.020013 where: bonds (distance) C4'-P energy: -91.402 bonds (distance) P-C4' energy: -80.346 flat angles C4'-P-C4' energy: -69.679 flat angles P-C4'-P energy: -56.519 tors. eta vs tors. theta energy: -30.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -595.928655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.928655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.928655 (E_RNA) where: Base-Base interactions energy: -289.598 where: short stacking energy: -201.468 Base-Backbone interact. energy: 3.053 local terms energy: -309.383523 where: bonds (distance) C4'-P energy: -79.123 bonds (distance) P-C4' energy: -79.710 flat angles C4'-P-C4' energy: -84.622 flat angles P-C4'-P energy: -46.680 tors. eta vs tors. theta energy: -19.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -520.889281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.889281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.889281 (E_RNA) where: Base-Base interactions energy: -217.857 where: short stacking energy: -153.954 Base-Backbone interact. energy: -1.924 local terms energy: -301.107493 where: bonds (distance) C4'-P energy: -90.197 bonds (distance) P-C4' energy: -80.712 flat angles C4'-P-C4' energy: -89.007 flat angles P-C4'-P energy: -30.650 tors. eta vs tors. theta energy: -10.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -449.946418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.946418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.946418 (E_RNA) where: Base-Base interactions energy: -179.635 where: short stacking energy: -120.032 Base-Backbone interact. energy: -0.370 local terms energy: -269.941524 where: bonds (distance) C4'-P energy: -78.008 bonds (distance) P-C4' energy: -75.511 flat angles C4'-P-C4' energy: -82.267 flat angles P-C4'-P energy: -38.995 tors. eta vs tors. theta energy: 4.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -363.198030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.198030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.198030 (E_RNA) where: Base-Base interactions energy: -131.702 where: short stacking energy: -108.087 Base-Backbone interact. energy: -0.075 local terms energy: -231.421274 where: bonds (distance) C4'-P energy: -72.699 bonds (distance) P-C4' energy: -88.702 flat angles C4'-P-C4' energy: -64.770 flat angles P-C4'-P energy: -39.559 tors. eta vs tors. theta energy: 34.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -952.628584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -952.628584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.628584 (E_RNA) where: Base-Base interactions energy: -506.811 where: short stacking energy: -325.013 Base-Backbone interact. energy: -2.100 local terms energy: -443.718127 where: bonds (distance) C4'-P energy: -101.125 bonds (distance) P-C4' energy: -105.223 flat angles C4'-P-C4' energy: -94.397 flat angles P-C4'-P energy: -64.803 tors. eta vs tors. theta energy: -78.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -884.556809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.556809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -884.556809 (E_RNA) where: Base-Base interactions energy: -461.150 where: short stacking energy: -312.804 Base-Backbone interact. energy: -0.405 local terms energy: -423.001607 where: bonds (distance) C4'-P energy: -100.874 bonds (distance) P-C4' energy: -103.427 flat angles C4'-P-C4' energy: -93.319 flat angles P-C4'-P energy: -58.805 tors. eta vs tors. theta energy: -66.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -846.760058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.760058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -846.760058 (E_RNA) where: Base-Base interactions energy: -453.868 where: short stacking energy: -293.854 Base-Backbone interact. energy: -0.993 local terms energy: -391.899339 where: bonds (distance) C4'-P energy: -83.177 bonds (distance) P-C4' energy: -97.703 flat angles C4'-P-C4' energy: -88.190 flat angles P-C4'-P energy: -62.004 tors. eta vs tors. theta energy: -60.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -920.394356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.394356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -920.394356 (E_RNA) where: Base-Base interactions energy: -525.716 where: short stacking energy: -287.353 Base-Backbone interact. energy: 1.989 local terms energy: -396.667571 where: bonds (distance) C4'-P energy: -87.706 bonds (distance) P-C4' energy: -92.462 flat angles C4'-P-C4' energy: -87.724 flat angles P-C4'-P energy: -59.657 tors. eta vs tors. theta energy: -69.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -596.517979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.517979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.517979 (E_RNA) where: Base-Base interactions energy: -242.111 where: short stacking energy: -193.523 Base-Backbone interact. energy: -1.697 local terms energy: -352.710042 where: bonds (distance) C4'-P energy: -93.941 bonds (distance) P-C4' energy: -98.660 flat angles C4'-P-C4' energy: -83.887 flat angles P-C4'-P energy: -46.463 tors. eta vs tors. theta energy: -29.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -598.196407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.196407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.196407 (E_RNA) where: Base-Base interactions energy: -247.098 where: short stacking energy: -198.044 Base-Backbone interact. energy: -0.941 local terms energy: -350.157623 where: bonds (distance) C4'-P energy: -82.357 bonds (distance) P-C4' energy: -94.840 flat angles C4'-P-C4' energy: -85.641 flat angles P-C4'-P energy: -58.287 tors. eta vs tors. theta energy: -29.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -608.895843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.895843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.895843 (E_RNA) where: Base-Base interactions energy: -298.138 where: short stacking energy: -173.629 Base-Backbone interact. energy: 1.570 local terms energy: -312.327280 where: bonds (distance) C4'-P energy: -89.262 bonds (distance) P-C4' energy: -90.628 flat angles C4'-P-C4' energy: -61.787 flat angles P-C4'-P energy: -46.464 tors. eta vs tors. theta energy: -24.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -524.690311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.690311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.690311 (E_RNA) where: Base-Base interactions energy: -236.346 where: short stacking energy: -147.402 Base-Backbone interact. energy: -2.845 local terms energy: -285.499233 where: bonds (distance) C4'-P energy: -76.139 bonds (distance) P-C4' energy: -91.970 flat angles C4'-P-C4' energy: -51.906 flat angles P-C4'-P energy: -59.904 tors. eta vs tors. theta energy: -5.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -414.951422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.951422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.951422 (E_RNA) where: Base-Base interactions energy: -165.087 where: short stacking energy: -111.359 Base-Backbone interact. energy: -2.543 local terms energy: -247.321368 where: bonds (distance) C4'-P energy: -71.837 bonds (distance) P-C4' energy: -88.237 flat angles C4'-P-C4' energy: -74.273 flat angles P-C4'-P energy: -29.284 tors. eta vs tors. theta energy: 16.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -385.723899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.723899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.723899 (E_RNA) where: Base-Base interactions energy: -147.824 where: short stacking energy: -101.963 Base-Backbone interact. energy: -0.410 local terms energy: -237.489668 where: bonds (distance) C4'-P energy: -57.567 bonds (distance) P-C4' energy: -72.590 flat angles C4'-P-C4' energy: -71.403 flat angles P-C4'-P energy: -47.021 tors. eta vs tors. theta energy: 11.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -986.415656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -986.415656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -986.415656 (E_RNA) where: Base-Base interactions energy: -560.981 where: short stacking energy: -334.574 Base-Backbone interact. energy: -1.122 local terms energy: -424.311857 where: bonds (distance) C4'-P energy: -93.390 bonds (distance) P-C4' energy: -94.125 flat angles C4'-P-C4' energy: -92.099 flat angles P-C4'-P energy: -62.256 tors. eta vs tors. theta energy: -82.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -955.619714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -955.619714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.619714 (E_RNA) where: Base-Base interactions energy: -526.468 where: short stacking energy: -348.462 Base-Backbone interact. energy: 0.091 local terms energy: -429.242691 where: bonds (distance) C4'-P energy: -95.936 bonds (distance) P-C4' energy: -105.997 flat angles C4'-P-C4' energy: -84.313 flat angles P-C4'-P energy: -60.013 tors. eta vs tors. theta energy: -82.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -976.159357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -976.159357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -976.159357 (E_RNA) where: Base-Base interactions energy: -576.112 where: short stacking energy: -310.035 Base-Backbone interact. energy: 0.069 local terms energy: -400.116768 where: bonds (distance) C4'-P energy: -95.947 bonds (distance) P-C4' energy: -85.763 flat angles C4'-P-C4' energy: -97.553 flat angles P-C4'-P energy: -57.926 tors. eta vs tors. theta energy: -62.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -817.007056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -817.007056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -817.007056 (E_RNA) where: Base-Base interactions energy: -440.100 where: short stacking energy: -258.728 Base-Backbone interact. energy: 0.388 local terms energy: -377.295398 where: bonds (distance) C4'-P energy: -72.646 bonds (distance) P-C4' energy: -101.183 flat angles C4'-P-C4' energy: -88.044 flat angles P-C4'-P energy: -54.220 tors. eta vs tors. theta energy: -61.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -638.638879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.638879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.638879 (E_RNA) where: Base-Base interactions energy: -297.122 where: short stacking energy: -196.453 Base-Backbone interact. energy: 5.809 local terms energy: -347.325970 where: bonds (distance) C4'-P energy: -83.549 bonds (distance) P-C4' energy: -92.281 flat angles C4'-P-C4' energy: -94.843 flat angles P-C4'-P energy: -53.664 tors. eta vs tors. theta energy: -22.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -545.947928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.947928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.947928 (E_RNA) where: Base-Base interactions energy: -236.054 where: short stacking energy: -169.207 Base-Backbone interact. energy: -0.432 local terms energy: -309.461877 where: bonds (distance) C4'-P energy: -90.107 bonds (distance) P-C4' energy: -97.125 flat angles C4'-P-C4' energy: -77.302 flat angles P-C4'-P energy: -45.647 tors. eta vs tors. theta energy: 0.719 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -700.242147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.242147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.242147 (E_RNA) where: Base-Base interactions energy: -395.139 where: short stacking energy: -194.757 Base-Backbone interact. energy: 0.531 local terms energy: -305.634415 where: bonds (distance) C4'-P energy: -84.071 bonds (distance) P-C4' energy: -86.324 flat angles C4'-P-C4' energy: -65.195 flat angles P-C4'-P energy: -42.555 tors. eta vs tors. theta energy: -27.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -542.735786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.735786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.735786 (E_RNA) where: Base-Base interactions energy: -236.670 where: short stacking energy: -146.952 Base-Backbone interact. energy: -1.424 local terms energy: -304.642081 where: bonds (distance) C4'-P energy: -81.852 bonds (distance) P-C4' energy: -94.082 flat angles C4'-P-C4' energy: -87.049 flat angles P-C4'-P energy: -24.681 tors. eta vs tors. theta energy: -16.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -422.798389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.798389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.798389 (E_RNA) where: Base-Base interactions energy: -147.540 where: short stacking energy: -123.349 Base-Backbone interact. energy: 3.370 local terms energy: -278.627887 where: bonds (distance) C4'-P energy: -88.256 bonds (distance) P-C4' energy: -77.859 flat angles C4'-P-C4' energy: -70.981 flat angles P-C4'-P energy: -47.914 tors. eta vs tors. theta energy: 6.383 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -389.400605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.400605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.400605 (E_RNA) where: Base-Base interactions energy: -132.344 where: short stacking energy: -127.228 Base-Backbone interact. energy: -2.431 local terms energy: -254.625290 where: bonds (distance) C4'-P energy: -77.116 bonds (distance) P-C4' energy: -72.321 flat angles C4'-P-C4' energy: -65.039 flat angles P-C4'-P energy: -41.546 tors. eta vs tors. theta energy: 1.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -994.846200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.846200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -994.846200 (E_RNA) where: Base-Base interactions energy: -540.530 where: short stacking energy: -341.186 Base-Backbone interact. energy: 1.660 local terms energy: -455.975748 where: bonds (distance) C4'-P energy: -98.286 bonds (distance) P-C4' energy: -104.983 flat angles C4'-P-C4' energy: -101.500 flat angles P-C4'-P energy: -50.744 tors. eta vs tors. theta energy: -100.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -979.933861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -979.933861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -979.933861 (E_RNA) where: Base-Base interactions energy: -550.191 where: short stacking energy: -329.675 Base-Backbone interact. energy: -3.205 local terms energy: -426.537352 where: bonds (distance) C4'-P energy: -98.456 bonds (distance) P-C4' energy: -94.405 flat angles C4'-P-C4' energy: -87.461 flat angles P-C4'-P energy: -58.646 tors. eta vs tors. theta energy: -87.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -971.648015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -971.648015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -971.648015 (E_RNA) where: Base-Base interactions energy: -587.841 where: short stacking energy: -306.688 Base-Backbone interact. energy: -0.293 local terms energy: -383.513817 where: bonds (distance) C4'-P energy: -98.089 bonds (distance) P-C4' energy: -82.042 flat angles C4'-P-C4' energy: -90.105 flat angles P-C4'-P energy: -59.953 tors. eta vs tors. theta energy: -53.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -824.353664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.353664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.353664 (E_RNA) where: Base-Base interactions energy: -424.272 where: short stacking energy: -277.516 Base-Backbone interact. energy: 1.053 local terms energy: -401.134757 where: bonds (distance) C4'-P energy: -91.123 bonds (distance) P-C4' energy: -96.900 flat angles C4'-P-C4' energy: -99.877 flat angles P-C4'-P energy: -50.691 tors. eta vs tors. theta energy: -62.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -652.590467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -652.590467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.590467 (E_RNA) where: Base-Base interactions energy: -310.583 where: short stacking energy: -227.789 Base-Backbone interact. energy: 0.553 local terms energy: -342.559933 where: bonds (distance) C4'-P energy: -82.265 bonds (distance) P-C4' energy: -84.238 flat angles C4'-P-C4' energy: -79.604 flat angles P-C4'-P energy: -59.247 tors. eta vs tors. theta energy: -37.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -779.765009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.765009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.765009 (E_RNA) where: Base-Base interactions energy: -422.988 where: short stacking energy: -229.832 Base-Backbone interact. energy: -1.579 local terms energy: -355.197856 where: bonds (distance) C4'-P energy: -94.170 bonds (distance) P-C4' energy: -84.304 flat angles C4'-P-C4' energy: -89.074 flat angles P-C4'-P energy: -53.413 tors. eta vs tors. theta energy: -34.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -524.315064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.315064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.315064 (E_RNA) where: Base-Base interactions energy: -217.194 where: short stacking energy: -201.470 Base-Backbone interact. energy: -1.797 local terms energy: -305.324023 where: bonds (distance) C4'-P energy: -78.266 bonds (distance) P-C4' energy: -79.753 flat angles C4'-P-C4' energy: -68.482 flat angles P-C4'-P energy: -48.728 tors. eta vs tors. theta energy: -30.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -556.397021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.397021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.397021 (E_RNA) where: Base-Base interactions energy: -251.027 where: short stacking energy: -183.100 Base-Backbone interact. energy: 2.573 local terms energy: -307.943412 where: bonds (distance) C4'-P energy: -71.325 bonds (distance) P-C4' energy: -90.894 flat angles C4'-P-C4' energy: -87.093 flat angles P-C4'-P energy: -43.458 tors. eta vs tors. theta energy: -15.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -420.652219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.652219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.652219 (E_RNA) where: Base-Base interactions energy: -180.279 where: short stacking energy: -154.993 Base-Backbone interact. energy: 1.611 local terms energy: -241.984376 where: bonds (distance) C4'-P energy: -81.048 bonds (distance) P-C4' energy: -76.088 flat angles C4'-P-C4' energy: -59.648 flat angles P-C4'-P energy: -35.182 tors. eta vs tors. theta energy: 9.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -372.630545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.630545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.630545 (E_RNA) where: Base-Base interactions energy: -129.702 where: short stacking energy: -91.389 Base-Backbone interact. energy: -3.568 local terms energy: -239.360782 where: bonds (distance) C4'-P energy: -80.655 bonds (distance) P-C4' energy: -74.387 flat angles C4'-P-C4' energy: -62.678 flat angles P-C4'-P energy: -36.707 tors. eta vs tors. theta energy: 15.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -996.481892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.481892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -996.481892 (E_RNA) where: Base-Base interactions energy: -564.435 where: short stacking energy: -341.778 Base-Backbone interact. energy: -1.873 local terms energy: -430.174521 where: bonds (distance) C4'-P energy: -95.497 bonds (distance) P-C4' energy: -94.346 flat angles C4'-P-C4' energy: -94.166 flat angles P-C4'-P energy: -51.094 tors. eta vs tors. theta energy: -95.071 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -963.368153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.368153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.368153 (E_RNA) where: Base-Base interactions energy: -537.080 where: short stacking energy: -350.870 Base-Backbone interact. energy: -1.018 local terms energy: -425.269592 where: bonds (distance) C4'-P energy: -91.019 bonds (distance) P-C4' energy: -98.654 flat angles C4'-P-C4' energy: -89.113 flat angles P-C4'-P energy: -70.451 tors. eta vs tors. theta energy: -76.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -1006.329312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.329312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1006.329312 (E_RNA) where: Base-Base interactions energy: -597.379 where: short stacking energy: -313.276 Base-Backbone interact. energy: -2.188 local terms energy: -406.763119 where: bonds (distance) C4'-P energy: -84.435 bonds (distance) P-C4' energy: -102.713 flat angles C4'-P-C4' energy: -99.836 flat angles P-C4'-P energy: -49.851 tors. eta vs tors. theta energy: -69.928 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -853.476959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.476959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.476959 (E_RNA) where: Base-Base interactions energy: -458.238 where: short stacking energy: -299.231 Base-Backbone interact. energy: -2.077 local terms energy: -393.161707 where: bonds (distance) C4'-P energy: -97.356 bonds (distance) P-C4' energy: -92.593 flat angles C4'-P-C4' energy: -83.715 flat angles P-C4'-P energy: -47.791 tors. eta vs tors. theta energy: -71.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -768.895309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.895309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.895309 (E_RNA) where: Base-Base interactions energy: -402.410 where: short stacking energy: -230.744 Base-Backbone interact. energy: 2.317 local terms energy: -368.802592 where: bonds (distance) C4'-P energy: -85.300 bonds (distance) P-C4' energy: -102.230 flat angles C4'-P-C4' energy: -84.511 flat angles P-C4'-P energy: -52.599 tors. eta vs tors. theta energy: -44.163 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -602.742145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.742145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.742145 (E_RNA) where: Base-Base interactions energy: -282.286 where: short stacking energy: -176.427 Base-Backbone interact. energy: -2.319 local terms energy: -318.137356 where: bonds (distance) C4'-P energy: -81.718 bonds (distance) P-C4' energy: -92.801 flat angles C4'-P-C4' energy: -81.827 flat angles P-C4'-P energy: -37.939 tors. eta vs tors. theta energy: -23.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -674.631140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.631140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.631140 (E_RNA) where: Base-Base interactions energy: -350.221 where: short stacking energy: -197.206 Base-Backbone interact. energy: -1.105 local terms energy: -323.305536 where: bonds (distance) C4'-P energy: -90.319 bonds (distance) P-C4' energy: -86.224 flat angles C4'-P-C4' energy: -67.395 flat angles P-C4'-P energy: -47.984 tors. eta vs tors. theta energy: -31.384 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -474.099468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.099468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.099468 (E_RNA) where: Base-Base interactions energy: -203.006 where: short stacking energy: -168.710 Base-Backbone interact. energy: 2.022 local terms energy: -273.115660 where: bonds (distance) C4'-P energy: -86.354 bonds (distance) P-C4' energy: -71.412 flat angles C4'-P-C4' energy: -66.776 flat angles P-C4'-P energy: -36.086 tors. eta vs tors. theta energy: -12.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -427.713272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.713272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.713272 (E_RNA) where: Base-Base interactions energy: -184.067 where: short stacking energy: -146.087 Base-Backbone interact. energy: 1.296 local terms energy: -244.942418 where: bonds (distance) C4'-P energy: -63.871 bonds (distance) P-C4' energy: -89.476 flat angles C4'-P-C4' energy: -65.368 flat angles P-C4'-P energy: -36.244 tors. eta vs tors. theta energy: 10.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -445.603567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.603567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.603567 (E_RNA) where: Base-Base interactions energy: -207.621 where: short stacking energy: -117.622 Base-Backbone interact. energy: -0.957 local terms energy: -237.025199 where: bonds (distance) C4'-P energy: -73.987 bonds (distance) P-C4' energy: -82.630 flat angles C4'-P-C4' energy: -68.112 flat angles P-C4'-P energy: -19.559 tors. eta vs tors. theta energy: 7.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -1023.307140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.307140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1023.307140 (E_RNA) where: Base-Base interactions energy: -567.422 where: short stacking energy: -348.202 Base-Backbone interact. energy: -1.983 local terms energy: -453.902354 where: bonds (distance) C4'-P energy: -91.010 bonds (distance) P-C4' energy: -108.480 flat angles C4'-P-C4' energy: -100.704 flat angles P-C4'-P energy: -65.589 tors. eta vs tors. theta energy: -88.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -1071.492928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1071.492928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1071.492928 (E_RNA) where: Base-Base interactions energy: -654.155 where: short stacking energy: -319.943 Base-Backbone interact. energy: -3.230 local terms energy: -414.108286 where: bonds (distance) C4'-P energy: -84.069 bonds (distance) P-C4' energy: -99.867 flat angles C4'-P-C4' energy: -96.502 flat angles P-C4'-P energy: -59.093 tors. eta vs tors. theta energy: -74.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -918.432416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -918.432416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -918.432416 (E_RNA) where: Base-Base interactions energy: -513.046 where: short stacking energy: -309.743 Base-Backbone interact. energy: -1.917 local terms energy: -403.469205 where: bonds (distance) C4'-P energy: -76.912 bonds (distance) P-C4' energy: -97.598 flat angles C4'-P-C4' energy: -100.729 flat angles P-C4'-P energy: -59.012 tors. eta vs tors. theta energy: -69.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -854.320115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -854.320115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -854.320115 (E_RNA) where: Base-Base interactions energy: -458.409 where: short stacking energy: -301.213 Base-Backbone interact. energy: -0.391 local terms energy: -395.520757 where: bonds (distance) C4'-P energy: -87.298 bonds (distance) P-C4' energy: -92.561 flat angles C4'-P-C4' energy: -91.081 flat angles P-C4'-P energy: -62.904 tors. eta vs tors. theta energy: -61.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -862.300943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.300943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -862.300943 (E_RNA) where: Base-Base interactions energy: -491.667 where: short stacking energy: -256.618 Base-Backbone interact. energy: -1.416 local terms energy: -369.217806 where: bonds (distance) C4'-P energy: -93.228 bonds (distance) P-C4' energy: -97.102 flat angles C4'-P-C4' energy: -95.831 flat angles P-C4'-P energy: -46.230 tors. eta vs tors. theta energy: -36.827 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -742.716013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.716013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -742.716013 (E_RNA) where: Base-Base interactions energy: -397.430 where: short stacking energy: -242.910 Base-Backbone interact. energy: 0.103 local terms energy: -345.388755 where: bonds (distance) C4'-P energy: -88.127 bonds (distance) P-C4' energy: -87.034 flat angles C4'-P-C4' energy: -81.897 flat angles P-C4'-P energy: -46.713 tors. eta vs tors. theta energy: -41.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -530.201973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.201973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.201973 (E_RNA) where: Base-Base interactions energy: -210.044 where: short stacking energy: -165.693 Base-Backbone interact. energy: 1.330 local terms energy: -321.487956 where: bonds (distance) C4'-P energy: -84.167 bonds (distance) P-C4' energy: -94.734 flat angles C4'-P-C4' energy: -76.953 flat angles P-C4'-P energy: -54.859 tors. eta vs tors. theta energy: -10.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -479.252774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.252774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.252774 (E_RNA) where: Base-Base interactions energy: -207.467 where: short stacking energy: -137.076 Base-Backbone interact. energy: -0.019 local terms energy: -271.766854 where: bonds (distance) C4'-P energy: -75.208 bonds (distance) P-C4' energy: -88.537 flat angles C4'-P-C4' energy: -76.945 flat angles P-C4'-P energy: -40.207 tors. eta vs tors. theta energy: 9.129 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -418.312460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.312460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.312460 (E_RNA) where: Base-Base interactions energy: -170.015 where: short stacking energy: -142.862 Base-Backbone interact. energy: -1.864 local terms energy: -246.434219 where: bonds (distance) C4'-P energy: -67.341 bonds (distance) P-C4' energy: -73.459 flat angles C4'-P-C4' energy: -76.232 flat angles P-C4'-P energy: -40.843 tors. eta vs tors. theta energy: 11.442 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -432.985544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.985544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.985544 (E_RNA) where: Base-Base interactions energy: -185.496 where: short stacking energy: -115.570 Base-Backbone interact. energy: 4.990 local terms energy: -252.479753 where: bonds (distance) C4'-P energy: -76.854 bonds (distance) P-C4' energy: -75.207 flat angles C4'-P-C4' energy: -72.617 flat angles P-C4'-P energy: -35.191 tors. eta vs tors. theta energy: 7.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -1158.601852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1158.601852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1158.601852 (E_RNA) where: Base-Base interactions energy: -697.028 where: short stacking energy: -370.535 Base-Backbone interact. energy: -0.345 local terms energy: -461.228611 where: bonds (distance) C4'-P energy: -89.883 bonds (distance) P-C4' energy: -100.565 flat angles C4'-P-C4' energy: -109.565 flat angles P-C4'-P energy: -65.693 tors. eta vs tors. theta energy: -95.523 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -1000.821426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1000.821426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.821426 (E_RNA) where: Base-Base interactions energy: -555.903 where: short stacking energy: -340.968 Base-Backbone interact. energy: -6.371 local terms energy: -438.547338 where: bonds (distance) C4'-P energy: -89.426 bonds (distance) P-C4' energy: -98.495 flat angles C4'-P-C4' energy: -104.813 flat angles P-C4'-P energy: -61.708 tors. eta vs tors. theta energy: -84.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -925.165947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -925.165947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -925.165947 (E_RNA) where: Base-Base interactions energy: -508.915 where: short stacking energy: -317.789 Base-Backbone interact. energy: 0.208 local terms energy: -416.458282 where: bonds (distance) C4'-P energy: -89.130 bonds (distance) P-C4' energy: -91.634 flat angles C4'-P-C4' energy: -95.005 flat angles P-C4'-P energy: -61.877 tors. eta vs tors. theta energy: -78.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -877.599793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.599793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -877.599793 (E_RNA) where: Base-Base interactions energy: -483.841 where: short stacking energy: -299.372 Base-Backbone interact. energy: -1.571 local terms energy: -392.188047 where: bonds (distance) C4'-P energy: -99.755 bonds (distance) P-C4' energy: -88.302 flat angles C4'-P-C4' energy: -81.880 flat angles P-C4'-P energy: -59.205 tors. eta vs tors. theta energy: -63.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -927.602361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.602361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.602361 (E_RNA) where: Base-Base interactions energy: -564.900 where: short stacking energy: -291.433 Base-Backbone interact. energy: -3.376 local terms energy: -359.326032 where: bonds (distance) C4'-P energy: -86.519 bonds (distance) P-C4' energy: -81.303 flat angles C4'-P-C4' energy: -86.451 flat angles P-C4'-P energy: -38.880 tors. eta vs tors. theta energy: -66.174 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -711.777993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.777993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.777993 (E_RNA) where: Base-Base interactions energy: -396.382 where: short stacking energy: -212.163 Base-Backbone interact. energy: -3.041 local terms energy: -312.354764 where: bonds (distance) C4'-P energy: -80.938 bonds (distance) P-C4' energy: -94.571 flat angles C4'-P-C4' energy: -67.178 flat angles P-C4'-P energy: -46.268 tors. eta vs tors. theta energy: -23.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -507.093040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.093040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.093040 (E_RNA) where: Base-Base interactions energy: -192.532 where: short stacking energy: -144.725 Base-Backbone interact. energy: 3.332 local terms energy: -317.893397 where: bonds (distance) C4'-P energy: -81.706 bonds (distance) P-C4' energy: -85.132 flat angles C4'-P-C4' energy: -85.655 flat angles P-C4'-P energy: -54.738 tors. eta vs tors. theta energy: -10.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -497.956046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.956046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.956046 (E_RNA) where: Base-Base interactions energy: -226.085 where: short stacking energy: -153.955 Base-Backbone interact. energy: 4.042 local terms energy: -275.913765 where: bonds (distance) C4'-P energy: -87.314 bonds (distance) P-C4' energy: -80.809 flat angles C4'-P-C4' energy: -55.388 flat angles P-C4'-P energy: -52.753 tors. eta vs tors. theta energy: 0.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -478.842974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.842974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.842974 (E_RNA) where: Base-Base interactions energy: -208.950 where: short stacking energy: -130.874 Base-Backbone interact. energy: 1.271 local terms energy: -271.164330 where: bonds (distance) C4'-P energy: -84.315 bonds (distance) P-C4' energy: -78.377 flat angles C4'-P-C4' energy: -73.429 flat angles P-C4'-P energy: -56.363 tors. eta vs tors. theta energy: 21.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -371.698781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.698781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.698781 (E_RNA) where: Base-Base interactions energy: -131.199 where: short stacking energy: -100.864 Base-Backbone interact. energy: -1.983 local terms energy: -238.516785 where: bonds (distance) C4'-P energy: -88.406 bonds (distance) P-C4' energy: -60.198 flat angles C4'-P-C4' energy: -75.727 flat angles P-C4'-P energy: -26.261 tors. eta vs tors. theta energy: 12.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -1164.439345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1164.439345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1164.439345 (E_RNA) where: Base-Base interactions energy: -727.798 where: short stacking energy: -369.085 Base-Backbone interact. energy: -0.551 local terms energy: -436.089734 where: bonds (distance) C4'-P energy: -95.468 bonds (distance) P-C4' energy: -94.231 flat angles C4'-P-C4' energy: -97.705 flat angles P-C4'-P energy: -53.181 tors. eta vs tors. theta energy: -95.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -1030.407823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1030.407823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1030.407823 (E_RNA) where: Base-Base interactions energy: -584.335 where: short stacking energy: -366.435 Base-Backbone interact. energy: -2.953 local terms energy: -443.119212 where: bonds (distance) C4'-P energy: -105.367 bonds (distance) P-C4' energy: -78.578 flat angles C4'-P-C4' energy: -104.920 flat angles P-C4'-P energy: -61.134 tors. eta vs tors. theta energy: -93.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -956.917918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -956.917918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.917918 (E_RNA) where: Base-Base interactions energy: -553.898 where: short stacking energy: -346.634 Base-Backbone interact. energy: 2.397 local terms energy: -405.416867 where: bonds (distance) C4'-P energy: -90.265 bonds (distance) P-C4' energy: -88.233 flat angles C4'-P-C4' energy: -87.691 flat angles P-C4'-P energy: -60.496 tors. eta vs tors. theta energy: -78.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -948.927862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -948.927862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -948.927862 (E_RNA) where: Base-Base interactions energy: -556.758 where: short stacking energy: -287.982 Base-Backbone interact. energy: -1.492 local terms energy: -390.677758 where: bonds (distance) C4'-P energy: -70.054 bonds (distance) P-C4' energy: -94.881 flat angles C4'-P-C4' energy: -96.627 flat angles P-C4'-P energy: -56.927 tors. eta vs tors. theta energy: -72.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -904.875165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.875165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -904.875165 (E_RNA) where: Base-Base interactions energy: -506.223 where: short stacking energy: -250.103 Base-Backbone interact. energy: -2.029 local terms energy: -396.622354 where: bonds (distance) C4'-P energy: -91.118 bonds (distance) P-C4' energy: -98.082 flat angles C4'-P-C4' energy: -95.829 flat angles P-C4'-P energy: -60.228 tors. eta vs tors. theta energy: -51.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -775.589661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.589661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.589661 (E_RNA) where: Base-Base interactions energy: -423.626 where: short stacking energy: -251.271 Base-Backbone interact. energy: -2.545 local terms energy: -349.418194 where: bonds (distance) C4'-P energy: -82.879 bonds (distance) P-C4' energy: -92.817 flat angles C4'-P-C4' energy: -70.467 flat angles P-C4'-P energy: -57.208 tors. eta vs tors. theta energy: -46.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -484.809439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.809439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.809439 (E_RNA) where: Base-Base interactions energy: -170.399 where: short stacking energy: -150.131 Base-Backbone interact. energy: -2.523 local terms energy: -311.887573 where: bonds (distance) C4'-P energy: -88.870 bonds (distance) P-C4' energy: -95.755 flat angles C4'-P-C4' energy: -76.454 flat angles P-C4'-P energy: -40.381 tors. eta vs tors. theta energy: -10.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -505.904797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.904797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.904797 (E_RNA) where: Base-Base interactions energy: -219.392 where: short stacking energy: -141.100 Base-Backbone interact. energy: -2.069 local terms energy: -284.443417 where: bonds (distance) C4'-P energy: -87.414 bonds (distance) P-C4' energy: -81.970 flat angles C4'-P-C4' energy: -74.528 flat angles P-C4'-P energy: -44.191 tors. eta vs tors. theta energy: 3.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -487.797856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.797856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.797856 (E_RNA) where: Base-Base interactions energy: -228.828 where: short stacking energy: -149.849 Base-Backbone interact. energy: 3.812 local terms energy: -262.781937 where: bonds (distance) C4'-P energy: -69.840 bonds (distance) P-C4' energy: -77.609 flat angles C4'-P-C4' energy: -64.901 flat angles P-C4'-P energy: -55.263 tors. eta vs tors. theta energy: 4.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -407.183619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.183619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.183619 (E_RNA) where: Base-Base interactions energy: -142.075 where: short stacking energy: -124.613 Base-Backbone interact. energy: 5.811 local terms energy: -270.919897 where: bonds (distance) C4'-P energy: -93.356 bonds (distance) P-C4' energy: -86.771 flat angles C4'-P-C4' energy: -67.257 flat angles P-C4'-P energy: -33.447 tors. eta vs tors. theta energy: 9.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -1189.202725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1189.202725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1189.202725 (E_RNA) where: Base-Base interactions energy: -731.464 where: short stacking energy: -368.208 Base-Backbone interact. energy: -2.021 local terms energy: -455.717746 where: bonds (distance) C4'-P energy: -88.749 bonds (distance) P-C4' energy: -102.197 flat angles C4'-P-C4' energy: -104.944 flat angles P-C4'-P energy: -62.609 tors. eta vs tors. theta energy: -97.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -993.461122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -993.461122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -993.461122 (E_RNA) where: Base-Base interactions energy: -574.005 where: short stacking energy: -307.689 Base-Backbone interact. energy: 0.989 local terms energy: -420.445985 where: bonds (distance) C4'-P energy: -98.210 bonds (distance) P-C4' energy: -93.410 flat angles C4'-P-C4' energy: -84.707 flat angles P-C4'-P energy: -61.002 tors. eta vs tors. theta energy: -83.116 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -1055.507527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.507527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1055.507527 (E_RNA) where: Base-Base interactions energy: -613.666 where: short stacking energy: -326.477 Base-Backbone interact. energy: -2.044 local terms energy: -439.797937 where: bonds (distance) C4'-P energy: -101.914 bonds (distance) P-C4' energy: -95.218 flat angles C4'-P-C4' energy: -93.299 flat angles P-C4'-P energy: -64.340 tors. eta vs tors. theta energy: -85.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -832.113078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.113078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.113078 (E_RNA) where: Base-Base interactions energy: -460.149 where: short stacking energy: -271.634 Base-Backbone interact. energy: -0.637 local terms energy: -371.327458 where: bonds (distance) C4'-P energy: -86.396 bonds (distance) P-C4' energy: -89.740 flat angles C4'-P-C4' energy: -90.624 flat angles P-C4'-P energy: -57.951 tors. eta vs tors. theta energy: -46.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -883.715536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -883.715536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -883.715536 (E_RNA) where: Base-Base interactions energy: -513.196 where: short stacking energy: -287.049 Base-Backbone interact. energy: -3.107 local terms energy: -367.411955 where: bonds (distance) C4'-P energy: -82.157 bonds (distance) P-C4' energy: -76.041 flat angles C4'-P-C4' energy: -90.389 flat angles P-C4'-P energy: -65.908 tors. eta vs tors. theta energy: -52.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -752.608772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.608772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.608772 (E_RNA) where: Base-Base interactions energy: -409.239 where: short stacking energy: -256.503 Base-Backbone interact. energy: -1.637 local terms energy: -341.733167 where: bonds (distance) C4'-P energy: -92.645 bonds (distance) P-C4' energy: -72.672 flat angles C4'-P-C4' energy: -92.940 flat angles P-C4'-P energy: -41.311 tors. eta vs tors. theta energy: -42.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -597.112900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.112900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.112900 (E_RNA) where: Base-Base interactions energy: -282.839 where: short stacking energy: -176.974 Base-Backbone interact. energy: -0.785 local terms energy: -313.488866 where: bonds (distance) C4'-P energy: -83.186 bonds (distance) P-C4' energy: -89.545 flat angles C4'-P-C4' energy: -71.514 flat angles P-C4'-P energy: -49.711 tors. eta vs tors. theta energy: -19.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -466.554551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.554551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.554551 (E_RNA) where: Base-Base interactions energy: -178.972 where: short stacking energy: -137.874 Base-Backbone interact. energy: 3.373 local terms energy: -290.955217 where: bonds (distance) C4'-P energy: -77.835 bonds (distance) P-C4' energy: -89.769 flat angles C4'-P-C4' energy: -86.033 flat angles P-C4'-P energy: -35.691 tors. eta vs tors. theta energy: -1.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -481.028113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.028113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.028113 (E_RNA) where: Base-Base interactions energy: -203.428 where: short stacking energy: -143.762 Base-Backbone interact. energy: 3.515 local terms energy: -281.114623 where: bonds (distance) C4'-P energy: -72.430 bonds (distance) P-C4' energy: -95.512 flat angles C4'-P-C4' energy: -73.542 flat angles P-C4'-P energy: -30.328 tors. eta vs tors. theta energy: -9.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -395.228735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.228735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.228735 (E_RNA) where: Base-Base interactions energy: -170.081 where: short stacking energy: -137.674 Base-Backbone interact. energy: -2.539 local terms energy: -222.609138 where: bonds (distance) C4'-P energy: -52.782 bonds (distance) P-C4' energy: -83.062 flat angles C4'-P-C4' energy: -63.334 flat angles P-C4'-P energy: -28.071 tors. eta vs tors. theta energy: 4.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -1169.845119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1169.845119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1169.845119 (E_RNA) where: Base-Base interactions energy: -698.639 where: short stacking energy: -382.016 Base-Backbone interact. energy: -3.062 local terms energy: -468.144716 where: bonds (distance) C4'-P energy: -100.406 bonds (distance) P-C4' energy: -91.218 flat angles C4'-P-C4' energy: -103.157 flat angles P-C4'-P energy: -74.869 tors. eta vs tors. theta energy: -98.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -1123.047868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1123.047868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1123.047868 (E_RNA) where: Base-Base interactions energy: -681.085 where: short stacking energy: -362.179 Base-Backbone interact. energy: -3.093 local terms energy: -438.870242 where: bonds (distance) C4'-P energy: -85.417 bonds (distance) P-C4' energy: -91.075 flat angles C4'-P-C4' energy: -98.996 flat angles P-C4'-P energy: -66.369 tors. eta vs tors. theta energy: -97.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -955.732168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -955.732168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.732168 (E_RNA) where: Base-Base interactions energy: -536.679 where: short stacking energy: -334.756 Base-Backbone interact. energy: 1.139 local terms energy: -420.191870 where: bonds (distance) C4'-P energy: -80.890 bonds (distance) P-C4' energy: -94.147 flat angles C4'-P-C4' energy: -99.424 flat angles P-C4'-P energy: -63.416 tors. eta vs tors. theta energy: -82.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -864.053719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -864.053719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -864.053719 (E_RNA) where: Base-Base interactions energy: -476.965 where: short stacking energy: -245.782 Base-Backbone interact. energy: -3.395 local terms energy: -383.693054 where: bonds (distance) C4'-P energy: -79.703 bonds (distance) P-C4' energy: -95.454 flat angles C4'-P-C4' energy: -92.993 flat angles P-C4'-P energy: -63.913 tors. eta vs tors. theta energy: -51.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -813.069498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.069498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.069498 (E_RNA) where: Base-Base interactions energy: -427.704 where: short stacking energy: -246.850 Base-Backbone interact. energy: -0.382 local terms energy: -384.983276 where: bonds (distance) C4'-P energy: -83.300 bonds (distance) P-C4' energy: -105.033 flat angles C4'-P-C4' energy: -87.740 flat angles P-C4'-P energy: -58.252 tors. eta vs tors. theta energy: -50.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -711.158928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.158928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.158928 (E_RNA) where: Base-Base interactions energy: -381.348 where: short stacking energy: -229.222 Base-Backbone interact. energy: -2.436 local terms energy: -327.375614 where: bonds (distance) C4'-P energy: -87.072 bonds (distance) P-C4' energy: -78.754 flat angles C4'-P-C4' energy: -76.100 flat angles P-C4'-P energy: -54.685 tors. eta vs tors. theta energy: -30.765 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -535.328780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.328780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.328780 (E_RNA) where: Base-Base interactions energy: -237.225 where: short stacking energy: -137.797 Base-Backbone interact. energy: -2.739 local terms energy: -295.364032 where: bonds (distance) C4'-P energy: -77.576 bonds (distance) P-C4' energy: -92.593 flat angles C4'-P-C4' energy: -74.850 flat angles P-C4'-P energy: -54.631 tors. eta vs tors. theta energy: 4.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -523.568091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.568091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.568091 (E_RNA) where: Base-Base interactions energy: -245.813 where: short stacking energy: -163.043 Base-Backbone interact. energy: -0.290 local terms energy: -277.465159 where: bonds (distance) C4'-P energy: -82.797 bonds (distance) P-C4' energy: -83.308 flat angles C4'-P-C4' energy: -68.070 flat angles P-C4'-P energy: -45.385 tors. eta vs tors. theta energy: 2.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -429.207416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.207416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.207416 (E_RNA) where: Base-Base interactions energy: -164.387 where: short stacking energy: -115.382 Base-Backbone interact. energy: 4.523 local terms energy: -269.344098 where: bonds (distance) C4'-P energy: -77.366 bonds (distance) P-C4' energy: -78.334 flat angles C4'-P-C4' energy: -80.786 flat angles P-C4'-P energy: -30.051 tors. eta vs tors. theta energy: -2.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -452.318355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.318355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.318355 (E_RNA) where: Base-Base interactions energy: -174.938 where: short stacking energy: -117.202 Base-Backbone interact. energy: 3.284 local terms energy: -280.663475 where: bonds (distance) C4'-P energy: -74.999 bonds (distance) P-C4' energy: -83.716 flat angles C4'-P-C4' energy: -81.160 flat angles P-C4'-P energy: -41.765 tors. eta vs tors. theta energy: 0.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -1182.040354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1182.040354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1182.040354 (E_RNA) where: Base-Base interactions energy: -737.446 where: short stacking energy: -370.891 Base-Backbone interact. energy: -1.600 local terms energy: -442.994436 where: bonds (distance) C4'-P energy: -97.632 bonds (distance) P-C4' energy: -95.486 flat angles C4'-P-C4' energy: -88.593 flat angles P-C4'-P energy: -70.165 tors. eta vs tors. theta energy: -91.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -1129.998771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1129.998771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1129.998771 (E_RNA) where: Base-Base interactions energy: -701.263 where: short stacking energy: -365.885 Base-Backbone interact. energy: -1.994 local terms energy: -426.741554 where: bonds (distance) C4'-P energy: -98.991 bonds (distance) P-C4' energy: -85.947 flat angles C4'-P-C4' energy: -92.446 flat angles P-C4'-P energy: -58.351 tors. eta vs tors. theta energy: -91.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -949.134520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -949.134520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.134520 (E_RNA) where: Base-Base interactions energy: -539.057 where: short stacking energy: -284.049 Base-Backbone interact. energy: -2.331 local terms energy: -407.746534 where: bonds (distance) C4'-P energy: -93.264 bonds (distance) P-C4' energy: -108.599 flat angles C4'-P-C4' energy: -93.205 flat angles P-C4'-P energy: -63.785 tors. eta vs tors. theta energy: -48.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -915.119724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -915.119724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -915.119724 (E_RNA) where: Base-Base interactions energy: -516.724 where: short stacking energy: -282.449 Base-Backbone interact. energy: -3.211 local terms energy: -395.184200 where: bonds (distance) C4'-P energy: -83.444 bonds (distance) P-C4' energy: -92.865 flat angles C4'-P-C4' energy: -101.400 flat angles P-C4'-P energy: -59.304 tors. eta vs tors. theta energy: -58.170 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -773.444020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -773.444020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -773.444020 (E_RNA) where: Base-Base interactions energy: -411.105 where: short stacking energy: -259.727 Base-Backbone interact. energy: -1.664 local terms energy: -360.675684 where: bonds (distance) C4'-P energy: -94.374 bonds (distance) P-C4' energy: -76.044 flat angles C4'-P-C4' energy: -96.589 flat angles P-C4'-P energy: -52.191 tors. eta vs tors. theta energy: -41.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -753.035358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.035358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.035358 (E_RNA) where: Base-Base interactions energy: -395.499 where: short stacking energy: -214.087 Base-Backbone interact. energy: -2.243 local terms energy: -355.293262 where: bonds (distance) C4'-P energy: -89.055 bonds (distance) P-C4' energy: -91.929 flat angles C4'-P-C4' energy: -85.337 flat angles P-C4'-P energy: -50.692 tors. eta vs tors. theta energy: -38.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -587.699190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.699190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.699190 (E_RNA) where: Base-Base interactions energy: -285.625 where: short stacking energy: -187.323 Base-Backbone interact. energy: -0.449 local terms energy: -301.624575 where: bonds (distance) C4'-P energy: -74.339 bonds (distance) P-C4' energy: -80.400 flat angles C4'-P-C4' energy: -82.451 flat angles P-C4'-P energy: -53.834 tors. eta vs tors. theta energy: -10.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -589.292196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.292196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.292196 (E_RNA) where: Base-Base interactions energy: -265.271 where: short stacking energy: -195.354 Base-Backbone interact. energy: 2.095 local terms energy: -326.116768 where: bonds (distance) C4'-P energy: -95.180 bonds (distance) P-C4' energy: -94.068 flat angles C4'-P-C4' energy: -82.013 flat angles P-C4'-P energy: -41.430 tors. eta vs tors. theta energy: -13.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -488.523391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.523391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.523391 (E_RNA) where: Base-Base interactions energy: -242.617 where: short stacking energy: -156.804 Base-Backbone interact. energy: 0.135 local terms energy: -246.041821 where: bonds (distance) C4'-P energy: -67.532 bonds (distance) P-C4' energy: -76.128 flat angles C4'-P-C4' energy: -63.823 flat angles P-C4'-P energy: -32.759 tors. eta vs tors. theta energy: -5.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -369.990514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.990514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.990514 (E_RNA) where: Base-Base interactions energy: -116.190 where: short stacking energy: -102.357 Base-Backbone interact. energy: 4.993 local terms energy: -258.794141 where: bonds (distance) C4'-P energy: -64.943 bonds (distance) P-C4' energy: -73.615 flat angles C4'-P-C4' energy: -66.489 flat angles P-C4'-P energy: -51.593 tors. eta vs tors. theta energy: -2.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -1191.470265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1191.470265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1191.470265 (E_RNA) where: Base-Base interactions energy: -735.893 where: short stacking energy: -386.377 Base-Backbone interact. energy: -0.906 local terms energy: -454.671303 where: bonds (distance) C4'-P energy: -87.417 bonds (distance) P-C4' energy: -98.217 flat angles C4'-P-C4' energy: -105.986 flat angles P-C4'-P energy: -73.818 tors. eta vs tors. theta energy: -89.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -1147.566788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1147.566788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1147.566788 (E_RNA) where: Base-Base interactions energy: -726.175 where: short stacking energy: -366.249 Base-Backbone interact. energy: -2.215 local terms energy: -419.176359 where: bonds (distance) C4'-P energy: -81.422 bonds (distance) P-C4' energy: -87.043 flat angles C4'-P-C4' energy: -95.944 flat angles P-C4'-P energy: -63.253 tors. eta vs tors. theta energy: -91.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -944.711976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -944.711976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -944.711976 (E_RNA) where: Base-Base interactions energy: -542.311 where: short stacking energy: -317.717 Base-Backbone interact. energy: 3.685 local terms energy: -406.086149 where: bonds (distance) C4'-P energy: -90.728 bonds (distance) P-C4' energy: -95.054 flat angles C4'-P-C4' energy: -96.452 flat angles P-C4'-P energy: -62.705 tors. eta vs tors. theta energy: -61.147 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -928.366153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -928.366153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.366153 (E_RNA) where: Base-Base interactions energy: -552.975 where: short stacking energy: -276.982 Base-Backbone interact. energy: -3.476 local terms energy: -371.915614 where: bonds (distance) C4'-P energy: -78.092 bonds (distance) P-C4' energy: -87.974 flat angles C4'-P-C4' energy: -89.738 flat angles P-C4'-P energy: -54.484 tors. eta vs tors. theta energy: -61.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -825.212506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -825.212506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -825.212506 (E_RNA) where: Base-Base interactions energy: -470.442 where: short stacking energy: -245.860 Base-Backbone interact. energy: -3.319 local terms energy: -351.451466 where: bonds (distance) C4'-P energy: -84.016 bonds (distance) P-C4' energy: -90.310 flat angles C4'-P-C4' energy: -98.728 flat angles P-C4'-P energy: -33.796 tors. eta vs tors. theta energy: -44.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -770.660492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.660492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.660492 (E_RNA) where: Base-Base interactions energy: -426.993 where: short stacking energy: -223.367 Base-Backbone interact. energy: -0.926 local terms energy: -342.741101 where: bonds (distance) C4'-P energy: -95.080 bonds (distance) P-C4' energy: -77.322 flat angles C4'-P-C4' energy: -84.114 flat angles P-C4'-P energy: -48.531 tors. eta vs tors. theta energy: -37.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -603.637009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.637009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.637009 (E_RNA) where: Base-Base interactions energy: -293.360 where: short stacking energy: -193.293 Base-Backbone interact. energy: -1.186 local terms energy: -309.090703 where: bonds (distance) C4'-P energy: -69.196 bonds (distance) P-C4' energy: -83.935 flat angles C4'-P-C4' energy: -88.254 flat angles P-C4'-P energy: -54.057 tors. eta vs tors. theta energy: -13.649 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -499.816016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.816016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.816016 (E_RNA) where: Base-Base interactions energy: -204.063 where: short stacking energy: -141.641 Base-Backbone interact. energy: -1.302 local terms energy: -294.451018 where: bonds (distance) C4'-P energy: -78.067 bonds (distance) P-C4' energy: -86.606 flat angles C4'-P-C4' energy: -66.898 flat angles P-C4'-P energy: -49.330 tors. eta vs tors. theta energy: -13.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -499.758595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.758595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.758595 (E_RNA) where: Base-Base interactions energy: -225.774 where: short stacking energy: -153.409 Base-Backbone interact. energy: -0.817 local terms energy: -273.167224 where: bonds (distance) C4'-P energy: -72.423 bonds (distance) P-C4' energy: -79.771 flat angles C4'-P-C4' energy: -66.803 flat angles P-C4'-P energy: -39.326 tors. eta vs tors. theta energy: -14.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -377.413643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.413643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.413643 (E_RNA) where: Base-Base interactions energy: -160.355 where: short stacking energy: -116.808 Base-Backbone interact. energy: 3.379 local terms energy: -220.438248 where: bonds (distance) C4'-P energy: -59.547 bonds (distance) P-C4' energy: -90.809 flat angles C4'-P-C4' energy: -64.962 flat angles P-C4'-P energy: -21.540 tors. eta vs tors. theta energy: 16.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -1164.975900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1164.975900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1164.975900 (E_RNA) where: Base-Base interactions energy: -708.431 where: short stacking energy: -377.592 Base-Backbone interact. energy: -2.994 local terms energy: -453.549942 where: bonds (distance) C4'-P energy: -89.779 bonds (distance) P-C4' energy: -98.422 flat angles C4'-P-C4' energy: -99.217 flat angles P-C4'-P energy: -66.253 tors. eta vs tors. theta energy: -99.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -1111.727053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1111.727053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1111.727053 (E_RNA) where: Base-Base interactions energy: -699.734 where: short stacking energy: -361.347 Base-Backbone interact. energy: 2.514 local terms energy: -414.507128 where: bonds (distance) C4'-P energy: -83.527 bonds (distance) P-C4' energy: -94.436 flat angles C4'-P-C4' energy: -94.687 flat angles P-C4'-P energy: -50.219 tors. eta vs tors. theta energy: -91.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -967.062682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -967.062682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -967.062682 (E_RNA) where: Base-Base interactions energy: -565.587 where: short stacking energy: -297.457 Base-Backbone interact. energy: -0.179 local terms energy: -401.296108 where: bonds (distance) C4'-P energy: -82.257 bonds (distance) P-C4' energy: -95.480 flat angles C4'-P-C4' energy: -102.724 flat angles P-C4'-P energy: -57.398 tors. eta vs tors. theta energy: -63.436 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -1008.330668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.330668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1008.330668 (E_RNA) where: Base-Base interactions energy: -603.911 where: short stacking energy: -340.098 Base-Backbone interact. energy: -2.747 local terms energy: -401.672374 where: bonds (distance) C4'-P energy: -81.901 bonds (distance) P-C4' energy: -88.083 flat angles C4'-P-C4' energy: -87.069 flat angles P-C4'-P energy: -59.683 tors. eta vs tors. theta energy: -84.936 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -860.725125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.725125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.725125 (E_RNA) where: Base-Base interactions energy: -480.771 where: short stacking energy: -275.974 Base-Backbone interact. energy: -0.332 local terms energy: -379.622336 where: bonds (distance) C4'-P energy: -80.112 bonds (distance) P-C4' energy: -89.935 flat angles C4'-P-C4' energy: -87.308 flat angles P-C4'-P energy: -57.145 tors. eta vs tors. theta energy: -65.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -790.783082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -790.783082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.783082 (E_RNA) where: Base-Base interactions energy: -442.543 where: short stacking energy: -234.327 Base-Backbone interact. energy: -1.765 local terms energy: -346.474896 where: bonds (distance) C4'-P energy: -90.481 bonds (distance) P-C4' energy: -88.285 flat angles C4'-P-C4' energy: -66.983 flat angles P-C4'-P energy: -64.765 tors. eta vs tors. theta energy: -35.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -590.478307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.478307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.478307 (E_RNA) where: Base-Base interactions energy: -296.092 where: short stacking energy: -176.316 Base-Backbone interact. energy: 2.526 local terms energy: -296.911989 where: bonds (distance) C4'-P energy: -78.580 bonds (distance) P-C4' energy: -91.922 flat angles C4'-P-C4' energy: -73.102 flat angles P-C4'-P energy: -37.679 tors. eta vs tors. theta energy: -15.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -536.280156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.280156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.280156 (E_RNA) where: Base-Base interactions energy: -268.037 where: short stacking energy: -179.337 Base-Backbone interact. energy: 4.730 local terms energy: -272.973507 where: bonds (distance) C4'-P energy: -78.149 bonds (distance) P-C4' energy: -70.714 flat angles C4'-P-C4' energy: -73.278 flat angles P-C4'-P energy: -50.019 tors. eta vs tors. theta energy: -0.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -480.419816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.419816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.419816 (E_RNA) where: Base-Base interactions energy: -198.634 where: short stacking energy: -132.478 Base-Backbone interact. energy: -1.696 local terms energy: -280.089737 where: bonds (distance) C4'-P energy: -82.322 bonds (distance) P-C4' energy: -64.257 flat angles C4'-P-C4' energy: -84.192 flat angles P-C4'-P energy: -52.611 tors. eta vs tors. theta energy: 3.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -366.671463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.671463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.671463 (E_RNA) where: Base-Base interactions energy: -128.898 where: short stacking energy: -113.871 Base-Backbone interact. energy: 4.139 local terms energy: -241.913097 where: bonds (distance) C4'-P energy: -71.597 bonds (distance) P-C4' energy: -76.810 flat angles C4'-P-C4' energy: -52.748 flat angles P-C4'-P energy: -51.152 tors. eta vs tors. theta energy: 10.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -1217.912754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1217.912754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1217.912754 (E_RNA) where: Base-Base interactions energy: -756.914 where: short stacking energy: -384.426 Base-Backbone interact. energy: -3.442 local terms energy: -457.556335 where: bonds (distance) C4'-P energy: -87.831 bonds (distance) P-C4' energy: -104.125 flat angles C4'-P-C4' energy: -96.203 flat angles P-C4'-P energy: -66.927 tors. eta vs tors. theta energy: -102.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -1078.691694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.691694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1078.691694 (E_RNA) where: Base-Base interactions energy: -630.402 where: short stacking energy: -336.823 Base-Backbone interact. energy: -2.634 local terms energy: -445.656237 where: bonds (distance) C4'-P energy: -94.132 bonds (distance) P-C4' energy: -87.946 flat angles C4'-P-C4' energy: -107.274 flat angles P-C4'-P energy: -71.870 tors. eta vs tors. theta energy: -84.434 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -980.258035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.258035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -980.258035 (E_RNA) where: Base-Base interactions energy: -561.426 where: short stacking energy: -298.647 Base-Backbone interact. energy: 0.283 local terms energy: -419.115446 where: bonds (distance) C4'-P energy: -100.380 bonds (distance) P-C4' energy: -83.416 flat angles C4'-P-C4' energy: -91.425 flat angles P-C4'-P energy: -70.914 tors. eta vs tors. theta energy: -72.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -998.225740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -998.225740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.225740 (E_RNA) where: Base-Base interactions energy: -604.312 where: short stacking energy: -329.428 Base-Backbone interact. energy: -2.446 local terms energy: -391.467774 where: bonds (distance) C4'-P energy: -84.252 bonds (distance) P-C4' energy: -89.797 flat angles C4'-P-C4' energy: -92.653 flat angles P-C4'-P energy: -36.734 tors. eta vs tors. theta energy: -88.031 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -830.110960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -830.110960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -830.110960 (E_RNA) where: Base-Base interactions energy: -447.030 where: short stacking energy: -260.228 Base-Backbone interact. energy: 1.737 local terms energy: -384.818351 where: bonds (distance) C4'-P energy: -85.594 bonds (distance) P-C4' energy: -100.365 flat angles C4'-P-C4' energy: -86.524 flat angles P-C4'-P energy: -54.660 tors. eta vs tors. theta energy: -57.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -838.760953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.760953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.760953 (E_RNA) where: Base-Base interactions energy: -473.294 where: short stacking energy: -268.511 Base-Backbone interact. energy: -1.673 local terms energy: -363.793620 where: bonds (distance) C4'-P energy: -95.552 bonds (distance) P-C4' energy: -80.569 flat angles C4'-P-C4' energy: -87.674 flat angles P-C4'-P energy: -49.005 tors. eta vs tors. theta energy: -50.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -678.034957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.034957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.034957 (E_RNA) where: Base-Base interactions energy: -375.977 where: short stacking energy: -203.389 Base-Backbone interact. energy: 0.477 local terms energy: -302.534409 where: bonds (distance) C4'-P energy: -83.521 bonds (distance) P-C4' energy: -74.067 flat angles C4'-P-C4' energy: -72.505 flat angles P-C4'-P energy: -48.396 tors. eta vs tors. theta energy: -24.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -547.196010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.196010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.196010 (E_RNA) where: Base-Base interactions energy: -259.953 where: short stacking energy: -170.400 Base-Backbone interact. energy: 1.267 local terms energy: -288.509771 where: bonds (distance) C4'-P energy: -79.512 bonds (distance) P-C4' energy: -95.922 flat angles C4'-P-C4' energy: -80.042 flat angles P-C4'-P energy: -33.710 tors. eta vs tors. theta energy: 0.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -518.168107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.168107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.168107 (E_RNA) where: Base-Base interactions energy: -227.780 where: short stacking energy: -133.265 Base-Backbone interact. energy: -1.735 local terms energy: -288.653451 where: bonds (distance) C4'-P energy: -66.399 bonds (distance) P-C4' energy: -82.576 flat angles C4'-P-C4' energy: -78.420 flat angles P-C4'-P energy: -53.526 tors. eta vs tors. theta energy: -7.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -399.630947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.630947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.630947 (E_RNA) where: Base-Base interactions energy: -179.406 where: short stacking energy: -109.067 Base-Backbone interact. energy: -1.161 local terms energy: -219.063793 where: bonds (distance) C4'-P energy: -61.384 bonds (distance) P-C4' energy: -77.005 flat angles C4'-P-C4' energy: -61.449 flat angles P-C4'-P energy: -43.083 tors. eta vs tors. theta energy: 23.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -1238.385868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1238.385868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1238.385868 (E_RNA) where: Base-Base interactions energy: -752.955 where: short stacking energy: -386.691 Base-Backbone interact. energy: -5.935 local terms energy: -479.495689 where: bonds (distance) C4'-P energy: -98.347 bonds (distance) P-C4' energy: -95.444 flat angles C4'-P-C4' energy: -110.115 flat angles P-C4'-P energy: -74.321 tors. eta vs tors. theta energy: -101.268 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -1124.771982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1124.771982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1124.771982 (E_RNA) where: Base-Base interactions energy: -679.283 where: short stacking energy: -360.424 Base-Backbone interact. energy: -1.705 local terms energy: -443.783329 where: bonds (distance) C4'-P energy: -91.495 bonds (distance) P-C4' energy: -94.364 flat angles C4'-P-C4' energy: -102.303 flat angles P-C4'-P energy: -57.028 tors. eta vs tors. theta energy: -98.594 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -1014.548433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.548433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1014.548433 (E_RNA) where: Base-Base interactions energy: -592.223 where: short stacking energy: -318.777 Base-Backbone interact. energy: -1.174 local terms energy: -421.151771 where: bonds (distance) C4'-P energy: -93.092 bonds (distance) P-C4' energy: -96.941 flat angles C4'-P-C4' energy: -94.072 flat angles P-C4'-P energy: -54.802 tors. eta vs tors. theta energy: -82.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -980.592233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.592233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -980.592233 (E_RNA) where: Base-Base interactions energy: -595.103 where: short stacking energy: -289.763 Base-Backbone interact. energy: -2.815 local terms energy: -382.673705 where: bonds (distance) C4'-P energy: -79.146 bonds (distance) P-C4' energy: -99.292 flat angles C4'-P-C4' energy: -93.682 flat angles P-C4'-P energy: -50.714 tors. eta vs tors. theta energy: -59.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -882.159743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -882.159743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.159743 (E_RNA) where: Base-Base interactions energy: -503.305 where: short stacking energy: -278.168 Base-Backbone interact. energy: 0.061 local terms energy: -378.916071 where: bonds (distance) C4'-P energy: -83.328 bonds (distance) P-C4' energy: -89.045 flat angles C4'-P-C4' energy: -89.609 flat angles P-C4'-P energy: -66.290 tors. eta vs tors. theta energy: -50.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -759.021704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.021704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.021704 (E_RNA) where: Base-Base interactions energy: -417.745 where: short stacking energy: -227.981 Base-Backbone interact. energy: 2.651 local terms energy: -343.927028 where: bonds (distance) C4'-P energy: -83.489 bonds (distance) P-C4' energy: -81.325 flat angles C4'-P-C4' energy: -96.362 flat angles P-C4'-P energy: -43.049 tors. eta vs tors. theta energy: -39.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -654.383515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.383515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.383515 (E_RNA) where: Base-Base interactions energy: -358.773 where: short stacking energy: -197.187 Base-Backbone interact. energy: 1.426 local terms energy: -297.037234 where: bonds (distance) C4'-P energy: -76.272 bonds (distance) P-C4' energy: -76.515 flat angles C4'-P-C4' energy: -73.843 flat angles P-C4'-P energy: -54.230 tors. eta vs tors. theta energy: -16.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -580.978305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.978305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.978305 (E_RNA) where: Base-Base interactions energy: -284.824 where: short stacking energy: -192.007 Base-Backbone interact. energy: 0.711 local terms energy: -296.865272 where: bonds (distance) C4'-P energy: -68.106 bonds (distance) P-C4' energy: -99.419 flat angles C4'-P-C4' energy: -55.304 flat angles P-C4'-P energy: -58.612 tors. eta vs tors. theta energy: -15.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -506.617770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.617770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.617770 (E_RNA) where: Base-Base interactions energy: -247.184 where: short stacking energy: -137.954 Base-Backbone interact. energy: -1.186 local terms energy: -258.247746 where: bonds (distance) C4'-P energy: -70.256 bonds (distance) P-C4' energy: -84.887 flat angles C4'-P-C4' energy: -75.163 flat angles P-C4'-P energy: -31.443 tors. eta vs tors. theta energy: 3.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -385.142467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.142467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.142467 (E_RNA) where: Base-Base interactions energy: -146.792 where: short stacking energy: -128.286 Base-Backbone interact. energy: -0.051 local terms energy: -238.299851 where: bonds (distance) C4'-P energy: -68.433 bonds (distance) P-C4' energy: -82.006 flat angles C4'-P-C4' energy: -60.373 flat angles P-C4'-P energy: -33.087 tors. eta vs tors. theta energy: 5.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -1192.907717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1192.907717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1192.907717 (E_RNA) where: Base-Base interactions energy: -729.362 where: short stacking energy: -373.453 Base-Backbone interact. energy: -1.611 local terms energy: -461.935494 where: bonds (distance) C4'-P energy: -89.603 bonds (distance) P-C4' energy: -95.081 flat angles C4'-P-C4' energy: -111.390 flat angles P-C4'-P energy: -60.479 tors. eta vs tors. theta energy: -105.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -1098.208125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1098.208125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1098.208125 (E_RNA) where: Base-Base interactions energy: -671.796 where: short stacking energy: -334.666 Base-Backbone interact. energy: -5.115 local terms energy: -421.297361 where: bonds (distance) C4'-P energy: -96.101 bonds (distance) P-C4' energy: -92.609 flat angles C4'-P-C4' energy: -91.615 flat angles P-C4'-P energy: -65.579 tors. eta vs tors. theta energy: -75.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -997.584840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.584840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -997.584840 (E_RNA) where: Base-Base interactions energy: -582.947 where: short stacking energy: -327.055 Base-Backbone interact. energy: 3.755 local terms energy: -418.393249 where: bonds (distance) C4'-P energy: -87.947 bonds (distance) P-C4' energy: -90.310 flat angles C4'-P-C4' energy: -99.801 flat angles P-C4'-P energy: -63.553 tors. eta vs tors. theta energy: -76.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -1006.283587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.283587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1006.283587 (E_RNA) where: Base-Base interactions energy: -629.478 where: short stacking energy: -321.250 Base-Backbone interact. energy: -3.294 local terms energy: -373.511200 where: bonds (distance) C4'-P energy: -87.623 bonds (distance) P-C4' energy: -81.510 flat angles C4'-P-C4' energy: -84.268 flat angles P-C4'-P energy: -42.580 tors. eta vs tors. theta energy: -77.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -887.174039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.174039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.174039 (E_RNA) where: Base-Base interactions energy: -518.034 where: short stacking energy: -282.918 Base-Backbone interact. energy: -0.898 local terms energy: -368.241447 where: bonds (distance) C4'-P energy: -79.552 bonds (distance) P-C4' energy: -84.465 flat angles C4'-P-C4' energy: -88.868 flat angles P-C4'-P energy: -50.227 tors. eta vs tors. theta energy: -65.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -814.543049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.543049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.543049 (E_RNA) where: Base-Base interactions energy: -479.141 where: short stacking energy: -274.491 Base-Backbone interact. energy: -2.270 local terms energy: -333.132524 where: bonds (distance) C4'-P energy: -68.682 bonds (distance) P-C4' energy: -80.828 flat angles C4'-P-C4' energy: -82.438 flat angles P-C4'-P energy: -47.069 tors. eta vs tors. theta energy: -54.116 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -687.095735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.095735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.095735 (E_RNA) where: Base-Base interactions energy: -345.404 where: short stacking energy: -183.845 Base-Backbone interact. energy: 0.228 local terms energy: -341.919896 where: bonds (distance) C4'-P energy: -91.747 bonds (distance) P-C4' energy: -80.933 flat angles C4'-P-C4' energy: -95.159 flat angles P-C4'-P energy: -42.673 tors. eta vs tors. theta energy: -31.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -558.450679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.450679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.450679 (E_RNA) where: Base-Base interactions energy: -283.588 where: short stacking energy: -184.057 Base-Backbone interact. energy: -0.487 local terms energy: -274.374867 where: bonds (distance) C4'-P energy: -77.431 bonds (distance) P-C4' energy: -85.965 flat angles C4'-P-C4' energy: -71.239 flat angles P-C4'-P energy: -32.793 tors. eta vs tors. theta energy: -6.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -461.649181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.649181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.649181 (E_RNA) where: Base-Base interactions energy: -205.062 where: short stacking energy: -139.177 Base-Backbone interact. energy: -1.137 local terms energy: -255.450546 where: bonds (distance) C4'-P energy: -70.869 bonds (distance) P-C4' energy: -70.326 flat angles C4'-P-C4' energy: -61.252 flat angles P-C4'-P energy: -60.486 tors. eta vs tors. theta energy: 7.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -372.880182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.880182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.880182 (E_RNA) where: Base-Base interactions energy: -109.185 where: short stacking energy: -102.094 Base-Backbone interact. energy: -0.885 local terms energy: -262.810823 where: bonds (distance) C4'-P energy: -80.110 bonds (distance) P-C4' energy: -84.766 flat angles C4'-P-C4' energy: -66.886 flat angles P-C4'-P energy: -54.038 tors. eta vs tors. theta energy: 22.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -1256.011278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1256.011278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1256.011278 (E_RNA) where: Base-Base interactions energy: -810.753 where: short stacking energy: -380.912 Base-Backbone interact. energy: -1.114 local terms energy: -444.143779 where: bonds (distance) C4'-P energy: -80.552 bonds (distance) P-C4' energy: -98.136 flat angles C4'-P-C4' energy: -103.630 flat angles P-C4'-P energy: -62.956 tors. eta vs tors. theta energy: -98.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -1118.162843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1118.162843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1118.162843 (E_RNA) where: Base-Base interactions energy: -707.419 where: short stacking energy: -370.561 Base-Backbone interact. energy: -0.405 local terms energy: -410.338244 where: bonds (distance) C4'-P energy: -87.760 bonds (distance) P-C4' energy: -83.244 flat angles C4'-P-C4' energy: -101.134 flat angles P-C4'-P energy: -62.203 tors. eta vs tors. theta energy: -75.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -1013.612376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1013.612376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1013.612376 (E_RNA) where: Base-Base interactions energy: -581.311 where: short stacking energy: -286.970 Base-Backbone interact. energy: 0.974 local terms energy: -433.275089 where: bonds (distance) C4'-P energy: -99.898 bonds (distance) P-C4' energy: -94.000 flat angles C4'-P-C4' energy: -109.394 flat angles P-C4'-P energy: -71.819 tors. eta vs tors. theta energy: -58.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -894.683857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.683857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -894.683857 (E_RNA) where: Base-Base interactions energy: -506.690 where: short stacking energy: -305.572 Base-Backbone interact. energy: -0.297 local terms energy: -387.697485 where: bonds (distance) C4'-P energy: -95.959 bonds (distance) P-C4' energy: -82.255 flat angles C4'-P-C4' energy: -82.818 flat angles P-C4'-P energy: -57.569 tors. eta vs tors. theta energy: -69.097 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -955.648352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -955.648352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.648352 (E_RNA) where: Base-Base interactions energy: -575.552 where: short stacking energy: -280.684 Base-Backbone interact. energy: -0.651 local terms energy: -379.446026 where: bonds (distance) C4'-P energy: -85.549 bonds (distance) P-C4' energy: -96.266 flat angles C4'-P-C4' energy: -87.699 flat angles P-C4'-P energy: -49.029 tors. eta vs tors. theta energy: -60.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -809.605332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -809.605332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.605332 (E_RNA) where: Base-Base interactions energy: -464.759 where: short stacking energy: -251.755 Base-Backbone interact. energy: 0.323 local terms energy: -345.169356 where: bonds (distance) C4'-P energy: -80.379 bonds (distance) P-C4' energy: -65.673 flat angles C4'-P-C4' energy: -100.555 flat angles P-C4'-P energy: -57.499 tors. eta vs tors. theta energy: -41.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -735.015111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.015111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.015111 (E_RNA) where: Base-Base interactions energy: -406.988 where: short stacking energy: -210.541 Base-Backbone interact. energy: -1.595 local terms energy: -326.431485 where: bonds (distance) C4'-P energy: -70.116 bonds (distance) P-C4' energy: -100.804 flat angles C4'-P-C4' energy: -80.687 flat angles P-C4'-P energy: -44.575 tors. eta vs tors. theta energy: -30.250 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -574.083946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.083946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.083946 (E_RNA) where: Base-Base interactions energy: -274.116 where: short stacking energy: -145.660 Base-Backbone interact. energy: 3.799 local terms energy: -303.766965 where: bonds (distance) C4'-P energy: -79.000 bonds (distance) P-C4' energy: -93.135 flat angles C4'-P-C4' energy: -90.503 flat angles P-C4'-P energy: -38.897 tors. eta vs tors. theta energy: -2.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -512.066368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.066368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.066368 (E_RNA) where: Base-Base interactions energy: -229.162 where: short stacking energy: -155.131 Base-Backbone interact. energy: 2.141 local terms energy: -285.046231 where: bonds (distance) C4'-P energy: -98.796 bonds (distance) P-C4' energy: -75.990 flat angles C4'-P-C4' energy: -51.648 flat angles P-C4'-P energy: -47.578 tors. eta vs tors. theta energy: -11.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -431.347128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.347128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.347128 (E_RNA) where: Base-Base interactions energy: -182.981 where: short stacking energy: -125.116 Base-Backbone interact. energy: -1.380 local terms energy: -246.986223 where: bonds (distance) C4'-P energy: -80.994 bonds (distance) P-C4' energy: -86.161 flat angles C4'-P-C4' energy: -56.256 flat angles P-C4'-P energy: -30.268 tors. eta vs tors. theta energy: 6.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -1222.093685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1222.093685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1222.093685 (E_RNA) where: Base-Base interactions energy: -770.257 where: short stacking energy: -377.467 Base-Backbone interact. energy: -1.600 local terms energy: -450.236547 where: bonds (distance) C4'-P energy: -81.699 bonds (distance) P-C4' energy: -95.615 flat angles C4'-P-C4' energy: -99.834 flat angles P-C4'-P energy: -71.688 tors. eta vs tors. theta energy: -101.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -1174.703295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1174.703295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1174.703295 (E_RNA) where: Base-Base interactions energy: -717.242 where: short stacking energy: -384.025 Base-Backbone interact. energy: -1.201 local terms energy: -456.260813 where: bonds (distance) C4'-P energy: -90.906 bonds (distance) P-C4' energy: -99.923 flat angles C4'-P-C4' energy: -97.711 flat angles P-C4'-P energy: -69.786 tors. eta vs tors. theta energy: -97.935 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -1114.095175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1114.095175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1114.095175 (E_RNA) where: Base-Base interactions energy: -664.810 where: short stacking energy: -329.729 Base-Backbone interact. energy: -2.610 local terms energy: -446.675091 where: bonds (distance) C4'-P energy: -103.224 bonds (distance) P-C4' energy: -84.247 flat angles C4'-P-C4' energy: -106.040 flat angles P-C4'-P energy: -72.762 tors. eta vs tors. theta energy: -80.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -1045.211793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.211793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1045.211793 (E_RNA) where: Base-Base interactions energy: -631.949 where: short stacking energy: -334.528 Base-Backbone interact. energy: 0.596 local terms energy: -413.859138 where: bonds (distance) C4'-P energy: -99.710 bonds (distance) P-C4' energy: -89.942 flat angles C4'-P-C4' energy: -82.255 flat angles P-C4'-P energy: -68.374 tors. eta vs tors. theta energy: -73.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -833.618545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.618545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.618545 (E_RNA) where: Base-Base interactions energy: -478.803 where: short stacking energy: -245.734 Base-Backbone interact. energy: 0.582 local terms energy: -355.396827 where: bonds (distance) C4'-P energy: -80.859 bonds (distance) P-C4' energy: -86.530 flat angles C4'-P-C4' energy: -87.858 flat angles P-C4'-P energy: -49.530 tors. eta vs tors. theta energy: -50.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -880.074917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.074917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -880.074917 (E_RNA) where: Base-Base interactions energy: -497.044 where: short stacking energy: -250.132 Base-Backbone interact. energy: -2.366 local terms energy: -380.664420 where: bonds (distance) C4'-P energy: -96.169 bonds (distance) P-C4' energy: -84.831 flat angles C4'-P-C4' energy: -83.975 flat angles P-C4'-P energy: -51.564 tors. eta vs tors. theta energy: -64.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -737.297635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.297635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.297635 (E_RNA) where: Base-Base interactions energy: -422.273 where: short stacking energy: -215.038 Base-Backbone interact. energy: -2.100 local terms energy: -312.924449 where: bonds (distance) C4'-P energy: -74.619 bonds (distance) P-C4' energy: -87.466 flat angles C4'-P-C4' energy: -67.337 flat angles P-C4'-P energy: -52.210 tors. eta vs tors. theta energy: -31.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -583.374860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.374860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.374860 (E_RNA) where: Base-Base interactions energy: -284.157 where: short stacking energy: -158.333 Base-Backbone interact. energy: -0.672 local terms energy: -298.546236 where: bonds (distance) C4'-P energy: -72.954 bonds (distance) P-C4' energy: -94.797 flat angles C4'-P-C4' energy: -82.048 flat angles P-C4'-P energy: -37.679 tors. eta vs tors. theta energy: -11.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -437.736779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.736779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.736779 (E_RNA) where: Base-Base interactions energy: -157.575 where: short stacking energy: -125.795 Base-Backbone interact. energy: -1.385 local terms energy: -278.777441 where: bonds (distance) C4'-P energy: -70.011 bonds (distance) P-C4' energy: -91.348 flat angles C4'-P-C4' energy: -76.609 flat angles P-C4'-P energy: -47.576 tors. eta vs tors. theta energy: 6.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -389.967898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.967898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.967898 (E_RNA) where: Base-Base interactions energy: -133.532 where: short stacking energy: -102.978 Base-Backbone interact. energy: 2.780 local terms energy: -259.215838 where: bonds (distance) C4'-P energy: -68.834 bonds (distance) P-C4' energy: -92.453 flat angles C4'-P-C4' energy: -72.012 flat angles P-C4'-P energy: -39.347 tors. eta vs tors. theta energy: 13.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -1246.396015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1246.396015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1246.396015 (E_RNA) where: Base-Base interactions energy: -785.571 where: short stacking energy: -409.964 Base-Backbone interact. energy: -3.665 local terms energy: -457.160705 where: bonds (distance) C4'-P energy: -80.040 bonds (distance) P-C4' energy: -95.195 flat angles C4'-P-C4' energy: -109.693 flat angles P-C4'-P energy: -59.027 tors. eta vs tors. theta energy: -113.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -1123.803639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1123.803639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1123.803639 (E_RNA) where: Base-Base interactions energy: -698.044 where: short stacking energy: -333.110 Base-Backbone interact. energy: -3.231 local terms energy: -422.527867 where: bonds (distance) C4'-P energy: -92.226 bonds (distance) P-C4' energy: -93.231 flat angles C4'-P-C4' energy: -90.598 flat angles P-C4'-P energy: -74.995 tors. eta vs tors. theta energy: -71.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -1103.786998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1103.786998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1103.786998 (E_RNA) where: Base-Base interactions energy: -693.927 where: short stacking energy: -303.510 Base-Backbone interact. energy: 0.354 local terms energy: -410.213987 where: bonds (distance) C4'-P energy: -93.471 bonds (distance) P-C4' energy: -82.945 flat angles C4'-P-C4' energy: -100.644 flat angles P-C4'-P energy: -64.894 tors. eta vs tors. theta energy: -68.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -1038.863986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.863986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.863986 (E_RNA) where: Base-Base interactions energy: -637.428 where: short stacking energy: -323.376 Base-Backbone interact. energy: -4.666 local terms energy: -396.770015 where: bonds (distance) C4'-P energy: -93.640 bonds (distance) P-C4' energy: -94.012 flat angles C4'-P-C4' energy: -81.118 flat angles P-C4'-P energy: -63.768 tors. eta vs tors. theta energy: -64.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -869.823796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.823796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -869.823796 (E_RNA) where: Base-Base interactions energy: -486.244 where: short stacking energy: -225.811 Base-Backbone interact. energy: -0.188 local terms energy: -383.391766 where: bonds (distance) C4'-P energy: -77.718 bonds (distance) P-C4' energy: -96.786 flat angles C4'-P-C4' energy: -87.992 flat angles P-C4'-P energy: -66.442 tors. eta vs tors. theta energy: -54.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -884.921584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.921584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -884.921584 (E_RNA) where: Base-Base interactions energy: -533.572 where: short stacking energy: -291.797 Base-Backbone interact. energy: 0.979 local terms energy: -352.328768 where: bonds (distance) C4'-P energy: -83.749 bonds (distance) P-C4' energy: -66.006 flat angles C4'-P-C4' energy: -89.748 flat angles P-C4'-P energy: -55.928 tors. eta vs tors. theta energy: -56.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -749.162607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -749.162607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.162607 (E_RNA) where: Base-Base interactions energy: -403.723 where: short stacking energy: -197.524 Base-Backbone interact. energy: -1.730 local terms energy: -343.709743 where: bonds (distance) C4'-P energy: -87.050 bonds (distance) P-C4' energy: -82.915 flat angles C4'-P-C4' energy: -85.692 flat angles P-C4'-P energy: -63.264 tors. eta vs tors. theta energy: -24.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -575.254812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.254812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.254812 (E_RNA) where: Base-Base interactions energy: -293.087 where: short stacking energy: -171.381 Base-Backbone interact. energy: 2.046 local terms energy: -284.213989 where: bonds (distance) C4'-P energy: -76.465 bonds (distance) P-C4' energy: -70.783 flat angles C4'-P-C4' energy: -71.660 flat angles P-C4'-P energy: -46.429 tors. eta vs tors. theta energy: -18.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -426.520696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.520696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.520696 (E_RNA) where: Base-Base interactions energy: -147.059 where: short stacking energy: -128.010 Base-Backbone interact. energy: 0.734 local terms energy: -280.195964 where: bonds (distance) C4'-P energy: -79.849 bonds (distance) P-C4' energy: -89.956 flat angles C4'-P-C4' energy: -74.869 flat angles P-C4'-P energy: -37.779 tors. eta vs tors. theta energy: 2.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -384.661236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.661236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.661236 (E_RNA) where: Base-Base interactions energy: -144.423 where: short stacking energy: -112.562 Base-Backbone interact. energy: 2.005 local terms energy: -242.242533 where: bonds (distance) C4'-P energy: -64.401 bonds (distance) P-C4' energy: -92.589 flat angles C4'-P-C4' energy: -59.824 flat angles P-C4'-P energy: -31.965 tors. eta vs tors. theta energy: 6.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -1280.447770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1280.447770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1280.447770 (E_RNA) where: Base-Base interactions energy: -804.878 where: short stacking energy: -412.276 Base-Backbone interact. energy: -2.373 local terms energy: -473.197002 where: bonds (distance) C4'-P energy: -100.996 bonds (distance) P-C4' energy: -96.250 flat angles C4'-P-C4' energy: -108.495 flat angles P-C4'-P energy: -55.408 tors. eta vs tors. theta energy: -112.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -1198.104909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1198.104909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1198.104909 (E_RNA) where: Base-Base interactions energy: -760.180 where: short stacking energy: -339.332 Base-Backbone interact. energy: -3.760 local terms energy: -434.164458 where: bonds (distance) C4'-P energy: -89.055 bonds (distance) P-C4' energy: -101.906 flat angles C4'-P-C4' energy: -108.372 flat angles P-C4'-P energy: -61.949 tors. eta vs tors. theta energy: -72.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -1083.758750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.758750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1083.758750 (E_RNA) where: Base-Base interactions energy: -673.129 where: short stacking energy: -327.231 Base-Backbone interact. energy: -3.134 local terms energy: -407.494988 where: bonds (distance) C4'-P energy: -91.433 bonds (distance) P-C4' energy: -96.812 flat angles C4'-P-C4' energy: -90.211 flat angles P-C4'-P energy: -53.463 tors. eta vs tors. theta energy: -75.576 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -1106.987762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1106.987762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1106.987762 (E_RNA) where: Base-Base interactions energy: -713.020 where: short stacking energy: -340.335 Base-Backbone interact. energy: 1.200 local terms energy: -395.168086 where: bonds (distance) C4'-P energy: -79.006 bonds (distance) P-C4' energy: -92.145 flat angles C4'-P-C4' energy: -100.305 flat angles P-C4'-P energy: -59.198 tors. eta vs tors. theta energy: -64.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -833.518421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.518421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.518421 (E_RNA) where: Base-Base interactions energy: -475.533 where: short stacking energy: -247.680 Base-Backbone interact. energy: 0.231 local terms energy: -358.216152 where: bonds (distance) C4'-P energy: -74.025 bonds (distance) P-C4' energy: -89.336 flat angles C4'-P-C4' energy: -84.374 flat angles P-C4'-P energy: -61.977 tors. eta vs tors. theta energy: -48.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -851.317956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -851.317956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -851.317956 (E_RNA) where: Base-Base interactions energy: -507.702 where: short stacking energy: -243.891 Base-Backbone interact. energy: -1.610 local terms energy: -342.005637 where: bonds (distance) C4'-P energy: -65.748 bonds (distance) P-C4' energy: -93.950 flat angles C4'-P-C4' energy: -82.031 flat angles P-C4'-P energy: -47.098 tors. eta vs tors. theta energy: -53.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -747.664744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.664744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.664744 (E_RNA) where: Base-Base interactions energy: -409.378 where: short stacking energy: -195.819 Base-Backbone interact. energy: -1.927 local terms energy: -336.359835 where: bonds (distance) C4'-P energy: -82.859 bonds (distance) P-C4' energy: -97.483 flat angles C4'-P-C4' energy: -86.235 flat angles P-C4'-P energy: -46.245 tors. eta vs tors. theta energy: -23.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -586.956141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.956141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.956141 (E_RNA) where: Base-Base interactions energy: -290.166 where: short stacking energy: -165.796 Base-Backbone interact. energy: 3.022 local terms energy: -299.811457 where: bonds (distance) C4'-P energy: -69.713 bonds (distance) P-C4' energy: -77.505 flat angles C4'-P-C4' energy: -88.027 flat angles P-C4'-P energy: -48.166 tors. eta vs tors. theta energy: -16.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -415.551811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.551811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.551811 (E_RNA) where: Base-Base interactions energy: -167.050 where: short stacking energy: -147.127 Base-Backbone interact. energy: -2.100 local terms energy: -246.401978 where: bonds (distance) C4'-P energy: -68.608 bonds (distance) P-C4' energy: -72.726 flat angles C4'-P-C4' energy: -73.039 flat angles P-C4'-P energy: -31.621 tors. eta vs tors. theta energy: -0.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -372.243290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.243290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.243290 (E_RNA) where: Base-Base interactions energy: -133.647 where: short stacking energy: -118.087 Base-Backbone interact. energy: 0.295 local terms energy: -238.891936 where: bonds (distance) C4'-P energy: -82.838 bonds (distance) P-C4' energy: -78.410 flat angles C4'-P-C4' energy: -65.446 flat angles P-C4'-P energy: -31.405 tors. eta vs tors. theta energy: 19.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -1259.124815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1259.124815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1259.124815 (E_RNA) where: Base-Base interactions energy: -809.572 where: short stacking energy: -363.809 Base-Backbone interact. energy: -0.395 local terms energy: -449.157745 where: bonds (distance) C4'-P energy: -93.234 bonds (distance) P-C4' energy: -106.662 flat angles C4'-P-C4' energy: -101.150 flat angles P-C4'-P energy: -61.525 tors. eta vs tors. theta energy: -86.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -1218.917904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1218.917904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1218.917904 (E_RNA) where: Base-Base interactions energy: -786.907 where: short stacking energy: -386.769 Base-Backbone interact. energy: -1.970 local terms energy: -430.041394 where: bonds (distance) C4'-P energy: -88.804 bonds (distance) P-C4' energy: -92.082 flat angles C4'-P-C4' energy: -84.114 flat angles P-C4'-P energy: -61.002 tors. eta vs tors. theta energy: -104.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -1160.002996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1160.002996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1160.002996 (E_RNA) where: Base-Base interactions energy: -732.609 where: short stacking energy: -358.665 Base-Backbone interact. energy: -0.368 local terms energy: -427.026016 where: bonds (distance) C4'-P energy: -90.197 bonds (distance) P-C4' energy: -102.265 flat angles C4'-P-C4' energy: -88.591 flat angles P-C4'-P energy: -66.830 tors. eta vs tors. theta energy: -79.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -1024.552317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1024.552317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1024.552317 (E_RNA) where: Base-Base interactions energy: -592.061 where: short stacking energy: -284.388 Base-Backbone interact. energy: -2.242 local terms energy: -430.248909 where: bonds (distance) C4'-P energy: -94.330 bonds (distance) P-C4' energy: -109.612 flat angles C4'-P-C4' energy: -94.184 flat angles P-C4'-P energy: -44.997 tors. eta vs tors. theta energy: -87.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -966.583246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.583246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.583246 (E_RNA) where: Base-Base interactions energy: -586.121 where: short stacking energy: -298.698 Base-Backbone interact. energy: -1.804 local terms energy: -378.658289 where: bonds (distance) C4'-P energy: -90.795 bonds (distance) P-C4' energy: -90.704 flat angles C4'-P-C4' energy: -83.044 flat angles P-C4'-P energy: -55.840 tors. eta vs tors. theta energy: -58.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -803.677577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.677577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -803.677577 (E_RNA) where: Base-Base interactions energy: -441.791 where: short stacking energy: -252.727 Base-Backbone interact. energy: 0.173 local terms energy: -362.059322 where: bonds (distance) C4'-P energy: -82.624 bonds (distance) P-C4' energy: -96.067 flat angles C4'-P-C4' energy: -94.063 flat angles P-C4'-P energy: -40.708 tors. eta vs tors. theta energy: -48.597 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -757.922226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -757.922226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.922226 (E_RNA) where: Base-Base interactions energy: -433.985 where: short stacking energy: -210.087 Base-Backbone interact. energy: -1.613 local terms energy: -322.324426 where: bonds (distance) C4'-P energy: -82.728 bonds (distance) P-C4' energy: -84.916 flat angles C4'-P-C4' energy: -73.808 flat angles P-C4'-P energy: -48.655 tors. eta vs tors. theta energy: -32.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -571.327034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.327034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.327034 (E_RNA) where: Base-Base interactions energy: -271.444 where: short stacking energy: -149.494 Base-Backbone interact. energy: -0.152 local terms energy: -299.730632 where: bonds (distance) C4'-P energy: -78.085 bonds (distance) P-C4' energy: -80.566 flat angles C4'-P-C4' energy: -81.616 flat angles P-C4'-P energy: -40.828 tors. eta vs tors. theta energy: -18.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -397.986190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.986190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.986190 (E_RNA) where: Base-Base interactions energy: -154.111 where: short stacking energy: -120.090 Base-Backbone interact. energy: 0.812 local terms energy: -244.687097 where: bonds (distance) C4'-P energy: -68.201 bonds (distance) P-C4' energy: -73.794 flat angles C4'-P-C4' energy: -67.217 flat angles P-C4'-P energy: -42.675 tors. eta vs tors. theta energy: 7.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -391.117180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.117180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.117180 (E_RNA) where: Base-Base interactions energy: -128.112 where: short stacking energy: -100.868 Base-Backbone interact. energy: 2.851 local terms energy: -265.856417 where: bonds (distance) C4'-P energy: -72.719 bonds (distance) P-C4' energy: -91.402 flat angles C4'-P-C4' energy: -62.255 flat angles P-C4'-P energy: -42.767 tors. eta vs tors. theta energy: 3.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -1276.925088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1276.925088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1276.925088 (E_RNA) where: Base-Base interactions energy: -831.923 where: short stacking energy: -392.017 Base-Backbone interact. energy: -3.240 local terms energy: -441.761643 where: bonds (distance) C4'-P energy: -87.601 bonds (distance) P-C4' energy: -99.653 flat angles C4'-P-C4' energy: -92.063 flat angles P-C4'-P energy: -68.275 tors. eta vs tors. theta energy: -94.170 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -1274.596082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1274.596082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1274.596082 (E_RNA) where: Base-Base interactions energy: -840.084 where: short stacking energy: -374.961 Base-Backbone interact. energy: 0.452 local terms energy: -434.964205 where: bonds (distance) C4'-P energy: -95.079 bonds (distance) P-C4' energy: -81.600 flat angles C4'-P-C4' energy: -96.277 flat angles P-C4'-P energy: -67.042 tors. eta vs tors. theta energy: -94.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -1219.831134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1219.831134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1219.831134 (E_RNA) where: Base-Base interactions energy: -787.111 where: short stacking energy: -380.616 Base-Backbone interact. energy: -1.397 local terms energy: -431.322384 where: bonds (distance) C4'-P energy: -89.989 bonds (distance) P-C4' energy: -93.618 flat angles C4'-P-C4' energy: -102.019 flat angles P-C4'-P energy: -59.416 tors. eta vs tors. theta energy: -86.280 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -1035.471939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.471939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1035.471939 (E_RNA) where: Base-Base interactions energy: -642.738 where: short stacking energy: -294.932 Base-Backbone interact. energy: -1.633 local terms energy: -391.100901 where: bonds (distance) C4'-P energy: -89.181 bonds (distance) P-C4' energy: -92.395 flat angles C4'-P-C4' energy: -87.175 flat angles P-C4'-P energy: -57.158 tors. eta vs tors. theta energy: -65.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -936.920447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -936.920447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -936.920447 (E_RNA) where: Base-Base interactions energy: -536.206 where: short stacking energy: -269.556 Base-Backbone interact. energy: -0.439 local terms energy: -400.275843 where: bonds (distance) C4'-P energy: -92.555 bonds (distance) P-C4' energy: -90.914 flat angles C4'-P-C4' energy: -92.386 flat angles P-C4'-P energy: -57.196 tors. eta vs tors. theta energy: -67.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -866.349278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.349278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.349278 (E_RNA) where: Base-Base interactions energy: -470.153 where: short stacking energy: -244.463 Base-Backbone interact. energy: -1.363 local terms energy: -394.833277 where: bonds (distance) C4'-P energy: -86.112 bonds (distance) P-C4' energy: -93.087 flat angles C4'-P-C4' energy: -91.498 flat angles P-C4'-P energy: -58.419 tors. eta vs tors. theta energy: -65.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -772.417768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.417768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.417768 (E_RNA) where: Base-Base interactions energy: -435.370 where: short stacking energy: -235.265 Base-Backbone interact. energy: -1.650 local terms energy: -335.398616 where: bonds (distance) C4'-P energy: -68.180 bonds (distance) P-C4' energy: -83.969 flat angles C4'-P-C4' energy: -76.910 flat angles P-C4'-P energy: -62.404 tors. eta vs tors. theta energy: -43.937 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -605.738310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.738310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.738310 (E_RNA) where: Base-Base interactions energy: -308.162 where: short stacking energy: -167.491 Base-Backbone interact. energy: 1.115 local terms energy: -298.691672 where: bonds (distance) C4'-P energy: -68.913 bonds (distance) P-C4' energy: -97.791 flat angles C4'-P-C4' energy: -91.101 flat angles P-C4'-P energy: -30.400 tors. eta vs tors. theta energy: -10.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -461.592646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.592646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.592646 (E_RNA) where: Base-Base interactions energy: -182.996 where: short stacking energy: -141.048 Base-Backbone interact. energy: -0.782 local terms energy: -277.814888 where: bonds (distance) C4'-P energy: -74.025 bonds (distance) P-C4' energy: -72.327 flat angles C4'-P-C4' energy: -74.709 flat angles P-C4'-P energy: -63.466 tors. eta vs tors. theta energy: 6.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -366.485249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.485249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.485249 (E_RNA) where: Base-Base interactions energy: -139.659 where: short stacking energy: -116.356 Base-Backbone interact. energy: -0.583 local terms energy: -226.244007 where: bonds (distance) C4'-P energy: -60.166 bonds (distance) P-C4' energy: -74.658 flat angles C4'-P-C4' energy: -73.277 flat angles P-C4'-P energy: -49.007 tors. eta vs tors. theta energy: 30.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -1331.751278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1331.751278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1331.751278 (E_RNA) where: Base-Base interactions energy: -871.202 where: short stacking energy: -396.269 Base-Backbone interact. energy: -2.135 local terms energy: -458.414343 where: bonds (distance) C4'-P energy: -89.206 bonds (distance) P-C4' energy: -97.305 flat angles C4'-P-C4' energy: -96.716 flat angles P-C4'-P energy: -69.128 tors. eta vs tors. theta energy: -106.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -1243.327929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1243.327929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1243.327929 (E_RNA) where: Base-Base interactions energy: -814.846 where: short stacking energy: -378.813 Base-Backbone interact. energy: 0.168 local terms energy: -428.650018 where: bonds (distance) C4'-P energy: -92.309 bonds (distance) P-C4' energy: -96.466 flat angles C4'-P-C4' energy: -86.507 flat angles P-C4'-P energy: -62.977 tors. eta vs tors. theta energy: -90.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -1277.087342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1277.087342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1277.087342 (E_RNA) where: Base-Base interactions energy: -819.264 where: short stacking energy: -410.986 Base-Backbone interact. energy: -2.179 local terms energy: -455.644042 where: bonds (distance) C4'-P energy: -91.111 bonds (distance) P-C4' energy: -86.724 flat angles C4'-P-C4' energy: -104.108 flat angles P-C4'-P energy: -61.840 tors. eta vs tors. theta energy: -111.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -1066.758486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1066.758486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1066.758486 (E_RNA) where: Base-Base interactions energy: -652.346 where: short stacking energy: -313.078 Base-Backbone interact. energy: -2.058 local terms energy: -412.354773 where: bonds (distance) C4'-P energy: -85.896 bonds (distance) P-C4' energy: -99.230 flat angles C4'-P-C4' energy: -90.468 flat angles P-C4'-P energy: -59.908 tors. eta vs tors. theta energy: -76.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -939.973623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -939.973623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.973623 (E_RNA) where: Base-Base interactions energy: -551.821 where: short stacking energy: -296.121 Base-Backbone interact. energy: 3.762 local terms energy: -391.915082 where: bonds (distance) C4'-P energy: -80.544 bonds (distance) P-C4' energy: -95.305 flat angles C4'-P-C4' energy: -91.389 flat angles P-C4'-P energy: -58.711 tors. eta vs tors. theta energy: -65.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -829.402105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.402105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.402105 (E_RNA) where: Base-Base interactions energy: -479.589 where: short stacking energy: -257.510 Base-Backbone interact. energy: -0.154 local terms energy: -349.658276 where: bonds (distance) C4'-P energy: -83.946 bonds (distance) P-C4' energy: -70.131 flat angles C4'-P-C4' energy: -92.259 flat angles P-C4'-P energy: -49.405 tors. eta vs tors. theta energy: -53.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -738.861331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.861331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.861331 (E_RNA) where: Base-Base interactions energy: -415.717 where: short stacking energy: -228.940 Base-Backbone interact. energy: -2.887 local terms energy: -320.257108 where: bonds (distance) C4'-P energy: -74.350 bonds (distance) P-C4' energy: -74.648 flat angles C4'-P-C4' energy: -88.149 flat angles P-C4'-P energy: -49.803 tors. eta vs tors. theta energy: -33.308 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -621.145478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.145478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.145478 (E_RNA) where: Base-Base interactions energy: -349.853 where: short stacking energy: -196.694 Base-Backbone interact. energy: -1.181 local terms energy: -270.111240 where: bonds (distance) C4'-P energy: -72.873 bonds (distance) P-C4' energy: -80.138 flat angles C4'-P-C4' energy: -78.827 flat angles P-C4'-P energy: -30.345 tors. eta vs tors. theta energy: -7.928 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -419.604127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.604127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.604127 (E_RNA) where: Base-Base interactions energy: -187.302 where: short stacking energy: -112.321 Base-Backbone interact. energy: 5.156 local terms energy: -237.457663 where: bonds (distance) C4'-P energy: -89.908 bonds (distance) P-C4' energy: -59.250 flat angles C4'-P-C4' energy: -70.647 flat angles P-C4'-P energy: -44.943 tors. eta vs tors. theta energy: 27.290 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -389.343935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.343935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.343935 (E_RNA) where: Base-Base interactions energy: -131.403 where: short stacking energy: -119.977 Base-Backbone interact. energy: -1.074 local terms energy: -256.866462 where: bonds (distance) C4'-P energy: -83.360 bonds (distance) P-C4' energy: -77.462 flat angles C4'-P-C4' energy: -75.721 flat angles P-C4'-P energy: -28.547 tors. eta vs tors. theta energy: 8.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -1347.086433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1347.086433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1347.086433 (E_RNA) where: Base-Base interactions energy: -869.448 where: short stacking energy: -401.273 Base-Backbone interact. energy: -3.787 local terms energy: -473.851828 where: bonds (distance) C4'-P energy: -94.051 bonds (distance) P-C4' energy: -100.521 flat angles C4'-P-C4' energy: -102.014 flat angles P-C4'-P energy: -68.207 tors. eta vs tors. theta energy: -109.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -1302.261592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1302.261592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1302.261592 (E_RNA) where: Base-Base interactions energy: -848.276 where: short stacking energy: -422.228 Base-Backbone interact. energy: -1.766 local terms energy: -452.219399 where: bonds (distance) C4'-P energy: -70.192 bonds (distance) P-C4' energy: -95.433 flat angles C4'-P-C4' energy: -98.043 flat angles P-C4'-P energy: -80.206 tors. eta vs tors. theta energy: -108.345 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -1215.670210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1215.670210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1215.670210 (E_RNA) where: Base-Base interactions energy: -766.334 where: short stacking energy: -346.884 Base-Backbone interact. energy: -3.427 local terms energy: -445.909258 where: bonds (distance) C4'-P energy: -90.459 bonds (distance) P-C4' energy: -98.721 flat angles C4'-P-C4' energy: -93.852 flat angles P-C4'-P energy: -64.676 tors. eta vs tors. theta energy: -98.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -1069.044656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.044656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1069.044656 (E_RNA) where: Base-Base interactions energy: -677.614 where: short stacking energy: -329.684 Base-Backbone interact. energy: 1.984 local terms energy: -393.414550 where: bonds (distance) C4'-P energy: -82.944 bonds (distance) P-C4' energy: -97.901 flat angles C4'-P-C4' energy: -77.159 flat angles P-C4'-P energy: -67.403 tors. eta vs tors. theta energy: -68.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -929.701711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -929.701711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -929.701711 (E_RNA) where: Base-Base interactions energy: -554.559 where: short stacking energy: -297.905 Base-Backbone interact. energy: -2.284 local terms energy: -372.858317 where: bonds (distance) C4'-P energy: -88.237 bonds (distance) P-C4' energy: -86.791 flat angles C4'-P-C4' energy: -84.967 flat angles P-C4'-P energy: -46.683 tors. eta vs tors. theta energy: -66.180 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -830.284019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -830.284019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -830.284019 (E_RNA) where: Base-Base interactions energy: -449.679 where: short stacking energy: -257.861 Base-Backbone interact. energy: -1.587 local terms energy: -379.018462 where: bonds (distance) C4'-P energy: -90.720 bonds (distance) P-C4' energy: -86.099 flat angles C4'-P-C4' energy: -85.409 flat angles P-C4'-P energy: -51.614 tors. eta vs tors. theta energy: -65.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -730.355880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.355880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.355880 (E_RNA) where: Base-Base interactions energy: -402.632 where: short stacking energy: -219.237 Base-Backbone interact. energy: -2.799 local terms energy: -324.924991 where: bonds (distance) C4'-P energy: -89.925 bonds (distance) P-C4' energy: -82.315 flat angles C4'-P-C4' energy: -83.120 flat angles P-C4'-P energy: -48.958 tors. eta vs tors. theta energy: -20.607 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -599.609505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.609505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.609505 (E_RNA) where: Base-Base interactions energy: -281.049 where: short stacking energy: -163.650 Base-Backbone interact. energy: 1.540 local terms energy: -320.100033 where: bonds (distance) C4'-P energy: -80.094 bonds (distance) P-C4' energy: -79.221 flat angles C4'-P-C4' energy: -92.529 flat angles P-C4'-P energy: -44.775 tors. eta vs tors. theta energy: -23.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -391.021008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.021008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.021008 (E_RNA) where: Base-Base interactions energy: -136.918 where: short stacking energy: -103.689 Base-Backbone interact. energy: -0.356 local terms energy: -253.746661 where: bonds (distance) C4'-P energy: -63.587 bonds (distance) P-C4' energy: -86.289 flat angles C4'-P-C4' energy: -84.221 flat angles P-C4'-P energy: -41.133 tors. eta vs tors. theta energy: 21.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -420.287188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.287188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.287188 (E_RNA) where: Base-Base interactions energy: -142.180 where: short stacking energy: -119.782 Base-Backbone interact. energy: 1.009 local terms energy: -279.115424 where: bonds (distance) C4'-P energy: -64.016 bonds (distance) P-C4' energy: -94.739 flat angles C4'-P-C4' energy: -73.428 flat angles P-C4'-P energy: -51.728 tors. eta vs tors. theta energy: 4.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -1361.413254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1361.413254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1361.413254 (E_RNA) where: Base-Base interactions energy: -852.658 where: short stacking energy: -423.965 Base-Backbone interact. energy: -3.670 local terms energy: -505.085136 where: bonds (distance) C4'-P energy: -100.421 bonds (distance) P-C4' energy: -95.962 flat angles C4'-P-C4' energy: -109.020 flat angles P-C4'-P energy: -74.825 tors. eta vs tors. theta energy: -124.857 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -1277.618552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1277.618552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1277.618552 (E_RNA) where: Base-Base interactions energy: -829.668 where: short stacking energy: -365.552 Base-Backbone interact. energy: -3.106 local terms energy: -444.844866 where: bonds (distance) C4'-P energy: -92.276 bonds (distance) P-C4' energy: -95.911 flat angles C4'-P-C4' energy: -107.032 flat angles P-C4'-P energy: -56.293 tors. eta vs tors. theta energy: -93.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -1166.304080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1166.304080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1166.304080 (E_RNA) where: Base-Base interactions energy: -747.108 where: short stacking energy: -371.562 Base-Backbone interact. energy: -3.912 local terms energy: -415.284036 where: bonds (distance) C4'-P energy: -78.746 bonds (distance) P-C4' energy: -83.509 flat angles C4'-P-C4' energy: -101.948 flat angles P-C4'-P energy: -54.721 tors. eta vs tors. theta energy: -96.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -1005.883283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.883283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1005.883283 (E_RNA) where: Base-Base interactions energy: -609.964 where: short stacking energy: -287.077 Base-Backbone interact. energy: 0.929 local terms energy: -396.848416 where: bonds (distance) C4'-P energy: -78.256 bonds (distance) P-C4' energy: -105.596 flat angles C4'-P-C4' energy: -87.884 flat angles P-C4'-P energy: -66.975 tors. eta vs tors. theta energy: -58.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -911.997732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -911.997732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.997732 (E_RNA) where: Base-Base interactions energy: -552.891 where: short stacking energy: -290.123 Base-Backbone interact. energy: -1.088 local terms energy: -358.018876 where: bonds (distance) C4'-P energy: -92.608 bonds (distance) P-C4' energy: -68.582 flat angles C4'-P-C4' energy: -96.620 flat angles P-C4'-P energy: -47.051 tors. eta vs tors. theta energy: -53.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -802.483878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -802.483878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -802.483878 (E_RNA) where: Base-Base interactions energy: -452.723 where: short stacking energy: -241.558 Base-Backbone interact. energy: -1.719 local terms energy: -348.042154 where: bonds (distance) C4'-P energy: -85.406 bonds (distance) P-C4' energy: -83.716 flat angles C4'-P-C4' energy: -80.552 flat angles P-C4'-P energy: -56.748 tors. eta vs tors. theta energy: -41.620 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -736.197822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.197822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.197822 (E_RNA) where: Base-Base interactions energy: -410.293 where: short stacking energy: -205.958 Base-Backbone interact. energy: -2.128 local terms energy: -323.776426 where: bonds (distance) C4'-P energy: -82.407 bonds (distance) P-C4' energy: -86.454 flat angles C4'-P-C4' energy: -75.895 flat angles P-C4'-P energy: -49.421 tors. eta vs tors. theta energy: -29.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -563.189246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.189246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.189246 (E_RNA) where: Base-Base interactions energy: -267.964 where: short stacking energy: -184.487 Base-Backbone interact. energy: 9.642 local terms energy: -304.867030 where: bonds (distance) C4'-P energy: -80.142 bonds (distance) P-C4' energy: -70.607 flat angles C4'-P-C4' energy: -84.156 flat angles P-C4'-P energy: -48.176 tors. eta vs tors. theta energy: -21.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -406.492025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.492025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.492025 (E_RNA) where: Base-Base interactions energy: -157.547 where: short stacking energy: -131.098 Base-Backbone interact. energy: 2.916 local terms energy: -251.860643 where: bonds (distance) C4'-P energy: -71.014 bonds (distance) P-C4' energy: -67.307 flat angles C4'-P-C4' energy: -74.829 flat angles P-C4'-P energy: -45.970 tors. eta vs tors. theta energy: 7.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -367.668966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.668966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.668966 (E_RNA) where: Base-Base interactions energy: -114.002 where: short stacking energy: -100.784 Base-Backbone interact. energy: -1.104 local terms energy: -252.563253 where: bonds (distance) C4'-P energy: -84.235 bonds (distance) P-C4' energy: -71.342 flat angles C4'-P-C4' energy: -66.636 flat angles P-C4'-P energy: -39.370 tors. eta vs tors. theta energy: 9.020 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -1372.113543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1372.113543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1372.113543 (E_RNA) where: Base-Base interactions energy: -878.931 where: short stacking energy: -435.875 Base-Backbone interact. energy: -2.235 local terms energy: -490.946887 where: bonds (distance) C4'-P energy: -89.964 bonds (distance) P-C4' energy: -98.981 flat angles C4'-P-C4' energy: -104.811 flat angles P-C4'-P energy: -74.216 tors. eta vs tors. theta energy: -122.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -1270.755763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1270.755763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1270.755763 (E_RNA) where: Base-Base interactions energy: -830.472 where: short stacking energy: -357.752 Base-Backbone interact. energy: -2.029 local terms energy: -438.254759 where: bonds (distance) C4'-P energy: -93.961 bonds (distance) P-C4' energy: -98.061 flat angles C4'-P-C4' energy: -89.847 flat angles P-C4'-P energy: -71.377 tors. eta vs tors. theta energy: -85.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -1140.589459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1140.589459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1140.589459 (E_RNA) where: Base-Base interactions energy: -700.942 where: short stacking energy: -376.388 Base-Backbone interact. energy: -2.168 local terms energy: -437.479497 where: bonds (distance) C4'-P energy: -66.104 bonds (distance) P-C4' energy: -89.379 flat angles C4'-P-C4' energy: -108.347 flat angles P-C4'-P energy: -68.689 tors. eta vs tors. theta energy: -104.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -1030.054428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1030.054428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1030.054428 (E_RNA) where: Base-Base interactions energy: -630.938 where: short stacking energy: -301.083 Base-Backbone interact. energy: -1.379 local terms energy: -397.738054 where: bonds (distance) C4'-P energy: -94.331 bonds (distance) P-C4' energy: -84.608 flat angles C4'-P-C4' energy: -85.591 flat angles P-C4'-P energy: -65.609 tors. eta vs tors. theta energy: -67.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -960.774681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.774681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.774681 (E_RNA) where: Base-Base interactions energy: -593.869 where: short stacking energy: -286.066 Base-Backbone interact. energy: -2.017 local terms energy: -364.889373 where: bonds (distance) C4'-P energy: -80.640 bonds (distance) P-C4' energy: -96.134 flat angles C4'-P-C4' energy: -76.006 flat angles P-C4'-P energy: -56.350 tors. eta vs tors. theta energy: -55.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -778.627288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.627288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.627288 (E_RNA) where: Base-Base interactions energy: -451.562 where: short stacking energy: -252.280 Base-Backbone interact. energy: -0.279 local terms energy: -326.786208 where: bonds (distance) C4'-P energy: -70.261 bonds (distance) P-C4' energy: -76.629 flat angles C4'-P-C4' energy: -84.841 flat angles P-C4'-P energy: -51.152 tors. eta vs tors. theta energy: -43.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -822.248170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.248170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -822.248170 (E_RNA) where: Base-Base interactions energy: -475.248 where: short stacking energy: -247.118 Base-Backbone interact. energy: 2.319 local terms energy: -349.320031 where: bonds (distance) C4'-P energy: -69.225 bonds (distance) P-C4' energy: -80.000 flat angles C4'-P-C4' energy: -108.672 flat angles P-C4'-P energy: -49.176 tors. eta vs tors. theta energy: -42.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -556.706195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.706195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.706195 (E_RNA) where: Base-Base interactions energy: -271.004 where: short stacking energy: -155.227 Base-Backbone interact. energy: 0.915 local terms energy: -286.617402 where: bonds (distance) C4'-P energy: -83.977 bonds (distance) P-C4' energy: -85.559 flat angles C4'-P-C4' energy: -62.881 flat angles P-C4'-P energy: -43.347 tors. eta vs tors. theta energy: -10.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -389.203674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.203674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.203674 (E_RNA) where: Base-Base interactions energy: -123.625 where: short stacking energy: -115.813 Base-Backbone interact. energy: -0.050 local terms energy: -265.528755 where: bonds (distance) C4'-P energy: -80.385 bonds (distance) P-C4' energy: -82.081 flat angles C4'-P-C4' energy: -72.196 flat angles P-C4'-P energy: -50.583 tors. eta vs tors. theta energy: 19.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -377.442701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.442701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.442701 (E_RNA) where: Base-Base interactions energy: -113.379 where: short stacking energy: -83.387 Base-Backbone interact. energy: 0.396 local terms energy: -264.459812 where: bonds (distance) C4'-P energy: -75.584 bonds (distance) P-C4' energy: -82.739 flat angles C4'-P-C4' energy: -55.009 flat angles P-C4'-P energy: -48.826 tors. eta vs tors. theta energy: -2.301 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -1340.434649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1340.434649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1340.434649 (E_RNA) where: Base-Base interactions energy: -877.296 where: short stacking energy: -416.390 Base-Backbone interact. energy: -0.627 local terms energy: -462.512221 where: bonds (distance) C4'-P energy: -91.052 bonds (distance) P-C4' energy: -91.679 flat angles C4'-P-C4' energy: -105.141 flat angles P-C4'-P energy: -56.269 tors. eta vs tors. theta energy: -118.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -1266.979967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1266.979967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1266.979967 (E_RNA) where: Base-Base interactions energy: -841.052 where: short stacking energy: -387.317 Base-Backbone interact. energy: 0.060 local terms energy: -425.987869 where: bonds (distance) C4'-P energy: -90.530 bonds (distance) P-C4' energy: -96.377 flat angles C4'-P-C4' energy: -104.721 flat angles P-C4'-P energy: -49.929 tors. eta vs tors. theta energy: -84.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -1147.582519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1147.582519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1147.582519 (E_RNA) where: Base-Base interactions energy: -716.900 where: short stacking energy: -327.736 Base-Backbone interact. energy: -3.527 local terms energy: -427.155399 where: bonds (distance) C4'-P energy: -99.828 bonds (distance) P-C4' energy: -91.967 flat angles C4'-P-C4' energy: -92.244 flat angles P-C4'-P energy: -62.329 tors. eta vs tors. theta energy: -80.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -1059.395187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.395187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.395187 (E_RNA) where: Base-Base interactions energy: -655.521 where: short stacking energy: -344.774 Base-Backbone interact. energy: -1.607 local terms energy: -402.266734 where: bonds (distance) C4'-P energy: -79.488 bonds (distance) P-C4' energy: -94.720 flat angles C4'-P-C4' energy: -95.882 flat angles P-C4'-P energy: -50.645 tors. eta vs tors. theta energy: -81.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -984.612048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.612048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.612048 (E_RNA) where: Base-Base interactions energy: -626.620 where: short stacking energy: -308.007 Base-Backbone interact. energy: -2.098 local terms energy: -355.893855 where: bonds (distance) C4'-P energy: -80.587 bonds (distance) P-C4' energy: -79.411 flat angles C4'-P-C4' energy: -81.344 flat angles P-C4'-P energy: -39.637 tors. eta vs tors. theta energy: -74.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -764.590220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -764.590220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -764.590220 (E_RNA) where: Base-Base interactions energy: -401.028 where: short stacking energy: -216.084 Base-Backbone interact. energy: -2.795 local terms energy: -360.767575 where: bonds (distance) C4'-P energy: -88.636 bonds (distance) P-C4' energy: -99.569 flat angles C4'-P-C4' energy: -84.360 flat angles P-C4'-P energy: -56.056 tors. eta vs tors. theta energy: -32.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -841.663873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.663873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.663873 (E_RNA) where: Base-Base interactions energy: -480.549 where: short stacking energy: -244.315 Base-Backbone interact. energy: -0.274 local terms energy: -360.840244 where: bonds (distance) C4'-P energy: -80.755 bonds (distance) P-C4' energy: -92.330 flat angles C4'-P-C4' energy: -92.809 flat angles P-C4'-P energy: -45.952 tors. eta vs tors. theta energy: -48.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -569.049623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.049623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.049623 (E_RNA) where: Base-Base interactions energy: -268.057 where: short stacking energy: -170.113 Base-Backbone interact. energy: -0.998 local terms energy: -299.993773 where: bonds (distance) C4'-P energy: -65.940 bonds (distance) P-C4' energy: -82.143 flat angles C4'-P-C4' energy: -76.228 flat angles P-C4'-P energy: -51.502 tors. eta vs tors. theta energy: -24.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -423.571749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.571749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.571749 (E_RNA) where: Base-Base interactions energy: -159.386 where: short stacking energy: -110.397 Base-Backbone interact. energy: 1.707 local terms energy: -265.892492 where: bonds (distance) C4'-P energy: -64.246 bonds (distance) P-C4' energy: -81.220 flat angles C4'-P-C4' energy: -80.948 flat angles P-C4'-P energy: -48.133 tors. eta vs tors. theta energy: 8.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -396.644770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.644770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.644770 (E_RNA) where: Base-Base interactions energy: -159.674 where: short stacking energy: -117.174 Base-Backbone interact. energy: -2.600 local terms energy: -234.370687 where: bonds (distance) C4'-P energy: -84.251 bonds (distance) P-C4' energy: -83.816 flat angles C4'-P-C4' energy: -66.158 flat angles P-C4'-P energy: -19.927 tors. eta vs tors. theta energy: 19.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -1359.137709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1359.137709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1359.137709 (E_RNA) where: Base-Base interactions energy: -871.401 where: short stacking energy: -396.165 Base-Backbone interact. energy: -0.536 local terms energy: -487.200481 where: bonds (distance) C4'-P energy: -98.933 bonds (distance) P-C4' energy: -103.197 flat angles C4'-P-C4' energy: -98.733 flat angles P-C4'-P energy: -74.893 tors. eta vs tors. theta energy: -111.444 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -1270.103286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1270.103286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1270.103286 (E_RNA) where: Base-Base interactions energy: -828.715 where: short stacking energy: -379.625 Base-Backbone interact. energy: -0.510 local terms energy: -440.879055 where: bonds (distance) C4'-P energy: -89.998 bonds (distance) P-C4' energy: -102.693 flat angles C4'-P-C4' energy: -99.926 flat angles P-C4'-P energy: -61.926 tors. eta vs tors. theta energy: -86.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -1187.492532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1187.492532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1187.492532 (E_RNA) where: Base-Base interactions energy: -762.443 where: short stacking energy: -344.373 Base-Backbone interact. energy: -1.757 local terms energy: -423.292702 where: bonds (distance) C4'-P energy: -83.354 bonds (distance) P-C4' energy: -94.585 flat angles C4'-P-C4' energy: -81.837 flat angles P-C4'-P energy: -66.711 tors. eta vs tors. theta energy: -96.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -1062.124241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1062.124241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1062.124241 (E_RNA) where: Base-Base interactions energy: -649.854 where: short stacking energy: -347.911 Base-Backbone interact. energy: -2.592 local terms energy: -409.678164 where: bonds (distance) C4'-P energy: -75.997 bonds (distance) P-C4' energy: -92.014 flat angles C4'-P-C4' energy: -100.233 flat angles P-C4'-P energy: -59.509 tors. eta vs tors. theta energy: -81.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -979.915388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -979.915388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -979.915388 (E_RNA) where: Base-Base interactions energy: -574.531 where: short stacking energy: -320.369 Base-Backbone interact. energy: -1.062 local terms energy: -404.322091 where: bonds (distance) C4'-P energy: -90.762 bonds (distance) P-C4' energy: -84.876 flat angles C4'-P-C4' energy: -107.738 flat angles P-C4'-P energy: -46.064 tors. eta vs tors. theta energy: -74.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -809.827255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -809.827255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.827255 (E_RNA) where: Base-Base interactions energy: -474.672 where: short stacking energy: -233.161 Base-Backbone interact. energy: 0.320 local terms energy: -335.475182 where: bonds (distance) C4'-P energy: -61.869 bonds (distance) P-C4' energy: -85.493 flat angles C4'-P-C4' energy: -92.022 flat angles P-C4'-P energy: -55.576 tors. eta vs tors. theta energy: -40.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -714.501292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.501292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.501292 (E_RNA) where: Base-Base interactions energy: -390.583 where: short stacking energy: -207.563 Base-Backbone interact. energy: -3.121 local terms energy: -320.797082 where: bonds (distance) C4'-P energy: -71.507 bonds (distance) P-C4' energy: -87.324 flat angles C4'-P-C4' energy: -71.863 flat angles P-C4'-P energy: -58.173 tors. eta vs tors. theta energy: -31.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -542.344760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.344760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.344760 (E_RNA) where: Base-Base interactions energy: -223.971 where: short stacking energy: -148.032 Base-Backbone interact. energy: 3.212 local terms energy: -321.586106 where: bonds (distance) C4'-P energy: -90.323 bonds (distance) P-C4' energy: -87.628 flat angles C4'-P-C4' energy: -66.519 flat angles P-C4'-P energy: -52.459 tors. eta vs tors. theta energy: -24.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -415.928968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.928968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.928968 (E_RNA) where: Base-Base interactions energy: -198.429 where: short stacking energy: -139.137 Base-Backbone interact. energy: 4.445 local terms energy: -221.944565 where: bonds (distance) C4'-P energy: -62.105 bonds (distance) P-C4' energy: -81.699 flat angles C4'-P-C4' energy: -47.990 flat angles P-C4'-P energy: -42.472 tors. eta vs tors. theta energy: 12.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -405.926273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.926273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.926273 (E_RNA) where: Base-Base interactions energy: -154.767 where: short stacking energy: -94.341 Base-Backbone interact. energy: -0.734 local terms energy: -250.425139 where: bonds (distance) C4'-P energy: -68.663 bonds (distance) P-C4' energy: -94.877 flat angles C4'-P-C4' energy: -60.536 flat angles P-C4'-P energy: -45.674 tors. eta vs tors. theta energy: 19.326 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -1400.908454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.908454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1400.908454 (E_RNA) where: Base-Base interactions energy: -917.602 where: short stacking energy: -409.754 Base-Backbone interact. energy: -2.463 local terms energy: -480.844249 where: bonds (distance) C4'-P energy: -90.086 bonds (distance) P-C4' energy: -93.175 flat angles C4'-P-C4' energy: -110.806 flat angles P-C4'-P energy: -70.001 tors. eta vs tors. theta energy: -116.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -1290.215835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1290.215835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1290.215835 (E_RNA) where: Base-Base interactions energy: -841.782 where: short stacking energy: -350.198 Base-Backbone interact. energy: -3.338 local terms energy: -445.096054 where: bonds (distance) C4'-P energy: -92.192 bonds (distance) P-C4' energy: -102.753 flat angles C4'-P-C4' energy: -99.057 flat angles P-C4'-P energy: -72.147 tors. eta vs tors. theta energy: -78.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -1182.136977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1182.136977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1182.136977 (E_RNA) where: Base-Base interactions energy: -733.727 where: short stacking energy: -362.855 Base-Backbone interact. energy: -3.974 local terms energy: -444.435742 where: bonds (distance) C4'-P energy: -77.116 bonds (distance) P-C4' energy: -107.693 flat angles C4'-P-C4' energy: -94.005 flat angles P-C4'-P energy: -68.177 tors. eta vs tors. theta energy: -97.444 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -1088.861033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1088.861033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1088.861033 (E_RNA) where: Base-Base interactions energy: -661.558 where: short stacking energy: -330.121 Base-Backbone interact. energy: -1.448 local terms energy: -425.855256 where: bonds (distance) C4'-P energy: -85.562 bonds (distance) P-C4' energy: -97.692 flat angles C4'-P-C4' energy: -96.759 flat angles P-C4'-P energy: -55.241 tors. eta vs tors. theta energy: -90.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -989.990755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.990755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -989.990755 (E_RNA) where: Base-Base interactions energy: -628.225 where: short stacking energy: -304.419 Base-Backbone interact. energy: -1.646 local terms energy: -360.119819 where: bonds (distance) C4'-P energy: -79.802 bonds (distance) P-C4' energy: -91.221 flat angles C4'-P-C4' energy: -82.224 flat angles P-C4'-P energy: -55.950 tors. eta vs tors. theta energy: -50.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -797.309690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.309690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.309690 (E_RNA) where: Base-Base interactions energy: -432.893 where: short stacking energy: -236.865 Base-Backbone interact. energy: -1.934 local terms energy: -362.482483 where: bonds (distance) C4'-P energy: -88.793 bonds (distance) P-C4' energy: -85.285 flat angles C4'-P-C4' energy: -87.577 flat angles P-C4'-P energy: -48.785 tors. eta vs tors. theta energy: -52.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -708.697828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.697828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.697828 (E_RNA) where: Base-Base interactions energy: -385.109 where: short stacking energy: -200.508 Base-Backbone interact. energy: -1.895 local terms energy: -321.693253 where: bonds (distance) C4'-P energy: -87.757 bonds (distance) P-C4' energy: -87.959 flat angles C4'-P-C4' energy: -78.473 flat angles P-C4'-P energy: -47.292 tors. eta vs tors. theta energy: -20.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -602.268566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.268566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.268566 (E_RNA) where: Base-Base interactions energy: -292.293 where: short stacking energy: -161.022 Base-Backbone interact. energy: -1.307 local terms energy: -308.668393 where: bonds (distance) C4'-P energy: -79.273 bonds (distance) P-C4' energy: -82.212 flat angles C4'-P-C4' energy: -80.314 flat angles P-C4'-P energy: -49.510 tors. eta vs tors. theta energy: -17.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -437.407280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.407280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.407280 (E_RNA) where: Base-Base interactions energy: -179.715 where: short stacking energy: -109.355 Base-Backbone interact. energy: 3.932 local terms energy: -261.624939 where: bonds (distance) C4'-P energy: -83.556 bonds (distance) P-C4' energy: -72.156 flat angles C4'-P-C4' energy: -62.391 flat angles P-C4'-P energy: -50.137 tors. eta vs tors. theta energy: 6.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -371.568760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.568760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.568760 (E_RNA) where: Base-Base interactions energy: -143.971 where: short stacking energy: -125.998 Base-Backbone interact. energy: 4.700 local terms energy: -232.297892 where: bonds (distance) C4'-P energy: -65.909 bonds (distance) P-C4' energy: -85.374 flat angles C4'-P-C4' energy: -58.196 flat angles P-C4'-P energy: -40.768 tors. eta vs tors. theta energy: 17.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -1402.825699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1402.825699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1402.825699 (E_RNA) where: Base-Base interactions energy: -910.656 where: short stacking energy: -387.833 Base-Backbone interact. energy: -1.758 local terms energy: -490.410969 where: bonds (distance) C4'-P energy: -94.504 bonds (distance) P-C4' energy: -107.651 flat angles C4'-P-C4' energy: -111.755 flat angles P-C4'-P energy: -70.615 tors. eta vs tors. theta energy: -105.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -1259.274968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1259.274968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1259.274968 (E_RNA) where: Base-Base interactions energy: -833.796 where: short stacking energy: -363.448 Base-Backbone interact. energy: -0.037 local terms energy: -425.441770 where: bonds (distance) C4'-P energy: -97.937 bonds (distance) P-C4' energy: -92.265 flat angles C4'-P-C4' energy: -97.887 flat angles P-C4'-P energy: -60.357 tors. eta vs tors. theta energy: -76.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -1197.408907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1197.408907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1197.408907 (E_RNA) where: Base-Base interactions energy: -757.368 where: short stacking energy: -372.641 Base-Backbone interact. energy: -1.536 local terms energy: -438.504783 where: bonds (distance) C4'-P energy: -82.017 bonds (distance) P-C4' energy: -89.516 flat angles C4'-P-C4' energy: -108.867 flat angles P-C4'-P energy: -57.410 tors. eta vs tors. theta energy: -100.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -1067.894773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.894773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1067.894773 (E_RNA) where: Base-Base interactions energy: -670.259 where: short stacking energy: -337.853 Base-Backbone interact. energy: -0.107 local terms energy: -397.529063 where: bonds (distance) C4'-P energy: -87.409 bonds (distance) P-C4' energy: -78.632 flat angles C4'-P-C4' energy: -90.139 flat angles P-C4'-P energy: -60.480 tors. eta vs tors. theta energy: -80.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -971.329091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -971.329091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -971.329091 (E_RNA) where: Base-Base interactions energy: -595.297 where: short stacking energy: -284.658 Base-Backbone interact. energy: -3.797 local terms energy: -372.235135 where: bonds (distance) C4'-P energy: -85.601 bonds (distance) P-C4' energy: -88.737 flat angles C4'-P-C4' energy: -79.562 flat angles P-C4'-P energy: -66.245 tors. eta vs tors. theta energy: -52.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -825.577326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -825.577326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -825.577326 (E_RNA) where: Base-Base interactions energy: -487.356 where: short stacking energy: -269.293 Base-Backbone interact. energy: -3.254 local terms energy: -334.967050 where: bonds (distance) C4'-P energy: -77.234 bonds (distance) P-C4' energy: -73.311 flat angles C4'-P-C4' energy: -79.608 flat angles P-C4'-P energy: -59.556 tors. eta vs tors. theta energy: -45.257 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -772.433149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.433149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.433149 (E_RNA) where: Base-Base interactions energy: -423.727 where: short stacking energy: -216.066 Base-Backbone interact. energy: -0.358 local terms energy: -348.348464 where: bonds (distance) C4'-P energy: -93.226 bonds (distance) P-C4' energy: -84.728 flat angles C4'-P-C4' energy: -75.746 flat angles P-C4'-P energy: -59.387 tors. eta vs tors. theta energy: -35.262 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -552.068272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.068272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.068272 (E_RNA) where: Base-Base interactions energy: -261.508 where: short stacking energy: -170.077 Base-Backbone interact. energy: -1.211 local terms energy: -289.349881 where: bonds (distance) C4'-P energy: -90.205 bonds (distance) P-C4' energy: -82.459 flat angles C4'-P-C4' energy: -71.744 flat angles P-C4'-P energy: -25.258 tors. eta vs tors. theta energy: -19.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -489.017137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.017137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.017137 (E_RNA) where: Base-Base interactions energy: -200.245 where: short stacking energy: -147.899 Base-Backbone interact. energy: 0.115 local terms energy: -288.887744 where: bonds (distance) C4'-P energy: -80.966 bonds (distance) P-C4' energy: -94.830 flat angles C4'-P-C4' energy: -68.714 flat angles P-C4'-P energy: -42.344 tors. eta vs tors. theta energy: -2.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -389.527511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.527511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.527511 (E_RNA) where: Base-Base interactions energy: -141.502 where: short stacking energy: -120.401 Base-Backbone interact. energy: -2.291 local terms energy: -245.734528 where: bonds (distance) C4'-P energy: -75.489 bonds (distance) P-C4' energy: -75.072 flat angles C4'-P-C4' energy: -80.730 flat angles P-C4'-P energy: -28.203 tors. eta vs tors. theta energy: 13.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -1407.296408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1407.296408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1407.296408 (E_RNA) where: Base-Base interactions energy: -939.984 where: short stacking energy: -413.375 Base-Backbone interact. energy: 0.095 local terms energy: -467.407552 where: bonds (distance) C4'-P energy: -87.638 bonds (distance) P-C4' energy: -95.170 flat angles C4'-P-C4' energy: -105.389 flat angles P-C4'-P energy: -63.145 tors. eta vs tors. theta energy: -116.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -1251.870209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1251.870209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1251.870209 (E_RNA) where: Base-Base interactions energy: -816.476 where: short stacking energy: -388.683 Base-Backbone interact. energy: -0.508 local terms energy: -434.885778 where: bonds (distance) C4'-P energy: -92.182 bonds (distance) P-C4' energy: -86.822 flat angles C4'-P-C4' energy: -96.823 flat angles P-C4'-P energy: -60.383 tors. eta vs tors. theta energy: -98.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -1196.300816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.300816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1196.300816 (E_RNA) where: Base-Base interactions energy: -763.967 where: short stacking energy: -354.286 Base-Backbone interact. energy: 1.700 local terms energy: -434.033684 where: bonds (distance) C4'-P energy: -93.318 bonds (distance) P-C4' energy: -96.590 flat angles C4'-P-C4' energy: -101.933 flat angles P-C4'-P energy: -59.349 tors. eta vs tors. theta energy: -82.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -1118.675540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1118.675540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1118.675540 (E_RNA) where: Base-Base interactions energy: -704.906 where: short stacking energy: -352.855 Base-Backbone interact. energy: 0.544 local terms energy: -414.313509 where: bonds (distance) C4'-P energy: -95.907 bonds (distance) P-C4' energy: -97.138 flat angles C4'-P-C4' energy: -79.077 flat angles P-C4'-P energy: -50.912 tors. eta vs tors. theta energy: -91.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -962.569396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -962.569396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.569396 (E_RNA) where: Base-Base interactions energy: -591.979 where: short stacking energy: -287.987 Base-Backbone interact. energy: -1.997 local terms energy: -368.593552 where: bonds (distance) C4'-P energy: -88.688 bonds (distance) P-C4' energy: -84.705 flat angles C4'-P-C4' energy: -87.740 flat angles P-C4'-P energy: -47.312 tors. eta vs tors. theta energy: -60.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -857.099213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -857.099213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -857.099213 (E_RNA) where: Base-Base interactions energy: -486.749 where: short stacking energy: -242.274 Base-Backbone interact. energy: 0.381 local terms energy: -370.731672 where: bonds (distance) C4'-P energy: -91.981 bonds (distance) P-C4' energy: -90.847 flat angles C4'-P-C4' energy: -76.682 flat angles P-C4'-P energy: -53.251 tors. eta vs tors. theta energy: -57.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -762.551588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.551588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.551588 (E_RNA) where: Base-Base interactions energy: -418.003 where: short stacking energy: -229.525 Base-Backbone interact. energy: 2.240 local terms energy: -346.788777 where: bonds (distance) C4'-P energy: -82.095 bonds (distance) P-C4' energy: -88.528 flat angles C4'-P-C4' energy: -82.241 flat angles P-C4'-P energy: -61.666 tors. eta vs tors. theta energy: -32.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -567.534928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.534928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.534928 (E_RNA) where: Base-Base interactions energy: -276.534 where: short stacking energy: -167.896 Base-Backbone interact. energy: -0.969 local terms energy: -290.031838 where: bonds (distance) C4'-P energy: -83.235 bonds (distance) P-C4' energy: -89.978 flat angles C4'-P-C4' energy: -59.096 flat angles P-C4'-P energy: -53.481 tors. eta vs tors. theta energy: -4.242 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -502.661494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.661494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.661494 (E_RNA) where: Base-Base interactions energy: -222.547 where: short stacking energy: -127.390 Base-Backbone interact. energy: -4.244 local terms energy: -275.870100 where: bonds (distance) C4'-P energy: -72.690 bonds (distance) P-C4' energy: -90.977 flat angles C4'-P-C4' energy: -79.156 flat angles P-C4'-P energy: -33.883 tors. eta vs tors. theta energy: 0.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -409.030731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.030731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.030731 (E_RNA) where: Base-Base interactions energy: -154.592 where: short stacking energy: -131.908 Base-Backbone interact. energy: 5.710 local terms energy: -260.148445 where: bonds (distance) C4'-P energy: -78.860 bonds (distance) P-C4' energy: -80.095 flat angles C4'-P-C4' energy: -68.364 flat angles P-C4'-P energy: -31.710 tors. eta vs tors. theta energy: -1.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -1403.106677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1403.106677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1403.106677 (E_RNA) where: Base-Base interactions energy: -928.930 where: short stacking energy: -412.684 Base-Backbone interact. energy: -1.141 local terms energy: -473.036036 where: bonds (distance) C4'-P energy: -87.929 bonds (distance) P-C4' energy: -100.555 flat angles C4'-P-C4' energy: -112.281 flat angles P-C4'-P energy: -59.879 tors. eta vs tors. theta energy: -112.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -1236.586345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1236.586345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1236.586345 (E_RNA) where: Base-Base interactions energy: -780.026 where: short stacking energy: -349.589 Base-Backbone interact. energy: -2.594 local terms energy: -453.966600 where: bonds (distance) C4'-P energy: -97.822 bonds (distance) P-C4' energy: -106.919 flat angles C4'-P-C4' energy: -94.448 flat angles P-C4'-P energy: -65.808 tors. eta vs tors. theta energy: -88.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -1204.591479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1204.591479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1204.591479 (E_RNA) where: Base-Base interactions energy: -771.238 where: short stacking energy: -354.415 Base-Backbone interact. energy: -3.198 local terms energy: -430.154981 where: bonds (distance) C4'-P energy: -91.626 bonds (distance) P-C4' energy: -88.451 flat angles C4'-P-C4' energy: -100.293 flat angles P-C4'-P energy: -54.015 tors. eta vs tors. theta energy: -95.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -1028.587606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1028.587606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1028.587606 (E_RNA) where: Base-Base interactions energy: -634.605 where: short stacking energy: -315.766 Base-Backbone interact. energy: -2.192 local terms energy: -391.790961 where: bonds (distance) C4'-P energy: -93.672 bonds (distance) P-C4' energy: -78.436 flat angles C4'-P-C4' energy: -91.694 flat angles P-C4'-P energy: -61.917 tors. eta vs tors. theta energy: -66.071 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -968.641145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -968.641145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -968.641145 (E_RNA) where: Base-Base interactions energy: -580.415 where: short stacking energy: -279.784 Base-Backbone interact. energy: -1.482 local terms energy: -386.743780 where: bonds (distance) C4'-P energy: -66.795 bonds (distance) P-C4' energy: -91.147 flat angles C4'-P-C4' energy: -88.152 flat angles P-C4'-P energy: -69.424 tors. eta vs tors. theta energy: -71.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -854.410072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -854.410072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -854.410072 (E_RNA) where: Base-Base interactions energy: -490.582 where: short stacking energy: -249.994 Base-Backbone interact. energy: -3.605 local terms energy: -360.223357 where: bonds (distance) C4'-P energy: -93.748 bonds (distance) P-C4' energy: -87.875 flat angles C4'-P-C4' energy: -79.555 flat angles P-C4'-P energy: -53.813 tors. eta vs tors. theta energy: -45.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -845.102603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.102603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.102603 (E_RNA) where: Base-Base interactions energy: -508.698 where: short stacking energy: -249.193 Base-Backbone interact. energy: -2.055 local terms energy: -334.348932 where: bonds (distance) C4'-P energy: -88.642 bonds (distance) P-C4' energy: -86.912 flat angles C4'-P-C4' energy: -70.874 flat angles P-C4'-P energy: -46.180 tors. eta vs tors. theta energy: -41.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -619.507290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.507290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.507290 (E_RNA) where: Base-Base interactions energy: -297.373 where: short stacking energy: -179.760 Base-Backbone interact. energy: 2.708 local terms energy: -324.842628 where: bonds (distance) C4'-P energy: -76.634 bonds (distance) P-C4' energy: -92.134 flat angles C4'-P-C4' energy: -83.335 flat angles P-C4'-P energy: -41.382 tors. eta vs tors. theta energy: -31.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -411.657529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.657529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.657529 (E_RNA) where: Base-Base interactions energy: -157.840 where: short stacking energy: -131.333 Base-Backbone interact. energy: 3.230 local terms energy: -257.047990 where: bonds (distance) C4'-P energy: -68.632 bonds (distance) P-C4' energy: -98.070 flat angles C4'-P-C4' energy: -60.849 flat angles P-C4'-P energy: -35.683 tors. eta vs tors. theta energy: 6.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -379.582596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.582596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.582596 (E_RNA) where: Base-Base interactions energy: -125.671 where: short stacking energy: -114.991 Base-Backbone interact. energy: 1.843 local terms energy: -255.754429 where: bonds (distance) C4'-P energy: -67.911 bonds (distance) P-C4' energy: -78.680 flat angles C4'-P-C4' energy: -89.062 flat angles P-C4'-P energy: -30.082 tors. eta vs tors. theta energy: 9.979 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -1417.918844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1417.918844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1417.918844 (E_RNA) where: Base-Base interactions energy: -940.966 where: short stacking energy: -397.070 Base-Backbone interact. energy: -3.936 local terms energy: -473.016900 where: bonds (distance) C4'-P energy: -99.916 bonds (distance) P-C4' energy: -87.563 flat angles C4'-P-C4' energy: -99.998 flat angles P-C4'-P energy: -69.790 tors. eta vs tors. theta energy: -115.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -1220.861216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1220.861216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1220.861216 (E_RNA) where: Base-Base interactions energy: -793.202 where: short stacking energy: -361.352 Base-Backbone interact. energy: -4.336 local terms energy: -423.323520 where: bonds (distance) C4'-P energy: -98.759 bonds (distance) P-C4' energy: -84.769 flat angles C4'-P-C4' energy: -86.834 flat angles P-C4'-P energy: -64.998 tors. eta vs tors. theta energy: -87.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -1178.032837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1178.032837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1178.032837 (E_RNA) where: Base-Base interactions energy: -744.934 where: short stacking energy: -361.528 Base-Backbone interact. energy: -2.293 local terms energy: -430.805668 where: bonds (distance) C4'-P energy: -94.088 bonds (distance) P-C4' energy: -92.355 flat angles C4'-P-C4' energy: -102.843 flat angles P-C4'-P energy: -52.161 tors. eta vs tors. theta energy: -89.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -1038.710538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.710538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.710538 (E_RNA) where: Base-Base interactions energy: -623.342 where: short stacking energy: -320.801 Base-Backbone interact. energy: 0.623 local terms energy: -415.991224 where: bonds (distance) C4'-P energy: -88.802 bonds (distance) P-C4' energy: -87.311 flat angles C4'-P-C4' energy: -104.848 flat angles P-C4'-P energy: -63.211 tors. eta vs tors. theta energy: -71.820 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -1037.375763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.375763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1037.375763 (E_RNA) where: Base-Base interactions energy: -650.302 where: short stacking energy: -307.722 Base-Backbone interact. energy: -2.296 local terms energy: -384.777675 where: bonds (distance) C4'-P energy: -89.863 bonds (distance) P-C4' energy: -92.111 flat angles C4'-P-C4' energy: -85.793 flat angles P-C4'-P energy: -49.538 tors. eta vs tors. theta energy: -67.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -852.791034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -852.791034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -852.791034 (E_RNA) where: Base-Base interactions energy: -496.632 where: short stacking energy: -261.797 Base-Backbone interact. energy: -1.274 local terms energy: -354.884983 where: bonds (distance) C4'-P energy: -82.137 bonds (distance) P-C4' energy: -90.115 flat angles C4'-P-C4' energy: -87.724 flat angles P-C4'-P energy: -50.556 tors. eta vs tors. theta energy: -44.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -750.510970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.510970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.510970 (E_RNA) where: Base-Base interactions energy: -430.753 where: short stacking energy: -191.404 Base-Backbone interact. energy: -2.272 local terms energy: -317.486313 where: bonds (distance) C4'-P energy: -90.490 bonds (distance) P-C4' energy: -81.091 flat angles C4'-P-C4' energy: -92.886 flat angles P-C4'-P energy: -48.009 tors. eta vs tors. theta energy: -5.011 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -552.819606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.819606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.819606 (E_RNA) where: Base-Base interactions energy: -264.045 where: short stacking energy: -160.449 Base-Backbone interact. energy: -1.820 local terms energy: -286.954726 where: bonds (distance) C4'-P energy: -81.481 bonds (distance) P-C4' energy: -77.204 flat angles C4'-P-C4' energy: -83.947 flat angles P-C4'-P energy: -34.566 tors. eta vs tors. theta energy: -9.757 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -401.241136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.241136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.241136 (E_RNA) where: Base-Base interactions energy: -132.086 where: short stacking energy: -120.937 Base-Backbone interact. energy: -0.725 local terms energy: -268.429381 where: bonds (distance) C4'-P energy: -81.683 bonds (distance) P-C4' energy: -80.820 flat angles C4'-P-C4' energy: -64.570 flat angles P-C4'-P energy: -47.631 tors. eta vs tors. theta energy: 6.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -368.733732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.733732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.733732 (E_RNA) where: Base-Base interactions energy: -114.555 where: short stacking energy: -92.045 Base-Backbone interact. energy: 2.770 local terms energy: -256.948376 where: bonds (distance) C4'-P energy: -91.472 bonds (distance) P-C4' energy: -65.777 flat angles C4'-P-C4' energy: -69.312 flat angles P-C4'-P energy: -33.077 tors. eta vs tors. theta energy: 2.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -1403.068171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1403.068171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1403.068171 (E_RNA) where: Base-Base interactions energy: -900.766 where: short stacking energy: -392.989 Base-Backbone interact. energy: -4.515 local terms energy: -497.786880 where: bonds (distance) C4'-P energy: -95.571 bonds (distance) P-C4' energy: -106.779 flat angles C4'-P-C4' energy: -109.150 flat angles P-C4'-P energy: -76.255 tors. eta vs tors. theta energy: -110.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -1213.659214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1213.659214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1213.659214 (E_RNA) where: Base-Base interactions energy: -781.246 where: short stacking energy: -338.422 Base-Backbone interact. energy: -4.175 local terms energy: -428.237551 where: bonds (distance) C4'-P energy: -87.801 bonds (distance) P-C4' energy: -95.476 flat angles C4'-P-C4' energy: -91.077 flat angles P-C4'-P energy: -74.132 tors. eta vs tors. theta energy: -79.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -1160.289812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1160.289812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1160.289812 (E_RNA) where: Base-Base interactions energy: -710.522 where: short stacking energy: -349.613 Base-Backbone interact. energy: -6.712 local terms energy: -443.056014 where: bonds (distance) C4'-P energy: -90.352 bonds (distance) P-C4' energy: -95.409 flat angles C4'-P-C4' energy: -98.916 flat angles P-C4'-P energy: -62.314 tors. eta vs tors. theta energy: -96.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -1073.736352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.736352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.736352 (E_RNA) where: Base-Base interactions energy: -661.753 where: short stacking energy: -310.349 Base-Backbone interact. energy: -0.783 local terms energy: -411.200549 where: bonds (distance) C4'-P energy: -101.338 bonds (distance) P-C4' energy: -87.265 flat angles C4'-P-C4' energy: -85.019 flat angles P-C4'-P energy: -55.275 tors. eta vs tors. theta energy: -82.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -1013.173781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1013.173781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1013.173781 (E_RNA) where: Base-Base interactions energy: -597.753 where: short stacking energy: -294.744 Base-Backbone interact. energy: -1.779 local terms energy: -413.642158 where: bonds (distance) C4'-P energy: -100.748 bonds (distance) P-C4' energy: -88.288 flat angles C4'-P-C4' energy: -101.882 flat angles P-C4'-P energy: -54.322 tors. eta vs tors. theta energy: -68.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -794.593749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.593749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.593749 (E_RNA) where: Base-Base interactions energy: -459.195 where: short stacking energy: -255.723 Base-Backbone interact. energy: -1.023 local terms energy: -334.375496 where: bonds (distance) C4'-P energy: -81.418 bonds (distance) P-C4' energy: -78.090 flat angles C4'-P-C4' energy: -87.529 flat angles P-C4'-P energy: -51.314 tors. eta vs tors. theta energy: -36.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -719.653822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.653822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.653822 (E_RNA) where: Base-Base interactions energy: -390.839 where: short stacking energy: -209.700 Base-Backbone interact. energy: -2.417 local terms energy: -326.396845 where: bonds (distance) C4'-P energy: -75.010 bonds (distance) P-C4' energy: -84.246 flat angles C4'-P-C4' energy: -86.914 flat angles P-C4'-P energy: -53.254 tors. eta vs tors. theta energy: -26.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -568.057633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.057633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.057633 (E_RNA) where: Base-Base interactions energy: -273.237 where: short stacking energy: -170.634 Base-Backbone interact. energy: 0.903 local terms energy: -295.723873 where: bonds (distance) C4'-P energy: -80.437 bonds (distance) P-C4' energy: -91.202 flat angles C4'-P-C4' energy: -72.769 flat angles P-C4'-P energy: -42.348 tors. eta vs tors. theta energy: -8.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -424.646190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.646190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.646190 (E_RNA) where: Base-Base interactions energy: -136.541 where: short stacking energy: -125.886 Base-Backbone interact. energy: -0.363 local terms energy: -287.742430 where: bonds (distance) C4'-P energy: -83.062 bonds (distance) P-C4' energy: -94.245 flat angles C4'-P-C4' energy: -78.764 flat angles P-C4'-P energy: -50.089 tors. eta vs tors. theta energy: 18.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -383.878067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.878067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.878067 (E_RNA) where: Base-Base interactions energy: -143.712 where: short stacking energy: -112.124 Base-Backbone interact. energy: -0.642 local terms energy: -239.523949 where: bonds (distance) C4'-P energy: -59.816 bonds (distance) P-C4' energy: -64.999 flat angles C4'-P-C4' energy: -76.380 flat angles P-C4'-P energy: -48.232 tors. eta vs tors. theta energy: 9.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -1383.592678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1383.592678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1383.592678 (E_RNA) where: Base-Base interactions energy: -917.822 where: short stacking energy: -411.153 Base-Backbone interact. energy: -1.706 local terms energy: -464.064684 where: bonds (distance) C4'-P energy: -101.350 bonds (distance) P-C4' energy: -96.002 flat angles C4'-P-C4' energy: -106.529 flat angles P-C4'-P energy: -55.844 tors. eta vs tors. theta energy: -104.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -1248.272429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1248.272429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1248.272429 (E_RNA) where: Base-Base interactions energy: -820.044 where: short stacking energy: -378.220 Base-Backbone interact. energy: -0.795 local terms energy: -427.433709 where: bonds (distance) C4'-P energy: -93.229 bonds (distance) P-C4' energy: -85.499 flat angles C4'-P-C4' energy: -92.638 flat angles P-C4'-P energy: -57.502 tors. eta vs tors. theta energy: -98.567 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -1137.984168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1137.984168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1137.984168 (E_RNA) where: Base-Base interactions energy: -700.616 where: short stacking energy: -318.862 Base-Backbone interact. energy: -2.543 local terms energy: -434.825700 where: bonds (distance) C4'-P energy: -97.949 bonds (distance) P-C4' energy: -94.383 flat angles C4'-P-C4' energy: -103.645 flat angles P-C4'-P energy: -62.323 tors. eta vs tors. theta energy: -76.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -1089.853064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.853064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1089.853064 (E_RNA) where: Base-Base interactions energy: -692.354 where: short stacking energy: -327.603 Base-Backbone interact. energy: 1.592 local terms energy: -399.091310 where: bonds (distance) C4'-P energy: -81.880 bonds (distance) P-C4' energy: -90.651 flat angles C4'-P-C4' energy: -92.222 flat angles P-C4'-P energy: -61.916 tors. eta vs tors. theta energy: -72.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -1025.123678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.123678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1025.123678 (E_RNA) where: Base-Base interactions energy: -623.507 where: short stacking energy: -288.386 Base-Backbone interact. energy: -1.625 local terms energy: -399.991805 where: bonds (distance) C4'-P energy: -92.877 bonds (distance) P-C4' energy: -94.561 flat angles C4'-P-C4' energy: -88.189 flat angles P-C4'-P energy: -49.551 tors. eta vs tors. theta energy: -74.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -807.662809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -807.662809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -807.662809 (E_RNA) where: Base-Base interactions energy: -443.943 where: short stacking energy: -226.827 Base-Backbone interact. energy: -2.978 local terms energy: -360.742379 where: bonds (distance) C4'-P energy: -104.649 bonds (distance) P-C4' energy: -101.848 flat angles C4'-P-C4' energy: -87.449 flat angles P-C4'-P energy: -44.026 tors. eta vs tors. theta energy: -22.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -791.355668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.355668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.355668 (E_RNA) where: Base-Base interactions energy: -466.846 where: short stacking energy: -248.943 Base-Backbone interact. energy: -1.129 local terms energy: -323.380418 where: bonds (distance) C4'-P energy: -76.805 bonds (distance) P-C4' energy: -74.569 flat angles C4'-P-C4' energy: -85.495 flat angles P-C4'-P energy: -46.676 tors. eta vs tors. theta energy: -39.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -569.414046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.414046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.414046 (E_RNA) where: Base-Base interactions energy: -280.759 where: short stacking energy: -184.331 Base-Backbone interact. energy: -2.005 local terms energy: -286.650293 where: bonds (distance) C4'-P energy: -70.538 bonds (distance) P-C4' energy: -89.367 flat angles C4'-P-C4' energy: -75.747 flat angles P-C4'-P energy: -39.951 tors. eta vs tors. theta energy: -11.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -412.313841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.313841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.313841 (E_RNA) where: Base-Base interactions energy: -152.303 where: short stacking energy: -127.382 Base-Backbone interact. energy: -0.513 local terms energy: -259.497838 where: bonds (distance) C4'-P energy: -82.206 bonds (distance) P-C4' energy: -82.587 flat angles C4'-P-C4' energy: -68.052 flat angles P-C4'-P energy: -41.182 tors. eta vs tors. theta energy: 14.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -381.993008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.993008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.993008 (E_RNA) where: Base-Base interactions energy: -132.199 where: short stacking energy: -119.663 Base-Backbone interact. energy: -1.295 local terms energy: -248.498852 where: bonds (distance) C4'-P energy: -75.390 bonds (distance) P-C4' energy: -73.094 flat angles C4'-P-C4' energy: -53.020 flat angles P-C4'-P energy: -53.804 tors. eta vs tors. theta energy: 6.810 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -1391.978276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1391.978276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1391.978276 (E_RNA) where: Base-Base interactions energy: -913.944 where: short stacking energy: -397.105 Base-Backbone interact. energy: -3.769 local terms energy: -474.265355 where: bonds (distance) C4'-P energy: -100.263 bonds (distance) P-C4' energy: -92.771 flat angles C4'-P-C4' energy: -109.332 flat angles P-C4'-P energy: -66.186 tors. eta vs tors. theta energy: -105.714 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -1277.510928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1277.510928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1277.510928 (E_RNA) where: Base-Base interactions energy: -842.260 where: short stacking energy: -361.991 Base-Backbone interact. energy: -0.431 local terms energy: -434.819211 where: bonds (distance) C4'-P energy: -93.972 bonds (distance) P-C4' energy: -93.009 flat angles C4'-P-C4' energy: -97.204 flat angles P-C4'-P energy: -69.874 tors. eta vs tors. theta energy: -80.761 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -1142.348180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1142.348180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1142.348180 (E_RNA) where: Base-Base interactions energy: -715.433 where: short stacking energy: -335.099 Base-Backbone interact. energy: -1.383 local terms energy: -425.532367 where: bonds (distance) C4'-P energy: -82.045 bonds (distance) P-C4' energy: -96.925 flat angles C4'-P-C4' energy: -103.257 flat angles P-C4'-P energy: -63.805 tors. eta vs tors. theta energy: -79.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -1105.216125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1105.216125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1105.216125 (E_RNA) where: Base-Base interactions energy: -690.078 where: short stacking energy: -352.740 Base-Backbone interact. energy: 0.848 local terms energy: -415.986109 where: bonds (distance) C4'-P energy: -92.608 bonds (distance) P-C4' energy: -79.894 flat angles C4'-P-C4' energy: -94.054 flat angles P-C4'-P energy: -70.296 tors. eta vs tors. theta energy: -79.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -1002.709632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1002.709632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1002.709632 (E_RNA) where: Base-Base interactions energy: -604.064 where: short stacking energy: -286.910 Base-Backbone interact. energy: 0.514 local terms energy: -399.159977 where: bonds (distance) C4'-P energy: -82.900 bonds (distance) P-C4' energy: -102.070 flat angles C4'-P-C4' energy: -86.931 flat angles P-C4'-P energy: -55.719 tors. eta vs tors. theta energy: -71.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -813.843944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.843944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.843944 (E_RNA) where: Base-Base interactions energy: -470.057 where: short stacking energy: -261.461 Base-Backbone interact. energy: 1.177 local terms energy: -344.964014 where: bonds (distance) C4'-P energy: -62.197 bonds (distance) P-C4' energy: -88.519 flat angles C4'-P-C4' energy: -93.326 flat angles P-C4'-P energy: -51.027 tors. eta vs tors. theta energy: -49.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -766.348734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.348734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.348734 (E_RNA) where: Base-Base interactions energy: -451.416 where: short stacking energy: -226.823 Base-Backbone interact. energy: -1.888 local terms energy: -313.045032 where: bonds (distance) C4'-P energy: -81.405 bonds (distance) P-C4' energy: -88.705 flat angles C4'-P-C4' energy: -84.452 flat angles P-C4'-P energy: -41.328 tors. eta vs tors. theta energy: -17.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -592.765285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.765285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.765285 (E_RNA) where: Base-Base interactions energy: -300.965 where: short stacking energy: -181.682 Base-Backbone interact. energy: -0.575 local terms energy: -291.225247 where: bonds (distance) C4'-P energy: -87.904 bonds (distance) P-C4' energy: -87.441 flat angles C4'-P-C4' energy: -65.373 flat angles P-C4'-P energy: -39.547 tors. eta vs tors. theta energy: -10.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -420.037592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.037592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.037592 (E_RNA) where: Base-Base interactions energy: -156.163 where: short stacking energy: -117.328 Base-Backbone interact. energy: 0.229 local terms energy: -264.103487 where: bonds (distance) C4'-P energy: -75.042 bonds (distance) P-C4' energy: -85.183 flat angles C4'-P-C4' energy: -57.909 flat angles P-C4'-P energy: -53.072 tors. eta vs tors. theta energy: 7.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -403.353566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.353566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.353566 (E_RNA) where: Base-Base interactions energy: -170.609 where: short stacking energy: -127.213 Base-Backbone interact. energy: 0.735 local terms energy: -233.479083 where: bonds (distance) C4'-P energy: -69.274 bonds (distance) P-C4' energy: -67.960 flat angles C4'-P-C4' energy: -76.095 flat angles P-C4'-P energy: -35.328 tors. eta vs tors. theta energy: 15.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -1395.117733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1395.117733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1395.117733 (E_RNA) where: Base-Base interactions energy: -933.634 where: short stacking energy: -403.148 Base-Backbone interact. energy: -4.708 local terms energy: -456.775935 where: bonds (distance) C4'-P energy: -94.227 bonds (distance) P-C4' energy: -98.720 flat angles C4'-P-C4' energy: -97.551 flat angles P-C4'-P energy: -62.891 tors. eta vs tors. theta energy: -103.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -1263.588019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1263.588019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1263.588019 (E_RNA) where: Base-Base interactions energy: -816.434 where: short stacking energy: -372.377 Base-Backbone interact. energy: -2.994 local terms energy: -444.159630 where: bonds (distance) C4'-P energy: -96.738 bonds (distance) P-C4' energy: -95.212 flat angles C4'-P-C4' energy: -93.706 flat angles P-C4'-P energy: -65.730 tors. eta vs tors. theta energy: -92.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -1131.871112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1131.871112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1131.871112 (E_RNA) where: Base-Base interactions energy: -729.199 where: short stacking energy: -325.429 Base-Backbone interact. energy: -2.359 local terms energy: -400.313405 where: bonds (distance) C4'-P energy: -91.623 bonds (distance) P-C4' energy: -86.267 flat angles C4'-P-C4' energy: -89.491 flat angles P-C4'-P energy: -63.930 tors. eta vs tors. theta energy: -69.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -1061.468201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.468201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.468201 (E_RNA) where: Base-Base interactions energy: -650.584 where: short stacking energy: -309.212 Base-Backbone interact. energy: -1.647 local terms energy: -409.237300 where: bonds (distance) C4'-P energy: -83.582 bonds (distance) P-C4' energy: -83.989 flat angles C4'-P-C4' energy: -84.874 flat angles P-C4'-P energy: -66.453 tors. eta vs tors. theta energy: -90.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -1031.447688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.447688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1031.447688 (E_RNA) where: Base-Base interactions energy: -601.520 where: short stacking energy: -292.891 Base-Backbone interact. energy: -1.612 local terms energy: -428.315303 where: bonds (distance) C4'-P energy: -89.554 bonds (distance) P-C4' energy: -99.626 flat angles C4'-P-C4' energy: -93.187 flat angles P-C4'-P energy: -71.430 tors. eta vs tors. theta energy: -74.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -927.242920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.242920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.242920 (E_RNA) where: Base-Base interactions energy: -566.723 where: short stacking energy: -294.294 Base-Backbone interact. energy: -2.289 local terms energy: -358.230860 where: bonds (distance) C4'-P energy: -76.118 bonds (distance) P-C4' energy: -76.470 flat angles C4'-P-C4' energy: -83.364 flat angles P-C4'-P energy: -60.215 tors. eta vs tors. theta energy: -62.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -794.426659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.426659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.426659 (E_RNA) where: Base-Base interactions energy: -455.034 where: short stacking energy: -204.864 Base-Backbone interact. energy: 0.536 local terms energy: -339.927880 where: bonds (distance) C4'-P energy: -89.850 bonds (distance) P-C4' energy: -88.851 flat angles C4'-P-C4' energy: -86.414 flat angles P-C4'-P energy: -46.183 tors. eta vs tors. theta energy: -28.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -561.309637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.309637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.309637 (E_RNA) where: Base-Base interactions energy: -291.404 where: short stacking energy: -177.004 Base-Backbone interact. energy: 0.059 local terms energy: -269.965082 where: bonds (distance) C4'-P energy: -73.277 bonds (distance) P-C4' energy: -82.803 flat angles C4'-P-C4' energy: -67.258 flat angles P-C4'-P energy: -39.828 tors. eta vs tors. theta energy: -6.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -460.498567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.498567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.498567 (E_RNA) where: Base-Base interactions energy: -195.831 where: short stacking energy: -131.145 Base-Backbone interact. energy: 2.118 local terms energy: -266.785964 where: bonds (distance) C4'-P energy: -83.421 bonds (distance) P-C4' energy: -76.137 flat angles C4'-P-C4' energy: -69.028 flat angles P-C4'-P energy: -32.435 tors. eta vs tors. theta energy: -5.765 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -379.224886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.224886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.224886 (E_RNA) where: Base-Base interactions energy: -147.125 where: short stacking energy: -119.506 Base-Backbone interact. energy: 3.324 local terms energy: -235.423961 where: bonds (distance) C4'-P energy: -77.055 bonds (distance) P-C4' energy: -67.308 flat angles C4'-P-C4' energy: -57.102 flat angles P-C4'-P energy: -50.294 tors. eta vs tors. theta energy: 16.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -1440.700017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1440.700017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1440.700017 (E_RNA) where: Base-Base interactions energy: -955.034 where: short stacking energy: -422.067 Base-Backbone interact. energy: -2.580 local terms energy: -483.085964 where: bonds (distance) C4'-P energy: -89.176 bonds (distance) P-C4' energy: -103.439 flat angles C4'-P-C4' energy: -104.569 flat angles P-C4'-P energy: -68.234 tors. eta vs tors. theta energy: -117.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -1254.170846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1254.170846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1254.170846 (E_RNA) where: Base-Base interactions energy: -802.085 where: short stacking energy: -375.485 Base-Backbone interact. energy: 0.178 local terms energy: -452.263945 where: bonds (distance) C4'-P energy: -96.120 bonds (distance) P-C4' energy: -96.947 flat angles C4'-P-C4' energy: -107.974 flat angles P-C4'-P energy: -59.694 tors. eta vs tors. theta energy: -91.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -1181.399838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1181.399838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1181.399838 (E_RNA) where: Base-Base interactions energy: -753.220 where: short stacking energy: -341.730 Base-Backbone interact. energy: -2.392 local terms energy: -425.787061 where: bonds (distance) C4'-P energy: -93.747 bonds (distance) P-C4' energy: -96.264 flat angles C4'-P-C4' energy: -96.237 flat angles P-C4'-P energy: -58.833 tors. eta vs tors. theta energy: -80.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -1134.104016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.104016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1134.104016 (E_RNA) where: Base-Base interactions energy: -699.578 where: short stacking energy: -347.949 Base-Backbone interact. energy: 2.610 local terms energy: -437.135537 where: bonds (distance) C4'-P energy: -93.348 bonds (distance) P-C4' energy: -92.899 flat angles C4'-P-C4' energy: -96.229 flat angles P-C4'-P energy: -67.048 tors. eta vs tors. theta energy: -87.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -1037.214339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.214339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1037.214339 (E_RNA) where: Base-Base interactions energy: -635.730 where: short stacking energy: -326.080 Base-Backbone interact. energy: -2.160 local terms energy: -399.325157 where: bonds (distance) C4'-P energy: -83.615 bonds (distance) P-C4' energy: -88.822 flat angles C4'-P-C4' energy: -81.354 flat angles P-C4'-P energy: -64.459 tors. eta vs tors. theta energy: -81.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -865.942416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -865.942416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -865.942416 (E_RNA) where: Base-Base interactions energy: -515.017 where: short stacking energy: -293.700 Base-Backbone interact. energy: -0.109 local terms energy: -350.816518 where: bonds (distance) C4'-P energy: -80.264 bonds (distance) P-C4' energy: -80.731 flat angles C4'-P-C4' energy: -80.552 flat angles P-C4'-P energy: -54.235 tors. eta vs tors. theta energy: -55.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -826.349506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.349506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.349506 (E_RNA) where: Base-Base interactions energy: -487.573 where: short stacking energy: -240.647 Base-Backbone interact. energy: -1.189 local terms energy: -337.586878 where: bonds (distance) C4'-P energy: -77.010 bonds (distance) P-C4' energy: -83.512 flat angles C4'-P-C4' energy: -80.746 flat angles P-C4'-P energy: -45.413 tors. eta vs tors. theta energy: -50.906 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -531.479782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.479782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.479782 (E_RNA) where: Base-Base interactions energy: -251.907 where: short stacking energy: -145.482 Base-Backbone interact. energy: -0.709 local terms energy: -278.864231 where: bonds (distance) C4'-P energy: -75.741 bonds (distance) P-C4' energy: -84.547 flat angles C4'-P-C4' energy: -73.411 flat angles P-C4'-P energy: -43.953 tors. eta vs tors. theta energy: -1.213 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -458.737610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.737610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.737610 (E_RNA) where: Base-Base interactions energy: -194.593 where: short stacking energy: -148.652 Base-Backbone interact. energy: 2.072 local terms energy: -266.216993 where: bonds (distance) C4'-P energy: -77.767 bonds (distance) P-C4' energy: -82.549 flat angles C4'-P-C4' energy: -67.364 flat angles P-C4'-P energy: -33.589 tors. eta vs tors. theta energy: -4.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -412.610706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.610706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.610706 (E_RNA) where: Base-Base interactions energy: -158.542 where: short stacking energy: -119.608 Base-Backbone interact. energy: -1.102 local terms energy: -252.966861 where: bonds (distance) C4'-P energy: -75.863 bonds (distance) P-C4' energy: -78.684 flat angles C4'-P-C4' energy: -59.945 flat angles P-C4'-P energy: -39.151 tors. eta vs tors. theta energy: 0.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -1476.179349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1476.179349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1476.179349 (E_RNA) where: Base-Base interactions energy: -998.750 where: short stacking energy: -426.696 Base-Backbone interact. energy: -4.854 local terms energy: -472.575550 where: bonds (distance) C4'-P energy: -88.118 bonds (distance) P-C4' energy: -96.890 flat angles C4'-P-C4' energy: -109.814 flat angles P-C4'-P energy: -60.262 tors. eta vs tors. theta energy: -117.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -1312.462067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1312.462067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1312.462067 (E_RNA) where: Base-Base interactions energy: -863.973 where: short stacking energy: -400.276 Base-Backbone interact. energy: -0.742 local terms energy: -447.747458 where: bonds (distance) C4'-P energy: -92.958 bonds (distance) P-C4' energy: -91.964 flat angles C4'-P-C4' energy: -109.050 flat angles P-C4'-P energy: -51.958 tors. eta vs tors. theta energy: -101.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -1194.023335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1194.023335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1194.023335 (E_RNA) where: Base-Base interactions energy: -759.378 where: short stacking energy: -348.846 Base-Backbone interact. energy: -5.095 local terms energy: -429.550391 where: bonds (distance) C4'-P energy: -81.231 bonds (distance) P-C4' energy: -98.338 flat angles C4'-P-C4' energy: -94.768 flat angles P-C4'-P energy: -64.012 tors. eta vs tors. theta energy: -91.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -1122.437871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1122.437871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1122.437871 (E_RNA) where: Base-Base interactions energy: -715.015 where: short stacking energy: -370.626 Base-Backbone interact. energy: 7.971 local terms energy: -415.394030 where: bonds (distance) C4'-P energy: -83.494 bonds (distance) P-C4' energy: -87.110 flat angles C4'-P-C4' energy: -99.011 flat angles P-C4'-P energy: -63.006 tors. eta vs tors. theta energy: -82.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -1051.953622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.953622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1051.953622 (E_RNA) where: Base-Base interactions energy: -662.324 where: short stacking energy: -331.905 Base-Backbone interact. energy: -0.386 local terms energy: -389.244507 where: bonds (distance) C4'-P energy: -80.649 bonds (distance) P-C4' energy: -83.348 flat angles C4'-P-C4' energy: -85.325 flat angles P-C4'-P energy: -55.802 tors. eta vs tors. theta energy: -84.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -887.135760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.135760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.135760 (E_RNA) where: Base-Base interactions energy: -525.574 where: short stacking energy: -259.803 Base-Backbone interact. energy: 1.121 local terms energy: -362.682561 where: bonds (distance) C4'-P energy: -95.926 bonds (distance) P-C4' energy: -87.736 flat angles C4'-P-C4' energy: -82.046 flat angles P-C4'-P energy: -41.712 tors. eta vs tors. theta energy: -55.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -827.587437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.587437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -827.587437 (E_RNA) where: Base-Base interactions energy: -485.890 where: short stacking energy: -254.994 Base-Backbone interact. energy: 1.281 local terms energy: -342.978402 where: bonds (distance) C4'-P energy: -83.952 bonds (distance) P-C4' energy: -79.691 flat angles C4'-P-C4' energy: -71.583 flat angles P-C4'-P energy: -63.442 tors. eta vs tors. theta energy: -44.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -558.173169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.173169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.173169 (E_RNA) where: Base-Base interactions energy: -266.362 where: short stacking energy: -155.418 Base-Backbone interact. energy: 1.861 local terms energy: -293.672592 where: bonds (distance) C4'-P energy: -74.772 bonds (distance) P-C4' energy: -94.409 flat angles C4'-P-C4' energy: -75.752 flat angles P-C4'-P energy: -45.666 tors. eta vs tors. theta energy: -3.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -457.300921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.300921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.300921 (E_RNA) where: Base-Base interactions energy: -210.244 where: short stacking energy: -143.322 Base-Backbone interact. energy: 0.444 local terms energy: -247.501008 where: bonds (distance) C4'-P energy: -78.849 bonds (distance) P-C4' energy: -66.786 flat angles C4'-P-C4' energy: -67.600 flat angles P-C4'-P energy: -43.415 tors. eta vs tors. theta energy: 9.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -416.671451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.671451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.671451 (E_RNA) where: Base-Base interactions energy: -171.560 where: short stacking energy: -123.951 Base-Backbone interact. energy: -1.345 local terms energy: -243.766375 where: bonds (distance) C4'-P energy: -79.676 bonds (distance) P-C4' energy: -68.757 flat angles C4'-P-C4' energy: -60.384 flat angles P-C4'-P energy: -40.623 tors. eta vs tors. theta energy: 5.673 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -1461.452970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1461.452970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1461.452970 (E_RNA) where: Base-Base interactions energy: -991.854 where: short stacking energy: -441.953 Base-Backbone interact. energy: -3.158 local terms energy: -466.440516 where: bonds (distance) C4'-P energy: -93.236 bonds (distance) P-C4' energy: -101.832 flat angles C4'-P-C4' energy: -97.103 flat angles P-C4'-P energy: -54.543 tors. eta vs tors. theta energy: -119.728 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -1299.630243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1299.630243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1299.630243 (E_RNA) where: Base-Base interactions energy: -833.157 where: short stacking energy: -373.201 Base-Backbone interact. energy: -1.406 local terms energy: -465.067210 where: bonds (distance) C4'-P energy: -99.691 bonds (distance) P-C4' energy: -98.294 flat angles C4'-P-C4' energy: -103.414 flat angles P-C4'-P energy: -57.484 tors. eta vs tors. theta energy: -106.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -1230.778925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1230.778925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1230.778925 (E_RNA) where: Base-Base interactions energy: -778.403 where: short stacking energy: -351.447 Base-Backbone interact. energy: -3.833 local terms energy: -448.542549 where: bonds (distance) C4'-P energy: -85.887 bonds (distance) P-C4' energy: -104.426 flat angles C4'-P-C4' energy: -91.249 flat angles P-C4'-P energy: -66.885 tors. eta vs tors. theta energy: -100.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -1120.271564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1120.271564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1120.271564 (E_RNA) where: Base-Base interactions energy: -712.852 where: short stacking energy: -346.338 Base-Backbone interact. energy: -1.200 local terms energy: -406.219301 where: bonds (distance) C4'-P energy: -86.720 bonds (distance) P-C4' energy: -85.304 flat angles C4'-P-C4' energy: -83.358 flat angles P-C4'-P energy: -75.568 tors. eta vs tors. theta energy: -75.269 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -1066.170600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1066.170600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1066.170600 (E_RNA) where: Base-Base interactions energy: -661.869 where: short stacking energy: -337.497 Base-Backbone interact. energy: 0.981 local terms energy: -405.282543 where: bonds (distance) C4'-P energy: -89.656 bonds (distance) P-C4' energy: -79.939 flat angles C4'-P-C4' energy: -90.053 flat angles P-C4'-P energy: -59.277 tors. eta vs tors. theta energy: -86.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -877.975744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.975744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -877.975744 (E_RNA) where: Base-Base interactions energy: -532.078 where: short stacking energy: -252.715 Base-Backbone interact. energy: -1.107 local terms energy: -344.790250 where: bonds (distance) C4'-P energy: -66.836 bonds (distance) P-C4' energy: -95.078 flat angles C4'-P-C4' energy: -87.965 flat angles P-C4'-P energy: -52.709 tors. eta vs tors. theta energy: -42.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -800.686742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.686742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.686742 (E_RNA) where: Base-Base interactions energy: -461.938 where: short stacking energy: -243.859 Base-Backbone interact. energy: 1.438 local terms energy: -340.186961 where: bonds (distance) C4'-P energy: -83.739 bonds (distance) P-C4' energy: -78.620 flat angles C4'-P-C4' energy: -84.779 flat angles P-C4'-P energy: -55.741 tors. eta vs tors. theta energy: -37.308 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -525.610583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.610583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.610583 (E_RNA) where: Base-Base interactions energy: -260.691 where: short stacking energy: -163.718 Base-Backbone interact. energy: 0.464 local terms energy: -265.383659 where: bonds (distance) C4'-P energy: -77.225 bonds (distance) P-C4' energy: -80.904 flat angles C4'-P-C4' energy: -65.714 flat angles P-C4'-P energy: -43.877 tors. eta vs tors. theta energy: 2.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -467.138128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.138128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.138128 (E_RNA) where: Base-Base interactions energy: -205.116 where: short stacking energy: -139.774 Base-Backbone interact. energy: -0.413 local terms energy: -261.608263 where: bonds (distance) C4'-P energy: -81.017 bonds (distance) P-C4' energy: -80.028 flat angles C4'-P-C4' energy: -54.829 flat angles P-C4'-P energy: -53.490 tors. eta vs tors. theta energy: 7.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -387.313476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.313476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.313476 (E_RNA) where: Base-Base interactions energy: -125.706 where: short stacking energy: -87.423 Base-Backbone interact. energy: 1.582 local terms energy: -263.188783 where: bonds (distance) C4'-P energy: -86.080 bonds (distance) P-C4' energy: -70.449 flat angles C4'-P-C4' energy: -81.370 flat angles P-C4'-P energy: -41.816 tors. eta vs tors. theta energy: 16.526 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -1424.596101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1424.596101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1424.596101 (E_RNA) where: Base-Base interactions energy: -959.848 where: short stacking energy: -416.738 Base-Backbone interact. energy: -1.539 local terms energy: -463.208941 where: bonds (distance) C4'-P energy: -87.059 bonds (distance) P-C4' energy: -89.620 flat angles C4'-P-C4' energy: -107.827 flat angles P-C4'-P energy: -67.915 tors. eta vs tors. theta energy: -110.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -1299.548433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1299.548433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1299.548433 (E_RNA) where: Base-Base interactions energy: -879.529 where: short stacking energy: -400.568 Base-Backbone interact. energy: 0.974 local terms energy: -420.993300 where: bonds (distance) C4'-P energy: -83.527 bonds (distance) P-C4' energy: -96.619 flat angles C4'-P-C4' energy: -90.121 flat angles P-C4'-P energy: -62.600 tors. eta vs tors. theta energy: -88.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -1246.962517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1246.962517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1246.962517 (E_RNA) where: Base-Base interactions energy: -790.559 where: short stacking energy: -387.448 Base-Backbone interact. energy: -0.430 local terms energy: -455.974238 where: bonds (distance) C4'-P energy: -91.810 bonds (distance) P-C4' energy: -105.072 flat angles C4'-P-C4' energy: -97.631 flat angles P-C4'-P energy: -58.903 tors. eta vs tors. theta energy: -102.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -1119.148702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1119.148702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1119.148702 (E_RNA) where: Base-Base interactions energy: -691.741 where: short stacking energy: -340.817 Base-Backbone interact. energy: -0.879 local terms energy: -426.528802 where: bonds (distance) C4'-P energy: -99.507 bonds (distance) P-C4' energy: -85.132 flat angles C4'-P-C4' energy: -99.702 flat angles P-C4'-P energy: -54.457 tors. eta vs tors. theta energy: -87.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -1043.271923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.271923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1043.271923 (E_RNA) where: Base-Base interactions energy: -636.367 where: short stacking energy: -332.483 Base-Backbone interact. energy: -0.525 local terms energy: -406.379640 where: bonds (distance) C4'-P energy: -85.998 bonds (distance) P-C4' energy: -97.047 flat angles C4'-P-C4' energy: -83.062 flat angles P-C4'-P energy: -52.327 tors. eta vs tors. theta energy: -87.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -870.731959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -870.731959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -870.731959 (E_RNA) where: Base-Base interactions energy: -521.568 where: short stacking energy: -274.520 Base-Backbone interact. energy: 2.593 local terms energy: -351.756237 where: bonds (distance) C4'-P energy: -75.298 bonds (distance) P-C4' energy: -81.132 flat angles C4'-P-C4' energy: -83.965 flat angles P-C4'-P energy: -64.565 tors. eta vs tors. theta energy: -46.797 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -815.963463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.963463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.963463 (E_RNA) where: Base-Base interactions energy: -467.477 where: short stacking energy: -265.956 Base-Backbone interact. energy: 1.373 local terms energy: -349.859922 where: bonds (distance) C4'-P energy: -74.485 bonds (distance) P-C4' energy: -75.823 flat angles C4'-P-C4' energy: -87.080 flat angles P-C4'-P energy: -61.078 tors. eta vs tors. theta energy: -51.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -512.332503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.332503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.332503 (E_RNA) where: Base-Base interactions energy: -226.604 where: short stacking energy: -138.673 Base-Backbone interact. energy: 1.238 local terms energy: -286.967159 where: bonds (distance) C4'-P energy: -59.722 bonds (distance) P-C4' energy: -98.001 flat angles C4'-P-C4' energy: -79.675 flat angles P-C4'-P energy: -53.237 tors. eta vs tors. theta energy: 3.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -413.866378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.866378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.866378 (E_RNA) where: Base-Base interactions energy: -149.156 where: short stacking energy: -138.771 Base-Backbone interact. energy: -3.567 local terms energy: -261.143583 where: bonds (distance) C4'-P energy: -72.965 bonds (distance) P-C4' energy: -72.308 flat angles C4'-P-C4' energy: -77.188 flat angles P-C4'-P energy: -28.884 tors. eta vs tors. theta energy: -9.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -463.689416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.689416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.689416 (E_RNA) where: Base-Base interactions energy: -190.951 where: short stacking energy: -136.687 Base-Backbone interact. energy: 0.040 local terms energy: -272.778639 where: bonds (distance) C4'-P energy: -84.329 bonds (distance) P-C4' energy: -75.906 flat angles C4'-P-C4' energy: -74.128 flat angles P-C4'-P energy: -29.205 tors. eta vs tors. theta energy: -9.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -1437.051760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.051760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1437.051760 (E_RNA) where: Base-Base interactions energy: -974.069 where: short stacking energy: -432.535 Base-Backbone interact. energy: 1.510 local terms energy: -464.491801 where: bonds (distance) C4'-P energy: -77.347 bonds (distance) P-C4' energy: -98.498 flat angles C4'-P-C4' energy: -88.378 flat angles P-C4'-P energy: -72.451 tors. eta vs tors. theta energy: -127.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -1286.826492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1286.826492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1286.826492 (E_RNA) where: Base-Base interactions energy: -858.422 where: short stacking energy: -377.319 Base-Backbone interact. energy: -3.721 local terms energy: -424.683660 where: bonds (distance) C4'-P energy: -87.759 bonds (distance) P-C4' energy: -90.386 flat angles C4'-P-C4' energy: -92.539 flat angles P-C4'-P energy: -68.693 tors. eta vs tors. theta energy: -85.307 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -1273.228030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1273.228030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1273.228030 (E_RNA) where: Base-Base interactions energy: -834.601 where: short stacking energy: -386.065 Base-Backbone interact. energy: 0.898 local terms energy: -439.524560 where: bonds (distance) C4'-P energy: -83.114 bonds (distance) P-C4' energy: -95.167 flat angles C4'-P-C4' energy: -97.003 flat angles P-C4'-P energy: -64.902 tors. eta vs tors. theta energy: -99.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -1081.849104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1081.849104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1081.849104 (E_RNA) where: Base-Base interactions energy: -677.464 where: short stacking energy: -336.025 Base-Backbone interact. energy: -2.358 local terms energy: -402.027493 where: bonds (distance) C4'-P energy: -86.337 bonds (distance) P-C4' energy: -83.953 flat angles C4'-P-C4' energy: -87.052 flat angles P-C4'-P energy: -64.809 tors. eta vs tors. theta energy: -79.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -996.584770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.584770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -996.584770 (E_RNA) where: Base-Base interactions energy: -599.527 where: short stacking energy: -315.090 Base-Backbone interact. energy: 0.092 local terms energy: -397.149622 where: bonds (distance) C4'-P energy: -87.870 bonds (distance) P-C4' energy: -95.830 flat angles C4'-P-C4' energy: -99.147 flat angles P-C4'-P energy: -44.686 tors. eta vs tors. theta energy: -69.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -900.708335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -900.708335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.708335 (E_RNA) where: Base-Base interactions energy: -527.219 where: short stacking energy: -260.855 Base-Backbone interact. energy: 1.431 local terms energy: -374.920404 where: bonds (distance) C4'-P energy: -79.582 bonds (distance) P-C4' energy: -93.769 flat angles C4'-P-C4' energy: -85.096 flat angles P-C4'-P energy: -57.930 tors. eta vs tors. theta energy: -58.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -775.280050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.280050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.280050 (E_RNA) where: Base-Base interactions energy: -454.992 where: short stacking energy: -242.818 Base-Backbone interact. energy: -1.677 local terms energy: -318.610945 where: bonds (distance) C4'-P energy: -79.297 bonds (distance) P-C4' energy: -70.240 flat angles C4'-P-C4' energy: -83.082 flat angles P-C4'-P energy: -49.168 tors. eta vs tors. theta energy: -36.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -552.168991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.168991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.168991 (E_RNA) where: Base-Base interactions energy: -260.676 where: short stacking energy: -174.707 Base-Backbone interact. energy: 5.940 local terms energy: -297.433633 where: bonds (distance) C4'-P energy: -79.156 bonds (distance) P-C4' energy: -89.185 flat angles C4'-P-C4' energy: -66.219 flat angles P-C4'-P energy: -42.292 tors. eta vs tors. theta energy: -20.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -415.380464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.380464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.380464 (E_RNA) where: Base-Base interactions energy: -175.272 where: short stacking energy: -130.441 Base-Backbone interact. energy: 4.419 local terms energy: -244.527505 where: bonds (distance) C4'-P energy: -76.659 bonds (distance) P-C4' energy: -79.246 flat angles C4'-P-C4' energy: -62.440 flat angles P-C4'-P energy: -29.424 tors. eta vs tors. theta energy: 3.242 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -454.195458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.195458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.195458 (E_RNA) where: Base-Base interactions energy: -217.863 where: short stacking energy: -135.549 Base-Backbone interact. energy: 1.632 local terms energy: -237.963670 where: bonds (distance) C4'-P energy: -69.625 bonds (distance) P-C4' energy: -60.123 flat angles C4'-P-C4' energy: -71.545 flat angles P-C4'-P energy: -35.216 tors. eta vs tors. theta energy: -1.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -1487.111940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1487.111940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1487.111940 (E_RNA) where: Base-Base interactions energy: -1001.594 where: short stacking energy: -445.183 Base-Backbone interact. energy: -1.838 local terms energy: -483.680327 where: bonds (distance) C4'-P energy: -92.856 bonds (distance) P-C4' energy: -98.595 flat angles C4'-P-C4' energy: -102.448 flat angles P-C4'-P energy: -64.075 tors. eta vs tors. theta energy: -125.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -1259.647990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1259.647990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1259.647990 (E_RNA) where: Base-Base interactions energy: -804.642 where: short stacking energy: -357.898 Base-Backbone interact. energy: 0.423 local terms energy: -455.428292 where: bonds (distance) C4'-P energy: -91.553 bonds (distance) P-C4' energy: -103.070 flat angles C4'-P-C4' energy: -102.386 flat angles P-C4'-P energy: -63.046 tors. eta vs tors. theta energy: -95.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -1272.128029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1272.128029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1272.128029 (E_RNA) where: Base-Base interactions energy: -824.918 where: short stacking energy: -371.986 Base-Backbone interact. energy: -4.558 local terms energy: -442.651910 where: bonds (distance) C4'-P energy: -85.415 bonds (distance) P-C4' energy: -90.649 flat angles C4'-P-C4' energy: -104.997 flat angles P-C4'-P energy: -56.288 tors. eta vs tors. theta energy: -105.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -1120.705649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1120.705649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1120.705649 (E_RNA) where: Base-Base interactions energy: -715.641 where: short stacking energy: -345.350 Base-Backbone interact. energy: -1.770 local terms energy: -403.294445 where: bonds (distance) C4'-P energy: -79.210 bonds (distance) P-C4' energy: -75.669 flat angles C4'-P-C4' energy: -93.159 flat angles P-C4'-P energy: -68.979 tors. eta vs tors. theta energy: -86.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -987.834283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.834283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -987.834283 (E_RNA) where: Base-Base interactions energy: -593.251 where: short stacking energy: -295.914 Base-Backbone interact. energy: -1.372 local terms energy: -393.211553 where: bonds (distance) C4'-P energy: -82.732 bonds (distance) P-C4' energy: -92.760 flat angles C4'-P-C4' energy: -88.464 flat angles P-C4'-P energy: -57.294 tors. eta vs tors. theta energy: -71.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -881.758287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -881.758287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.758287 (E_RNA) where: Base-Base interactions energy: -528.137 where: short stacking energy: -251.490 Base-Backbone interact. energy: 6.583 local terms energy: -360.204827 where: bonds (distance) C4'-P energy: -76.520 bonds (distance) P-C4' energy: -84.931 flat angles C4'-P-C4' energy: -88.051 flat angles P-C4'-P energy: -59.138 tors. eta vs tors. theta energy: -51.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -729.329646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.329646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.329646 (E_RNA) where: Base-Base interactions energy: -392.016 where: short stacking energy: -195.009 Base-Backbone interact. energy: -0.691 local terms energy: -336.622698 where: bonds (distance) C4'-P energy: -83.996 bonds (distance) P-C4' energy: -95.990 flat angles C4'-P-C4' energy: -66.366 flat angles P-C4'-P energy: -55.007 tors. eta vs tors. theta energy: -35.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -559.430968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.430968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.430968 (E_RNA) where: Base-Base interactions energy: -260.715 where: short stacking energy: -148.475 Base-Backbone interact. energy: -1.474 local terms energy: -297.242556 where: bonds (distance) C4'-P energy: -75.438 bonds (distance) P-C4' energy: -89.268 flat angles C4'-P-C4' energy: -79.817 flat angles P-C4'-P energy: -47.906 tors. eta vs tors. theta energy: -4.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -485.298934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.298934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.298934 (E_RNA) where: Base-Base interactions energy: -228.486 where: short stacking energy: -121.222 Base-Backbone interact. energy: 5.086 local terms energy: -261.899340 where: bonds (distance) C4'-P energy: -63.373 bonds (distance) P-C4' energy: -79.487 flat angles C4'-P-C4' energy: -68.322 flat angles P-C4'-P energy: -53.569 tors. eta vs tors. theta energy: 2.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -388.904845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.904845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.904845 (E_RNA) where: Base-Base interactions energy: -158.535 where: short stacking energy: -127.459 Base-Backbone interact. energy: 2.055 local terms energy: -232.424856 where: bonds (distance) C4'-P energy: -72.809 bonds (distance) P-C4' energy: -60.371 flat angles C4'-P-C4' energy: -64.503 flat angles P-C4'-P energy: -33.490 tors. eta vs tors. theta energy: -1.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -1455.983733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1455.983733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1455.983733 (E_RNA) where: Base-Base interactions energy: -981.288 where: short stacking energy: -457.249 Base-Backbone interact. energy: -0.412 local terms energy: -474.284301 where: bonds (distance) C4'-P energy: -98.271 bonds (distance) P-C4' energy: -95.953 flat angles C4'-P-C4' energy: -91.409 flat angles P-C4'-P energy: -71.710 tors. eta vs tors. theta energy: -116.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -1284.130171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1284.130171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1284.130171 (E_RNA) where: Base-Base interactions energy: -822.412 where: short stacking energy: -355.208 Base-Backbone interact. energy: -2.662 local terms energy: -459.056231 where: bonds (distance) C4'-P energy: -88.844 bonds (distance) P-C4' energy: -109.702 flat angles C4'-P-C4' energy: -105.619 flat angles P-C4'-P energy: -59.986 tors. eta vs tors. theta energy: -94.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -1264.760415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1264.760415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1264.760415 (E_RNA) where: Base-Base interactions energy: -842.735 where: short stacking energy: -387.679 Base-Backbone interact. energy: -0.977 local terms energy: -421.048332 where: bonds (distance) C4'-P energy: -77.997 bonds (distance) P-C4' energy: -98.150 flat angles C4'-P-C4' energy: -96.829 flat angles P-C4'-P energy: -50.891 tors. eta vs tors. theta energy: -97.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -1100.567318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1100.567318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1100.567318 (E_RNA) where: Base-Base interactions energy: -672.379 where: short stacking energy: -337.812 Base-Backbone interact. energy: -1.586 local terms energy: -426.602193 where: bonds (distance) C4'-P energy: -88.258 bonds (distance) P-C4' energy: -88.332 flat angles C4'-P-C4' energy: -94.043 flat angles P-C4'-P energy: -71.790 tors. eta vs tors. theta energy: -84.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -995.695455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -995.695455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -995.695455 (E_RNA) where: Base-Base interactions energy: -614.178 where: short stacking energy: -314.922 Base-Backbone interact. energy: -1.404 local terms energy: -380.113373 where: bonds (distance) C4'-P energy: -86.439 bonds (distance) P-C4' energy: -68.149 flat angles C4'-P-C4' energy: -97.879 flat angles P-C4'-P energy: -54.766 tors. eta vs tors. theta energy: -72.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -945.815314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.815314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.815314 (E_RNA) where: Base-Base interactions energy: -583.880 where: short stacking energy: -284.141 Base-Backbone interact. energy: 2.179 local terms energy: -364.114714 where: bonds (distance) C4'-P energy: -83.769 bonds (distance) P-C4' energy: -80.883 flat angles C4'-P-C4' energy: -85.784 flat angles P-C4'-P energy: -50.812 tors. eta vs tors. theta energy: -62.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -765.693941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.693941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.693941 (E_RNA) where: Base-Base interactions energy: -425.295 where: short stacking energy: -211.300 Base-Backbone interact. energy: 0.097 local terms energy: -340.496571 where: bonds (distance) C4'-P energy: -83.819 bonds (distance) P-C4' energy: -91.026 flat angles C4'-P-C4' energy: -80.355 flat angles P-C4'-P energy: -51.731 tors. eta vs tors. theta energy: -33.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -530.307715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.307715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.307715 (E_RNA) where: Base-Base interactions energy: -254.159 where: short stacking energy: -178.780 Base-Backbone interact. energy: -2.079 local terms energy: -274.069297 where: bonds (distance) C4'-P energy: -63.384 bonds (distance) P-C4' energy: -83.529 flat angles C4'-P-C4' energy: -65.299 flat angles P-C4'-P energy: -36.704 tors. eta vs tors. theta energy: -25.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -497.361418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.361418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.361418 (E_RNA) where: Base-Base interactions energy: -233.036 where: short stacking energy: -142.338 Base-Backbone interact. energy: 4.935 local terms energy: -269.260950 where: bonds (distance) C4'-P energy: -86.029 bonds (distance) P-C4' energy: -71.796 flat angles C4'-P-C4' energy: -82.297 flat angles P-C4'-P energy: -34.373 tors. eta vs tors. theta energy: 5.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -366.769908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.769908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.769908 (E_RNA) where: Base-Base interactions energy: -133.194 where: short stacking energy: -119.335 Base-Backbone interact. energy: -1.360 local terms energy: -232.216075 where: bonds (distance) C4'-P energy: -79.483 bonds (distance) P-C4' energy: -80.699 flat angles C4'-P-C4' energy: -61.485 flat angles P-C4'-P energy: -37.427 tors. eta vs tors. theta energy: 26.877 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -1463.009247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1463.009247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.009247 (E_RNA) where: Base-Base interactions energy: -977.708 where: short stacking energy: -449.986 Base-Backbone interact. energy: -0.509 local terms energy: -484.791912 where: bonds (distance) C4'-P energy: -86.348 bonds (distance) P-C4' energy: -108.122 flat angles C4'-P-C4' energy: -107.525 flat angles P-C4'-P energy: -59.831 tors. eta vs tors. theta energy: -122.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -1265.097909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1265.097909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1265.097909 (E_RNA) where: Base-Base interactions energy: -839.013 where: short stacking energy: -371.248 Base-Backbone interact. energy: -0.404 local terms energy: -425.681458 where: bonds (distance) C4'-P energy: -66.528 bonds (distance) P-C4' energy: -103.628 flat angles C4'-P-C4' energy: -106.274 flat angles P-C4'-P energy: -68.782 tors. eta vs tors. theta energy: -80.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -1260.951407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1260.951407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1260.951407 (E_RNA) where: Base-Base interactions energy: -831.421 where: short stacking energy: -393.548 Base-Backbone interact. energy: -5.191 local terms energy: -424.338948 where: bonds (distance) C4'-P energy: -82.360 bonds (distance) P-C4' energy: -89.310 flat angles C4'-P-C4' energy: -86.919 flat angles P-C4'-P energy: -56.651 tors. eta vs tors. theta energy: -109.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -1119.900005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1119.900005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1119.900005 (E_RNA) where: Base-Base interactions energy: -673.138 where: short stacking energy: -368.162 Base-Backbone interact. energy: 0.252 local terms energy: -447.013239 where: bonds (distance) C4'-P energy: -89.680 bonds (distance) P-C4' energy: -98.538 flat angles C4'-P-C4' energy: -96.094 flat angles P-C4'-P energy: -59.681 tors. eta vs tors. theta energy: -103.020 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -1013.496331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1013.496331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1013.496331 (E_RNA) where: Base-Base interactions energy: -603.050 where: short stacking energy: -310.269 Base-Backbone interact. energy: -1.513 local terms energy: -408.932999 where: bonds (distance) C4'-P energy: -91.677 bonds (distance) P-C4' energy: -87.376 flat angles C4'-P-C4' energy: -94.794 flat angles P-C4'-P energy: -64.904 tors. eta vs tors. theta energy: -70.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -940.740765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -940.740765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.740765 (E_RNA) where: Base-Base interactions energy: -583.529 where: short stacking energy: -297.242 Base-Backbone interact. energy: -2.109 local terms energy: -355.103189 where: bonds (distance) C4'-P energy: -69.092 bonds (distance) P-C4' energy: -72.465 flat angles C4'-P-C4' energy: -96.622 flat angles P-C4'-P energy: -40.762 tors. eta vs tors. theta energy: -76.163 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -914.209908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -914.209908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -914.209908 (E_RNA) where: Base-Base interactions energy: -532.622 where: short stacking energy: -258.837 Base-Backbone interact. energy: -0.898 local terms energy: -380.689131 where: bonds (distance) C4'-P energy: -85.306 bonds (distance) P-C4' energy: -106.344 flat angles C4'-P-C4' energy: -80.297 flat angles P-C4'-P energy: -56.794 tors. eta vs tors. theta energy: -51.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -662.451994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.451994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.451994 (E_RNA) where: Base-Base interactions energy: -355.223 where: short stacking energy: -196.425 Base-Backbone interact. energy: 1.457 local terms energy: -308.686170 where: bonds (distance) C4'-P energy: -77.046 bonds (distance) P-C4' energy: -98.186 flat angles C4'-P-C4' energy: -78.903 flat angles P-C4'-P energy: -25.039 tors. eta vs tors. theta energy: -29.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -473.911061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.911061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.911061 (E_RNA) where: Base-Base interactions energy: -192.208 where: short stacking energy: -137.924 Base-Backbone interact. energy: -0.432 local terms energy: -281.271558 where: bonds (distance) C4'-P energy: -75.899 bonds (distance) P-C4' energy: -84.139 flat angles C4'-P-C4' energy: -80.731 flat angles P-C4'-P energy: -40.223 tors. eta vs tors. theta energy: -0.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -369.610124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.610124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.610124 (E_RNA) where: Base-Base interactions energy: -123.264 where: short stacking energy: -103.168 Base-Backbone interact. energy: -0.880 local terms energy: -245.465689 where: bonds (distance) C4'-P energy: -78.983 bonds (distance) P-C4' energy: -71.723 flat angles C4'-P-C4' energy: -65.795 flat angles P-C4'-P energy: -38.561 tors. eta vs tors. theta energy: 9.597 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -1449.419910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1449.419910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1449.419910 (E_RNA) where: Base-Base interactions energy: -949.151 where: short stacking energy: -432.197 Base-Backbone interact. energy: -2.335 local terms energy: -497.933043 where: bonds (distance) C4'-P energy: -97.118 bonds (distance) P-C4' energy: -100.859 flat angles C4'-P-C4' energy: -112.476 flat angles P-C4'-P energy: -64.273 tors. eta vs tors. theta energy: -123.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -1280.923710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1280.923710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1280.923710 (E_RNA) where: Base-Base interactions energy: -853.239 where: short stacking energy: -362.651 Base-Backbone interact. energy: -1.732 local terms energy: -425.952248 where: bonds (distance) C4'-P energy: -97.191 bonds (distance) P-C4' energy: -88.586 flat angles C4'-P-C4' energy: -96.768 flat angles P-C4'-P energy: -52.908 tors. eta vs tors. theta energy: -90.499 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -1260.536021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1260.536021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1260.536021 (E_RNA) where: Base-Base interactions energy: -820.376 where: short stacking energy: -416.409 Base-Backbone interact. energy: -1.170 local terms energy: -438.990320 where: bonds (distance) C4'-P energy: -89.950 bonds (distance) P-C4' energy: -79.315 flat angles C4'-P-C4' energy: -102.816 flat angles P-C4'-P energy: -60.840 tors. eta vs tors. theta energy: -106.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -1089.834140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.834140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1089.834140 (E_RNA) where: Base-Base interactions energy: -667.542 where: short stacking energy: -337.993 Base-Backbone interact. energy: -0.258 local terms energy: -422.033408 where: bonds (distance) C4'-P energy: -82.280 bonds (distance) P-C4' energy: -100.347 flat angles C4'-P-C4' energy: -87.340 flat angles P-C4'-P energy: -63.654 tors. eta vs tors. theta energy: -88.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -1016.321997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.321997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1016.321997 (E_RNA) where: Base-Base interactions energy: -600.217 where: short stacking energy: -318.554 Base-Backbone interact. energy: -0.278 local terms energy: -415.827519 where: bonds (distance) C4'-P energy: -82.019 bonds (distance) P-C4' energy: -97.832 flat angles C4'-P-C4' energy: -89.682 flat angles P-C4'-P energy: -68.416 tors. eta vs tors. theta energy: -77.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -939.644936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -939.644936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.644936 (E_RNA) where: Base-Base interactions energy: -555.531 where: short stacking energy: -272.665 Base-Backbone interact. energy: 1.822 local terms energy: -385.936355 where: bonds (distance) C4'-P energy: -88.997 bonds (distance) P-C4' energy: -93.414 flat angles C4'-P-C4' energy: -88.858 flat angles P-C4'-P energy: -64.024 tors. eta vs tors. theta energy: -50.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -904.033865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.033865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -904.033865 (E_RNA) where: Base-Base interactions energy: -548.252 where: short stacking energy: -268.582 Base-Backbone interact. energy: 1.444 local terms energy: -357.225571 where: bonds (distance) C4'-P energy: -72.862 bonds (distance) P-C4' energy: -83.047 flat angles C4'-P-C4' energy: -81.472 flat angles P-C4'-P energy: -53.617 tors. eta vs tors. theta energy: -66.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -649.448615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.448615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.448615 (E_RNA) where: Base-Base interactions energy: -354.429 where: short stacking energy: -189.552 Base-Backbone interact. energy: -2.714 local terms energy: -292.305936 where: bonds (distance) C4'-P energy: -76.042 bonds (distance) P-C4' energy: -81.909 flat angles C4'-P-C4' energy: -81.000 flat angles P-C4'-P energy: -35.720 tors. eta vs tors. theta energy: -17.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -471.817376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.817376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.817376 (E_RNA) where: Base-Base interactions energy: -216.234 where: short stacking energy: -156.416 Base-Backbone interact. energy: -1.273 local terms energy: -254.310324 where: bonds (distance) C4'-P energy: -66.360 bonds (distance) P-C4' energy: -89.417 flat angles C4'-P-C4' energy: -76.606 flat angles P-C4'-P energy: -10.042 tors. eta vs tors. theta energy: -11.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -363.687212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.687212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.687212 (E_RNA) where: Base-Base interactions energy: -122.033 where: short stacking energy: -95.202 Base-Backbone interact. energy: 5.320 local terms energy: -246.974684 where: bonds (distance) C4'-P energy: -75.139 bonds (distance) P-C4' energy: -80.667 flat angles C4'-P-C4' energy: -70.810 flat angles P-C4'-P energy: -44.120 tors. eta vs tors. theta energy: 23.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -1457.862590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1457.862590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.862590 (E_RNA) where: Base-Base interactions energy: -956.258 where: short stacking energy: -448.165 Base-Backbone interact. energy: 0.498 local terms energy: -502.102686 where: bonds (distance) C4'-P energy: -90.979 bonds (distance) P-C4' energy: -99.564 flat angles C4'-P-C4' energy: -105.978 flat angles P-C4'-P energy: -73.377 tors. eta vs tors. theta energy: -132.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -1262.263373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1262.263373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1262.263373 (E_RNA) where: Base-Base interactions energy: -820.634 where: short stacking energy: -352.019 Base-Backbone interact. energy: 1.255 local terms energy: -442.884258 where: bonds (distance) C4'-P energy: -97.957 bonds (distance) P-C4' energy: -102.785 flat angles C4'-P-C4' energy: -95.941 flat angles P-C4'-P energy: -63.216 tors. eta vs tors. theta energy: -82.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -1294.160512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1294.160512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1294.160512 (E_RNA) where: Base-Base interactions energy: -833.776 where: short stacking energy: -392.522 Base-Backbone interact. energy: 1.665 local terms energy: -462.049056 where: bonds (distance) C4'-P energy: -97.176 bonds (distance) P-C4' energy: -85.887 flat angles C4'-P-C4' energy: -104.668 flat angles P-C4'-P energy: -64.364 tors. eta vs tors. theta energy: -109.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -1149.842221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1149.842221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1149.842221 (E_RNA) where: Base-Base interactions energy: -696.855 where: short stacking energy: -344.919 Base-Backbone interact. energy: -2.085 local terms energy: -450.901391 where: bonds (distance) C4'-P energy: -92.212 bonds (distance) P-C4' energy: -86.020 flat angles C4'-P-C4' energy: -103.450 flat angles P-C4'-P energy: -76.428 tors. eta vs tors. theta energy: -92.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -1004.733717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.733717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1004.733717 (E_RNA) where: Base-Base interactions energy: -605.072 where: short stacking energy: -319.690 Base-Backbone interact. energy: 2.075 local terms energy: -401.736423 where: bonds (distance) C4'-P energy: -71.584 bonds (distance) P-C4' energy: -107.351 flat angles C4'-P-C4' energy: -86.676 flat angles P-C4'-P energy: -60.620 tors. eta vs tors. theta energy: -75.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -961.150778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -961.150778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.150778 (E_RNA) where: Base-Base interactions energy: -611.861 where: short stacking energy: -285.892 Base-Backbone interact. energy: -1.216 local terms energy: -348.073901 where: bonds (distance) C4'-P energy: -84.903 bonds (distance) P-C4' energy: -70.667 flat angles C4'-P-C4' energy: -82.880 flat angles P-C4'-P energy: -57.432 tors. eta vs tors. theta energy: -52.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -987.188966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.188966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -987.188966 (E_RNA) where: Base-Base interactions energy: -634.568 where: short stacking energy: -301.730 Base-Backbone interact. energy: 1.996 local terms energy: -354.617377 where: bonds (distance) C4'-P energy: -77.286 bonds (distance) P-C4' energy: -89.280 flat angles C4'-P-C4' energy: -72.570 flat angles P-C4'-P energy: -55.243 tors. eta vs tors. theta energy: -60.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -680.555883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.555883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.555883 (E_RNA) where: Base-Base interactions energy: -391.526 where: short stacking energy: -219.821 Base-Backbone interact. energy: 1.770 local terms energy: -290.800081 where: bonds (distance) C4'-P energy: -68.972 bonds (distance) P-C4' energy: -74.469 flat angles C4'-P-C4' energy: -71.319 flat angles P-C4'-P energy: -47.471 tors. eta vs tors. theta energy: -28.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -403.441135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.441135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.441135 (E_RNA) where: Base-Base interactions energy: -127.614 where: short stacking energy: -118.339 Base-Backbone interact. energy: -2.421 local terms energy: -273.405785 where: bonds (distance) C4'-P energy: -68.234 bonds (distance) P-C4' energy: -95.616 flat angles C4'-P-C4' energy: -74.269 flat angles P-C4'-P energy: -43.214 tors. eta vs tors. theta energy: 7.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -371.779945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.779945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.779945 (E_RNA) where: Base-Base interactions energy: -109.373 where: short stacking energy: -93.449 Base-Backbone interact. energy: -2.960 local terms energy: -259.447606 where: bonds (distance) C4'-P energy: -82.203 bonds (distance) P-C4' energy: -73.768 flat angles C4'-P-C4' energy: -59.164 flat angles P-C4'-P energy: -45.682 tors. eta vs tors. theta energy: 1.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -1474.210741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1474.210741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1474.210741 (E_RNA) where: Base-Base interactions energy: -959.666 where: short stacking energy: -439.682 Base-Backbone interact. energy: -1.340 local terms energy: -513.204530 where: bonds (distance) C4'-P energy: -102.984 bonds (distance) P-C4' energy: -97.750 flat angles C4'-P-C4' energy: -107.559 flat angles P-C4'-P energy: -78.960 tors. eta vs tors. theta energy: -125.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -1323.223607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1323.223607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1323.223607 (E_RNA) where: Base-Base interactions energy: -875.047 where: short stacking energy: -391.800 Base-Backbone interact. energy: -3.483 local terms energy: -444.692905 where: bonds (distance) C4'-P energy: -92.612 bonds (distance) P-C4' energy: -97.593 flat angles C4'-P-C4' energy: -91.945 flat angles P-C4'-P energy: -66.640 tors. eta vs tors. theta energy: -95.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -1220.013749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1220.013749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1220.013749 (E_RNA) where: Base-Base interactions energy: -790.418 where: short stacking energy: -339.754 Base-Backbone interact. energy: 0.732 local terms energy: -430.328109 where: bonds (distance) C4'-P energy: -101.907 bonds (distance) P-C4' energy: -91.486 flat angles C4'-P-C4' energy: -92.964 flat angles P-C4'-P energy: -60.829 tors. eta vs tors. theta energy: -83.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -1144.064589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1144.064589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1144.064589 (E_RNA) where: Base-Base interactions energy: -721.269 where: short stacking energy: -375.609 Base-Backbone interact. energy: 0.564 local terms energy: -423.359491 where: bonds (distance) C4'-P energy: -69.145 bonds (distance) P-C4' energy: -93.970 flat angles C4'-P-C4' energy: -93.562 flat angles P-C4'-P energy: -64.176 tors. eta vs tors. theta energy: -102.507 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -1006.212623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.212623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1006.212623 (E_RNA) where: Base-Base interactions energy: -628.752 where: short stacking energy: -302.133 Base-Backbone interact. energy: -0.384 local terms energy: -377.077513 where: bonds (distance) C4'-P energy: -93.576 bonds (distance) P-C4' energy: -89.518 flat angles C4'-P-C4' energy: -87.896 flat angles P-C4'-P energy: -35.867 tors. eta vs tors. theta energy: -70.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -1040.623031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.623031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.623031 (E_RNA) where: Base-Base interactions energy: -652.678 where: short stacking energy: -285.608 Base-Backbone interact. energy: -0.025 local terms energy: -387.920189 where: bonds (distance) C4'-P energy: -97.506 bonds (distance) P-C4' energy: -67.728 flat angles C4'-P-C4' energy: -95.939 flat angles P-C4'-P energy: -72.286 tors. eta vs tors. theta energy: -54.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -915.443773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -915.443773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -915.443773 (E_RNA) where: Base-Base interactions energy: -547.880 where: short stacking energy: -261.901 Base-Backbone interact. energy: -0.203 local terms energy: -367.360823 where: bonds (distance) C4'-P energy: -86.184 bonds (distance) P-C4' energy: -91.268 flat angles C4'-P-C4' energy: -75.234 flat angles P-C4'-P energy: -59.580 tors. eta vs tors. theta energy: -55.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -675.784419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.784419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.784419 (E_RNA) where: Base-Base interactions energy: -381.869 where: short stacking energy: -199.628 Base-Backbone interact. energy: 1.592 local terms energy: -295.507159 where: bonds (distance) C4'-P energy: -69.348 bonds (distance) P-C4' energy: -76.908 flat angles C4'-P-C4' energy: -77.523 flat angles P-C4'-P energy: -45.126 tors. eta vs tors. theta energy: -26.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -405.015485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.015485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.015485 (E_RNA) where: Base-Base interactions energy: -160.637 where: short stacking energy: -118.956 Base-Backbone interact. energy: -0.812 local terms energy: -243.567166 where: bonds (distance) C4'-P energy: -72.144 bonds (distance) P-C4' energy: -81.487 flat angles C4'-P-C4' energy: -58.109 flat angles P-C4'-P energy: -47.022 tors. eta vs tors. theta energy: 15.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -373.183066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.183066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.183066 (E_RNA) where: Base-Base interactions energy: -116.242 where: short stacking energy: -82.711 Base-Backbone interact. energy: 2.811 local terms energy: -259.751608 where: bonds (distance) C4'-P energy: -85.375 bonds (distance) P-C4' energy: -90.676 flat angles C4'-P-C4' energy: -74.198 flat angles P-C4'-P energy: -37.119 tors. eta vs tors. theta energy: 27.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -1478.227107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.227107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.227107 (E_RNA) where: Base-Base interactions energy: -993.040 where: short stacking energy: -433.195 Base-Backbone interact. energy: -5.717 local terms energy: -479.470764 where: bonds (distance) C4'-P energy: -97.713 bonds (distance) P-C4' energy: -96.170 flat angles C4'-P-C4' energy: -97.472 flat angles P-C4'-P energy: -73.574 tors. eta vs tors. theta energy: -114.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -1326.319772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1326.319772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1326.319772 (E_RNA) where: Base-Base interactions energy: -883.110 where: short stacking energy: -396.357 Base-Backbone interact. energy: -2.271 local terms energy: -440.939636 where: bonds (distance) C4'-P energy: -78.028 bonds (distance) P-C4' energy: -97.269 flat angles C4'-P-C4' energy: -100.847 flat angles P-C4'-P energy: -61.243 tors. eta vs tors. theta energy: -103.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -1199.756030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1199.756030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1199.756030 (E_RNA) where: Base-Base interactions energy: -735.605 where: short stacking energy: -346.414 Base-Backbone interact. energy: -0.911 local terms energy: -463.239895 where: bonds (distance) C4'-P energy: -92.308 bonds (distance) P-C4' energy: -104.704 flat angles C4'-P-C4' energy: -111.079 flat angles P-C4'-P energy: -59.837 tors. eta vs tors. theta energy: -95.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -1124.311677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1124.311677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1124.311677 (E_RNA) where: Base-Base interactions energy: -703.899 where: short stacking energy: -351.492 Base-Backbone interact. energy: -0.772 local terms energy: -419.640172 where: bonds (distance) C4'-P energy: -91.467 bonds (distance) P-C4' energy: -73.889 flat angles C4'-P-C4' energy: -91.803 flat angles P-C4'-P energy: -78.394 tors. eta vs tors. theta energy: -84.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -1084.279160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1084.279160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1084.279160 (E_RNA) where: Base-Base interactions energy: -685.333 where: short stacking energy: -336.030 Base-Backbone interact. energy: -0.807 local terms energy: -398.140036 where: bonds (distance) C4'-P energy: -85.149 bonds (distance) P-C4' energy: -76.480 flat angles C4'-P-C4' energy: -86.696 flat angles P-C4'-P energy: -63.980 tors. eta vs tors. theta energy: -85.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -971.376169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -971.376169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -971.376169 (E_RNA) where: Base-Base interactions energy: -607.549 where: short stacking energy: -317.604 Base-Backbone interact. energy: -1.087 local terms energy: -362.740798 where: bonds (distance) C4'-P energy: -68.198 bonds (distance) P-C4' energy: -76.523 flat angles C4'-P-C4' energy: -75.607 flat angles P-C4'-P energy: -56.669 tors. eta vs tors. theta energy: -85.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -925.779527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -925.779527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -925.779527 (E_RNA) where: Base-Base interactions energy: -562.992 where: short stacking energy: -277.684 Base-Backbone interact. energy: -1.266 local terms energy: -361.521366 where: bonds (distance) C4'-P energy: -79.706 bonds (distance) P-C4' energy: -85.944 flat angles C4'-P-C4' energy: -91.869 flat angles P-C4'-P energy: -45.831 tors. eta vs tors. theta energy: -58.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -652.041919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -652.041919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.041919 (E_RNA) where: Base-Base interactions energy: -341.290 where: short stacking energy: -203.083 Base-Backbone interact. energy: -1.088 local terms energy: -309.664095 where: bonds (distance) C4'-P energy: -84.112 bonds (distance) P-C4' energy: -76.868 flat angles C4'-P-C4' energy: -78.339 flat angles P-C4'-P energy: -53.338 tors. eta vs tors. theta energy: -17.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -387.807171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.807171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.807171 (E_RNA) where: Base-Base interactions energy: -125.223 where: short stacking energy: -109.142 Base-Backbone interact. energy: -0.350 local terms energy: -262.234519 where: bonds (distance) C4'-P energy: -82.269 bonds (distance) P-C4' energy: -88.555 flat angles C4'-P-C4' energy: -62.773 flat angles P-C4'-P energy: -51.995 tors. eta vs tors. theta energy: 23.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -398.487475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.487475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.487475 (E_RNA) where: Base-Base interactions energy: -126.394 where: short stacking energy: -108.808 Base-Backbone interact. energy: -1.143 local terms energy: -270.950042 where: bonds (distance) C4'-P energy: -85.853 bonds (distance) P-C4' energy: -89.479 flat angles C4'-P-C4' energy: -73.209 flat angles P-C4'-P energy: -28.889 tors. eta vs tors. theta energy: 6.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -1461.578969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1461.578969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1461.578969 (E_RNA) where: Base-Base interactions energy: -967.914 where: short stacking energy: -434.804 Base-Backbone interact. energy: -3.398 local terms energy: -490.267170 where: bonds (distance) C4'-P energy: -85.897 bonds (distance) P-C4' energy: -103.003 flat angles C4'-P-C4' energy: -108.406 flat angles P-C4'-P energy: -63.686 tors. eta vs tors. theta energy: -129.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -1358.476873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1358.476873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1358.476873 (E_RNA) where: Base-Base interactions energy: -881.332 where: short stacking energy: -406.076 Base-Backbone interact. energy: -0.559 local terms energy: -476.585739 where: bonds (distance) C4'-P energy: -90.814 bonds (distance) P-C4' energy: -98.138 flat angles C4'-P-C4' energy: -108.550 flat angles P-C4'-P energy: -73.939 tors. eta vs tors. theta energy: -105.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -1210.481472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1210.481472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1210.481472 (E_RNA) where: Base-Base interactions energy: -801.679 where: short stacking energy: -360.661 Base-Backbone interact. energy: -0.702 local terms energy: -408.100589 where: bonds (distance) C4'-P energy: -86.764 bonds (distance) P-C4' energy: -85.651 flat angles C4'-P-C4' energy: -103.187 flat angles P-C4'-P energy: -48.125 tors. eta vs tors. theta energy: -84.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -1141.903431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1141.903431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1141.903431 (E_RNA) where: Base-Base interactions energy: -708.522 where: short stacking energy: -325.927 Base-Backbone interact. energy: -1.831 local terms energy: -431.550288 where: bonds (distance) C4'-P energy: -93.174 bonds (distance) P-C4' energy: -94.309 flat angles C4'-P-C4' energy: -87.903 flat angles P-C4'-P energy: -65.403 tors. eta vs tors. theta energy: -90.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -1076.166509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.166509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1076.166509 (E_RNA) where: Base-Base interactions energy: -651.276 where: short stacking energy: -310.358 Base-Backbone interact. energy: 0.738 local terms energy: -425.628248 where: bonds (distance) C4'-P energy: -86.428 bonds (distance) P-C4' energy: -90.792 flat angles C4'-P-C4' energy: -103.585 flat angles P-C4'-P energy: -61.655 tors. eta vs tors. theta energy: -83.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -984.242321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.242321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.242321 (E_RNA) where: Base-Base interactions energy: -621.782 where: short stacking energy: -304.266 Base-Backbone interact. energy: -1.510 local terms energy: -360.949994 where: bonds (distance) C4'-P energy: -88.148 bonds (distance) P-C4' energy: -67.683 flat angles C4'-P-C4' energy: -76.626 flat angles P-C4'-P energy: -64.228 tors. eta vs tors. theta energy: -64.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -871.231368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.231368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.231368 (E_RNA) where: Base-Base interactions energy: -534.559 where: short stacking energy: -247.583 Base-Backbone interact. energy: 0.967 local terms energy: -337.639363 where: bonds (distance) C4'-P energy: -91.471 bonds (distance) P-C4' energy: -84.102 flat angles C4'-P-C4' energy: -82.998 flat angles P-C4'-P energy: -36.364 tors. eta vs tors. theta energy: -42.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -678.259733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.259733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.259733 (E_RNA) where: Base-Base interactions energy: -362.533 where: short stacking energy: -202.093 Base-Backbone interact. energy: -2.084 local terms energy: -313.642269 where: bonds (distance) C4'-P energy: -87.977 bonds (distance) P-C4' energy: -75.282 flat angles C4'-P-C4' energy: -74.439 flat angles P-C4'-P energy: -51.570 tors. eta vs tors. theta energy: -24.374 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -441.409412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.409412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.409412 (E_RNA) where: Base-Base interactions energy: -188.632 where: short stacking energy: -139.819 Base-Backbone interact. energy: 1.619 local terms energy: -254.396350 where: bonds (distance) C4'-P energy: -80.581 bonds (distance) P-C4' energy: -80.085 flat angles C4'-P-C4' energy: -81.637 flat angles P-C4'-P energy: -28.873 tors. eta vs tors. theta energy: 16.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -385.492404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.492404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.492404 (E_RNA) where: Base-Base interactions energy: -128.367 where: short stacking energy: -109.803 Base-Backbone interact. energy: -4.055 local terms energy: -253.069949 where: bonds (distance) C4'-P energy: -83.704 bonds (distance) P-C4' energy: -89.723 flat angles C4'-P-C4' energy: -65.317 flat angles P-C4'-P energy: -35.725 tors. eta vs tors. theta energy: 21.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -1461.586097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1461.586097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1461.586097 (E_RNA) where: Base-Base interactions energy: -968.049 where: short stacking energy: -422.164 Base-Backbone interact. energy: -4.014 local terms energy: -489.523348 where: bonds (distance) C4'-P energy: -101.323 bonds (distance) P-C4' energy: -87.120 flat angles C4'-P-C4' energy: -106.746 flat angles P-C4'-P energy: -71.426 tors. eta vs tors. theta energy: -122.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -1353.944282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1353.944282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1353.944282 (E_RNA) where: Base-Base interactions energy: -869.701 where: short stacking energy: -401.485 Base-Backbone interact. energy: -1.152 local terms energy: -483.090351 where: bonds (distance) C4'-P energy: -108.364 bonds (distance) P-C4' energy: -100.352 flat angles C4'-P-C4' energy: -97.893 flat angles P-C4'-P energy: -69.149 tors. eta vs tors. theta energy: -107.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -1245.807504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1245.807504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1245.807504 (E_RNA) where: Base-Base interactions energy: -825.234 where: short stacking energy: -328.862 Base-Backbone interact. energy: -0.425 local terms energy: -420.148211 where: bonds (distance) C4'-P energy: -93.517 bonds (distance) P-C4' energy: -92.639 flat angles C4'-P-C4' energy: -92.281 flat angles P-C4'-P energy: -61.902 tors. eta vs tors. theta energy: -79.809 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -1157.667638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1157.667638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1157.667638 (E_RNA) where: Base-Base interactions energy: -737.979 where: short stacking energy: -353.507 Base-Backbone interact. energy: -2.021 local terms energy: -417.668036 where: bonds (distance) C4'-P energy: -79.172 bonds (distance) P-C4' energy: -78.952 flat angles C4'-P-C4' energy: -92.215 flat angles P-C4'-P energy: -65.889 tors. eta vs tors. theta energy: -101.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -1047.745590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.745590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1047.745590 (E_RNA) where: Base-Base interactions energy: -634.181 where: short stacking energy: -298.527 Base-Backbone interact. energy: -0.038 local terms energy: -413.526646 where: bonds (distance) C4'-P energy: -81.316 bonds (distance) P-C4' energy: -98.176 flat angles C4'-P-C4' energy: -92.421 flat angles P-C4'-P energy: -67.583 tors. eta vs tors. theta energy: -74.031 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -968.747025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -968.747025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -968.747025 (E_RNA) where: Base-Base interactions energy: -595.658 where: short stacking energy: -290.575 Base-Backbone interact. energy: 1.663 local terms energy: -374.751993 where: bonds (distance) C4'-P energy: -91.782 bonds (distance) P-C4' energy: -90.610 flat angles C4'-P-C4' energy: -80.358 flat angles P-C4'-P energy: -58.884 tors. eta vs tors. theta energy: -53.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -856.919371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.919371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -856.919371 (E_RNA) where: Base-Base interactions energy: -511.383 where: short stacking energy: -243.451 Base-Backbone interact. energy: -2.623 local terms energy: -342.912945 where: bonds (distance) C4'-P energy: -69.969 bonds (distance) P-C4' energy: -77.944 flat angles C4'-P-C4' energy: -93.091 flat angles P-C4'-P energy: -52.802 tors. eta vs tors. theta energy: -49.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -667.615658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.615658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.615658 (E_RNA) where: Base-Base interactions energy: -386.504 where: short stacking energy: -212.474 Base-Backbone interact. energy: -0.686 local terms energy: -280.425541 where: bonds (distance) C4'-P energy: -90.626 bonds (distance) P-C4' energy: -72.192 flat angles C4'-P-C4' energy: -61.418 flat angles P-C4'-P energy: -43.819 tors. eta vs tors. theta energy: -12.370 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -482.668946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.668946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.668946 (E_RNA) where: Base-Base interactions energy: -213.339 where: short stacking energy: -141.920 Base-Backbone interact. energy: 1.727 local terms energy: -271.057065 where: bonds (distance) C4'-P energy: -67.687 bonds (distance) P-C4' energy: -75.879 flat angles C4'-P-C4' energy: -80.838 flat angles P-C4'-P energy: -33.116 tors. eta vs tors. theta energy: -13.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -405.333747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.333747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.333747 (E_RNA) where: Base-Base interactions energy: -168.987 where: short stacking energy: -123.997 Base-Backbone interact. energy: -0.250 local terms energy: -236.096829 where: bonds (distance) C4'-P energy: -75.432 bonds (distance) P-C4' energy: -59.421 flat angles C4'-P-C4' energy: -77.025 flat angles P-C4'-P energy: -36.448 tors. eta vs tors. theta energy: 12.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -1456.639607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1456.639607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1456.639607 (E_RNA) where: Base-Base interactions energy: -965.913 where: short stacking energy: -442.434 Base-Backbone interact. energy: 0.700 local terms energy: -491.425835 where: bonds (distance) C4'-P energy: -89.745 bonds (distance) P-C4' energy: -100.893 flat angles C4'-P-C4' energy: -101.437 flat angles P-C4'-P energy: -70.997 tors. eta vs tors. theta energy: -128.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -1352.225400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1352.225400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.225400 (E_RNA) where: Base-Base interactions energy: -888.580 where: short stacking energy: -407.377 Base-Backbone interact. energy: -0.594 local terms energy: -463.051261 where: bonds (distance) C4'-P energy: -88.976 bonds (distance) P-C4' energy: -91.636 flat angles C4'-P-C4' energy: -95.949 flat angles P-C4'-P energy: -74.076 tors. eta vs tors. theta energy: -112.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -1234.795206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1234.795206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1234.795206 (E_RNA) where: Base-Base interactions energy: -830.120 where: short stacking energy: -378.035 Base-Backbone interact. energy: 1.960 local terms energy: -406.634837 where: bonds (distance) C4'-P energy: -78.497 bonds (distance) P-C4' energy: -80.006 flat angles C4'-P-C4' energy: -103.759 flat angles P-C4'-P energy: -56.988 tors. eta vs tors. theta energy: -87.384 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -1179.399085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1179.399085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1179.399085 (E_RNA) where: Base-Base interactions energy: -742.603 where: short stacking energy: -352.942 Base-Backbone interact. energy: -1.003 local terms energy: -435.793038 where: bonds (distance) C4'-P energy: -86.621 bonds (distance) P-C4' energy: -98.522 flat angles C4'-P-C4' energy: -88.862 flat angles P-C4'-P energy: -66.348 tors. eta vs tors. theta energy: -95.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -1025.591322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.591322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1025.591322 (E_RNA) where: Base-Base interactions energy: -630.328 where: short stacking energy: -312.254 Base-Backbone interact. energy: -0.634 local terms energy: -394.629911 where: bonds (distance) C4'-P energy: -81.445 bonds (distance) P-C4' energy: -84.550 flat angles C4'-P-C4' energy: -86.753 flat angles P-C4'-P energy: -57.431 tors. eta vs tors. theta energy: -84.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -1010.478868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.478868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1010.478868 (E_RNA) where: Base-Base interactions energy: -631.826 where: short stacking energy: -295.158 Base-Backbone interact. energy: 5.941 local terms energy: -384.593927 where: bonds (distance) C4'-P energy: -80.969 bonds (distance) P-C4' energy: -85.823 flat angles C4'-P-C4' energy: -92.354 flat angles P-C4'-P energy: -57.674 tors. eta vs tors. theta energy: -67.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -850.511840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.511840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -850.511840 (E_RNA) where: Base-Base interactions energy: -506.093 where: short stacking energy: -238.197 Base-Backbone interact. energy: 0.835 local terms energy: -345.253936 where: bonds (distance) C4'-P energy: -82.012 bonds (distance) P-C4' energy: -96.093 flat angles C4'-P-C4' energy: -78.424 flat angles P-C4'-P energy: -39.605 tors. eta vs tors. theta energy: -49.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -641.006799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -641.006799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -641.006799 (E_RNA) where: Base-Base interactions energy: -337.758 where: short stacking energy: -195.718 Base-Backbone interact. energy: -2.606 local terms energy: -300.642640 where: bonds (distance) C4'-P energy: -69.189 bonds (distance) P-C4' energy: -90.172 flat angles C4'-P-C4' energy: -74.492 flat angles P-C4'-P energy: -56.021 tors. eta vs tors. theta energy: -10.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -470.580023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.580023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.580023 (E_RNA) where: Base-Base interactions energy: -185.445 where: short stacking energy: -136.995 Base-Backbone interact. energy: 0.556 local terms energy: -285.690878 where: bonds (distance) C4'-P energy: -95.236 bonds (distance) P-C4' energy: -89.940 flat angles C4'-P-C4' energy: -64.165 flat angles P-C4'-P energy: -38.149 tors. eta vs tors. theta energy: 1.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -434.544474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.544474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.544474 (E_RNA) where: Base-Base interactions energy: -175.721 where: short stacking energy: -132.710 Base-Backbone interact. energy: 3.452 local terms energy: -262.274978 where: bonds (distance) C4'-P energy: -69.262 bonds (distance) P-C4' energy: -88.087 flat angles C4'-P-C4' energy: -69.351 flat angles P-C4'-P energy: -31.212 tors. eta vs tors. theta energy: -4.364 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -1441.466246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1441.466246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1441.466246 (E_RNA) where: Base-Base interactions energy: -946.988 where: short stacking energy: -406.105 Base-Backbone interact. energy: -3.314 local terms energy: -491.164270 where: bonds (distance) C4'-P energy: -98.883 bonds (distance) P-C4' energy: -108.864 flat angles C4'-P-C4' energy: -101.858 flat angles P-C4'-P energy: -65.622 tors. eta vs tors. theta energy: -115.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -1342.956240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.956240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1342.956240 (E_RNA) where: Base-Base interactions energy: -866.069 where: short stacking energy: -385.602 Base-Backbone interact. energy: -1.090 local terms energy: -475.796756 where: bonds (distance) C4'-P energy: -95.608 bonds (distance) P-C4' energy: -101.833 flat angles C4'-P-C4' energy: -106.330 flat angles P-C4'-P energy: -60.371 tors. eta vs tors. theta energy: -111.655 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -1231.486815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1231.486815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1231.486815 (E_RNA) where: Base-Base interactions energy: -832.658 where: short stacking energy: -367.536 Base-Backbone interact. energy: -3.897 local terms energy: -394.931999 where: bonds (distance) C4'-P energy: -86.222 bonds (distance) P-C4' energy: -73.493 flat angles C4'-P-C4' energy: -94.003 flat angles P-C4'-P energy: -47.973 tors. eta vs tors. theta energy: -93.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -1165.958190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1165.958190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1165.958190 (E_RNA) where: Base-Base interactions energy: -769.903 where: short stacking energy: -364.853 Base-Backbone interact. energy: -0.743 local terms energy: -395.311939 where: bonds (distance) C4'-P energy: -89.334 bonds (distance) P-C4' energy: -64.737 flat angles C4'-P-C4' energy: -84.302 flat angles P-C4'-P energy: -62.512 tors. eta vs tors. theta energy: -94.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -1054.630131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1054.630131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1054.630131 (E_RNA) where: Base-Base interactions energy: -638.481 where: short stacking energy: -323.709 Base-Backbone interact. energy: -1.115 local terms energy: -415.033938 where: bonds (distance) C4'-P energy: -93.800 bonds (distance) P-C4' energy: -95.822 flat angles C4'-P-C4' energy: -87.002 flat angles P-C4'-P energy: -67.698 tors. eta vs tors. theta energy: -70.712 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -1015.234545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1015.234545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1015.234545 (E_RNA) where: Base-Base interactions energy: -636.331 where: short stacking energy: -257.438 Base-Backbone interact. energy: -3.768 local terms energy: -375.136252 where: bonds (distance) C4'-P energy: -84.445 bonds (distance) P-C4' energy: -77.697 flat angles C4'-P-C4' energy: -92.682 flat angles P-C4'-P energy: -53.358 tors. eta vs tors. theta energy: -66.955 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -839.901529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -839.901529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -839.901529 (E_RNA) where: Base-Base interactions energy: -492.945 where: short stacking energy: -217.851 Base-Backbone interact. energy: -2.803 local terms energy: -344.153584 where: bonds (distance) C4'-P energy: -85.230 bonds (distance) P-C4' energy: -87.691 flat angles C4'-P-C4' energy: -77.421 flat angles P-C4'-P energy: -57.468 tors. eta vs tors. theta energy: -36.344 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -585.397785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.397785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.397785 (E_RNA) where: Base-Base interactions energy: -289.157 where: short stacking energy: -156.142 Base-Backbone interact. energy: -0.858 local terms energy: -295.382969 where: bonds (distance) C4'-P energy: -76.489 bonds (distance) P-C4' energy: -87.613 flat angles C4'-P-C4' energy: -69.011 flat angles P-C4'-P energy: -47.612 tors. eta vs tors. theta energy: -14.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -464.579471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.579471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.579471 (E_RNA) where: Base-Base interactions energy: -210.984 where: short stacking energy: -139.019 Base-Backbone interact. energy: -2.617 local terms energy: -250.978302 where: bonds (distance) C4'-P energy: -63.450 bonds (distance) P-C4' energy: -81.117 flat angles C4'-P-C4' energy: -74.350 flat angles P-C4'-P energy: -39.830 tors. eta vs tors. theta energy: 7.769 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -387.115263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.115263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.115263 (E_RNA) where: Base-Base interactions energy: -123.703 where: short stacking energy: -102.707 Base-Backbone interact. energy: -0.576 local terms energy: -262.836499 where: bonds (distance) C4'-P energy: -75.661 bonds (distance) P-C4' energy: -68.546 flat angles C4'-P-C4' energy: -77.428 flat angles P-C4'-P energy: -52.863 tors. eta vs tors. theta energy: 11.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -1457.029152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1457.029152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.029152 (E_RNA) where: Base-Base interactions energy: -948.072 where: short stacking energy: -420.726 Base-Backbone interact. energy: -2.402 local terms energy: -506.555249 where: bonds (distance) C4'-P energy: -92.277 bonds (distance) P-C4' energy: -97.153 flat angles C4'-P-C4' energy: -112.996 flat angles P-C4'-P energy: -76.516 tors. eta vs tors. theta energy: -127.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -1356.030246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1356.030246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1356.030246 (E_RNA) where: Base-Base interactions energy: -882.645 where: short stacking energy: -412.251 Base-Backbone interact. energy: -2.429 local terms energy: -470.956622 where: bonds (distance) C4'-P energy: -91.913 bonds (distance) P-C4' energy: -95.765 flat angles C4'-P-C4' energy: -103.629 flat angles P-C4'-P energy: -64.583 tors. eta vs tors. theta energy: -115.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -1252.373503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1252.373503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1252.373503 (E_RNA) where: Base-Base interactions energy: -806.545 where: short stacking energy: -370.199 Base-Backbone interact. energy: -0.264 local terms energy: -445.564678 where: bonds (distance) C4'-P energy: -91.272 bonds (distance) P-C4' energy: -103.299 flat angles C4'-P-C4' energy: -97.154 flat angles P-C4'-P energy: -62.196 tors. eta vs tors. theta energy: -91.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -1135.347724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1135.347724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1135.347724 (E_RNA) where: Base-Base interactions energy: -725.255 where: short stacking energy: -337.868 Base-Backbone interact. energy: 2.273 local terms energy: -412.365463 where: bonds (distance) C4'-P energy: -83.627 bonds (distance) P-C4' energy: -101.705 flat angles C4'-P-C4' energy: -92.919 flat angles P-C4'-P energy: -48.956 tors. eta vs tors. theta energy: -85.158 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -1013.960021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1013.960021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1013.960021 (E_RNA) where: Base-Base interactions energy: -610.881 where: short stacking energy: -298.231 Base-Backbone interact. energy: 1.125 local terms energy: -404.204384 where: bonds (distance) C4'-P energy: -90.757 bonds (distance) P-C4' energy: -93.945 flat angles C4'-P-C4' energy: -88.430 flat angles P-C4'-P energy: -62.351 tors. eta vs tors. theta energy: -68.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -1044.782557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1044.782557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1044.782557 (E_RNA) where: Base-Base interactions energy: -668.102 where: short stacking energy: -308.204 Base-Backbone interact. energy: 4.842 local terms energy: -381.522565 where: bonds (distance) C4'-P energy: -79.653 bonds (distance) P-C4' energy: -99.046 flat angles C4'-P-C4' energy: -87.289 flat angles P-C4'-P energy: -46.461 tors. eta vs tors. theta energy: -69.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -832.005882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.005882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.005882 (E_RNA) where: Base-Base interactions energy: -492.129 where: short stacking energy: -230.591 Base-Backbone interact. energy: -0.904 local terms energy: -338.972394 where: bonds (distance) C4'-P energy: -76.458 bonds (distance) P-C4' energy: -87.163 flat angles C4'-P-C4' energy: -72.073 flat angles P-C4'-P energy: -53.526 tors. eta vs tors. theta energy: -49.753 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -523.374050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.374050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.374050 (E_RNA) where: Base-Base interactions energy: -236.319 where: short stacking energy: -167.995 Base-Backbone interact. energy: 0.702 local terms energy: -287.757571 where: bonds (distance) C4'-P energy: -82.438 bonds (distance) P-C4' energy: -84.646 flat angles C4'-P-C4' energy: -53.281 flat angles P-C4'-P energy: -58.971 tors. eta vs tors. theta energy: -8.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -561.955654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.955654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.955654 (E_RNA) where: Base-Base interactions energy: -291.518 where: short stacking energy: -159.900 Base-Backbone interact. energy: 0.338 local terms energy: -270.775963 where: bonds (distance) C4'-P energy: -63.916 bonds (distance) P-C4' energy: -84.327 flat angles C4'-P-C4' energy: -67.225 flat angles P-C4'-P energy: -38.108 tors. eta vs tors. theta energy: -17.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -368.724576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.724576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.724576 (E_RNA) where: Base-Base interactions energy: -115.903 where: short stacking energy: -104.477 Base-Backbone interact. energy: 5.620 local terms energy: -258.441067 where: bonds (distance) C4'-P energy: -74.994 bonds (distance) P-C4' energy: -77.748 flat angles C4'-P-C4' energy: -80.313 flat angles P-C4'-P energy: -41.621 tors. eta vs tors. theta energy: 16.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -1478.712717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.712717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.712717 (E_RNA) where: Base-Base interactions energy: -968.409 where: short stacking energy: -431.655 Base-Backbone interact. energy: -2.783 local terms energy: -507.520443 where: bonds (distance) C4'-P energy: -99.836 bonds (distance) P-C4' energy: -104.545 flat angles C4'-P-C4' energy: -110.841 flat angles P-C4'-P energy: -66.322 tors. eta vs tors. theta energy: -125.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -1358.005543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1358.005543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1358.005543 (E_RNA) where: Base-Base interactions energy: -874.756 where: short stacking energy: -417.682 Base-Backbone interact. energy: -3.146 local terms energy: -480.103692 where: bonds (distance) C4'-P energy: -94.308 bonds (distance) P-C4' energy: -88.911 flat angles C4'-P-C4' energy: -107.756 flat angles P-C4'-P energy: -71.561 tors. eta vs tors. theta energy: -117.567 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -1192.239990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1192.239990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1192.239990 (E_RNA) where: Base-Base interactions energy: -766.496 where: short stacking energy: -374.450 Base-Backbone interact. energy: -2.173 local terms energy: -423.570533 where: bonds (distance) C4'-P energy: -80.859 bonds (distance) P-C4' energy: -88.216 flat angles C4'-P-C4' energy: -90.185 flat angles P-C4'-P energy: -64.496 tors. eta vs tors. theta energy: -99.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -1182.347101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1182.347101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1182.347101 (E_RNA) where: Base-Base interactions energy: -769.308 where: short stacking energy: -322.319 Base-Backbone interact. energy: 0.265 local terms energy: -413.304244 where: bonds (distance) C4'-P energy: -85.420 bonds (distance) P-C4' energy: -89.809 flat angles C4'-P-C4' energy: -84.369 flat angles P-C4'-P energy: -61.475 tors. eta vs tors. theta energy: -92.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -1095.622149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.622149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1095.622149 (E_RNA) where: Base-Base interactions energy: -687.305 where: short stacking energy: -336.207 Base-Backbone interact. energy: 0.240 local terms energy: -408.557218 where: bonds (distance) C4'-P energy: -66.560 bonds (distance) P-C4' energy: -88.095 flat angles C4'-P-C4' energy: -95.240 flat angles P-C4'-P energy: -69.127 tors. eta vs tors. theta energy: -89.535 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -952.621172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -952.621172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.621172 (E_RNA) where: Base-Base interactions energy: -571.554 where: short stacking energy: -292.911 Base-Backbone interact. energy: 0.557 local terms energy: -381.624524 where: bonds (distance) C4'-P energy: -76.547 bonds (distance) P-C4' energy: -87.325 flat angles C4'-P-C4' energy: -93.797 flat angles P-C4'-P energy: -58.483 tors. eta vs tors. theta energy: -65.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -859.065880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -859.065880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.065880 (E_RNA) where: Base-Base interactions energy: -507.349 where: short stacking energy: -283.414 Base-Backbone interact. energy: -0.032 local terms energy: -351.684571 where: bonds (distance) C4'-P energy: -67.013 bonds (distance) P-C4' energy: -80.549 flat angles C4'-P-C4' energy: -89.599 flat angles P-C4'-P energy: -61.416 tors. eta vs tors. theta energy: -53.108 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -530.584947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.584947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.584947 (E_RNA) where: Base-Base interactions energy: -222.784 where: short stacking energy: -148.790 Base-Backbone interact. energy: -2.193 local terms energy: -305.607891 where: bonds (distance) C4'-P energy: -85.738 bonds (distance) P-C4' energy: -88.623 flat angles C4'-P-C4' energy: -77.705 flat angles P-C4'-P energy: -51.688 tors. eta vs tors. theta energy: -1.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -539.137823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.137823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.137823 (E_RNA) where: Base-Base interactions energy: -243.649 where: short stacking energy: -134.718 Base-Backbone interact. energy: 3.638 local terms energy: -299.127384 where: bonds (distance) C4'-P energy: -94.827 bonds (distance) P-C4' energy: -82.342 flat angles C4'-P-C4' energy: -76.620 flat angles P-C4'-P energy: -43.692 tors. eta vs tors. theta energy: -1.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -374.117282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.117282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.117282 (E_RNA) where: Base-Base interactions energy: -112.557 where: short stacking energy: -92.279 Base-Backbone interact. energy: -0.304 local terms energy: -261.256078 where: bonds (distance) C4'-P energy: -73.692 bonds (distance) P-C4' energy: -79.352 flat angles C4'-P-C4' energy: -74.526 flat angles P-C4'-P energy: -48.084 tors. eta vs tors. theta energy: 14.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -1461.883809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1461.883809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1461.883809 (E_RNA) where: Base-Base interactions energy: -983.211 where: short stacking energy: -438.738 Base-Backbone interact. energy: -3.057 local terms energy: -475.615814 where: bonds (distance) C4'-P energy: -92.149 bonds (distance) P-C4' energy: -95.208 flat angles C4'-P-C4' energy: -104.757 flat angles P-C4'-P energy: -69.367 tors. eta vs tors. theta energy: -114.135 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -1374.000705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1374.000705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1374.000705 (E_RNA) where: Base-Base interactions energy: -898.484 where: short stacking energy: -411.597 Base-Backbone interact. energy: 4.832 local terms energy: -480.348810 where: bonds (distance) C4'-P energy: -88.543 bonds (distance) P-C4' energy: -106.004 flat angles C4'-P-C4' energy: -99.220 flat angles P-C4'-P energy: -55.781 tors. eta vs tors. theta energy: -130.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -1232.635536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1232.635536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1232.635536 (E_RNA) where: Base-Base interactions energy: -766.884 where: short stacking energy: -398.848 Base-Backbone interact. energy: -0.214 local terms energy: -465.537602 where: bonds (distance) C4'-P energy: -84.038 bonds (distance) P-C4' energy: -107.473 flat angles C4'-P-C4' energy: -102.488 flat angles P-C4'-P energy: -66.331 tors. eta vs tors. theta energy: -105.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -1198.237084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1198.237084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1198.237084 (E_RNA) where: Base-Base interactions energy: -781.349 where: short stacking energy: -322.989 Base-Backbone interact. energy: -0.771 local terms energy: -416.116784 where: bonds (distance) C4'-P energy: -101.351 bonds (distance) P-C4' energy: -97.826 flat angles C4'-P-C4' energy: -72.551 flat angles P-C4'-P energy: -66.118 tors. eta vs tors. theta energy: -78.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -1074.453820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1074.453820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1074.453820 (E_RNA) where: Base-Base interactions energy: -684.012 where: short stacking energy: -323.672 Base-Backbone interact. energy: 1.383 local terms energy: -391.824282 where: bonds (distance) C4'-P energy: -86.043 bonds (distance) P-C4' energy: -78.515 flat angles C4'-P-C4' energy: -83.991 flat angles P-C4'-P energy: -70.545 tors. eta vs tors. theta energy: -72.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -937.692207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.692207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.692207 (E_RNA) where: Base-Base interactions energy: -574.005 where: short stacking energy: -293.140 Base-Backbone interact. energy: -4.556 local terms energy: -359.131335 where: bonds (distance) C4'-P energy: -78.199 bonds (distance) P-C4' energy: -77.588 flat angles C4'-P-C4' energy: -91.746 flat angles P-C4'-P energy: -47.092 tors. eta vs tors. theta energy: -64.507 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -806.124162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.124162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -806.124162 (E_RNA) where: Base-Base interactions energy: -487.108 where: short stacking energy: -213.702 Base-Backbone interact. energy: -3.025 local terms energy: -315.990951 where: bonds (distance) C4'-P energy: -80.134 bonds (distance) P-C4' energy: -85.910 flat angles C4'-P-C4' energy: -80.962 flat angles P-C4'-P energy: -34.913 tors. eta vs tors. theta energy: -34.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -601.790492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.790492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.790492 (E_RNA) where: Base-Base interactions energy: -323.702 where: short stacking energy: -172.325 Base-Backbone interact. energy: 8.003 local terms energy: -286.091040 where: bonds (distance) C4'-P energy: -81.827 bonds (distance) P-C4' energy: -78.910 flat angles C4'-P-C4' energy: -72.767 flat angles P-C4'-P energy: -48.079 tors. eta vs tors. theta energy: -4.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -470.008545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.008545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.008545 (E_RNA) where: Base-Base interactions energy: -187.391 where: short stacking energy: -130.732 Base-Backbone interact. energy: -1.539 local terms energy: -281.078328 where: bonds (distance) C4'-P energy: -83.417 bonds (distance) P-C4' energy: -92.690 flat angles C4'-P-C4' energy: -61.346 flat angles P-C4'-P energy: -40.430 tors. eta vs tors. theta energy: -3.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -364.623628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.623628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.623628 (E_RNA) where: Base-Base interactions energy: -116.980 where: short stacking energy: -108.028 Base-Backbone interact. energy: -1.472 local terms energy: -246.171716 where: bonds (distance) C4'-P energy: -78.440 bonds (distance) P-C4' energy: -77.933 flat angles C4'-P-C4' energy: -77.003 flat angles P-C4'-P energy: -41.458 tors. eta vs tors. theta energy: 28.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -1501.496074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1501.496074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1501.496074 (E_RNA) where: Base-Base interactions energy: -1002.624 where: short stacking energy: -453.186 Base-Backbone interact. energy: -2.139 local terms energy: -496.732724 where: bonds (distance) C4'-P energy: -92.294 bonds (distance) P-C4' energy: -106.716 flat angles C4'-P-C4' energy: -109.393 flat angles P-C4'-P energy: -70.345 tors. eta vs tors. theta energy: -117.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -1379.428263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1379.428263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.428263 (E_RNA) where: Base-Base interactions energy: -924.112 where: short stacking energy: -419.941 Base-Backbone interact. energy: -2.041 local terms energy: -453.274703 where: bonds (distance) C4'-P energy: -87.857 bonds (distance) P-C4' energy: -79.487 flat angles C4'-P-C4' energy: -108.214 flat angles P-C4'-P energy: -65.098 tors. eta vs tors. theta energy: -112.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -1263.676108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1263.676108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1263.676108 (E_RNA) where: Base-Base interactions energy: -811.190 where: short stacking energy: -394.944 Base-Backbone interact. energy: -0.559 local terms energy: -451.926931 where: bonds (distance) C4'-P energy: -96.227 bonds (distance) P-C4' energy: -88.374 flat angles C4'-P-C4' energy: -101.469 flat angles P-C4'-P energy: -62.706 tors. eta vs tors. theta energy: -103.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -1184.312204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1184.312204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1184.312204 (E_RNA) where: Base-Base interactions energy: -793.856 where: short stacking energy: -333.613 Base-Backbone interact. energy: 4.106 local terms energy: -394.561972 where: bonds (distance) C4'-P energy: -82.759 bonds (distance) P-C4' energy: -91.204 flat angles C4'-P-C4' energy: -98.490 flat angles P-C4'-P energy: -51.145 tors. eta vs tors. theta energy: -70.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -1076.500076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.500076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1076.500076 (E_RNA) where: Base-Base interactions energy: -685.003 where: short stacking energy: -325.493 Base-Backbone interact. energy: -2.997 local terms energy: -388.500503 where: bonds (distance) C4'-P energy: -69.527 bonds (distance) P-C4' energy: -93.449 flat angles C4'-P-C4' energy: -92.426 flat angles P-C4'-P energy: -57.307 tors. eta vs tors. theta energy: -75.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -924.787849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -924.787849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.787849 (E_RNA) where: Base-Base interactions energy: -580.845 where: short stacking energy: -303.290 Base-Backbone interact. energy: 0.647 local terms energy: -344.589828 where: bonds (distance) C4'-P energy: -63.015 bonds (distance) P-C4' energy: -86.950 flat angles C4'-P-C4' energy: -84.615 flat angles P-C4'-P energy: -47.494 tors. eta vs tors. theta energy: -62.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -762.496897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.496897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.496897 (E_RNA) where: Base-Base interactions energy: -421.492 where: short stacking energy: -208.316 Base-Backbone interact. energy: 0.771 local terms energy: -341.775538 where: bonds (distance) C4'-P energy: -86.759 bonds (distance) P-C4' energy: -86.597 flat angles C4'-P-C4' energy: -77.942 flat angles P-C4'-P energy: -45.992 tors. eta vs tors. theta energy: -44.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -588.426045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.426045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.426045 (E_RNA) where: Base-Base interactions energy: -309.214 where: short stacking energy: -162.127 Base-Backbone interact. energy: 3.947 local terms energy: -283.159246 where: bonds (distance) C4'-P energy: -63.785 bonds (distance) P-C4' energy: -94.184 flat angles C4'-P-C4' energy: -86.263 flat angles P-C4'-P energy: -36.046 tors. eta vs tors. theta energy: -2.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -502.411901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.411901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.411901 (E_RNA) where: Base-Base interactions energy: -223.086 where: short stacking energy: -146.525 Base-Backbone interact. energy: -1.172 local terms energy: -278.153536 where: bonds (distance) C4'-P energy: -76.100 bonds (distance) P-C4' energy: -87.842 flat angles C4'-P-C4' energy: -66.233 flat angles P-C4'-P energy: -32.949 tors. eta vs tors. theta energy: -15.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -355.098951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.098951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.098951 (E_RNA) where: Base-Base interactions energy: -119.457 where: short stacking energy: -92.525 Base-Backbone interact. energy: -0.443 local terms energy: -235.199086 where: bonds (distance) C4'-P energy: -84.353 bonds (distance) P-C4' energy: -62.530 flat angles C4'-P-C4' energy: -73.549 flat angles P-C4'-P energy: -42.357 tors. eta vs tors. theta energy: 27.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -1486.915088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1486.915088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1486.915088 (E_RNA) where: Base-Base interactions energy: -999.847 where: short stacking energy: -436.813 Base-Backbone interact. energy: -4.383 local terms energy: -482.685504 where: bonds (distance) C4'-P energy: -99.989 bonds (distance) P-C4' energy: -95.048 flat angles C4'-P-C4' energy: -108.432 flat angles P-C4'-P energy: -65.499 tors. eta vs tors. theta energy: -113.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -1394.099043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1394.099043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1394.099043 (E_RNA) where: Base-Base interactions energy: -941.983 where: short stacking energy: -387.284 Base-Backbone interact. energy: -3.020 local terms energy: -449.096068 where: bonds (distance) C4'-P energy: -92.348 bonds (distance) P-C4' energy: -86.544 flat angles C4'-P-C4' energy: -101.239 flat angles P-C4'-P energy: -54.980 tors. eta vs tors. theta energy: -113.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -1222.044784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1222.044784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1222.044784 (E_RNA) where: Base-Base interactions energy: -779.801 where: short stacking energy: -379.805 Base-Backbone interact. energy: -0.879 local terms energy: -441.365590 where: bonds (distance) C4'-P energy: -87.736 bonds (distance) P-C4' energy: -93.201 flat angles C4'-P-C4' energy: -100.320 flat angles P-C4'-P energy: -54.771 tors. eta vs tors. theta energy: -105.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -1207.578267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1207.578267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1207.578267 (E_RNA) where: Base-Base interactions energy: -770.130 where: short stacking energy: -332.968 Base-Backbone interact. energy: 5.062 local terms energy: -442.510293 where: bonds (distance) C4'-P energy: -98.806 bonds (distance) P-C4' energy: -95.085 flat angles C4'-P-C4' energy: -98.157 flat angles P-C4'-P energy: -68.413 tors. eta vs tors. theta energy: -82.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -1093.574129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1093.574129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1093.574129 (E_RNA) where: Base-Base interactions energy: -693.159 where: short stacking energy: -345.931 Base-Backbone interact. energy: 1.988 local terms energy: -402.402606 where: bonds (distance) C4'-P energy: -73.111 bonds (distance) P-C4' energy: -85.635 flat angles C4'-P-C4' energy: -96.408 flat angles P-C4'-P energy: -59.516 tors. eta vs tors. theta energy: -87.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -850.313609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.313609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -850.313609 (E_RNA) where: Base-Base interactions energy: -483.758 where: short stacking energy: -247.039 Base-Backbone interact. energy: -1.412 local terms energy: -365.143133 where: bonds (distance) C4'-P energy: -92.437 bonds (distance) P-C4' energy: -91.159 flat angles C4'-P-C4' energy: -81.284 flat angles P-C4'-P energy: -45.960 tors. eta vs tors. theta energy: -54.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -771.804751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.804751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.804751 (E_RNA) where: Base-Base interactions energy: -443.409 where: short stacking energy: -227.949 Base-Backbone interact. energy: -2.182 local terms energy: -326.213266 where: bonds (distance) C4'-P energy: -75.747 bonds (distance) P-C4' energy: -81.107 flat angles C4'-P-C4' energy: -75.117 flat angles P-C4'-P energy: -55.359 tors. eta vs tors. theta energy: -38.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -521.435257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.435257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.435257 (E_RNA) where: Base-Base interactions energy: -239.544 where: short stacking energy: -162.996 Base-Backbone interact. energy: 1.524 local terms energy: -283.415481 where: bonds (distance) C4'-P energy: -78.077 bonds (distance) P-C4' energy: -76.544 flat angles C4'-P-C4' energy: -64.467 flat angles P-C4'-P energy: -56.881 tors. eta vs tors. theta energy: -7.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -576.575259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.575259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.575259 (E_RNA) where: Base-Base interactions energy: -291.496 where: short stacking energy: -176.568 Base-Backbone interact. energy: -0.893 local terms energy: -284.186403 where: bonds (distance) C4'-P energy: -65.547 bonds (distance) P-C4' energy: -76.632 flat angles C4'-P-C4' energy: -81.467 flat angles P-C4'-P energy: -45.291 tors. eta vs tors. theta energy: -15.250 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -373.892331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.892331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.892331 (E_RNA) where: Base-Base interactions energy: -104.442 where: short stacking energy: -93.622 Base-Backbone interact. energy: -0.550 local terms energy: -268.900679 where: bonds (distance) C4'-P energy: -80.070 bonds (distance) P-C4' energy: -91.729 flat angles C4'-P-C4' energy: -66.827 flat angles P-C4'-P energy: -58.168 tors. eta vs tors. theta energy: 27.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -1462.463519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1462.463519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1462.463519 (E_RNA) where: Base-Base interactions energy: -987.556 where: short stacking energy: -409.519 Base-Backbone interact. energy: -3.859 local terms energy: -471.048114 where: bonds (distance) C4'-P energy: -89.497 bonds (distance) P-C4' energy: -88.759 flat angles C4'-P-C4' energy: -109.070 flat angles P-C4'-P energy: -65.714 tors. eta vs tors. theta energy: -118.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -1400.437012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.437012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1400.437012 (E_RNA) where: Base-Base interactions energy: -929.224 where: short stacking energy: -412.547 Base-Backbone interact. energy: -1.151 local terms energy: -470.062084 where: bonds (distance) C4'-P energy: -89.561 bonds (distance) P-C4' energy: -89.436 flat angles C4'-P-C4' energy: -98.300 flat angles P-C4'-P energy: -67.289 tors. eta vs tors. theta energy: -125.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -1268.568672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1268.568672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1268.568672 (E_RNA) where: Base-Base interactions energy: -830.961 where: short stacking energy: -368.788 Base-Backbone interact. energy: -1.682 local terms energy: -435.926030 where: bonds (distance) C4'-P energy: -85.156 bonds (distance) P-C4' energy: -88.480 flat angles C4'-P-C4' energy: -107.965 flat angles P-C4'-P energy: -66.766 tors. eta vs tors. theta energy: -87.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -1207.604706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1207.604706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1207.604706 (E_RNA) where: Base-Base interactions energy: -774.270 where: short stacking energy: -390.709 Base-Backbone interact. energy: 4.533 local terms energy: -437.867408 where: bonds (distance) C4'-P energy: -83.015 bonds (distance) P-C4' energy: -84.816 flat angles C4'-P-C4' energy: -94.268 flat angles P-C4'-P energy: -71.128 tors. eta vs tors. theta energy: -104.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -1093.063877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1093.063877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1093.063877 (E_RNA) where: Base-Base interactions energy: -684.588 where: short stacking energy: -336.839 Base-Backbone interact. energy: -2.153 local terms energy: -406.323415 where: bonds (distance) C4'-P energy: -90.846 bonds (distance) P-C4' energy: -93.151 flat angles C4'-P-C4' energy: -93.428 flat angles P-C4'-P energy: -47.033 tors. eta vs tors. theta energy: -81.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -878.401122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.401122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -878.401122 (E_RNA) where: Base-Base interactions energy: -504.932 where: short stacking energy: -260.636 Base-Backbone interact. energy: -0.320 local terms energy: -373.148870 where: bonds (distance) C4'-P energy: -80.397 bonds (distance) P-C4' energy: -87.232 flat angles C4'-P-C4' energy: -87.280 flat angles P-C4'-P energy: -47.034 tors. eta vs tors. theta energy: -71.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -779.100733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.100733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.100733 (E_RNA) where: Base-Base interactions energy: -463.333 where: short stacking energy: -219.194 Base-Backbone interact. energy: 0.103 local terms energy: -315.870512 where: bonds (distance) C4'-P energy: -69.563 bonds (distance) P-C4' energy: -86.677 flat angles C4'-P-C4' energy: -70.301 flat angles P-C4'-P energy: -59.734 tors. eta vs tors. theta energy: -29.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -530.536649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.536649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.536649 (E_RNA) where: Base-Base interactions energy: -250.633 where: short stacking energy: -176.453 Base-Backbone interact. energy: 1.206 local terms energy: -281.109670 where: bonds (distance) C4'-P energy: -76.482 bonds (distance) P-C4' energy: -86.621 flat angles C4'-P-C4' energy: -70.470 flat angles P-C4'-P energy: -31.277 tors. eta vs tors. theta energy: -16.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -533.211005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.211005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.211005 (E_RNA) where: Base-Base interactions energy: -278.878 where: short stacking energy: -164.199 Base-Backbone interact. energy: 0.889 local terms energy: -255.221764 where: bonds (distance) C4'-P energy: -69.214 bonds (distance) P-C4' energy: -87.997 flat angles C4'-P-C4' energy: -65.064 flat angles P-C4'-P energy: -35.332 tors. eta vs tors. theta energy: 2.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -387.146246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.146246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.146246 (E_RNA) where: Base-Base interactions energy: -145.782 where: short stacking energy: -131.742 Base-Backbone interact. energy: 1.308 local terms energy: -242.672815 where: bonds (distance) C4'-P energy: -63.460 bonds (distance) P-C4' energy: -94.346 flat angles C4'-P-C4' energy: -52.794 flat angles P-C4'-P energy: -29.059 tors. eta vs tors. theta energy: -3.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -1476.236707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1476.236707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1476.236707 (E_RNA) where: Base-Base interactions energy: -986.329 where: short stacking energy: -439.971 Base-Backbone interact. energy: -2.328 local terms energy: -487.579339 where: bonds (distance) C4'-P energy: -91.922 bonds (distance) P-C4' energy: -93.051 flat angles C4'-P-C4' energy: -100.764 flat angles P-C4'-P energy: -69.444 tors. eta vs tors. theta energy: -132.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -1398.752565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1398.752565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1398.752565 (E_RNA) where: Base-Base interactions energy: -935.471 where: short stacking energy: -398.678 Base-Backbone interact. energy: -5.240 local terms energy: -458.041089 where: bonds (distance) C4'-P energy: -97.035 bonds (distance) P-C4' energy: -89.561 flat angles C4'-P-C4' energy: -102.107 flat angles P-C4'-P energy: -63.097 tors. eta vs tors. theta energy: -106.242 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -1300.283543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1300.283543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1300.283543 (E_RNA) where: Base-Base interactions energy: -887.796 where: short stacking energy: -380.407 Base-Backbone interact. energy: -4.585 local terms energy: -407.902632 where: bonds (distance) C4'-P energy: -73.561 bonds (distance) P-C4' energy: -77.104 flat angles C4'-P-C4' energy: -89.583 flat angles P-C4'-P energy: -64.871 tors. eta vs tors. theta energy: -102.784 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -1180.244559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1180.244559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1180.244559 (E_RNA) where: Base-Base interactions energy: -753.878 where: short stacking energy: -378.406 Base-Backbone interact. energy: 0.818 local terms energy: -427.184061 where: bonds (distance) C4'-P energy: -79.102 bonds (distance) P-C4' energy: -83.526 flat angles C4'-P-C4' energy: -106.160 flat angles P-C4'-P energy: -58.802 tors. eta vs tors. theta energy: -99.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -1100.155518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1100.155518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1100.155518 (E_RNA) where: Base-Base interactions energy: -694.419 where: short stacking energy: -309.508 Base-Backbone interact. energy: -2.891 local terms energy: -402.844880 where: bonds (distance) C4'-P energy: -88.675 bonds (distance) P-C4' energy: -84.279 flat angles C4'-P-C4' energy: -102.434 flat angles P-C4'-P energy: -55.530 tors. eta vs tors. theta energy: -71.926 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -920.869568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.869568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -920.869568 (E_RNA) where: Base-Base interactions energy: -555.749 where: short stacking energy: -269.164 Base-Backbone interact. energy: -1.625 local terms energy: -363.495699 where: bonds (distance) C4'-P energy: -89.886 bonds (distance) P-C4' energy: -64.893 flat angles C4'-P-C4' energy: -81.121 flat angles P-C4'-P energy: -61.151 tors. eta vs tors. theta energy: -66.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -783.062707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.062707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.062707 (E_RNA) where: Base-Base interactions energy: -453.175 where: short stacking energy: -229.780 Base-Backbone interact. energy: 3.346 local terms energy: -333.234355 where: bonds (distance) C4'-P energy: -89.131 bonds (distance) P-C4' energy: -82.113 flat angles C4'-P-C4' energy: -79.853 flat angles P-C4'-P energy: -47.839 tors. eta vs tors. theta energy: -34.299 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -587.668695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.668695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.668695 (E_RNA) where: Base-Base interactions energy: -293.780 where: short stacking energy: -176.671 Base-Backbone interact. energy: 1.109 local terms energy: -294.997893 where: bonds (distance) C4'-P energy: -83.496 bonds (distance) P-C4' energy: -85.115 flat angles C4'-P-C4' energy: -73.980 flat angles P-C4'-P energy: -44.660 tors. eta vs tors. theta energy: -7.746 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -568.164565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.164565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.164565 (E_RNA) where: Base-Base interactions energy: -277.173 where: short stacking energy: -159.344 Base-Backbone interact. energy: 2.323 local terms energy: -293.313919 where: bonds (distance) C4'-P energy: -93.040 bonds (distance) P-C4' energy: -85.826 flat angles C4'-P-C4' energy: -83.070 flat angles P-C4'-P energy: -28.723 tors. eta vs tors. theta energy: -2.655 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -387.997884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.997884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.997884 (E_RNA) where: Base-Base interactions energy: -100.609 where: short stacking energy: -82.389 Base-Backbone interact. energy: -1.263 local terms energy: -286.125868 where: bonds (distance) C4'-P energy: -85.924 bonds (distance) P-C4' energy: -95.819 flat angles C4'-P-C4' energy: -82.086 flat angles P-C4'-P energy: -38.325 tors. eta vs tors. theta energy: 16.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -1465.054175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1465.054175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1465.054175 (E_RNA) where: Base-Base interactions energy: -973.985 where: short stacking energy: -426.461 Base-Backbone interact. energy: 0.537 local terms energy: -491.605471 where: bonds (distance) C4'-P energy: -87.929 bonds (distance) P-C4' energy: -92.047 flat angles C4'-P-C4' energy: -109.172 flat angles P-C4'-P energy: -74.692 tors. eta vs tors. theta energy: -127.765 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -1409.203643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1409.203643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1409.203643 (E_RNA) where: Base-Base interactions energy: -940.652 where: short stacking energy: -399.964 Base-Backbone interact. energy: -0.624 local terms energy: -467.926884 where: bonds (distance) C4'-P energy: -94.145 bonds (distance) P-C4' energy: -100.214 flat angles C4'-P-C4' energy: -104.190 flat angles P-C4'-P energy: -59.117 tors. eta vs tors. theta energy: -110.261 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -1338.379343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1338.379343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1338.379343 (E_RNA) where: Base-Base interactions energy: -883.962 where: short stacking energy: -382.911 Base-Backbone interact. energy: -2.945 local terms energy: -451.472542 where: bonds (distance) C4'-P energy: -74.542 bonds (distance) P-C4' energy: -89.134 flat angles C4'-P-C4' energy: -106.250 flat angles P-C4'-P energy: -73.276 tors. eta vs tors. theta energy: -108.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -1159.035851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1159.035851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1159.035851 (E_RNA) where: Base-Base interactions energy: -742.307 where: short stacking energy: -360.195 Base-Backbone interact. energy: -1.657 local terms energy: -415.072630 where: bonds (distance) C4'-P energy: -83.384 bonds (distance) P-C4' energy: -79.666 flat angles C4'-P-C4' energy: -91.578 flat angles P-C4'-P energy: -74.024 tors. eta vs tors. theta energy: -86.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -1125.854956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1125.854956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1125.854956 (E_RNA) where: Base-Base interactions energy: -691.403 where: short stacking energy: -332.871 Base-Backbone interact. energy: -1.560 local terms energy: -432.891884 where: bonds (distance) C4'-P energy: -89.103 bonds (distance) P-C4' energy: -100.414 flat angles C4'-P-C4' energy: -81.029 flat angles P-C4'-P energy: -63.042 tors. eta vs tors. theta energy: -99.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -860.165746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.165746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.165746 (E_RNA) where: Base-Base interactions energy: -504.980 where: short stacking energy: -237.625 Base-Backbone interact. energy: -0.867 local terms energy: -354.318324 where: bonds (distance) C4'-P energy: -84.452 bonds (distance) P-C4' energy: -92.514 flat angles C4'-P-C4' energy: -90.061 flat angles P-C4'-P energy: -53.428 tors. eta vs tors. theta energy: -33.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -817.723999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -817.723999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -817.723999 (E_RNA) where: Base-Base interactions energy: -471.657 where: short stacking energy: -215.956 Base-Backbone interact. energy: 0.105 local terms energy: -346.172080 where: bonds (distance) C4'-P energy: -77.016 bonds (distance) P-C4' energy: -93.371 flat angles C4'-P-C4' energy: -74.754 flat angles P-C4'-P energy: -56.057 tors. eta vs tors. theta energy: -44.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -569.656740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.656740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.656740 (E_RNA) where: Base-Base interactions energy: -281.742 where: short stacking energy: -181.088 Base-Backbone interact. energy: -0.772 local terms energy: -287.142784 where: bonds (distance) C4'-P energy: -86.367 bonds (distance) P-C4' energy: -76.867 flat angles C4'-P-C4' energy: -65.143 flat angles P-C4'-P energy: -48.661 tors. eta vs tors. theta energy: -10.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -598.615146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.615146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.615146 (E_RNA) where: Base-Base interactions energy: -318.979 where: short stacking energy: -156.919 Base-Backbone interact. energy: 1.837 local terms energy: -281.473585 where: bonds (distance) C4'-P energy: -69.610 bonds (distance) P-C4' energy: -90.872 flat angles C4'-P-C4' energy: -78.950 flat angles P-C4'-P energy: -39.181 tors. eta vs tors. theta energy: -2.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -358.033640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.033640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.033640 (E_RNA) where: Base-Base interactions energy: -135.297 where: short stacking energy: -110.075 Base-Backbone interact. energy: 5.982 local terms energy: -228.717899 where: bonds (distance) C4'-P energy: -64.979 bonds (distance) P-C4' energy: -88.288 flat angles C4'-P-C4' energy: -62.560 flat angles P-C4'-P energy: -31.355 tors. eta vs tors. theta energy: 18.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -1449.366813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1449.366813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1449.366813 (E_RNA) where: Base-Base interactions energy: -972.573 where: short stacking energy: -422.331 Base-Backbone interact. energy: -2.562 local terms energy: -474.231252 where: bonds (distance) C4'-P energy: -96.941 bonds (distance) P-C4' energy: -93.042 flat angles C4'-P-C4' energy: -105.334 flat angles P-C4'-P energy: -64.788 tors. eta vs tors. theta energy: -114.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -1430.513891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1430.513891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1430.513891 (E_RNA) where: Base-Base interactions energy: -958.496 where: short stacking energy: -414.707 Base-Backbone interact. energy: -4.334 local terms energy: -467.684381 where: bonds (distance) C4'-P energy: -95.169 bonds (distance) P-C4' energy: -94.489 flat angles C4'-P-C4' energy: -106.805 flat angles P-C4'-P energy: -61.398 tors. eta vs tors. theta energy: -109.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -1327.491635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1327.491635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1327.491635 (E_RNA) where: Base-Base interactions energy: -879.600 where: short stacking energy: -388.675 Base-Backbone interact. energy: -4.091 local terms energy: -443.800518 where: bonds (distance) C4'-P energy: -82.961 bonds (distance) P-C4' energy: -78.224 flat angles C4'-P-C4' energy: -109.783 flat angles P-C4'-P energy: -65.947 tors. eta vs tors. theta energy: -106.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -1132.117225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1132.117225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1132.117225 (E_RNA) where: Base-Base interactions energy: -715.803 where: short stacking energy: -334.385 Base-Backbone interact. energy: -3.161 local terms energy: -413.153188 where: bonds (distance) C4'-P energy: -82.603 bonds (distance) P-C4' energy: -85.697 flat angles C4'-P-C4' energy: -98.468 flat angles P-C4'-P energy: -67.982 tors. eta vs tors. theta energy: -78.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -1169.367605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1169.367605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1169.367605 (E_RNA) where: Base-Base interactions energy: -762.207 where: short stacking energy: -361.828 Base-Backbone interact. energy: 5.115 local terms energy: -412.274825 where: bonds (distance) C4'-P energy: -83.476 bonds (distance) P-C4' energy: -85.203 flat angles C4'-P-C4' energy: -93.385 flat angles P-C4'-P energy: -50.288 tors. eta vs tors. theta energy: -99.923 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -878.369917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.369917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -878.369917 (E_RNA) where: Base-Base interactions energy: -537.180 where: short stacking energy: -256.770 Base-Backbone interact. energy: -1.981 local terms energy: -339.208313 where: bonds (distance) C4'-P energy: -85.851 bonds (distance) P-C4' energy: -78.783 flat angles C4'-P-C4' energy: -80.082 flat angles P-C4'-P energy: -40.371 tors. eta vs tors. theta energy: -54.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -831.261025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.261025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.261025 (E_RNA) where: Base-Base interactions energy: -484.888 where: short stacking energy: -251.592 Base-Backbone interact. energy: -2.816 local terms energy: -343.556590 where: bonds (distance) C4'-P energy: -89.963 bonds (distance) P-C4' energy: -80.771 flat angles C4'-P-C4' energy: -73.269 flat angles P-C4'-P energy: -55.440 tors. eta vs tors. theta energy: -44.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -641.313202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -641.313202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -641.313202 (E_RNA) where: Base-Base interactions energy: -343.969 where: short stacking energy: -185.836 Base-Backbone interact. energy: -1.666 local terms energy: -295.678574 where: bonds (distance) C4'-P energy: -84.465 bonds (distance) P-C4' energy: -73.421 flat angles C4'-P-C4' energy: -69.489 flat angles P-C4'-P energy: -51.537 tors. eta vs tors. theta energy: -16.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -494.232154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.232154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.232154 (E_RNA) where: Base-Base interactions energy: -219.075 where: short stacking energy: -146.520 Base-Backbone interact. energy: -1.627 local terms energy: -273.530499 where: bonds (distance) C4'-P energy: -76.920 bonds (distance) P-C4' energy: -74.635 flat angles C4'-P-C4' energy: -76.251 flat angles P-C4'-P energy: -50.103 tors. eta vs tors. theta energy: 4.378 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -390.289817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.289817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.289817 (E_RNA) where: Base-Base interactions energy: -151.568 where: short stacking energy: -124.423 Base-Backbone interact. energy: -1.182 local terms energy: -237.539247 where: bonds (distance) C4'-P energy: -76.619 bonds (distance) P-C4' energy: -79.926 flat angles C4'-P-C4' energy: -49.061 flat angles P-C4'-P energy: -39.835 tors. eta vs tors. theta energy: 7.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -1474.570409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1474.570409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1474.570409 (E_RNA) where: Base-Base interactions energy: -977.721 where: short stacking energy: -436.112 Base-Backbone interact. energy: -4.590 local terms energy: -492.259047 where: bonds (distance) C4'-P energy: -98.983 bonds (distance) P-C4' energy: -102.587 flat angles C4'-P-C4' energy: -106.040 flat angles P-C4'-P energy: -66.502 tors. eta vs tors. theta energy: -118.147 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -1419.951665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1419.951665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1419.951665 (E_RNA) where: Base-Base interactions energy: -929.355 where: short stacking energy: -415.840 Base-Backbone interact. energy: -0.777 local terms energy: -489.819157 where: bonds (distance) C4'-P energy: -103.312 bonds (distance) P-C4' energy: -90.132 flat angles C4'-P-C4' energy: -110.121 flat angles P-C4'-P energy: -71.042 tors. eta vs tors. theta energy: -115.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -1299.283408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1299.283408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1299.283408 (E_RNA) where: Base-Base interactions energy: -853.592 where: short stacking energy: -366.760 Base-Backbone interact. energy: -3.523 local terms energy: -442.168123 where: bonds (distance) C4'-P energy: -91.076 bonds (distance) P-C4' energy: -86.416 flat angles C4'-P-C4' energy: -100.801 flat angles P-C4'-P energy: -61.662 tors. eta vs tors. theta energy: -102.213 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -1153.627556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1153.627556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1153.627556 (E_RNA) where: Base-Base interactions energy: -719.471 where: short stacking energy: -336.402 Base-Backbone interact. energy: -0.680 local terms energy: -433.476824 where: bonds (distance) C4'-P energy: -87.710 bonds (distance) P-C4' energy: -95.911 flat angles C4'-P-C4' energy: -99.138 flat angles P-C4'-P energy: -62.261 tors. eta vs tors. theta energy: -88.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -1119.279115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1119.279115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1119.279115 (E_RNA) where: Base-Base interactions energy: -694.093 where: short stacking energy: -317.630 Base-Backbone interact. energy: 1.603 local terms energy: -426.788706 where: bonds (distance) C4'-P energy: -97.389 bonds (distance) P-C4' energy: -97.638 flat angles C4'-P-C4' energy: -98.786 flat angles P-C4'-P energy: -55.685 tors. eta vs tors. theta energy: -77.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -958.774206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -958.774206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.774206 (E_RNA) where: Base-Base interactions energy: -592.094 where: short stacking energy: -275.230 Base-Backbone interact. energy: -2.466 local terms energy: -364.214078 where: bonds (distance) C4'-P energy: -83.213 bonds (distance) P-C4' energy: -87.406 flat angles C4'-P-C4' energy: -97.145 flat angles P-C4'-P energy: -35.706 tors. eta vs tors. theta energy: -60.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -829.112179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.112179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.112179 (E_RNA) where: Base-Base interactions energy: -486.055 where: short stacking energy: -244.851 Base-Backbone interact. energy: -1.225 local terms energy: -341.832986 where: bonds (distance) C4'-P energy: -81.565 bonds (distance) P-C4' energy: -69.098 flat angles C4'-P-C4' energy: -90.851 flat angles P-C4'-P energy: -50.748 tors. eta vs tors. theta energy: -49.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -633.526149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.526149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.526149 (E_RNA) where: Base-Base interactions energy: -337.294 where: short stacking energy: -177.289 Base-Backbone interact. energy: -2.148 local terms energy: -294.084313 where: bonds (distance) C4'-P energy: -81.018 bonds (distance) P-C4' energy: -86.686 flat angles C4'-P-C4' energy: -73.836 flat angles P-C4'-P energy: -31.393 tors. eta vs tors. theta energy: -21.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -517.499419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.499419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.499419 (E_RNA) where: Base-Base interactions energy: -259.090 where: short stacking energy: -163.351 Base-Backbone interact. energy: -0.359 local terms energy: -258.050333 where: bonds (distance) C4'-P energy: -63.351 bonds (distance) P-C4' energy: -92.590 flat angles C4'-P-C4' energy: -52.886 flat angles P-C4'-P energy: -42.172 tors. eta vs tors. theta energy: -7.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -400.544196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.544196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.544196 (E_RNA) where: Base-Base interactions energy: -138.404 where: short stacking energy: -124.972 Base-Backbone interact. energy: -0.533 local terms energy: -261.607946 where: bonds (distance) C4'-P energy: -67.369 bonds (distance) P-C4' energy: -88.055 flat angles C4'-P-C4' energy: -81.411 flat angles P-C4'-P energy: -27.246 tors. eta vs tors. theta energy: 2.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -1475.585824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1475.585824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1475.585824 (E_RNA) where: Base-Base interactions energy: -996.172 where: short stacking energy: -460.775 Base-Backbone interact. energy: -3.209 local terms energy: -476.204736 where: bonds (distance) C4'-P energy: -88.265 bonds (distance) P-C4' energy: -104.189 flat angles C4'-P-C4' energy: -100.680 flat angles P-C4'-P energy: -65.534 tors. eta vs tors. theta energy: -117.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -1437.101335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.101335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1437.101335 (E_RNA) where: Base-Base interactions energy: -961.024 where: short stacking energy: -409.433 Base-Backbone interact. energy: -3.646 local terms energy: -472.431562 where: bonds (distance) C4'-P energy: -91.750 bonds (distance) P-C4' energy: -102.517 flat angles C4'-P-C4' energy: -101.595 flat angles P-C4'-P energy: -64.043 tors. eta vs tors. theta energy: -112.526 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -1340.278903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1340.278903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1340.278903 (E_RNA) where: Base-Base interactions energy: -885.815 where: short stacking energy: -382.538 Base-Backbone interact. energy: -3.576 local terms energy: -450.888707 where: bonds (distance) C4'-P energy: -88.869 bonds (distance) P-C4' energy: -83.941 flat angles C4'-P-C4' energy: -102.713 flat angles P-C4'-P energy: -63.523 tors. eta vs tors. theta energy: -111.843 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -1152.600158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1152.600158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1152.600158 (E_RNA) where: Base-Base interactions energy: -740.801 where: short stacking energy: -364.285 Base-Backbone interact. energy: -3.100 local terms energy: -408.699574 where: bonds (distance) C4'-P energy: -82.289 bonds (distance) P-C4' energy: -78.290 flat angles C4'-P-C4' energy: -95.320 flat angles P-C4'-P energy: -63.686 tors. eta vs tors. theta energy: -89.115 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -1097.268114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1097.268114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1097.268114 (E_RNA) where: Base-Base interactions energy: -694.050 where: short stacking energy: -322.957 Base-Backbone interact. energy: 1.815 local terms energy: -405.032259 where: bonds (distance) C4'-P energy: -76.678 bonds (distance) P-C4' energy: -94.962 flat angles C4'-P-C4' energy: -94.895 flat angles P-C4'-P energy: -58.763 tors. eta vs tors. theta energy: -79.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -928.029918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -928.029918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.029918 (E_RNA) where: Base-Base interactions energy: -558.962 where: short stacking energy: -251.290 Base-Backbone interact. energy: 2.641 local terms energy: -371.708715 where: bonds (distance) C4'-P energy: -88.784 bonds (distance) P-C4' energy: -94.021 flat angles C4'-P-C4' energy: -85.259 flat angles P-C4'-P energy: -54.204 tors. eta vs tors. theta energy: -49.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -852.426209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -852.426209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -852.426209 (E_RNA) where: Base-Base interactions energy: -495.450 where: short stacking energy: -248.111 Base-Backbone interact. energy: 1.632 local terms energy: -358.607643 where: bonds (distance) C4'-P energy: -81.000 bonds (distance) P-C4' energy: -73.098 flat angles C4'-P-C4' energy: -95.672 flat angles P-C4'-P energy: -59.653 tors. eta vs tors. theta energy: -49.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -583.114771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.114771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.114771 (E_RNA) where: Base-Base interactions energy: -299.647 where: short stacking energy: -173.728 Base-Backbone interact. energy: -0.227 local terms energy: -283.240085 where: bonds (distance) C4'-P energy: -68.104 bonds (distance) P-C4' energy: -81.340 flat angles C4'-P-C4' energy: -80.420 flat angles P-C4'-P energy: -44.456 tors. eta vs tors. theta energy: -8.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -530.873176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.873176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.873176 (E_RNA) where: Base-Base interactions energy: -271.344 where: short stacking energy: -164.733 Base-Backbone interact. energy: 1.209 local terms energy: -260.737555 where: bonds (distance) C4'-P energy: -81.411 bonds (distance) P-C4' energy: -86.107 flat angles C4'-P-C4' energy: -54.898 flat angles P-C4'-P energy: -35.234 tors. eta vs tors. theta energy: -3.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -389.983824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.983824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.983824 (E_RNA) where: Base-Base interactions energy: -136.342 where: short stacking energy: -109.892 Base-Backbone interact. energy: 0.517 local terms energy: -254.159641 where: bonds (distance) C4'-P energy: -74.201 bonds (distance) P-C4' energy: -80.133 flat angles C4'-P-C4' energy: -65.888 flat angles P-C4'-P energy: -51.473 tors. eta vs tors. theta energy: 17.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -1475.582861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1475.582861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1475.582861 (E_RNA) where: Base-Base interactions energy: -997.995 where: short stacking energy: -436.403 Base-Backbone interact. energy: -2.758 local terms energy: -474.830272 where: bonds (distance) C4'-P energy: -81.986 bonds (distance) P-C4' energy: -103.237 flat angles C4'-P-C4' energy: -111.855 flat angles P-C4'-P energy: -65.470 tors. eta vs tors. theta energy: -112.282 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -1409.882607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1409.882607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1409.882607 (E_RNA) where: Base-Base interactions energy: -951.521 where: short stacking energy: -400.745 Base-Backbone interact. energy: -0.657 local terms energy: -457.704458 where: bonds (distance) C4'-P energy: -83.807 bonds (distance) P-C4' energy: -102.743 flat angles C4'-P-C4' energy: -100.199 flat angles P-C4'-P energy: -70.950 tors. eta vs tors. theta energy: -100.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -1346.182353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1346.182353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1346.182353 (E_RNA) where: Base-Base interactions energy: -892.140 where: short stacking energy: -375.049 Base-Backbone interact. energy: -5.470 local terms energy: -448.572808 where: bonds (distance) C4'-P energy: -89.497 bonds (distance) P-C4' energy: -84.094 flat angles C4'-P-C4' energy: -100.184 flat angles P-C4'-P energy: -69.188 tors. eta vs tors. theta energy: -105.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -1156.051441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1156.051441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1156.051441 (E_RNA) where: Base-Base interactions energy: -723.188 where: short stacking energy: -364.831 Base-Backbone interact. energy: 0.697 local terms energy: -433.561013 where: bonds (distance) C4'-P energy: -90.293 bonds (distance) P-C4' energy: -99.489 flat angles C4'-P-C4' energy: -88.384 flat angles P-C4'-P energy: -55.121 tors. eta vs tors. theta energy: -100.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -1148.919161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1148.919161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1148.919161 (E_RNA) where: Base-Base interactions energy: -754.653 where: short stacking energy: -340.248 Base-Backbone interact. energy: 1.220 local terms energy: -395.486072 where: bonds (distance) C4'-P energy: -77.945 bonds (distance) P-C4' energy: -83.723 flat angles C4'-P-C4' energy: -89.797 flat angles P-C4'-P energy: -57.937 tors. eta vs tors. theta energy: -86.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -905.960902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -905.960902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.960902 (E_RNA) where: Base-Base interactions energy: -539.861 where: short stacking energy: -269.889 Base-Backbone interact. energy: 0.954 local terms energy: -367.053569 where: bonds (distance) C4'-P energy: -79.381 bonds (distance) P-C4' energy: -98.887 flat angles C4'-P-C4' energy: -81.250 flat angles P-C4'-P energy: -52.744 tors. eta vs tors. theta energy: -54.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -804.807017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -804.807017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -804.807017 (E_RNA) where: Base-Base interactions energy: -454.140 where: short stacking energy: -238.712 Base-Backbone interact. energy: -0.735 local terms energy: -349.931671 where: bonds (distance) C4'-P energy: -80.945 bonds (distance) P-C4' energy: -83.006 flat angles C4'-P-C4' energy: -83.926 flat angles P-C4'-P energy: -54.330 tors. eta vs tors. theta energy: -47.724 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -587.484026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.484026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.484026 (E_RNA) where: Base-Base interactions energy: -295.914 where: short stacking energy: -174.630 Base-Backbone interact. energy: 4.018 local terms energy: -295.588222 where: bonds (distance) C4'-P energy: -84.428 bonds (distance) P-C4' energy: -77.823 flat angles C4'-P-C4' energy: -85.123 flat angles P-C4'-P energy: -46.920 tors. eta vs tors. theta energy: -1.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -531.358160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.358160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.358160 (E_RNA) where: Base-Base interactions energy: -268.902 where: short stacking energy: -139.582 Base-Backbone interact. energy: 2.429 local terms energy: -264.885737 where: bonds (distance) C4'-P energy: -65.853 bonds (distance) P-C4' energy: -84.411 flat angles C4'-P-C4' energy: -70.446 flat angles P-C4'-P energy: -50.735 tors. eta vs tors. theta energy: 6.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -410.581355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.581355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.581355 (E_RNA) where: Base-Base interactions energy: -162.679 where: short stacking energy: -115.957 Base-Backbone interact. energy: -1.784 local terms energy: -246.118073 where: bonds (distance) C4'-P energy: -61.712 bonds (distance) P-C4' energy: -79.896 flat angles C4'-P-C4' energy: -74.107 flat angles P-C4'-P energy: -37.550 tors. eta vs tors. theta energy: 7.147 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -1466.022141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1466.022141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1466.022141 (E_RNA) where: Base-Base interactions energy: -964.111 where: short stacking energy: -428.135 Base-Backbone interact. energy: -1.648 local terms energy: -500.263538 where: bonds (distance) C4'-P energy: -102.805 bonds (distance) P-C4' energy: -104.992 flat angles C4'-P-C4' energy: -111.936 flat angles P-C4'-P energy: -66.289 tors. eta vs tors. theta energy: -114.242 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -1395.250188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1395.250188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1395.250188 (E_RNA) where: Base-Base interactions energy: -936.090 where: short stacking energy: -410.457 Base-Backbone interact. energy: -0.530 local terms energy: -458.630136 where: bonds (distance) C4'-P energy: -85.650 bonds (distance) P-C4' energy: -96.024 flat angles C4'-P-C4' energy: -103.993 flat angles P-C4'-P energy: -60.617 tors. eta vs tors. theta energy: -112.347 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -1307.154989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1307.154989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1307.154989 (E_RNA) where: Base-Base interactions energy: -852.319 where: short stacking energy: -367.930 Base-Backbone interact. energy: 0.974 local terms energy: -455.809321 where: bonds (distance) C4'-P energy: -90.569 bonds (distance) P-C4' energy: -99.442 flat angles C4'-P-C4' energy: -103.923 flat angles P-C4'-P energy: -63.476 tors. eta vs tors. theta energy: -98.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -1200.407647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1200.407647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1200.407647 (E_RNA) where: Base-Base interactions energy: -796.069 where: short stacking energy: -356.935 Base-Backbone interact. energy: -1.268 local terms energy: -403.071171 where: bonds (distance) C4'-P energy: -82.171 bonds (distance) P-C4' energy: -87.778 flat angles C4'-P-C4' energy: -95.852 flat angles P-C4'-P energy: -62.725 tors. eta vs tors. theta energy: -74.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -1106.110711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1106.110711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1106.110711 (E_RNA) where: Base-Base interactions energy: -715.528 where: short stacking energy: -359.060 Base-Backbone interact. energy: -2.745 local terms energy: -387.838312 where: bonds (distance) C4'-P energy: -78.525 bonds (distance) P-C4' energy: -79.602 flat angles C4'-P-C4' energy: -93.091 flat angles P-C4'-P energy: -46.537 tors. eta vs tors. theta energy: -90.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -905.104852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -905.104852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.104852 (E_RNA) where: Base-Base interactions energy: -564.631 where: short stacking energy: -279.269 Base-Backbone interact. energy: -1.990 local terms energy: -338.484535 where: bonds (distance) C4'-P energy: -74.903 bonds (distance) P-C4' energy: -68.892 flat angles C4'-P-C4' energy: -76.711 flat angles P-C4'-P energy: -59.490 tors. eta vs tors. theta energy: -58.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -844.476829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -844.476829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -844.476829 (E_RNA) where: Base-Base interactions energy: -517.118 where: short stacking energy: -255.551 Base-Backbone interact. energy: 3.694 local terms energy: -331.053216 where: bonds (distance) C4'-P energy: -83.080 bonds (distance) P-C4' energy: -74.417 flat angles C4'-P-C4' energy: -82.616 flat angles P-C4'-P energy: -37.495 tors. eta vs tors. theta energy: -53.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -547.443772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.443772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.443772 (E_RNA) where: Base-Base interactions energy: -264.151 where: short stacking energy: -139.587 Base-Backbone interact. energy: 0.099 local terms energy: -283.391600 where: bonds (distance) C4'-P energy: -70.658 bonds (distance) P-C4' energy: -88.718 flat angles C4'-P-C4' energy: -77.570 flat angles P-C4'-P energy: -46.502 tors. eta vs tors. theta energy: 0.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -568.831840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.831840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.831840 (E_RNA) where: Base-Base interactions energy: -272.709 where: short stacking energy: -164.538 Base-Backbone interact. energy: -2.192 local terms energy: -293.930452 where: bonds (distance) C4'-P energy: -76.504 bonds (distance) P-C4' energy: -79.037 flat angles C4'-P-C4' energy: -83.900 flat angles P-C4'-P energy: -42.197 tors. eta vs tors. theta energy: -12.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -387.770988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.770988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.770988 (E_RNA) where: Base-Base interactions energy: -131.500 where: short stacking energy: -120.013 Base-Backbone interact. energy: 3.434 local terms energy: -259.704959 where: bonds (distance) C4'-P energy: -64.041 bonds (distance) P-C4' energy: -79.130 flat angles C4'-P-C4' energy: -84.367 flat angles P-C4'-P energy: -28.975 tors. eta vs tors. theta energy: -3.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -1489.691681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.691681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.691681 (E_RNA) where: Base-Base interactions energy: -990.456 where: short stacking energy: -433.530 Base-Backbone interact. energy: -3.816 local terms energy: -495.419007 where: bonds (distance) C4'-P energy: -100.227 bonds (distance) P-C4' energy: -99.324 flat angles C4'-P-C4' energy: -110.541 flat angles P-C4'-P energy: -65.999 tors. eta vs tors. theta energy: -119.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -1417.983435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1417.983435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1417.983435 (E_RNA) where: Base-Base interactions energy: -943.467 where: short stacking energy: -412.076 Base-Backbone interact. energy: -2.863 local terms energy: -471.653781 where: bonds (distance) C4'-P energy: -99.290 bonds (distance) P-C4' energy: -86.981 flat angles C4'-P-C4' energy: -102.760 flat angles P-C4'-P energy: -67.449 tors. eta vs tors. theta energy: -115.174 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -1308.319697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1308.319697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1308.319697 (E_RNA) where: Base-Base interactions energy: -854.590 where: short stacking energy: -376.966 Base-Backbone interact. energy: -1.724 local terms energy: -452.005814 where: bonds (distance) C4'-P energy: -81.566 bonds (distance) P-C4' energy: -94.914 flat angles C4'-P-C4' energy: -102.622 flat angles P-C4'-P energy: -62.995 tors. eta vs tors. theta energy: -109.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -1248.879280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1248.879280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1248.879280 (E_RNA) where: Base-Base interactions energy: -793.402 where: short stacking energy: -371.650 Base-Backbone interact. energy: -1.945 local terms energy: -453.531771 where: bonds (distance) C4'-P energy: -87.060 bonds (distance) P-C4' energy: -87.705 flat angles C4'-P-C4' energy: -102.896 flat angles P-C4'-P energy: -76.065 tors. eta vs tors. theta energy: -99.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -1086.035359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.035359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1086.035359 (E_RNA) where: Base-Base interactions energy: -686.711 where: short stacking energy: -325.251 Base-Backbone interact. energy: -3.895 local terms energy: -395.428830 where: bonds (distance) C4'-P energy: -89.893 bonds (distance) P-C4' energy: -92.882 flat angles C4'-P-C4' energy: -85.912 flat angles P-C4'-P energy: -59.567 tors. eta vs tors. theta energy: -67.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -953.970173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -953.970173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.970173 (E_RNA) where: Base-Base interactions energy: -593.114 where: short stacking energy: -267.779 Base-Backbone interact. energy: -0.714 local terms energy: -360.141243 where: bonds (distance) C4'-P energy: -84.141 bonds (distance) P-C4' energy: -89.279 flat angles C4'-P-C4' energy: -85.181 flat angles P-C4'-P energy: -60.254 tors. eta vs tors. theta energy: -41.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -866.228687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.228687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.228687 (E_RNA) where: Base-Base interactions energy: -503.690 where: short stacking energy: -237.291 Base-Backbone interact. energy: -2.420 local terms energy: -360.118712 where: bonds (distance) C4'-P energy: -91.157 bonds (distance) P-C4' energy: -80.711 flat angles C4'-P-C4' energy: -91.198 flat angles P-C4'-P energy: -50.763 tors. eta vs tors. theta energy: -46.290 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -546.079749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.079749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.079749 (E_RNA) where: Base-Base interactions energy: -235.306 where: short stacking energy: -164.979 Base-Backbone interact. energy: -2.524 local terms energy: -308.249484 where: bonds (distance) C4'-P energy: -91.201 bonds (distance) P-C4' energy: -82.546 flat angles C4'-P-C4' energy: -66.082 flat angles P-C4'-P energy: -47.615 tors. eta vs tors. theta energy: -20.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -550.278131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.278131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.278131 (E_RNA) where: Base-Base interactions energy: -291.215 where: short stacking energy: -162.047 Base-Backbone interact. energy: -1.632 local terms energy: -257.431067 where: bonds (distance) C4'-P energy: -90.311 bonds (distance) P-C4' energy: -65.123 flat angles C4'-P-C4' energy: -70.498 flat angles P-C4'-P energy: -39.895 tors. eta vs tors. theta energy: 8.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -368.889363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.889363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.889363 (E_RNA) where: Base-Base interactions energy: -136.208 where: short stacking energy: -107.665 Base-Backbone interact. energy: -1.518 local terms energy: -231.163475 where: bonds (distance) C4'-P energy: -70.862 bonds (distance) P-C4' energy: -85.543 flat angles C4'-P-C4' energy: -47.958 flat angles P-C4'-P energy: -37.879 tors. eta vs tors. theta energy: 11.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -1488.898157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1488.898157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1488.898157 (E_RNA) where: Base-Base interactions energy: -990.723 where: short stacking energy: -420.431 Base-Backbone interact. energy: -2.162 local terms energy: -496.013043 where: bonds (distance) C4'-P energy: -91.526 bonds (distance) P-C4' energy: -100.128 flat angles C4'-P-C4' energy: -107.056 flat angles P-C4'-P energy: -66.470 tors. eta vs tors. theta energy: -130.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -1350.208360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1350.208360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1350.208360 (E_RNA) where: Base-Base interactions energy: -893.240 where: short stacking energy: -412.381 Base-Backbone interact. energy: 6.705 local terms energy: -463.673905 where: bonds (distance) C4'-P energy: -89.859 bonds (distance) P-C4' energy: -90.576 flat angles C4'-P-C4' energy: -104.318 flat angles P-C4'-P energy: -65.302 tors. eta vs tors. theta energy: -113.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -1338.383254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1338.383254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1338.383254 (E_RNA) where: Base-Base interactions energy: -899.127 where: short stacking energy: -372.360 Base-Backbone interact. energy: 0.251 local terms energy: -439.507260 where: bonds (distance) C4'-P energy: -84.339 bonds (distance) P-C4' energy: -97.934 flat angles C4'-P-C4' energy: -103.848 flat angles P-C4'-P energy: -55.696 tors. eta vs tors. theta energy: -97.691 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -1192.464597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1192.464597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1192.464597 (E_RNA) where: Base-Base interactions energy: -778.390 where: short stacking energy: -368.504 Base-Backbone interact. energy: 3.616 local terms energy: -417.690313 where: bonds (distance) C4'-P energy: -89.466 bonds (distance) P-C4' energy: -88.766 flat angles C4'-P-C4' energy: -94.722 flat angles P-C4'-P energy: -55.444 tors. eta vs tors. theta energy: -89.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -1104.817592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1104.817592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.817592 (E_RNA) where: Base-Base interactions energy: -729.915 where: short stacking energy: -347.776 Base-Backbone interact. energy: 0.069 local terms energy: -374.972133 where: bonds (distance) C4'-P energy: -85.282 bonds (distance) P-C4' energy: -78.872 flat angles C4'-P-C4' energy: -88.317 flat angles P-C4'-P energy: -42.601 tors. eta vs tors. theta energy: -79.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -912.926386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -912.926386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -912.926386 (E_RNA) where: Base-Base interactions energy: -550.184 where: short stacking energy: -244.293 Base-Backbone interact. energy: 2.441 local terms energy: -365.184061 where: bonds (distance) C4'-P energy: -79.468 bonds (distance) P-C4' energy: -90.127 flat angles C4'-P-C4' energy: -88.087 flat angles P-C4'-P energy: -52.329 tors. eta vs tors. theta energy: -55.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -878.446681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.446681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -878.446681 (E_RNA) where: Base-Base interactions energy: -524.486 where: short stacking energy: -256.372 Base-Backbone interact. energy: 1.164 local terms energy: -355.124881 where: bonds (distance) C4'-P energy: -87.605 bonds (distance) P-C4' energy: -72.749 flat angles C4'-P-C4' energy: -88.839 flat angles P-C4'-P energy: -50.359 tors. eta vs tors. theta energy: -55.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -637.943654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -637.943654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.943654 (E_RNA) where: Base-Base interactions energy: -347.954 where: short stacking energy: -205.813 Base-Backbone interact. energy: 4.280 local terms energy: -294.269552 where: bonds (distance) C4'-P energy: -72.829 bonds (distance) P-C4' energy: -81.809 flat angles C4'-P-C4' energy: -65.225 flat angles P-C4'-P energy: -45.868 tors. eta vs tors. theta energy: -28.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -488.357794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.357794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.357794 (E_RNA) where: Base-Base interactions energy: -241.098 where: short stacking energy: -129.287 Base-Backbone interact. energy: 7.554 local terms energy: -254.813906 where: bonds (distance) C4'-P energy: -71.338 bonds (distance) P-C4' energy: -75.488 flat angles C4'-P-C4' energy: -68.658 flat angles P-C4'-P energy: -49.136 tors. eta vs tors. theta energy: 9.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -380.786764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.786764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.786764 (E_RNA) where: Base-Base interactions energy: -123.527 where: short stacking energy: -105.286 Base-Backbone interact. energy: -0.182 local terms energy: -257.077695 where: bonds (distance) C4'-P energy: -80.074 bonds (distance) P-C4' energy: -76.059 flat angles C4'-P-C4' energy: -64.857 flat angles P-C4'-P energy: -38.362 tors. eta vs tors. theta energy: 2.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -1488.128920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1488.128920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1488.128920 (E_RNA) where: Base-Base interactions energy: -997.342 where: short stacking energy: -447.737 Base-Backbone interact. energy: 1.212 local terms energy: -491.999412 where: bonds (distance) C4'-P energy: -91.314 bonds (distance) P-C4' energy: -98.136 flat angles C4'-P-C4' energy: -99.114 flat angles P-C4'-P energy: -76.310 tors. eta vs tors. theta energy: -127.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -1380.379946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1380.379946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1380.379946 (E_RNA) where: Base-Base interactions energy: -921.683 where: short stacking energy: -399.412 Base-Backbone interact. energy: -0.404 local terms energy: -458.293333 where: bonds (distance) C4'-P energy: -86.135 bonds (distance) P-C4' energy: -96.319 flat angles C4'-P-C4' energy: -97.833 flat angles P-C4'-P energy: -57.401 tors. eta vs tors. theta energy: -120.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -1336.619621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1336.619621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1336.619621 (E_RNA) where: Base-Base interactions energy: -905.391 where: short stacking energy: -389.098 Base-Backbone interact. energy: 2.256 local terms energy: -433.483818 where: bonds (distance) C4'-P energy: -78.387 bonds (distance) P-C4' energy: -92.974 flat angles C4'-P-C4' energy: -93.422 flat angles P-C4'-P energy: -70.060 tors. eta vs tors. theta energy: -98.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -1167.649184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1167.649184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1167.649184 (E_RNA) where: Base-Base interactions energy: -725.217 where: short stacking energy: -328.863 Base-Backbone interact. energy: -1.064 local terms energy: -441.368077 where: bonds (distance) C4'-P energy: -95.651 bonds (distance) P-C4' energy: -96.906 flat angles C4'-P-C4' energy: -102.727 flat angles P-C4'-P energy: -64.672 tors. eta vs tors. theta energy: -81.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -1094.438892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1094.438892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1094.438892 (E_RNA) where: Base-Base interactions energy: -697.658 where: short stacking energy: -312.316 Base-Backbone interact. energy: 5.109 local terms energy: -401.889947 where: bonds (distance) C4'-P energy: -78.175 bonds (distance) P-C4' energy: -99.893 flat angles C4'-P-C4' energy: -85.382 flat angles P-C4'-P energy: -59.010 tors. eta vs tors. theta energy: -79.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -951.682686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -951.682686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -951.682686 (E_RNA) where: Base-Base interactions energy: -583.054 where: short stacking energy: -274.343 Base-Backbone interact. energy: -1.077 local terms energy: -367.551517 where: bonds (distance) C4'-P energy: -89.140 bonds (distance) P-C4' energy: -78.530 flat angles C4'-P-C4' energy: -76.380 flat angles P-C4'-P energy: -53.150 tors. eta vs tors. theta energy: -70.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -894.109802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.109802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -894.109802 (E_RNA) where: Base-Base interactions energy: -529.498 where: short stacking energy: -255.150 Base-Backbone interact. energy: -0.996 local terms energy: -363.615332 where: bonds (distance) C4'-P energy: -83.654 bonds (distance) P-C4' energy: -86.645 flat angles C4'-P-C4' energy: -85.669 flat angles P-C4'-P energy: -53.596 tors. eta vs tors. theta energy: -54.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -612.726159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.726159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -612.726159 (E_RNA) where: Base-Base interactions energy: -309.034 where: short stacking energy: -189.072 Base-Backbone interact. energy: 1.217 local terms energy: -304.909248 where: bonds (distance) C4'-P energy: -76.293 bonds (distance) P-C4' energy: -88.966 flat angles C4'-P-C4' energy: -77.889 flat angles P-C4'-P energy: -51.725 tors. eta vs tors. theta energy: -10.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -506.884634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.884634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.884634 (E_RNA) where: Base-Base interactions energy: -233.360 where: short stacking energy: -130.779 Base-Backbone interact. energy: -1.347 local terms energy: -272.177722 where: bonds (distance) C4'-P energy: -66.005 bonds (distance) P-C4' energy: -81.228 flat angles C4'-P-C4' energy: -81.876 flat angles P-C4'-P energy: -39.446 tors. eta vs tors. theta energy: -3.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -408.980940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.980940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.980940 (E_RNA) where: Base-Base interactions energy: -184.545 where: short stacking energy: -151.420 Base-Backbone interact. energy: 5.393 local terms energy: -229.828062 where: bonds (distance) C4'-P energy: -61.958 bonds (distance) P-C4' energy: -59.383 flat angles C4'-P-C4' energy: -74.816 flat angles P-C4'-P energy: -27.751 tors. eta vs tors. theta energy: -5.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -1500.491055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1500.491055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1500.491055 (E_RNA) where: Base-Base interactions energy: -1018.576 where: short stacking energy: -433.860 Base-Backbone interact. energy: 0.260 local terms energy: -482.174193 where: bonds (distance) C4'-P energy: -89.590 bonds (distance) P-C4' energy: -97.557 flat angles C4'-P-C4' energy: -101.703 flat angles P-C4'-P energy: -69.852 tors. eta vs tors. theta energy: -123.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -1359.634392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1359.634392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1359.634392 (E_RNA) where: Base-Base interactions energy: -899.289 where: short stacking energy: -388.696 Base-Backbone interact. energy: -1.568 local terms energy: -458.777794 where: bonds (distance) C4'-P energy: -89.525 bonds (distance) P-C4' energy: -100.632 flat angles C4'-P-C4' energy: -101.582 flat angles P-C4'-P energy: -65.839 tors. eta vs tors. theta energy: -101.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -1281.639140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1281.639140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1281.639140 (E_RNA) where: Base-Base interactions energy: -844.123 where: short stacking energy: -359.227 Base-Backbone interact. energy: -3.078 local terms energy: -434.438389 where: bonds (distance) C4'-P energy: -85.716 bonds (distance) P-C4' energy: -90.279 flat angles C4'-P-C4' energy: -99.448 flat angles P-C4'-P energy: -65.540 tors. eta vs tors. theta energy: -93.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -1179.994009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1179.994009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1179.994009 (E_RNA) where: Base-Base interactions energy: -756.118 where: short stacking energy: -351.426 Base-Backbone interact. energy: 0.331 local terms energy: -424.207608 where: bonds (distance) C4'-P energy: -78.827 bonds (distance) P-C4' energy: -84.996 flat angles C4'-P-C4' energy: -100.316 flat angles P-C4'-P energy: -74.264 tors. eta vs tors. theta energy: -85.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -1081.133542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1081.133542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1081.133542 (E_RNA) where: Base-Base interactions energy: -705.738 where: short stacking energy: -329.038 Base-Backbone interact. energy: -2.708 local terms energy: -372.687488 where: bonds (distance) C4'-P energy: -67.393 bonds (distance) P-C4' energy: -82.823 flat angles C4'-P-C4' energy: -79.805 flat angles P-C4'-P energy: -57.920 tors. eta vs tors. theta energy: -84.747 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -985.243338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.243338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -985.243338 (E_RNA) where: Base-Base interactions energy: -625.661 where: short stacking energy: -281.777 Base-Backbone interact. energy: -0.073 local terms energy: -359.508890 where: bonds (distance) C4'-P energy: -79.561 bonds (distance) P-C4' energy: -88.640 flat angles C4'-P-C4' energy: -79.004 flat angles P-C4'-P energy: -52.293 tors. eta vs tors. theta energy: -60.011 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -878.173267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.173267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -878.173267 (E_RNA) where: Base-Base interactions energy: -520.257 where: short stacking energy: -252.501 Base-Backbone interact. energy: 0.222 local terms energy: -358.138529 where: bonds (distance) C4'-P energy: -83.391 bonds (distance) P-C4' energy: -86.329 flat angles C4'-P-C4' energy: -86.922 flat angles P-C4'-P energy: -54.438 tors. eta vs tors. theta energy: -47.058 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -607.678881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.678881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.678881 (E_RNA) where: Base-Base interactions energy: -309.806 where: short stacking energy: -156.559 Base-Backbone interact. energy: -1.328 local terms energy: -296.544813 where: bonds (distance) C4'-P energy: -90.785 bonds (distance) P-C4' energy: -91.937 flat angles C4'-P-C4' energy: -69.918 flat angles P-C4'-P energy: -38.471 tors. eta vs tors. theta energy: -5.434 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -531.494776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.494776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.494776 (E_RNA) where: Base-Base interactions energy: -248.767 where: short stacking energy: -177.054 Base-Backbone interact. energy: 0.056 local terms energy: -282.784279 where: bonds (distance) C4'-P energy: -84.346 bonds (distance) P-C4' energy: -82.930 flat angles C4'-P-C4' energy: -64.149 flat angles P-C4'-P energy: -39.716 tors. eta vs tors. theta energy: -11.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -373.494473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.494473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.494473 (E_RNA) where: Base-Base interactions energy: -144.523 where: short stacking energy: -115.304 Base-Backbone interact. energy: 5.391 local terms energy: -234.362396 where: bonds (distance) C4'-P energy: -72.777 bonds (distance) P-C4' energy: -82.692 flat angles C4'-P-C4' energy: -76.244 flat angles P-C4'-P energy: -32.354 tors. eta vs tors. theta energy: 29.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -1507.886505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1507.886505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1507.886505 (E_RNA) where: Base-Base interactions energy: -1007.517 where: short stacking energy: -418.332 Base-Backbone interact. energy: -1.450 local terms energy: -498.919423 where: bonds (distance) C4'-P energy: -102.080 bonds (distance) P-C4' energy: -97.798 flat angles C4'-P-C4' energy: -107.676 flat angles P-C4'-P energy: -67.030 tors. eta vs tors. theta energy: -124.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -1350.597165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1350.597165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1350.597165 (E_RNA) where: Base-Base interactions energy: -904.094 where: short stacking energy: -358.696 Base-Backbone interact. energy: -4.817 local terms energy: -441.685952 where: bonds (distance) C4'-P energy: -102.907 bonds (distance) P-C4' energy: -95.301 flat angles C4'-P-C4' energy: -100.028 flat angles P-C4'-P energy: -53.757 tors. eta vs tors. theta energy: -89.692 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -1255.669498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1255.669498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1255.669498 (E_RNA) where: Base-Base interactions energy: -820.458 where: short stacking energy: -369.427 Base-Backbone interact. energy: -2.729 local terms energy: -432.482608 where: bonds (distance) C4'-P energy: -91.215 bonds (distance) P-C4' energy: -92.675 flat angles C4'-P-C4' energy: -96.531 flat angles P-C4'-P energy: -53.243 tors. eta vs tors. theta energy: -98.817 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -1197.655298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1197.655298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1197.655298 (E_RNA) where: Base-Base interactions energy: -765.424 where: short stacking energy: -352.407 Base-Backbone interact. energy: 1.613 local terms energy: -433.844001 where: bonds (distance) C4'-P energy: -96.897 bonds (distance) P-C4' energy: -99.140 flat angles C4'-P-C4' energy: -92.444 flat angles P-C4'-P energy: -57.308 tors. eta vs tors. theta energy: -88.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -1105.779267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1105.779267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1105.779267 (E_RNA) where: Base-Base interactions energy: -709.136 where: short stacking energy: -351.712 Base-Backbone interact. energy: -0.900 local terms energy: -395.743189 where: bonds (distance) C4'-P energy: -82.292 bonds (distance) P-C4' energy: -94.885 flat angles C4'-P-C4' energy: -87.796 flat angles P-C4'-P energy: -51.284 tors. eta vs tors. theta energy: -79.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -1000.193513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1000.193513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.193513 (E_RNA) where: Base-Base interactions energy: -630.678 where: short stacking energy: -271.504 Base-Backbone interact. energy: -1.060 local terms energy: -368.455939 where: bonds (distance) C4'-P energy: -77.994 bonds (distance) P-C4' energy: -90.268 flat angles C4'-P-C4' energy: -81.803 flat angles P-C4'-P energy: -52.717 tors. eta vs tors. theta energy: -65.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -838.200849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.200849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.200849 (E_RNA) where: Base-Base interactions energy: -484.911 where: short stacking energy: -221.292 Base-Backbone interact. energy: -1.001 local terms energy: -352.289154 where: bonds (distance) C4'-P energy: -90.928 bonds (distance) P-C4' energy: -90.392 flat angles C4'-P-C4' energy: -75.513 flat angles P-C4'-P energy: -50.358 tors. eta vs tors. theta energy: -45.099 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -590.932960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.932960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.932960 (E_RNA) where: Base-Base interactions energy: -313.833 where: short stacking energy: -191.024 Base-Backbone interact. energy: 2.561 local terms energy: -279.661468 where: bonds (distance) C4'-P energy: -65.934 bonds (distance) P-C4' energy: -92.169 flat angles C4'-P-C4' energy: -85.828 flat angles P-C4'-P energy: -31.096 tors. eta vs tors. theta energy: -4.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -510.283808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.283808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.283808 (E_RNA) where: Base-Base interactions energy: -224.118 where: short stacking energy: -131.020 Base-Backbone interact. energy: 0.758 local terms energy: -286.923846 where: bonds (distance) C4'-P energy: -91.077 bonds (distance) P-C4' energy: -72.487 flat angles C4'-P-C4' energy: -77.474 flat angles P-C4'-P energy: -46.926 tors. eta vs tors. theta energy: 1.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -370.841050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.841050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.841050 (E_RNA) where: Base-Base interactions energy: -123.363 where: short stacking energy: -112.691 Base-Backbone interact. energy: 0.085 local terms energy: -247.562697 where: bonds (distance) C4'-P energy: -77.628 bonds (distance) P-C4' energy: -81.442 flat angles C4'-P-C4' energy: -74.490 flat angles P-C4'-P energy: -34.765 tors. eta vs tors. theta energy: 20.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -1514.797297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1514.797297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1514.797297 (E_RNA) where: Base-Base interactions energy: -1015.440 where: short stacking energy: -441.032 Base-Backbone interact. energy: -2.917 local terms energy: -496.441109 where: bonds (distance) C4'-P energy: -105.784 bonds (distance) P-C4' energy: -92.821 flat angles C4'-P-C4' energy: -101.647 flat angles P-C4'-P energy: -67.012 tors. eta vs tors. theta energy: -129.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -1332.979995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1332.979995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1332.979995 (E_RNA) where: Base-Base interactions energy: -871.202 where: short stacking energy: -385.110 Base-Backbone interact. energy: -4.126 local terms energy: -457.652430 where: bonds (distance) C4'-P energy: -90.319 bonds (distance) P-C4' energy: -93.960 flat angles C4'-P-C4' energy: -93.552 flat angles P-C4'-P energy: -66.142 tors. eta vs tors. theta energy: -113.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -1265.192837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1265.192837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1265.192837 (E_RNA) where: Base-Base interactions energy: -829.246 where: short stacking energy: -344.379 Base-Backbone interact. energy: -5.683 local terms energy: -430.264796 where: bonds (distance) C4'-P energy: -82.709 bonds (distance) P-C4' energy: -100.195 flat angles C4'-P-C4' energy: -100.303 flat angles P-C4'-P energy: -64.240 tors. eta vs tors. theta energy: -82.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -1163.042670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1163.042670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1163.042670 (E_RNA) where: Base-Base interactions energy: -761.860 where: short stacking energy: -354.525 Base-Backbone interact. energy: 1.505 local terms energy: -402.687369 where: bonds (distance) C4'-P energy: -91.297 bonds (distance) P-C4' energy: -100.282 flat angles C4'-P-C4' energy: -91.582 flat angles P-C4'-P energy: -45.181 tors. eta vs tors. theta energy: -74.345 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -1059.760263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.760263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.760263 (E_RNA) where: Base-Base interactions energy: -665.641 where: short stacking energy: -319.585 Base-Backbone interact. energy: 2.105 local terms energy: -396.224561 where: bonds (distance) C4'-P energy: -81.163 bonds (distance) P-C4' energy: -77.917 flat angles C4'-P-C4' energy: -96.181 flat angles P-C4'-P energy: -63.354 tors. eta vs tors. theta energy: -77.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -985.320770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.320770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -985.320770 (E_RNA) where: Base-Base interactions energy: -598.649 where: short stacking energy: -264.649 Base-Backbone interact. energy: -5.071 local terms energy: -381.600673 where: bonds (distance) C4'-P energy: -96.178 bonds (distance) P-C4' energy: -97.458 flat angles C4'-P-C4' energy: -79.395 flat angles P-C4'-P energy: -51.295 tors. eta vs tors. theta energy: -57.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -853.642456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.642456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.642456 (E_RNA) where: Base-Base interactions energy: -483.455 where: short stacking energy: -241.006 Base-Backbone interact. energy: -1.689 local terms energy: -368.498158 where: bonds (distance) C4'-P energy: -91.875 bonds (distance) P-C4' energy: -79.358 flat angles C4'-P-C4' energy: -73.777 flat angles P-C4'-P energy: -62.753 tors. eta vs tors. theta energy: -60.737 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -597.650238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.650238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.650238 (E_RNA) where: Base-Base interactions energy: -327.154 where: short stacking energy: -183.393 Base-Backbone interact. energy: 3.042 local terms energy: -273.538465 where: bonds (distance) C4'-P energy: -74.403 bonds (distance) P-C4' energy: -79.691 flat angles C4'-P-C4' energy: -81.505 flat angles P-C4'-P energy: -30.070 tors. eta vs tors. theta energy: -7.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -578.100972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.100972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.100972 (E_RNA) where: Base-Base interactions energy: -316.417 where: short stacking energy: -181.467 Base-Backbone interact. energy: 1.801 local terms energy: -263.485795 where: bonds (distance) C4'-P energy: -66.374 bonds (distance) P-C4' energy: -77.647 flat angles C4'-P-C4' energy: -54.041 flat angles P-C4'-P energy: -48.483 tors. eta vs tors. theta energy: -16.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -400.909104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.909104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.909104 (E_RNA) where: Base-Base interactions energy: -145.141 where: short stacking energy: -135.149 Base-Backbone interact. energy: 0.832 local terms energy: -256.599928 where: bonds (distance) C4'-P energy: -67.318 bonds (distance) P-C4' energy: -81.530 flat angles C4'-P-C4' energy: -69.550 flat angles P-C4'-P energy: -36.324 tors. eta vs tors. theta energy: -1.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -1516.822231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1516.822231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1516.822231 (E_RNA) where: Base-Base interactions energy: -1017.949 where: short stacking energy: -450.146 Base-Backbone interact. energy: -3.706 local terms energy: -495.167535 where: bonds (distance) C4'-P energy: -92.618 bonds (distance) P-C4' energy: -103.308 flat angles C4'-P-C4' energy: -109.669 flat angles P-C4'-P energy: -70.279 tors. eta vs tors. theta energy: -119.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -1340.562202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1340.562202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1340.562202 (E_RNA) where: Base-Base interactions energy: -875.567 where: short stacking energy: -378.094 Base-Backbone interact. energy: -1.798 local terms energy: -463.197537 where: bonds (distance) C4'-P energy: -95.933 bonds (distance) P-C4' energy: -103.955 flat angles C4'-P-C4' energy: -99.164 flat angles P-C4'-P energy: -68.460 tors. eta vs tors. theta energy: -95.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -1244.918462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1244.918462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1244.918462 (E_RNA) where: Base-Base interactions energy: -809.572 where: short stacking energy: -351.907 Base-Backbone interact. energy: -3.813 local terms energy: -431.534025 where: bonds (distance) C4'-P energy: -92.291 bonds (distance) P-C4' energy: -91.606 flat angles C4'-P-C4' energy: -106.266 flat angles P-C4'-P energy: -57.324 tors. eta vs tors. theta energy: -84.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -1166.503612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1166.503612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1166.503612 (E_RNA) where: Base-Base interactions energy: -763.408 where: short stacking energy: -368.258 Base-Backbone interact. energy: -0.784 local terms energy: -402.312458 where: bonds (distance) C4'-P energy: -79.991 bonds (distance) P-C4' energy: -71.660 flat angles C4'-P-C4' energy: -95.044 flat angles P-C4'-P energy: -64.371 tors. eta vs tors. theta energy: -91.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -1054.867584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1054.867584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1054.867584 (E_RNA) where: Base-Base interactions energy: -666.711 where: short stacking energy: -326.189 Base-Backbone interact. energy: 0.103 local terms energy: -388.259590 where: bonds (distance) C4'-P energy: -93.621 bonds (distance) P-C4' energy: -77.436 flat angles C4'-P-C4' energy: -79.249 flat angles P-C4'-P energy: -60.757 tors. eta vs tors. theta energy: -77.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -940.104972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -940.104972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.104972 (E_RNA) where: Base-Base interactions energy: -568.755 where: short stacking energy: -267.479 Base-Backbone interact. energy: -2.468 local terms energy: -368.881772 where: bonds (distance) C4'-P energy: -83.927 bonds (distance) P-C4' energy: -99.995 flat angles C4'-P-C4' energy: -88.084 flat angles P-C4'-P energy: -42.478 tors. eta vs tors. theta energy: -54.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -822.426764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.426764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -822.426764 (E_RNA) where: Base-Base interactions energy: -458.631 where: short stacking energy: -233.630 Base-Backbone interact. energy: -1.919 local terms energy: -361.876323 where: bonds (distance) C4'-P energy: -79.552 bonds (distance) P-C4' energy: -93.597 flat angles C4'-P-C4' energy: -88.076 flat angles P-C4'-P energy: -60.940 tors. eta vs tors. theta energy: -39.712 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -599.724435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.724435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.724435 (E_RNA) where: Base-Base interactions energy: -310.894 where: short stacking energy: -164.360 Base-Backbone interact. energy: -2.316 local terms energy: -286.513745 where: bonds (distance) C4'-P energy: -78.499 bonds (distance) P-C4' energy: -84.489 flat angles C4'-P-C4' energy: -81.681 flat angles P-C4'-P energy: -39.722 tors. eta vs tors. theta energy: -2.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -545.946510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.946510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.946510 (E_RNA) where: Base-Base interactions energy: -252.093 where: short stacking energy: -151.531 Base-Backbone interact. energy: -2.077 local terms energy: -291.775947 where: bonds (distance) C4'-P energy: -86.373 bonds (distance) P-C4' energy: -76.037 flat angles C4'-P-C4' energy: -66.482 flat angles P-C4'-P energy: -59.146 tors. eta vs tors. theta energy: -3.737 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -393.860633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.860633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.860633 (E_RNA) where: Base-Base interactions energy: -135.159 where: short stacking energy: -111.282 Base-Backbone interact. energy: -1.434 local terms energy: -257.266852 where: bonds (distance) C4'-P energy: -72.620 bonds (distance) P-C4' energy: -92.719 flat angles C4'-P-C4' energy: -61.584 flat angles P-C4'-P energy: -48.459 tors. eta vs tors. theta energy: 18.116 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -1502.448986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1502.448986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1502.448986 (E_RNA) where: Base-Base interactions energy: -1037.029 where: short stacking energy: -453.300 Base-Backbone interact. energy: -3.034 local terms energy: -462.385804 where: bonds (distance) C4'-P energy: -87.567 bonds (distance) P-C4' energy: -95.537 flat angles C4'-P-C4' energy: -109.214 flat angles P-C4'-P energy: -49.517 tors. eta vs tors. theta energy: -120.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -1319.356107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1319.356107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1319.356107 (E_RNA) where: Base-Base interactions energy: -876.719 where: short stacking energy: -401.900 Base-Backbone interact. energy: -1.316 local terms energy: -441.320462 where: bonds (distance) C4'-P energy: -89.005 bonds (distance) P-C4' energy: -93.359 flat angles C4'-P-C4' energy: -109.670 flat angles P-C4'-P energy: -44.815 tors. eta vs tors. theta energy: -104.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -1243.273123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1243.273123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1243.273123 (E_RNA) where: Base-Base interactions energy: -794.835 where: short stacking energy: -354.938 Base-Backbone interact. energy: -3.259 local terms energy: -445.178633 where: bonds (distance) C4'-P energy: -101.344 bonds (distance) P-C4' energy: -99.218 flat angles C4'-P-C4' energy: -99.090 flat angles P-C4'-P energy: -58.639 tors. eta vs tors. theta energy: -86.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -1173.132800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1173.132800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1173.132800 (E_RNA) where: Base-Base interactions energy: -751.384 where: short stacking energy: -339.442 Base-Backbone interact. energy: -2.739 local terms energy: -419.009745 where: bonds (distance) C4'-P energy: -84.771 bonds (distance) P-C4' energy: -95.954 flat angles C4'-P-C4' energy: -84.249 flat angles P-C4'-P energy: -58.251 tors. eta vs tors. theta energy: -95.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -1039.911557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.911557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1039.911557 (E_RNA) where: Base-Base interactions energy: -636.860 where: short stacking energy: -297.685 Base-Backbone interact. energy: 0.212 local terms energy: -403.263079 where: bonds (distance) C4'-P energy: -86.853 bonds (distance) P-C4' energy: -84.577 flat angles C4'-P-C4' energy: -101.490 flat angles P-C4'-P energy: -63.241 tors. eta vs tors. theta energy: -67.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -982.091852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.091852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -982.091852 (E_RNA) where: Base-Base interactions energy: -609.851 where: short stacking energy: -275.954 Base-Backbone interact. energy: -0.971 local terms energy: -371.269641 where: bonds (distance) C4'-P energy: -72.706 bonds (distance) P-C4' energy: -84.574 flat angles C4'-P-C4' energy: -87.027 flat angles P-C4'-P energy: -53.859 tors. eta vs tors. theta energy: -73.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -864.144560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -864.144560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -864.144560 (E_RNA) where: Base-Base interactions energy: -503.630 where: short stacking energy: -265.185 Base-Backbone interact. energy: -0.533 local terms energy: -359.981448 where: bonds (distance) C4'-P energy: -83.145 bonds (distance) P-C4' energy: -71.273 flat angles C4'-P-C4' energy: -87.442 flat angles P-C4'-P energy: -50.433 tors. eta vs tors. theta energy: -67.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -611.567975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.567975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.567975 (E_RNA) where: Base-Base interactions energy: -319.002 where: short stacking energy: -167.852 Base-Backbone interact. energy: -1.414 local terms energy: -291.151243 where: bonds (distance) C4'-P energy: -72.309 bonds (distance) P-C4' energy: -77.181 flat angles C4'-P-C4' energy: -80.231 flat angles P-C4'-P energy: -53.269 tors. eta vs tors. theta energy: -8.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -589.472836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.472836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.472836 (E_RNA) where: Base-Base interactions energy: -296.613 where: short stacking energy: -168.025 Base-Backbone interact. energy: 5.156 local terms energy: -298.015541 where: bonds (distance) C4'-P energy: -79.938 bonds (distance) P-C4' energy: -94.725 flat angles C4'-P-C4' energy: -91.452 flat angles P-C4'-P energy: -29.907 tors. eta vs tors. theta energy: -1.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -370.149039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.149039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.149039 (E_RNA) where: Base-Base interactions energy: -145.846 where: short stacking energy: -102.657 Base-Backbone interact. energy: 1.302 local terms energy: -225.604697 where: bonds (distance) C4'-P energy: -83.109 bonds (distance) P-C4' energy: -81.057 flat angles C4'-P-C4' energy: -62.933 flat angles P-C4'-P energy: -28.005 tors. eta vs tors. theta energy: 29.499 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -1476.992543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1476.992543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1476.992543 (E_RNA) where: Base-Base interactions energy: -986.508 where: short stacking energy: -440.665 Base-Backbone interact. energy: -0.015 local terms energy: -490.469675 where: bonds (distance) C4'-P energy: -96.648 bonds (distance) P-C4' energy: -98.334 flat angles C4'-P-C4' energy: -105.162 flat angles P-C4'-P energy: -72.645 tors. eta vs tors. theta energy: -117.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -1346.192828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1346.192828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1346.192828 (E_RNA) where: Base-Base interactions energy: -912.184 where: short stacking energy: -380.811 Base-Backbone interact. energy: -0.135 local terms energy: -433.874532 where: bonds (distance) C4'-P energy: -93.442 bonds (distance) P-C4' energy: -91.851 flat angles C4'-P-C4' energy: -89.946 flat angles P-C4'-P energy: -64.672 tors. eta vs tors. theta energy: -93.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -1239.510609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1239.510609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1239.510609 (E_RNA) where: Base-Base interactions energy: -785.349 where: short stacking energy: -378.229 Base-Backbone interact. energy: -0.398 local terms energy: -453.763110 where: bonds (distance) C4'-P energy: -96.387 bonds (distance) P-C4' energy: -97.587 flat angles C4'-P-C4' energy: -107.371 flat angles P-C4'-P energy: -55.035 tors. eta vs tors. theta energy: -97.384 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -1215.289036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1215.289036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1215.289036 (E_RNA) where: Base-Base interactions energy: -799.368 where: short stacking energy: -358.468 Base-Backbone interact. energy: 1.665 local terms energy: -417.586365 where: bonds (distance) C4'-P energy: -77.985 bonds (distance) P-C4' energy: -85.416 flat angles C4'-P-C4' energy: -96.562 flat angles P-C4'-P energy: -63.504 tors. eta vs tors. theta energy: -94.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -1057.795446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.795446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1057.795446 (E_RNA) where: Base-Base interactions energy: -666.109 where: short stacking energy: -332.457 Base-Backbone interact. energy: -0.050 local terms energy: -391.636518 where: bonds (distance) C4'-P energy: -75.205 bonds (distance) P-C4' energy: -80.514 flat angles C4'-P-C4' energy: -93.825 flat angles P-C4'-P energy: -56.371 tors. eta vs tors. theta energy: -85.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -972.270870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.270870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.270870 (E_RNA) where: Base-Base interactions energy: -628.526 where: short stacking energy: -300.069 Base-Backbone interact. energy: 3.766 local terms energy: -347.510681 where: bonds (distance) C4'-P energy: -75.768 bonds (distance) P-C4' energy: -84.412 flat angles C4'-P-C4' energy: -80.787 flat angles P-C4'-P energy: -40.608 tors. eta vs tors. theta energy: -65.935 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -816.946811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -816.946811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -816.946811 (E_RNA) where: Base-Base interactions energy: -464.663 where: short stacking energy: -238.211 Base-Backbone interact. energy: -3.068 local terms energy: -349.215828 where: bonds (distance) C4'-P energy: -89.562 bonds (distance) P-C4' energy: -86.252 flat angles C4'-P-C4' energy: -74.476 flat angles P-C4'-P energy: -47.115 tors. eta vs tors. theta energy: -51.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -624.140124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.140124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.140124 (E_RNA) where: Base-Base interactions energy: -325.000 where: short stacking energy: -178.534 Base-Backbone interact. energy: 2.028 local terms energy: -301.167784 where: bonds (distance) C4'-P energy: -78.710 bonds (distance) P-C4' energy: -94.430 flat angles C4'-P-C4' energy: -69.646 flat angles P-C4'-P energy: -33.218 tors. eta vs tors. theta energy: -25.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -547.857481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.857481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.857481 (E_RNA) where: Base-Base interactions energy: -272.270 where: short stacking energy: -166.312 Base-Backbone interact. energy: 0.230 local terms energy: -275.817803 where: bonds (distance) C4'-P energy: -74.336 bonds (distance) P-C4' energy: -85.811 flat angles C4'-P-C4' energy: -70.759 flat angles P-C4'-P energy: -35.953 tors. eta vs tors. theta energy: -8.959 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -381.184764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.184764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.184764 (E_RNA) where: Base-Base interactions energy: -119.124 where: short stacking energy: -91.176 Base-Backbone interact. energy: -1.506 local terms energy: -260.555170 where: bonds (distance) C4'-P energy: -84.810 bonds (distance) P-C4' energy: -85.160 flat angles C4'-P-C4' energy: -66.019 flat angles P-C4'-P energy: -37.456 tors. eta vs tors. theta energy: 12.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -1477.561053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1477.561053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1477.561053 (E_RNA) where: Base-Base interactions energy: -974.224 where: short stacking energy: -429.290 Base-Backbone interact. energy: -2.962 local terms energy: -500.374534 where: bonds (distance) C4'-P energy: -95.764 bonds (distance) P-C4' energy: -101.124 flat angles C4'-P-C4' energy: -107.569 flat angles P-C4'-P energy: -73.771 tors. eta vs tors. theta energy: -122.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -1356.044733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1356.044733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1356.044733 (E_RNA) where: Base-Base interactions energy: -909.402 where: short stacking energy: -378.564 Base-Backbone interact. energy: -1.912 local terms energy: -444.729792 where: bonds (distance) C4'-P energy: -96.053 bonds (distance) P-C4' energy: -103.046 flat angles C4'-P-C4' energy: -80.347 flat angles P-C4'-P energy: -65.962 tors. eta vs tors. theta energy: -99.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -1239.517460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1239.517460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1239.517460 (E_RNA) where: Base-Base interactions energy: -782.465 where: short stacking energy: -378.715 Base-Backbone interact. energy: 0.798 local terms energy: -457.850151 where: bonds (distance) C4'-P energy: -95.386 bonds (distance) P-C4' energy: -94.647 flat angles C4'-P-C4' energy: -92.276 flat angles P-C4'-P energy: -67.998 tors. eta vs tors. theta energy: -107.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -1234.318970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1234.318970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1234.318970 (E_RNA) where: Base-Base interactions energy: -782.878 where: short stacking energy: -369.103 Base-Backbone interact. energy: 0.904 local terms energy: -452.344757 where: bonds (distance) C4'-P energy: -93.905 bonds (distance) P-C4' energy: -87.267 flat angles C4'-P-C4' energy: -102.383 flat angles P-C4'-P energy: -65.552 tors. eta vs tors. theta energy: -103.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -1057.320646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.320646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1057.320646 (E_RNA) where: Base-Base interactions energy: -687.299 where: short stacking energy: -283.620 Base-Backbone interact. energy: -0.977 local terms energy: -369.044658 where: bonds (distance) C4'-P energy: -71.380 bonds (distance) P-C4' energy: -88.573 flat angles C4'-P-C4' energy: -89.853 flat angles P-C4'-P energy: -55.480 tors. eta vs tors. theta energy: -63.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -986.688304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -986.688304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -986.688304 (E_RNA) where: Base-Base interactions energy: -613.966 where: short stacking energy: -301.097 Base-Backbone interact. energy: 4.702 local terms energy: -377.424192 where: bonds (distance) C4'-P energy: -94.682 bonds (distance) P-C4' energy: -85.447 flat angles C4'-P-C4' energy: -83.756 flat angles P-C4'-P energy: -51.033 tors. eta vs tors. theta energy: -62.507 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -829.618067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.618067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.618067 (E_RNA) where: Base-Base interactions energy: -472.308 where: short stacking energy: -266.624 Base-Backbone interact. energy: -3.615 local terms energy: -353.695152 where: bonds (distance) C4'-P energy: -74.340 bonds (distance) P-C4' energy: -98.449 flat angles C4'-P-C4' energy: -86.222 flat angles P-C4'-P energy: -37.667 tors. eta vs tors. theta energy: -57.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -595.276677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.276677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.276677 (E_RNA) where: Base-Base interactions energy: -298.986 where: short stacking energy: -155.426 Base-Backbone interact. energy: -1.190 local terms energy: -295.100575 where: bonds (distance) C4'-P energy: -70.666 bonds (distance) P-C4' energy: -93.131 flat angles C4'-P-C4' energy: -76.936 flat angles P-C4'-P energy: -44.557 tors. eta vs tors. theta energy: -9.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -596.338541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.338541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.338541 (E_RNA) where: Base-Base interactions energy: -342.953 where: short stacking energy: -182.601 Base-Backbone interact. energy: -2.576 local terms energy: -250.809541 where: bonds (distance) C4'-P energy: -68.940 bonds (distance) P-C4' energy: -73.135 flat angles C4'-P-C4' energy: -61.552 flat angles P-C4'-P energy: -35.997 tors. eta vs tors. theta energy: -11.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -374.904351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.904351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.904351 (E_RNA) where: Base-Base interactions energy: -140.230 where: short stacking energy: -91.615 Base-Backbone interact. energy: -1.452 local terms energy: -233.221735 where: bonds (distance) C4'-P energy: -73.058 bonds (distance) P-C4' energy: -86.549 flat angles C4'-P-C4' energy: -61.745 flat angles P-C4'-P energy: -28.725 tors. eta vs tors. theta energy: 16.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -1460.037980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1460.037980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1460.037980 (E_RNA) where: Base-Base interactions energy: -953.626 where: short stacking energy: -425.481 Base-Backbone interact. energy: -0.958 local terms energy: -505.454389 where: bonds (distance) C4'-P energy: -97.080 bonds (distance) P-C4' energy: -92.633 flat angles C4'-P-C4' energy: -109.321 flat angles P-C4'-P energy: -83.325 tors. eta vs tors. theta energy: -123.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -1388.633145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1388.633145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1388.633145 (E_RNA) where: Base-Base interactions energy: -931.399 where: short stacking energy: -392.860 Base-Backbone interact. energy: -4.041 local terms energy: -453.192995 where: bonds (distance) C4'-P energy: -86.021 bonds (distance) P-C4' energy: -90.844 flat angles C4'-P-C4' energy: -98.518 flat angles P-C4'-P energy: -66.575 tors. eta vs tors. theta energy: -111.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -1246.660832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1246.660832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1246.660832 (E_RNA) where: Base-Base interactions energy: -801.992 where: short stacking energy: -383.108 Base-Backbone interact. energy: -0.632 local terms energy: -444.037368 where: bonds (distance) C4'-P energy: -78.304 bonds (distance) P-C4' energy: -87.101 flat angles C4'-P-C4' energy: -106.043 flat angles P-C4'-P energy: -60.456 tors. eta vs tors. theta energy: -112.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -1185.456733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1185.456733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1185.456733 (E_RNA) where: Base-Base interactions energy: -777.606 where: short stacking energy: -338.558 Base-Backbone interact. energy: -3.273 local terms energy: -404.578207 where: bonds (distance) C4'-P energy: -83.056 bonds (distance) P-C4' energy: -94.902 flat angles C4'-P-C4' energy: -90.263 flat angles P-C4'-P energy: -48.349 tors. eta vs tors. theta energy: -88.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -1035.074112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.074112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1035.074112 (E_RNA) where: Base-Base interactions energy: -631.141 where: short stacking energy: -295.617 Base-Backbone interact. energy: -2.311 local terms energy: -401.621770 where: bonds (distance) C4'-P energy: -80.714 bonds (distance) P-C4' energy: -97.832 flat angles C4'-P-C4' energy: -86.040 flat angles P-C4'-P energy: -63.177 tors. eta vs tors. theta energy: -73.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -1066.630268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1066.630268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1066.630268 (E_RNA) where: Base-Base interactions energy: -649.720 where: short stacking energy: -308.165 Base-Backbone interact. energy: -1.768 local terms energy: -415.142571 where: bonds (distance) C4'-P energy: -93.996 bonds (distance) P-C4' energy: -87.501 flat angles C4'-P-C4' energy: -84.581 flat angles P-C4'-P energy: -63.797 tors. eta vs tors. theta energy: -85.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -878.451095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.451095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -878.451095 (E_RNA) where: Base-Base interactions energy: -534.500 where: short stacking energy: -266.674 Base-Backbone interact. energy: -1.172 local terms energy: -342.779284 where: bonds (distance) C4'-P energy: -75.841 bonds (distance) P-C4' energy: -87.664 flat angles C4'-P-C4' energy: -81.158 flat angles P-C4'-P energy: -47.626 tors. eta vs tors. theta energy: -50.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -614.700151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.700151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.700151 (E_RNA) where: Base-Base interactions energy: -315.437 where: short stacking energy: -175.188 Base-Backbone interact. energy: -1.534 local terms energy: -297.729527 where: bonds (distance) C4'-P energy: -78.104 bonds (distance) P-C4' energy: -95.319 flat angles C4'-P-C4' energy: -67.913 flat angles P-C4'-P energy: -48.768 tors. eta vs tors. theta energy: -7.626 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -606.413398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.413398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.413398 (E_RNA) where: Base-Base interactions energy: -328.079 where: short stacking energy: -186.321 Base-Backbone interact. energy: 0.089 local terms energy: -278.423041 where: bonds (distance) C4'-P energy: -76.183 bonds (distance) P-C4' energy: -82.561 flat angles C4'-P-C4' energy: -75.775 flat angles P-C4'-P energy: -33.649 tors. eta vs tors. theta energy: -10.255 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -381.227606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.227606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.227606 (E_RNA) where: Base-Base interactions energy: -139.977 where: short stacking energy: -106.761 Base-Backbone interact. energy: 6.747 local terms energy: -247.997849 where: bonds (distance) C4'-P energy: -71.946 bonds (distance) P-C4' energy: -87.294 flat angles C4'-P-C4' energy: -55.506 flat angles P-C4'-P energy: -40.691 tors. eta vs tors. theta energy: 7.439 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -1495.419073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1495.419073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1495.419073 (E_RNA) where: Base-Base interactions energy: -985.828 where: short stacking energy: -435.500 Base-Backbone interact. energy: -1.670 local terms energy: -507.921900 where: bonds (distance) C4'-P energy: -99.785 bonds (distance) P-C4' energy: -103.969 flat angles C4'-P-C4' energy: -116.594 flat angles P-C4'-P energy: -67.001 tors. eta vs tors. theta energy: -120.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -1405.460993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1405.460993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1405.460993 (E_RNA) where: Base-Base interactions energy: -941.373 where: short stacking energy: -422.031 Base-Backbone interact. energy: -5.966 local terms energy: -458.122870 where: bonds (distance) C4'-P energy: -78.672 bonds (distance) P-C4' energy: -93.669 flat angles C4'-P-C4' energy: -101.953 flat angles P-C4'-P energy: -69.959 tors. eta vs tors. theta energy: -113.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -1259.194509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1259.194509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1259.194509 (E_RNA) where: Base-Base interactions energy: -813.692 where: short stacking energy: -383.283 Base-Backbone interact. energy: 0.648 local terms energy: -446.149934 where: bonds (distance) C4'-P energy: -96.684 bonds (distance) P-C4' energy: -100.223 flat angles C4'-P-C4' energy: -96.345 flat angles P-C4'-P energy: -55.156 tors. eta vs tors. theta energy: -97.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -1242.930623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1242.930623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1242.930623 (E_RNA) where: Base-Base interactions energy: -787.141 where: short stacking energy: -362.248 Base-Backbone interact. energy: -0.191 local terms energy: -455.597887 where: bonds (distance) C4'-P energy: -91.118 bonds (distance) P-C4' energy: -99.022 flat angles C4'-P-C4' energy: -95.861 flat angles P-C4'-P energy: -70.490 tors. eta vs tors. theta energy: -99.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -1057.336606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.336606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1057.336606 (E_RNA) where: Base-Base interactions energy: -667.354 where: short stacking energy: -325.324 Base-Backbone interact. energy: -2.291 local terms energy: -387.691399 where: bonds (distance) C4'-P energy: -81.287 bonds (distance) P-C4' energy: -89.703 flat angles C4'-P-C4' energy: -89.984 flat angles P-C4'-P energy: -44.935 tors. eta vs tors. theta energy: -81.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -1037.459671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.459671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1037.459671 (E_RNA) where: Base-Base interactions energy: -633.386 where: short stacking energy: -311.232 Base-Backbone interact. energy: -2.211 local terms energy: -401.862712 where: bonds (distance) C4'-P energy: -71.171 bonds (distance) P-C4' energy: -82.937 flat angles C4'-P-C4' energy: -93.392 flat angles P-C4'-P energy: -58.015 tors. eta vs tors. theta energy: -96.347 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -858.763559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.763559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -858.763559 (E_RNA) where: Base-Base interactions energy: -508.570 where: short stacking energy: -252.921 Base-Backbone interact. energy: -0.306 local terms energy: -349.887857 where: bonds (distance) C4'-P energy: -80.642 bonds (distance) P-C4' energy: -77.121 flat angles C4'-P-C4' energy: -93.182 flat angles P-C4'-P energy: -51.250 tors. eta vs tors. theta energy: -47.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -625.379494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -625.379494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -625.379494 (E_RNA) where: Base-Base interactions energy: -320.059 where: short stacking energy: -195.179 Base-Backbone interact. energy: -0.744 local terms energy: -304.575707 where: bonds (distance) C4'-P energy: -72.656 bonds (distance) P-C4' energy: -78.781 flat angles C4'-P-C4' energy: -75.512 flat angles P-C4'-P energy: -44.762 tors. eta vs tors. theta energy: -32.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -602.494655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.494655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.494655 (E_RNA) where: Base-Base interactions energy: -308.706 where: short stacking energy: -158.703 Base-Backbone interact. energy: 1.174 local terms energy: -294.962160 where: bonds (distance) C4'-P energy: -70.386 bonds (distance) P-C4' energy: -89.727 flat angles C4'-P-C4' energy: -68.188 flat angles P-C4'-P energy: -59.633 tors. eta vs tors. theta energy: -7.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -371.796090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.796090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.796090 (E_RNA) where: Base-Base interactions energy: -120.763 where: short stacking energy: -97.641 Base-Backbone interact. energy: -0.929 local terms energy: -250.103397 where: bonds (distance) C4'-P energy: -79.168 bonds (distance) P-C4' energy: -81.257 flat angles C4'-P-C4' energy: -75.755 flat angles P-C4'-P energy: -37.492 tors. eta vs tors. theta energy: 23.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -1488.968898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1488.968898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1488.968898 (E_RNA) where: Base-Base interactions energy: -999.389 where: short stacking energy: -429.998 Base-Backbone interact. energy: -2.211 local terms energy: -487.368828 where: bonds (distance) C4'-P energy: -92.813 bonds (distance) P-C4' energy: -96.633 flat angles C4'-P-C4' energy: -105.283 flat angles P-C4'-P energy: -72.815 tors. eta vs tors. theta energy: -119.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -1394.009394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1394.009394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1394.009394 (E_RNA) where: Base-Base interactions energy: -925.478 where: short stacking energy: -406.956 Base-Backbone interact. energy: -2.785 local terms energy: -465.746575 where: bonds (distance) C4'-P energy: -97.940 bonds (distance) P-C4' energy: -103.874 flat angles C4'-P-C4' energy: -98.139 flat angles P-C4'-P energy: -61.746 tors. eta vs tors. theta energy: -104.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -1282.510291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1282.510291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1282.510291 (E_RNA) where: Base-Base interactions energy: -845.287 where: short stacking energy: -385.319 Base-Backbone interact. energy: -2.146 local terms energy: -435.076998 where: bonds (distance) C4'-P energy: -89.169 bonds (distance) P-C4' energy: -83.774 flat angles C4'-P-C4' energy: -89.664 flat angles P-C4'-P energy: -71.133 tors. eta vs tors. theta energy: -101.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -1148.002929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1148.002929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1148.002929 (E_RNA) where: Base-Base interactions energy: -756.095 where: short stacking energy: -327.081 Base-Backbone interact. energy: 0.540 local terms energy: -392.447997 where: bonds (distance) C4'-P energy: -91.673 bonds (distance) P-C4' energy: -82.047 flat angles C4'-P-C4' energy: -87.581 flat angles P-C4'-P energy: -66.857 tors. eta vs tors. theta energy: -64.290 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -1037.001695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.001695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1037.001695 (E_RNA) where: Base-Base interactions energy: -633.739 where: short stacking energy: -312.653 Base-Backbone interact. energy: 3.436 local terms energy: -406.698938 where: bonds (distance) C4'-P energy: -80.973 bonds (distance) P-C4' energy: -78.001 flat angles C4'-P-C4' energy: -102.815 flat angles P-C4'-P energy: -66.663 tors. eta vs tors. theta energy: -78.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -979.222463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -979.222463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -979.222463 (E_RNA) where: Base-Base interactions energy: -597.482 where: short stacking energy: -270.475 Base-Backbone interact. energy: 1.122 local terms energy: -382.862145 where: bonds (distance) C4'-P energy: -84.573 bonds (distance) P-C4' energy: -93.587 flat angles C4'-P-C4' energy: -89.580 flat angles P-C4'-P energy: -53.295 tors. eta vs tors. theta energy: -61.827 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -841.049545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.049545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.049545 (E_RNA) where: Base-Base interactions energy: -501.723 where: short stacking energy: -250.990 Base-Backbone interact. energy: 0.080 local terms energy: -339.406680 where: bonds (distance) C4'-P energy: -91.955 bonds (distance) P-C4' energy: -82.386 flat angles C4'-P-C4' energy: -81.210 flat angles P-C4'-P energy: -52.664 tors. eta vs tors. theta energy: -31.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -618.930230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.930230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.930230 (E_RNA) where: Base-Base interactions energy: -320.066 where: short stacking energy: -165.575 Base-Backbone interact. energy: -1.109 local terms energy: -297.755380 where: bonds (distance) C4'-P energy: -80.612 bonds (distance) P-C4' energy: -83.889 flat angles C4'-P-C4' energy: -81.706 flat angles P-C4'-P energy: -39.876 tors. eta vs tors. theta energy: -11.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -568.116486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.116486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.116486 (E_RNA) where: Base-Base interactions energy: -280.799 where: short stacking energy: -139.742 Base-Backbone interact. energy: 0.684 local terms energy: -288.001784 where: bonds (distance) C4'-P energy: -91.848 bonds (distance) P-C4' energy: -73.959 flat angles C4'-P-C4' energy: -74.857 flat angles P-C4'-P energy: -50.027 tors. eta vs tors. theta energy: 2.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -392.248309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.248309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.248309 (E_RNA) where: Base-Base interactions energy: -128.669 where: short stacking energy: -103.798 Base-Backbone interact. energy: 2.656 local terms energy: -266.235451 where: bonds (distance) C4'-P energy: -99.196 bonds (distance) P-C4' energy: -85.007 flat angles C4'-P-C4' energy: -51.038 flat angles P-C4'-P energy: -46.600 tors. eta vs tors. theta energy: 15.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -1518.751106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1518.751106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1518.751106 (E_RNA) where: Base-Base interactions energy: -1024.470 where: short stacking energy: -456.525 Base-Backbone interact. energy: -4.330 local terms energy: -489.950664 where: bonds (distance) C4'-P energy: -95.522 bonds (distance) P-C4' energy: -95.625 flat angles C4'-P-C4' energy: -107.926 flat angles P-C4'-P energy: -61.626 tors. eta vs tors. theta energy: -129.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -1397.870627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1397.870627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1397.870627 (E_RNA) where: Base-Base interactions energy: -939.276 where: short stacking energy: -393.763 Base-Backbone interact. energy: -3.074 local terms energy: -455.520838 where: bonds (distance) C4'-P energy: -84.505 bonds (distance) P-C4' energy: -95.065 flat angles C4'-P-C4' energy: -103.163 flat angles P-C4'-P energy: -63.921 tors. eta vs tors. theta energy: -108.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -1294.503205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1294.503205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1294.503205 (E_RNA) where: Base-Base interactions energy: -826.338 where: short stacking energy: -394.067 Base-Backbone interact. energy: -1.468 local terms energy: -466.696776 where: bonds (distance) C4'-P energy: -97.040 bonds (distance) P-C4' energy: -92.606 flat angles C4'-P-C4' energy: -102.497 flat angles P-C4'-P energy: -68.931 tors. eta vs tors. theta energy: -105.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -1154.037304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1154.037304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1154.037304 (E_RNA) where: Base-Base interactions energy: -706.047 where: short stacking energy: -319.989 Base-Backbone interact. energy: -1.889 local terms energy: -446.101830 where: bonds (distance) C4'-P energy: -101.222 bonds (distance) P-C4' energy: -96.091 flat angles C4'-P-C4' energy: -103.733 flat angles P-C4'-P energy: -60.859 tors. eta vs tors. theta energy: -84.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -1022.914113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1022.914113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1022.914113 (E_RNA) where: Base-Base interactions energy: -639.798 where: short stacking energy: -328.951 Base-Backbone interact. energy: 1.847 local terms energy: -384.963320 where: bonds (distance) C4'-P energy: -76.386 bonds (distance) P-C4' energy: -94.716 flat angles C4'-P-C4' energy: -85.063 flat angles P-C4'-P energy: -54.387 tors. eta vs tors. theta energy: -74.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -934.090563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -934.090563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -934.090563 (E_RNA) where: Base-Base interactions energy: -568.201 where: short stacking energy: -277.107 Base-Backbone interact. energy: -3.636 local terms energy: -362.253535 where: bonds (distance) C4'-P energy: -82.850 bonds (distance) P-C4' energy: -84.470 flat angles C4'-P-C4' energy: -81.893 flat angles P-C4'-P energy: -48.466 tors. eta vs tors. theta energy: -64.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -849.143290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.143290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.143290 (E_RNA) where: Base-Base interactions energy: -505.974 where: short stacking energy: -237.596 Base-Backbone interact. energy: 4.055 local terms energy: -347.224247 where: bonds (distance) C4'-P energy: -78.962 bonds (distance) P-C4' energy: -76.626 flat angles C4'-P-C4' energy: -82.020 flat angles P-C4'-P energy: -58.162 tors. eta vs tors. theta energy: -51.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -643.986086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.986086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.986086 (E_RNA) where: Base-Base interactions energy: -347.420 where: short stacking energy: -192.489 Base-Backbone interact. energy: -1.795 local terms energy: -294.771783 where: bonds (distance) C4'-P energy: -68.717 bonds (distance) P-C4' energy: -86.943 flat angles C4'-P-C4' energy: -74.234 flat angles P-C4'-P energy: -47.874 tors. eta vs tors. theta energy: -17.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -552.209997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.209997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.209997 (E_RNA) where: Base-Base interactions energy: -289.726 where: short stacking energy: -174.016 Base-Backbone interact. energy: 4.335 local terms energy: -266.819197 where: bonds (distance) C4'-P energy: -72.973 bonds (distance) P-C4' energy: -83.860 flat angles C4'-P-C4' energy: -63.153 flat angles P-C4'-P energy: -45.710 tors. eta vs tors. theta energy: -1.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -372.921878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.921878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.921878 (E_RNA) where: Base-Base interactions energy: -134.367 where: short stacking energy: -107.640 Base-Backbone interact. energy: -1.593 local terms energy: -236.961994 where: bonds (distance) C4'-P energy: -72.261 bonds (distance) P-C4' energy: -81.430 flat angles C4'-P-C4' energy: -70.948 flat angles P-C4'-P energy: -34.391 tors. eta vs tors. theta energy: 22.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -1473.454949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1473.454949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1473.454949 (E_RNA) where: Base-Base interactions energy: -985.164 where: short stacking energy: -434.256 Base-Backbone interact. energy: -1.492 local terms energy: -486.798867 where: bonds (distance) C4'-P energy: -87.674 bonds (distance) P-C4' energy: -104.469 flat angles C4'-P-C4' energy: -110.160 flat angles P-C4'-P energy: -67.878 tors. eta vs tors. theta energy: -116.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -1387.537186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1387.537186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1387.537186 (E_RNA) where: Base-Base interactions energy: -927.199 where: short stacking energy: -403.585 Base-Backbone interact. energy: -3.745 local terms energy: -456.593182 where: bonds (distance) C4'-P energy: -75.811 bonds (distance) P-C4' energy: -94.936 flat angles C4'-P-C4' energy: -104.838 flat angles P-C4'-P energy: -69.740 tors. eta vs tors. theta energy: -111.268 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -1270.136985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1270.136985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1270.136985 (E_RNA) where: Base-Base interactions energy: -838.786 where: short stacking energy: -360.327 Base-Backbone interact. energy: 0.236 local terms energy: -431.586883 where: bonds (distance) C4'-P energy: -87.781 bonds (distance) P-C4' energy: -98.576 flat angles C4'-P-C4' energy: -95.655 flat angles P-C4'-P energy: -57.782 tors. eta vs tors. theta energy: -91.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -1204.787479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1204.787479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1204.787479 (E_RNA) where: Base-Base interactions energy: -755.691 where: short stacking energy: -384.220 Base-Backbone interact. energy: -0.933 local terms energy: -448.163835 where: bonds (distance) C4'-P energy: -98.701 bonds (distance) P-C4' energy: -88.659 flat angles C4'-P-C4' energy: -105.503 flat angles P-C4'-P energy: -52.652 tors. eta vs tors. theta energy: -102.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -1037.658213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.658213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1037.658213 (E_RNA) where: Base-Base interactions energy: -664.716 where: short stacking energy: -300.268 Base-Backbone interact. energy: -3.088 local terms energy: -369.854308 where: bonds (distance) C4'-P energy: -84.429 bonds (distance) P-C4' energy: -75.826 flat angles C4'-P-C4' energy: -94.928 flat angles P-C4'-P energy: -43.745 tors. eta vs tors. theta energy: -70.925 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -923.953229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -923.953229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.953229 (E_RNA) where: Base-Base interactions energy: -550.668 where: short stacking energy: -263.781 Base-Backbone interact. energy: -0.089 local terms energy: -373.196098 where: bonds (distance) C4'-P energy: -75.449 bonds (distance) P-C4' energy: -103.278 flat angles C4'-P-C4' energy: -86.118 flat angles P-C4'-P energy: -48.975 tors. eta vs tors. theta energy: -59.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -845.114141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.114141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.114141 (E_RNA) where: Base-Base interactions energy: -494.537 where: short stacking energy: -262.521 Base-Backbone interact. energy: 0.628 local terms energy: -351.204667 where: bonds (distance) C4'-P energy: -78.176 bonds (distance) P-C4' energy: -79.927 flat angles C4'-P-C4' energy: -93.086 flat angles P-C4'-P energy: -53.115 tors. eta vs tors. theta energy: -46.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -618.742320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.742320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.742320 (E_RNA) where: Base-Base interactions energy: -321.185 where: short stacking energy: -188.047 Base-Backbone interact. energy: 0.808 local terms energy: -298.364698 where: bonds (distance) C4'-P energy: -78.418 bonds (distance) P-C4' energy: -88.399 flat angles C4'-P-C4' energy: -74.024 flat angles P-C4'-P energy: -45.167 tors. eta vs tors. theta energy: -12.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -428.072946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -428.072946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.072946 (E_RNA) where: Base-Base interactions energy: -178.196 where: short stacking energy: -121.515 Base-Backbone interact. energy: 1.112 local terms energy: -250.989339 where: bonds (distance) C4'-P energy: -66.631 bonds (distance) P-C4' energy: -80.303 flat angles C4'-P-C4' energy: -59.713 flat angles P-C4'-P energy: -64.785 tors. eta vs tors. theta energy: 20.442 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -580.714992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.714992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.714992 (E_RNA) where: Base-Base interactions energy: -301.297 where: short stacking energy: -149.601 Base-Backbone interact. energy: -1.225 local terms energy: -278.193064 where: bonds (distance) C4'-P energy: -85.650 bonds (distance) P-C4' energy: -54.798 flat angles C4'-P-C4' energy: -80.879 flat angles P-C4'-P energy: -51.751 tors. eta vs tors. theta energy: -5.116 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -1474.731206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1474.731206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1474.731206 (E_RNA) where: Base-Base interactions energy: -991.801 where: short stacking energy: -444.059 Base-Backbone interact. energy: -2.169 local terms energy: -480.761013 where: bonds (distance) C4'-P energy: -94.884 bonds (distance) P-C4' energy: -98.121 flat angles C4'-P-C4' energy: -110.914 flat angles P-C4'-P energy: -63.430 tors. eta vs tors. theta energy: -113.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -1365.117760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.117760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1365.117760 (E_RNA) where: Base-Base interactions energy: -898.588 where: short stacking energy: -385.336 Base-Backbone interact. energy: -2.130 local terms energy: -464.399940 where: bonds (distance) C4'-P energy: -93.005 bonds (distance) P-C4' energy: -98.177 flat angles C4'-P-C4' energy: -100.061 flat angles P-C4'-P energy: -65.132 tors. eta vs tors. theta energy: -108.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -1282.558114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1282.558114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1282.558114 (E_RNA) where: Base-Base interactions energy: -826.858 where: short stacking energy: -383.082 Base-Backbone interact. energy: 0.328 local terms energy: -456.028431 where: bonds (distance) C4'-P energy: -90.413 bonds (distance) P-C4' energy: -96.858 flat angles C4'-P-C4' energy: -106.249 flat angles P-C4'-P energy: -60.668 tors. eta vs tors. theta energy: -101.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -1160.383031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1160.383031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1160.383031 (E_RNA) where: Base-Base interactions energy: -721.302 where: short stacking energy: -345.330 Base-Backbone interact. energy: -0.876 local terms energy: -438.204807 where: bonds (distance) C4'-P energy: -90.012 bonds (distance) P-C4' energy: -105.582 flat angles C4'-P-C4' energy: -92.688 flat angles P-C4'-P energy: -58.355 tors. eta vs tors. theta energy: -91.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -1009.741805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.741805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.741805 (E_RNA) where: Base-Base interactions energy: -641.347 where: short stacking energy: -313.624 Base-Backbone interact. energy: -2.432 local terms energy: -365.963090 where: bonds (distance) C4'-P energy: -80.852 bonds (distance) P-C4' energy: -74.116 flat angles C4'-P-C4' energy: -85.492 flat angles P-C4'-P energy: -51.469 tors. eta vs tors. theta energy: -74.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -876.837792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -876.837792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.837792 (E_RNA) where: Base-Base interactions energy: -529.228 where: short stacking energy: -231.778 Base-Backbone interact. energy: 0.948 local terms energy: -348.556930 where: bonds (distance) C4'-P energy: -80.296 bonds (distance) P-C4' energy: -82.457 flat angles C4'-P-C4' energy: -79.691 flat angles P-C4'-P energy: -61.178 tors. eta vs tors. theta energy: -44.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -860.459667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.459667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.459667 (E_RNA) where: Base-Base interactions energy: -544.748 where: short stacking energy: -254.280 Base-Backbone interact. energy: 3.597 local terms energy: -319.307983 where: bonds (distance) C4'-P energy: -70.534 bonds (distance) P-C4' energy: -86.663 flat angles C4'-P-C4' energy: -73.146 flat angles P-C4'-P energy: -45.292 tors. eta vs tors. theta energy: -43.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -444.928184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.928184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.928184 (E_RNA) where: Base-Base interactions energy: -183.604 where: short stacking energy: -137.161 Base-Backbone interact. energy: -1.420 local terms energy: -259.903881 where: bonds (distance) C4'-P energy: -77.638 bonds (distance) P-C4' energy: -71.754 flat angles C4'-P-C4' energy: -81.726 flat angles P-C4'-P energy: -47.946 tors. eta vs tors. theta energy: 19.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -549.722989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.722989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.722989 (E_RNA) where: Base-Base interactions energy: -275.842 where: short stacking energy: -156.085 Base-Backbone interact. energy: 1.882 local terms energy: -275.763416 where: bonds (distance) C4'-P energy: -70.158 bonds (distance) P-C4' energy: -74.585 flat angles C4'-P-C4' energy: -82.203 flat angles P-C4'-P energy: -45.675 tors. eta vs tors. theta energy: -3.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -564.834443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.834443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.834443 (E_RNA) where: Base-Base interactions energy: -287.863 where: short stacking energy: -162.072 Base-Backbone interact. energy: 0.242 local terms energy: -277.213671 where: bonds (distance) C4'-P energy: -78.487 bonds (distance) P-C4' energy: -84.965 flat angles C4'-P-C4' energy: -54.991 flat angles P-C4'-P energy: -44.103 tors. eta vs tors. theta energy: -14.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -1492.430141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1492.430141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1492.430141 (E_RNA) where: Base-Base interactions energy: -997.250 where: short stacking energy: -451.016 Base-Backbone interact. energy: -2.402 local terms energy: -492.778771 where: bonds (distance) C4'-P energy: -98.470 bonds (distance) P-C4' energy: -96.807 flat angles C4'-P-C4' energy: -111.207 flat angles P-C4'-P energy: -60.310 tors. eta vs tors. theta energy: -125.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -1397.756077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1397.756077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1397.756077 (E_RNA) where: Base-Base interactions energy: -918.885 where: short stacking energy: -408.682 Base-Backbone interact. energy: -1.635 local terms energy: -477.236402 where: bonds (distance) C4'-P energy: -97.957 bonds (distance) P-C4' energy: -105.593 flat angles C4'-P-C4' energy: -93.974 flat angles P-C4'-P energy: -66.240 tors. eta vs tors. theta energy: -113.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -1281.821459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1281.821459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1281.821459 (E_RNA) where: Base-Base interactions energy: -830.007 where: short stacking energy: -368.056 Base-Backbone interact. energy: -4.570 local terms energy: -447.245064 where: bonds (distance) C4'-P energy: -85.442 bonds (distance) P-C4' energy: -100.289 flat angles C4'-P-C4' energy: -107.990 flat angles P-C4'-P energy: -69.974 tors. eta vs tors. theta energy: -83.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -1149.721372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1149.721372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1149.721372 (E_RNA) where: Base-Base interactions energy: -733.907 where: short stacking energy: -345.167 Base-Backbone interact. energy: -1.250 local terms energy: -414.564846 where: bonds (distance) C4'-P energy: -86.856 bonds (distance) P-C4' energy: -90.967 flat angles C4'-P-C4' energy: -107.997 flat angles P-C4'-P energy: -48.944 tors. eta vs tors. theta energy: -79.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -1061.152717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.152717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.152717 (E_RNA) where: Base-Base interactions energy: -645.756 where: short stacking energy: -329.995 Base-Backbone interact. energy: -3.079 local terms energy: -412.317240 where: bonds (distance) C4'-P energy: -83.605 bonds (distance) P-C4' energy: -89.383 flat angles C4'-P-C4' energy: -93.733 flat angles P-C4'-P energy: -55.324 tors. eta vs tors. theta energy: -90.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -879.694495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.694495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.694495 (E_RNA) where: Base-Base interactions energy: -536.302 where: short stacking energy: -268.099 Base-Backbone interact. energy: 2.201 local terms energy: -345.593201 where: bonds (distance) C4'-P energy: -78.523 bonds (distance) P-C4' energy: -79.072 flat angles C4'-P-C4' energy: -84.458 flat angles P-C4'-P energy: -52.079 tors. eta vs tors. theta energy: -51.461 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -854.912194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -854.912194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -854.912194 (E_RNA) where: Base-Base interactions energy: -479.140 where: short stacking energy: -210.501 Base-Backbone interact. energy: -1.788 local terms energy: -373.984151 where: bonds (distance) C4'-P energy: -95.549 bonds (distance) P-C4' energy: -95.037 flat angles C4'-P-C4' energy: -80.184 flat angles P-C4'-P energy: -58.232 tors. eta vs tors. theta energy: -44.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -494.549463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.549463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.549463 (E_RNA) where: Base-Base interactions energy: -234.348 where: short stacking energy: -172.561 Base-Backbone interact. energy: 1.891 local terms energy: -262.093274 where: bonds (distance) C4'-P energy: -54.213 bonds (distance) P-C4' energy: -89.235 flat angles C4'-P-C4' energy: -63.996 flat angles P-C4'-P energy: -38.531 tors. eta vs tors. theta energy: -16.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -551.654086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.654086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.654086 (E_RNA) where: Base-Base interactions energy: -290.331 where: short stacking energy: -154.339 Base-Backbone interact. energy: -1.315 local terms energy: -260.008179 where: bonds (distance) C4'-P energy: -79.478 bonds (distance) P-C4' energy: -73.309 flat angles C4'-P-C4' energy: -66.641 flat angles P-C4'-P energy: -39.662 tors. eta vs tors. theta energy: -0.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -518.501605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.501605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.501605 (E_RNA) where: Base-Base interactions energy: -236.429 where: short stacking energy: -140.962 Base-Backbone interact. energy: 2.099 local terms energy: -284.171463 where: bonds (distance) C4'-P energy: -82.214 bonds (distance) P-C4' energy: -93.076 flat angles C4'-P-C4' energy: -59.726 flat angles P-C4'-P energy: -50.152 tors. eta vs tors. theta energy: 0.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -1457.372699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1457.372699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.372699 (E_RNA) where: Base-Base interactions energy: -967.168 where: short stacking energy: -427.684 Base-Backbone interact. energy: 0.048 local terms energy: -490.252234 where: bonds (distance) C4'-P energy: -103.083 bonds (distance) P-C4' energy: -101.984 flat angles C4'-P-C4' energy: -104.571 flat angles P-C4'-P energy: -65.075 tors. eta vs tors. theta energy: -115.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -1325.018260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1325.018260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1325.018260 (E_RNA) where: Base-Base interactions energy: -894.162 where: short stacking energy: -406.480 Base-Backbone interact. energy: -3.856 local terms energy: -427.000577 where: bonds (distance) C4'-P energy: -94.941 bonds (distance) P-C4' energy: -74.120 flat angles C4'-P-C4' energy: -84.491 flat angles P-C4'-P energy: -64.474 tors. eta vs tors. theta energy: -108.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -1294.576168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1294.576168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1294.576168 (E_RNA) where: Base-Base interactions energy: -850.964 where: short stacking energy: -394.331 Base-Backbone interact. energy: -1.435 local terms energy: -442.177209 where: bonds (distance) C4'-P energy: -99.898 bonds (distance) P-C4' energy: -86.846 flat angles C4'-P-C4' energy: -87.070 flat angles P-C4'-P energy: -61.729 tors. eta vs tors. theta energy: -106.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -1155.702409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1155.702409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1155.702409 (E_RNA) where: Base-Base interactions energy: -719.613 where: short stacking energy: -347.381 Base-Backbone interact. energy: -1.953 local terms energy: -434.135914 where: bonds (distance) C4'-P energy: -82.637 bonds (distance) P-C4' energy: -92.357 flat angles C4'-P-C4' energy: -110.112 flat angles P-C4'-P energy: -58.834 tors. eta vs tors. theta energy: -90.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -1074.818340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1074.818340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1074.818340 (E_RNA) where: Base-Base interactions energy: -690.333 where: short stacking energy: -301.086 Base-Backbone interact. energy: 3.254 local terms energy: -387.738907 where: bonds (distance) C4'-P energy: -84.601 bonds (distance) P-C4' energy: -86.089 flat angles C4'-P-C4' energy: -81.958 flat angles P-C4'-P energy: -71.111 tors. eta vs tors. theta energy: -63.979 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -911.720773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -911.720773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.720773 (E_RNA) where: Base-Base interactions energy: -559.283 where: short stacking energy: -272.542 Base-Backbone interact. energy: 1.611 local terms energy: -354.049321 where: bonds (distance) C4'-P energy: -96.052 bonds (distance) P-C4' energy: -72.124 flat angles C4'-P-C4' energy: -84.420 flat angles P-C4'-P energy: -52.484 tors. eta vs tors. theta energy: -48.969 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -860.055689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.055689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.055689 (E_RNA) where: Base-Base interactions energy: -488.751 where: short stacking energy: -258.470 Base-Backbone interact. energy: -0.057 local terms energy: -371.247445 where: bonds (distance) C4'-P energy: -91.072 bonds (distance) P-C4' energy: -88.009 flat angles C4'-P-C4' energy: -79.415 flat angles P-C4'-P energy: -49.351 tors. eta vs tors. theta energy: -63.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -613.281801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.281801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.281801 (E_RNA) where: Base-Base interactions energy: -301.367 where: short stacking energy: -173.816 Base-Backbone interact. energy: -1.030 local terms energy: -310.885321 where: bonds (distance) C4'-P energy: -83.259 bonds (distance) P-C4' energy: -92.246 flat angles C4'-P-C4' energy: -63.017 flat angles P-C4'-P energy: -54.270 tors. eta vs tors. theta energy: -18.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -414.719804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.719804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.719804 (E_RNA) where: Base-Base interactions energy: -156.601 where: short stacking energy: -136.176 Base-Backbone interact. energy: -1.543 local terms energy: -256.575312 where: bonds (distance) C4'-P energy: -63.441 bonds (distance) P-C4' energy: -93.592 flat angles C4'-P-C4' energy: -67.739 flat angles P-C4'-P energy: -44.796 tors. eta vs tors. theta energy: 12.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -485.042870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.042870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.042870 (E_RNA) where: Base-Base interactions energy: -220.249 where: short stacking energy: -134.209 Base-Backbone interact. energy: 6.693 local terms energy: -271.487060 where: bonds (distance) C4'-P energy: -80.962 bonds (distance) P-C4' energy: -68.291 flat angles C4'-P-C4' energy: -76.650 flat angles P-C4'-P energy: -40.385 tors. eta vs tors. theta energy: -5.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -1471.660196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1471.660196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1471.660196 (E_RNA) where: Base-Base interactions energy: -992.317 where: short stacking energy: -454.850 Base-Backbone interact. energy: -1.052 local terms energy: -478.291436 where: bonds (distance) C4'-P energy: -92.599 bonds (distance) P-C4' energy: -92.604 flat angles C4'-P-C4' energy: -101.139 flat angles P-C4'-P energy: -69.574 tors. eta vs tors. theta energy: -122.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -1376.507774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1376.507774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.507774 (E_RNA) where: Base-Base interactions energy: -900.516 where: short stacking energy: -403.018 Base-Backbone interact. energy: -2.320 local terms energy: -473.672223 where: bonds (distance) C4'-P energy: -94.886 bonds (distance) P-C4' energy: -93.601 flat angles C4'-P-C4' energy: -102.136 flat angles P-C4'-P energy: -70.043 tors. eta vs tors. theta energy: -113.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -1242.777941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1242.777941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1242.777941 (E_RNA) where: Base-Base interactions energy: -802.522 where: short stacking energy: -381.379 Base-Backbone interact. energy: -0.619 local terms energy: -439.637167 where: bonds (distance) C4'-P energy: -89.227 bonds (distance) P-C4' energy: -100.846 flat angles C4'-P-C4' energy: -103.378 flat angles P-C4'-P energy: -58.178 tors. eta vs tors. theta energy: -88.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -1180.560242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1180.560242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1180.560242 (E_RNA) where: Base-Base interactions energy: -754.100 where: short stacking energy: -337.975 Base-Backbone interact. energy: -1.529 local terms energy: -424.931123 where: bonds (distance) C4'-P energy: -88.642 bonds (distance) P-C4' energy: -91.383 flat angles C4'-P-C4' energy: -104.668 flat angles P-C4'-P energy: -62.649 tors. eta vs tors. theta energy: -77.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -1205.460565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1205.460565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1205.460565 (E_RNA) where: Base-Base interactions energy: -779.096 where: short stacking energy: -348.418 Base-Backbone interact. energy: -1.014 local terms energy: -425.351031 where: bonds (distance) C4'-P energy: -76.510 bonds (distance) P-C4' energy: -103.523 flat angles C4'-P-C4' energy: -91.480 flat angles P-C4'-P energy: -55.628 tors. eta vs tors. theta energy: -98.210 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -916.984390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -916.984390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -916.984390 (E_RNA) where: Base-Base interactions energy: -522.687 where: short stacking energy: -246.597 Base-Backbone interact. energy: 1.189 local terms energy: -395.486210 where: bonds (distance) C4'-P energy: -90.888 bonds (distance) P-C4' energy: -101.627 flat angles C4'-P-C4' energy: -91.603 flat angles P-C4'-P energy: -62.952 tors. eta vs tors. theta energy: -48.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -860.938628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.938628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.938628 (E_RNA) where: Base-Base interactions energy: -516.268 where: short stacking energy: -247.513 Base-Backbone interact. energy: -2.137 local terms energy: -342.533892 where: bonds (distance) C4'-P energy: -80.499 bonds (distance) P-C4' energy: -70.559 flat angles C4'-P-C4' energy: -80.719 flat angles P-C4'-P energy: -58.113 tors. eta vs tors. theta energy: -52.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -649.680439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.680439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.680439 (E_RNA) where: Base-Base interactions energy: -335.748 where: short stacking energy: -184.853 Base-Backbone interact. energy: 5.524 local terms energy: -319.456573 where: bonds (distance) C4'-P energy: -77.484 bonds (distance) P-C4' energy: -88.349 flat angles C4'-P-C4' energy: -80.905 flat angles P-C4'-P energy: -58.818 tors. eta vs tors. theta energy: -13.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -555.528786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.528786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.528786 (E_RNA) where: Base-Base interactions energy: -251.113 where: short stacking energy: -161.449 Base-Backbone interact. energy: -1.850 local terms energy: -302.565196 where: bonds (distance) C4'-P energy: -77.932 bonds (distance) P-C4' energy: -100.339 flat angles C4'-P-C4' energy: -76.588 flat angles P-C4'-P energy: -35.104 tors. eta vs tors. theta energy: -12.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -383.060184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.060184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.060184 (E_RNA) where: Base-Base interactions energy: -125.779 where: short stacking energy: -114.928 Base-Backbone interact. energy: 2.211 local terms energy: -259.491739 where: bonds (distance) C4'-P energy: -71.433 bonds (distance) P-C4' energy: -89.101 flat angles C4'-P-C4' energy: -72.370 flat angles P-C4'-P energy: -36.876 tors. eta vs tors. theta energy: 10.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -1446.396996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1446.396996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1446.396996 (E_RNA) where: Base-Base interactions energy: -973.849 where: short stacking energy: -423.273 Base-Backbone interact. energy: 0.515 local terms energy: -473.062711 where: bonds (distance) C4'-P energy: -87.846 bonds (distance) P-C4' energy: -93.449 flat angles C4'-P-C4' energy: -103.983 flat angles P-C4'-P energy: -66.943 tors. eta vs tors. theta energy: -120.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -1350.447904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1350.447904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1350.447904 (E_RNA) where: Base-Base interactions energy: -894.149 where: short stacking energy: -378.389 Base-Backbone interact. energy: -0.742 local terms energy: -455.557098 where: bonds (distance) C4'-P energy: -81.457 bonds (distance) P-C4' energy: -104.088 flat angles C4'-P-C4' energy: -101.051 flat angles P-C4'-P energy: -67.507 tors. eta vs tors. theta energy: -101.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -1267.617109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1267.617109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1267.617109 (E_RNA) where: Base-Base interactions energy: -844.806 where: short stacking energy: -402.013 Base-Backbone interact. energy: 3.450 local terms energy: -426.261832 where: bonds (distance) C4'-P energy: -90.989 bonds (distance) P-C4' energy: -85.332 flat angles C4'-P-C4' energy: -84.369 flat angles P-C4'-P energy: -64.205 tors. eta vs tors. theta energy: -101.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -1183.836260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1183.836260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1183.836260 (E_RNA) where: Base-Base interactions energy: -755.732 where: short stacking energy: -361.606 Base-Backbone interact. energy: -0.493 local terms energy: -427.610999 where: bonds (distance) C4'-P energy: -84.878 bonds (distance) P-C4' energy: -88.594 flat angles C4'-P-C4' energy: -87.482 flat angles P-C4'-P energy: -69.331 tors. eta vs tors. theta energy: -97.326 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -1149.050304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1149.050304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1149.050304 (E_RNA) where: Base-Base interactions energy: -742.630 where: short stacking energy: -322.173 Base-Backbone interact. energy: 0.838 local terms energy: -407.258121 where: bonds (distance) C4'-P energy: -85.577 bonds (distance) P-C4' energy: -88.958 flat angles C4'-P-C4' energy: -101.177 flat angles P-C4'-P energy: -61.412 tors. eta vs tors. theta energy: -70.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -928.364315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -928.364315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.364315 (E_RNA) where: Base-Base interactions energy: -574.841 where: short stacking energy: -284.613 Base-Backbone interact. energy: -1.948 local terms energy: -351.574723 where: bonds (distance) C4'-P energy: -79.274 bonds (distance) P-C4' energy: -77.206 flat angles C4'-P-C4' energy: -85.981 flat angles P-C4'-P energy: -49.092 tors. eta vs tors. theta energy: -60.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -809.331785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -809.331785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.331785 (E_RNA) where: Base-Base interactions energy: -478.709 where: short stacking energy: -227.092 Base-Backbone interact. energy: 4.287 local terms energy: -334.909167 where: bonds (distance) C4'-P energy: -75.016 bonds (distance) P-C4' energy: -98.245 flat angles C4'-P-C4' energy: -73.464 flat angles P-C4'-P energy: -53.436 tors. eta vs tors. theta energy: -34.748 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -689.231316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.231316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.231316 (E_RNA) where: Base-Base interactions energy: -373.299 where: short stacking energy: -185.545 Base-Backbone interact. energy: 0.751 local terms energy: -316.683934 where: bonds (distance) C4'-P energy: -79.988 bonds (distance) P-C4' energy: -92.928 flat angles C4'-P-C4' energy: -83.320 flat angles P-C4'-P energy: -31.710 tors. eta vs tors. theta energy: -28.738 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -517.027426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.027426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.027426 (E_RNA) where: Base-Base interactions energy: -232.832 where: short stacking energy: -134.596 Base-Backbone interact. energy: -2.217 local terms energy: -281.978027 where: bonds (distance) C4'-P energy: -85.504 bonds (distance) P-C4' energy: -91.994 flat angles C4'-P-C4' energy: -76.362 flat angles P-C4'-P energy: -46.969 tors. eta vs tors. theta energy: 18.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -364.220642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.220642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.220642 (E_RNA) where: Base-Base interactions energy: -130.540 where: short stacking energy: -117.754 Base-Backbone interact. energy: -1.988 local terms energy: -231.692774 where: bonds (distance) C4'-P energy: -72.608 bonds (distance) P-C4' energy: -71.103 flat angles C4'-P-C4' energy: -57.090 flat angles P-C4'-P energy: -45.919 tors. eta vs tors. theta energy: 15.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -1489.134907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.134907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.134907 (E_RNA) where: Base-Base interactions energy: -992.274 where: short stacking energy: -452.931 Base-Backbone interact. energy: -0.989 local terms energy: -495.872625 where: bonds (distance) C4'-P energy: -104.286 bonds (distance) P-C4' energy: -89.062 flat angles C4'-P-C4' energy: -107.206 flat angles P-C4'-P energy: -71.548 tors. eta vs tors. theta energy: -123.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -1388.356558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1388.356558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1388.356558 (E_RNA) where: Base-Base interactions energy: -922.401 where: short stacking energy: -390.230 Base-Backbone interact. energy: -5.216 local terms energy: -460.740056 where: bonds (distance) C4'-P energy: -92.752 bonds (distance) P-C4' energy: -94.890 flat angles C4'-P-C4' energy: -105.764 flat angles P-C4'-P energy: -52.373 tors. eta vs tors. theta energy: -114.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -1239.533114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1239.533114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1239.533114 (E_RNA) where: Base-Base interactions energy: -816.702 where: short stacking energy: -352.766 Base-Backbone interact. energy: 3.123 local terms energy: -425.954270 where: bonds (distance) C4'-P energy: -90.167 bonds (distance) P-C4' energy: -95.025 flat angles C4'-P-C4' energy: -93.032 flat angles P-C4'-P energy: -56.806 tors. eta vs tors. theta energy: -90.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -1178.857524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1178.857524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1178.857524 (E_RNA) where: Base-Base interactions energy: -767.263 where: short stacking energy: -355.293 Base-Backbone interact. energy: -2.523 local terms energy: -409.071977 where: bonds (distance) C4'-P energy: -74.873 bonds (distance) P-C4' energy: -88.816 flat angles C4'-P-C4' energy: -96.118 flat angles P-C4'-P energy: -64.650 tors. eta vs tors. theta energy: -84.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -1085.045068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.045068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1085.045068 (E_RNA) where: Base-Base interactions energy: -687.813 where: short stacking energy: -316.410 Base-Backbone interact. energy: -2.413 local terms energy: -394.818795 where: bonds (distance) C4'-P energy: -77.431 bonds (distance) P-C4' energy: -77.084 flat angles C4'-P-C4' energy: -102.090 flat angles P-C4'-P energy: -64.515 tors. eta vs tors. theta energy: -73.700 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -902.618627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -902.618627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -902.618627 (E_RNA) where: Base-Base interactions energy: -550.986 where: short stacking energy: -270.941 Base-Backbone interact. energy: 0.303 local terms energy: -351.935128 where: bonds (distance) C4'-P energy: -85.422 bonds (distance) P-C4' energy: -80.503 flat angles C4'-P-C4' energy: -76.404 flat angles P-C4'-P energy: -55.699 tors. eta vs tors. theta energy: -53.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -847.573591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -847.573591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -847.573591 (E_RNA) where: Base-Base interactions energy: -472.155 where: short stacking energy: -240.106 Base-Backbone interact. energy: -1.689 local terms energy: -373.729347 where: bonds (distance) C4'-P energy: -88.840 bonds (distance) P-C4' energy: -90.589 flat angles C4'-P-C4' energy: -91.647 flat angles P-C4'-P energy: -58.926 tors. eta vs tors. theta energy: -43.728 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -677.266638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.266638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.266638 (E_RNA) where: Base-Base interactions energy: -333.693 where: short stacking energy: -189.552 Base-Backbone interact. energy: -0.339 local terms energy: -343.235409 where: bonds (distance) C4'-P energy: -98.358 bonds (distance) P-C4' energy: -96.723 flat angles C4'-P-C4' energy: -75.328 flat angles P-C4'-P energy: -49.118 tors. eta vs tors. theta energy: -23.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -498.581065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.581065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.581065 (E_RNA) where: Base-Base interactions energy: -197.921 where: short stacking energy: -135.146 Base-Backbone interact. energy: -2.750 local terms energy: -297.909760 where: bonds (distance) C4'-P energy: -87.976 bonds (distance) P-C4' energy: -90.324 flat angles C4'-P-C4' energy: -81.762 flat angles P-C4'-P energy: -50.251 tors. eta vs tors. theta energy: 12.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -395.053331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.053331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.053331 (E_RNA) where: Base-Base interactions energy: -151.182 where: short stacking energy: -122.330 Base-Backbone interact. energy: 0.566 local terms energy: -244.437021 where: bonds (distance) C4'-P energy: -62.068 bonds (distance) P-C4' energy: -80.152 flat angles C4'-P-C4' energy: -88.911 flat angles P-C4'-P energy: -38.555 tors. eta vs tors. theta energy: 25.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -1440.054001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1440.054001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1440.054001 (E_RNA) where: Base-Base interactions energy: -957.293 where: short stacking energy: -426.942 Base-Backbone interact. energy: -0.658 local terms energy: -482.103234 where: bonds (distance) C4'-P energy: -95.201 bonds (distance) P-C4' energy: -90.981 flat angles C4'-P-C4' energy: -107.196 flat angles P-C4'-P energy: -73.068 tors. eta vs tors. theta energy: -115.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -1382.229579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1382.229579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1382.229579 (E_RNA) where: Base-Base interactions energy: -919.920 where: short stacking energy: -408.347 Base-Backbone interact. energy: -4.253 local terms energy: -458.056425 where: bonds (distance) C4'-P energy: -87.608 bonds (distance) P-C4' energy: -98.986 flat angles C4'-P-C4' energy: -99.057 flat angles P-C4'-P energy: -60.625 tors. eta vs tors. theta energy: -111.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -1220.596370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1220.596370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1220.596370 (E_RNA) where: Base-Base interactions energy: -798.674 where: short stacking energy: -352.187 Base-Backbone interact. energy: 1.013 local terms energy: -422.935924 where: bonds (distance) C4'-P energy: -91.719 bonds (distance) P-C4' energy: -93.963 flat angles C4'-P-C4' energy: -92.488 flat angles P-C4'-P energy: -48.475 tors. eta vs tors. theta energy: -96.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -1214.213281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1214.213281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1214.213281 (E_RNA) where: Base-Base interactions energy: -786.786 where: short stacking energy: -393.496 Base-Backbone interact. energy: -1.970 local terms energy: -425.456940 where: bonds (distance) C4'-P energy: -83.453 bonds (distance) P-C4' energy: -98.069 flat angles C4'-P-C4' energy: -90.111 flat angles P-C4'-P energy: -47.493 tors. eta vs tors. theta energy: -106.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -1068.515372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.515372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1068.515372 (E_RNA) where: Base-Base interactions energy: -676.543 where: short stacking energy: -340.559 Base-Backbone interact. energy: -2.139 local terms energy: -389.833092 where: bonds (distance) C4'-P energy: -83.909 bonds (distance) P-C4' energy: -82.128 flat angles C4'-P-C4' energy: -89.810 flat angles P-C4'-P energy: -48.678 tors. eta vs tors. theta energy: -85.307 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -875.549929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.549929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -875.549929 (E_RNA) where: Base-Base interactions energy: -535.286 where: short stacking energy: -255.553 Base-Backbone interact. energy: -1.514 local terms energy: -338.749552 where: bonds (distance) C4'-P energy: -82.782 bonds (distance) P-C4' energy: -94.386 flat angles C4'-P-C4' energy: -74.516 flat angles P-C4'-P energy: -36.981 tors. eta vs tors. theta energy: -50.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -863.512225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -863.512225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -863.512225 (E_RNA) where: Base-Base interactions energy: -510.475 where: short stacking energy: -269.501 Base-Backbone interact. energy: -0.510 local terms energy: -352.527418 where: bonds (distance) C4'-P energy: -83.592 bonds (distance) P-C4' energy: -93.211 flat angles C4'-P-C4' energy: -78.295 flat angles P-C4'-P energy: -55.574 tors. eta vs tors. theta energy: -41.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -706.030683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.030683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.030683 (E_RNA) where: Base-Base interactions energy: -383.786 where: short stacking energy: -202.229 Base-Backbone interact. energy: -0.673 local terms energy: -321.571674 where: bonds (distance) C4'-P energy: -81.586 bonds (distance) P-C4' energy: -87.073 flat angles C4'-P-C4' energy: -81.082 flat angles P-C4'-P energy: -50.494 tors. eta vs tors. theta energy: -21.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -523.924742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.924742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.924742 (E_RNA) where: Base-Base interactions energy: -251.221 where: short stacking energy: -136.180 Base-Backbone interact. energy: -1.738 local terms energy: -270.965466 where: bonds (distance) C4'-P energy: -72.311 bonds (distance) P-C4' energy: -78.633 flat angles C4'-P-C4' energy: -75.281 flat angles P-C4'-P energy: -35.560 tors. eta vs tors. theta energy: -9.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -376.109717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.109717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.109717 (E_RNA) where: Base-Base interactions energy: -126.872 where: short stacking energy: -121.540 Base-Backbone interact. energy: 1.427 local terms energy: -250.664941 where: bonds (distance) C4'-P energy: -86.028 bonds (distance) P-C4' energy: -81.398 flat angles C4'-P-C4' energy: -57.431 flat angles P-C4'-P energy: -36.780 tors. eta vs tors. theta energy: 10.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -1435.106872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.106872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1435.106872 (E_RNA) where: Base-Base interactions energy: -956.975 where: short stacking energy: -416.911 Base-Backbone interact. energy: -3.411 local terms energy: -474.720359 where: bonds (distance) C4'-P energy: -101.277 bonds (distance) P-C4' energy: -97.709 flat angles C4'-P-C4' energy: -100.401 flat angles P-C4'-P energy: -60.760 tors. eta vs tors. theta energy: -114.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -1390.544457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1390.544457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1390.544457 (E_RNA) where: Base-Base interactions energy: -919.690 where: short stacking energy: -417.605 Base-Backbone interact. energy: -0.869 local terms energy: -469.985345 where: bonds (distance) C4'-P energy: -90.332 bonds (distance) P-C4' energy: -94.172 flat angles C4'-P-C4' energy: -108.767 flat angles P-C4'-P energy: -62.108 tors. eta vs tors. theta energy: -114.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -1232.442526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1232.442526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1232.442526 (E_RNA) where: Base-Base interactions energy: -802.784 where: short stacking energy: -349.775 Base-Backbone interact. energy: -0.292 local terms energy: -429.366522 where: bonds (distance) C4'-P energy: -94.966 bonds (distance) P-C4' energy: -97.464 flat angles C4'-P-C4' energy: -80.639 flat angles P-C4'-P energy: -66.676 tors. eta vs tors. theta energy: -89.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -1187.267429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1187.267429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1187.267429 (E_RNA) where: Base-Base interactions energy: -775.041 where: short stacking energy: -353.755 Base-Backbone interact. energy: -2.992 local terms energy: -409.234243 where: bonds (distance) C4'-P energy: -90.407 bonds (distance) P-C4' energy: -88.490 flat angles C4'-P-C4' energy: -89.007 flat angles P-C4'-P energy: -52.889 tors. eta vs tors. theta energy: -88.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -1057.189252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.189252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1057.189252 (E_RNA) where: Base-Base interactions energy: -692.862 where: short stacking energy: -297.438 Base-Backbone interact. energy: 4.344 local terms energy: -368.671963 where: bonds (distance) C4'-P energy: -79.028 bonds (distance) P-C4' energy: -94.693 flat angles C4'-P-C4' energy: -72.088 flat angles P-C4'-P energy: -49.613 tors. eta vs tors. theta energy: -73.250 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -917.295043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -917.295043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -917.295043 (E_RNA) where: Base-Base interactions energy: -554.922 where: short stacking energy: -256.800 Base-Backbone interact. energy: -0.075 local terms energy: -362.298399 where: bonds (distance) C4'-P energy: -90.574 bonds (distance) P-C4' energy: -82.014 flat angles C4'-P-C4' energy: -84.800 flat angles P-C4'-P energy: -51.291 tors. eta vs tors. theta energy: -53.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -885.641695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -885.641695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.641695 (E_RNA) where: Base-Base interactions energy: -546.996 where: short stacking energy: -283.760 Base-Backbone interact. energy: -1.221 local terms energy: -337.424103 where: bonds (distance) C4'-P energy: -69.523 bonds (distance) P-C4' energy: -87.440 flat angles C4'-P-C4' energy: -83.846 flat angles P-C4'-P energy: -51.330 tors. eta vs tors. theta energy: -45.284 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -723.124734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -723.124734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.124734 (E_RNA) where: Base-Base interactions energy: -418.439 where: short stacking energy: -230.575 Base-Backbone interact. energy: -0.805 local terms energy: -303.881101 where: bonds (distance) C4'-P energy: -62.118 bonds (distance) P-C4' energy: -93.551 flat angles C4'-P-C4' energy: -78.879 flat angles P-C4'-P energy: -52.485 tors. eta vs tors. theta energy: -16.848 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -556.600452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.600452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.600452 (E_RNA) where: Base-Base interactions energy: -266.692 where: short stacking energy: -147.795 Base-Backbone interact. energy: -1.273 local terms energy: -288.635084 where: bonds (distance) C4'-P energy: -75.551 bonds (distance) P-C4' energy: -81.033 flat angles C4'-P-C4' energy: -79.917 flat angles P-C4'-P energy: -58.271 tors. eta vs tors. theta energy: 6.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -392.449271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.449271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.449271 (E_RNA) where: Base-Base interactions energy: -150.898 where: short stacking energy: -134.426 Base-Backbone interact. energy: 1.158 local terms energy: -242.708646 where: bonds (distance) C4'-P energy: -69.441 bonds (distance) P-C4' energy: -76.936 flat angles C4'-P-C4' energy: -77.525 flat angles P-C4'-P energy: -30.163 tors. eta vs tors. theta energy: 11.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -1462.660914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1462.660914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1462.660914 (E_RNA) where: Base-Base interactions energy: -965.232 where: short stacking energy: -430.511 Base-Backbone interact. energy: -5.245 local terms energy: -492.184126 where: bonds (distance) C4'-P energy: -104.384 bonds (distance) P-C4' energy: -96.217 flat angles C4'-P-C4' energy: -112.346 flat angles P-C4'-P energy: -66.104 tors. eta vs tors. theta energy: -113.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -1384.062338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1384.062338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1384.062338 (E_RNA) where: Base-Base interactions energy: -922.462 where: short stacking energy: -414.148 Base-Backbone interact. energy: -1.539 local terms energy: -460.061363 where: bonds (distance) C4'-P energy: -86.301 bonds (distance) P-C4' energy: -98.864 flat angles C4'-P-C4' energy: -99.261 flat angles P-C4'-P energy: -60.600 tors. eta vs tors. theta energy: -115.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -1232.626752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1232.626752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1232.626752 (E_RNA) where: Base-Base interactions energy: -802.744 where: short stacking energy: -367.019 Base-Backbone interact. energy: 0.162 local terms energy: -430.044755 where: bonds (distance) C4'-P energy: -91.915 bonds (distance) P-C4' energy: -97.079 flat angles C4'-P-C4' energy: -95.324 flat angles P-C4'-P energy: -54.440 tors. eta vs tors. theta energy: -91.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -1149.773651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1149.773651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1149.773651 (E_RNA) where: Base-Base interactions energy: -752.916 where: short stacking energy: -319.792 Base-Backbone interact. energy: -3.703 local terms energy: -393.154794 where: bonds (distance) C4'-P energy: -72.551 bonds (distance) P-C4' energy: -93.369 flat angles C4'-P-C4' energy: -84.646 flat angles P-C4'-P energy: -56.638 tors. eta vs tors. theta energy: -85.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -1067.302621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.302621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1067.302621 (E_RNA) where: Base-Base interactions energy: -687.574 where: short stacking energy: -330.024 Base-Backbone interact. energy: 4.080 local terms energy: -383.809002 where: bonds (distance) C4'-P energy: -98.748 bonds (distance) P-C4' energy: -86.926 flat angles C4'-P-C4' energy: -78.546 flat angles P-C4'-P energy: -45.035 tors. eta vs tors. theta energy: -74.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -925.960469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -925.960469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -925.960469 (E_RNA) where: Base-Base interactions energy: -542.887 where: short stacking energy: -264.162 Base-Backbone interact. energy: -2.734 local terms energy: -380.339663 where: bonds (distance) C4'-P energy: -88.774 bonds (distance) P-C4' energy: -98.046 flat angles C4'-P-C4' energy: -87.282 flat angles P-C4'-P energy: -49.535 tors. eta vs tors. theta energy: -56.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -894.441899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.441899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -894.441899 (E_RNA) where: Base-Base interactions energy: -540.579 where: short stacking energy: -232.308 Base-Backbone interact. energy: -3.113 local terms energy: -350.749163 where: bonds (distance) C4'-P energy: -88.661 bonds (distance) P-C4' energy: -80.086 flat angles C4'-P-C4' energy: -76.987 flat angles P-C4'-P energy: -56.296 tors. eta vs tors. theta energy: -48.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -703.832235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.832235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.832235 (E_RNA) where: Base-Base interactions energy: -383.162 where: short stacking energy: -206.708 Base-Backbone interact. energy: 0.172 local terms energy: -320.842352 where: bonds (distance) C4'-P energy: -81.152 bonds (distance) P-C4' energy: -89.285 flat angles C4'-P-C4' energy: -82.796 flat angles P-C4'-P energy: -38.988 tors. eta vs tors. theta energy: -28.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -580.142558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.142558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.142558 (E_RNA) where: Base-Base interactions energy: -290.446 where: short stacking energy: -160.273 Base-Backbone interact. energy: -1.292 local terms energy: -288.404963 where: bonds (distance) C4'-P energy: -71.735 bonds (distance) P-C4' energy: -70.893 flat angles C4'-P-C4' energy: -81.354 flat angles P-C4'-P energy: -47.973 tors. eta vs tors. theta energy: -16.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -374.414019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.414019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.414019 (E_RNA) where: Base-Base interactions energy: -125.649 where: short stacking energy: -117.885 Base-Backbone interact. energy: -0.050 local terms energy: -248.714369 where: bonds (distance) C4'-P energy: -78.033 bonds (distance) P-C4' energy: -83.590 flat angles C4'-P-C4' energy: -73.192 flat angles P-C4'-P energy: -27.917 tors. eta vs tors. theta energy: 14.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -1463.082424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1463.082424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.082424 (E_RNA) where: Base-Base interactions energy: -991.180 where: short stacking energy: -430.411 Base-Backbone interact. energy: -3.923 local terms energy: -467.979585 where: bonds (distance) C4'-P energy: -90.273 bonds (distance) P-C4' energy: -94.173 flat angles C4'-P-C4' energy: -99.106 flat angles P-C4'-P energy: -56.453 tors. eta vs tors. theta energy: -127.976 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -1398.221850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1398.221850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1398.221850 (E_RNA) where: Base-Base interactions energy: -949.873 where: short stacking energy: -421.175 Base-Backbone interact. energy: -3.335 local terms energy: -445.013406 where: bonds (distance) C4'-P energy: -96.118 bonds (distance) P-C4' energy: -85.273 flat angles C4'-P-C4' energy: -106.846 flat angles P-C4'-P energy: -53.475 tors. eta vs tors. theta energy: -103.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -1240.766763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1240.766763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1240.766763 (E_RNA) where: Base-Base interactions energy: -804.461 where: short stacking energy: -359.034 Base-Backbone interact. energy: -3.086 local terms energy: -433.220224 where: bonds (distance) C4'-P energy: -87.277 bonds (distance) P-C4' energy: -107.406 flat angles C4'-P-C4' energy: -83.203 flat angles P-C4'-P energy: -57.308 tors. eta vs tors. theta energy: -98.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -1194.825845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1194.825845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1194.825845 (E_RNA) where: Base-Base interactions energy: -761.847 where: short stacking energy: -357.472 Base-Backbone interact. energy: -1.023 local terms energy: -431.955482 where: bonds (distance) C4'-P energy: -84.933 bonds (distance) P-C4' energy: -91.883 flat angles C4'-P-C4' energy: -92.544 flat angles P-C4'-P energy: -68.069 tors. eta vs tors. theta energy: -94.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -1093.042062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1093.042062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1093.042062 (E_RNA) where: Base-Base interactions energy: -687.623 where: short stacking energy: -330.841 Base-Backbone interact. energy: -2.337 local terms energy: -403.082652 where: bonds (distance) C4'-P energy: -95.322 bonds (distance) P-C4' energy: -77.010 flat angles C4'-P-C4' energy: -86.428 flat angles P-C4'-P energy: -58.799 tors. eta vs tors. theta energy: -85.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -953.159060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -953.159060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.159060 (E_RNA) where: Base-Base interactions energy: -575.163 where: short stacking energy: -300.737 Base-Backbone interact. energy: -3.153 local terms energy: -374.843121 where: bonds (distance) C4'-P energy: -81.396 bonds (distance) P-C4' energy: -67.773 flat angles C4'-P-C4' energy: -92.525 flat angles P-C4'-P energy: -56.304 tors. eta vs tors. theta energy: -76.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -892.875210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -892.875210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -892.875210 (E_RNA) where: Base-Base interactions energy: -551.763 where: short stacking energy: -247.471 Base-Backbone interact. energy: 2.975 local terms energy: -344.087453 where: bonds (distance) C4'-P energy: -91.205 bonds (distance) P-C4' energy: -83.431 flat angles C4'-P-C4' energy: -86.991 flat angles P-C4'-P energy: -40.462 tors. eta vs tors. theta energy: -41.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -731.891536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.891536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.891536 (E_RNA) where: Base-Base interactions energy: -399.322 where: short stacking energy: -187.839 Base-Backbone interact. energy: 0.352 local terms energy: -332.920831 where: bonds (distance) C4'-P energy: -95.375 bonds (distance) P-C4' energy: -93.308 flat angles C4'-P-C4' energy: -74.227 flat angles P-C4'-P energy: -45.040 tors. eta vs tors. theta energy: -24.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -526.153392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.153392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.153392 (E_RNA) where: Base-Base interactions energy: -241.994 where: short stacking energy: -133.457 Base-Backbone interact. energy: -0.119 local terms energy: -284.040223 where: bonds (distance) C4'-P energy: -63.915 bonds (distance) P-C4' energy: -100.596 flat angles C4'-P-C4' energy: -83.570 flat angles P-C4'-P energy: -52.159 tors. eta vs tors. theta energy: 16.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -385.411452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.411452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.411452 (E_RNA) where: Base-Base interactions energy: -126.140 where: short stacking energy: -102.275 Base-Backbone interact. energy: -0.256 local terms energy: -259.015602 where: bonds (distance) C4'-P energy: -76.885 bonds (distance) P-C4' energy: -87.285 flat angles C4'-P-C4' energy: -77.972 flat angles P-C4'-P energy: -30.732 tors. eta vs tors. theta energy: 13.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -1428.120700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1428.120700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1428.120700 (E_RNA) where: Base-Base interactions energy: -934.386 where: short stacking energy: -418.356 Base-Backbone interact. energy: -4.294 local terms energy: -489.441330 where: bonds (distance) C4'-P energy: -99.960 bonds (distance) P-C4' energy: -92.313 flat angles C4'-P-C4' energy: -112.064 flat angles P-C4'-P energy: -68.796 tors. eta vs tors. theta energy: -116.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -1422.940380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1422.940380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1422.940380 (E_RNA) where: Base-Base interactions energy: -935.312 where: short stacking energy: -426.568 Base-Backbone interact. energy: -2.777 local terms energy: -484.851210 where: bonds (distance) C4'-P energy: -91.097 bonds (distance) P-C4' energy: -105.962 flat angles C4'-P-C4' energy: -103.928 flat angles P-C4'-P energy: -69.850 tors. eta vs tors. theta energy: -114.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -1258.132227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1258.132227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1258.132227 (E_RNA) where: Base-Base interactions energy: -823.839 where: short stacking energy: -357.089 Base-Backbone interact. energy: -1.449 local terms energy: -432.843568 where: bonds (distance) C4'-P energy: -83.874 bonds (distance) P-C4' energy: -85.353 flat angles C4'-P-C4' energy: -106.522 flat angles P-C4'-P energy: -62.917 tors. eta vs tors. theta energy: -94.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -1203.127498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1203.127498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1203.127498 (E_RNA) where: Base-Base interactions energy: -769.817 where: short stacking energy: -353.952 Base-Backbone interact. energy: 3.517 local terms energy: -436.826862 where: bonds (distance) C4'-P energy: -94.611 bonds (distance) P-C4' energy: -90.381 flat angles C4'-P-C4' energy: -105.015 flat angles P-C4'-P energy: -57.956 tors. eta vs tors. theta energy: -88.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -1084.435009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1084.435009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1084.435009 (E_RNA) where: Base-Base interactions energy: -681.649 where: short stacking energy: -327.721 Base-Backbone interact. energy: 0.018 local terms energy: -402.803451 where: bonds (distance) C4'-P energy: -88.707 bonds (distance) P-C4' energy: -93.312 flat angles C4'-P-C4' energy: -91.071 flat angles P-C4'-P energy: -52.617 tors. eta vs tors. theta energy: -77.097 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -964.903715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.903715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.903715 (E_RNA) where: Base-Base interactions energy: -572.761 where: short stacking energy: -299.024 Base-Backbone interact. energy: -0.434 local terms energy: -391.708276 where: bonds (distance) C4'-P energy: -77.334 bonds (distance) P-C4' energy: -90.096 flat angles C4'-P-C4' energy: -96.597 flat angles P-C4'-P energy: -60.628 tors. eta vs tors. theta energy: -67.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -937.350638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.350638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.350638 (E_RNA) where: Base-Base interactions energy: -567.255 where: short stacking energy: -285.961 Base-Backbone interact. energy: 1.438 local terms energy: -371.533688 where: bonds (distance) C4'-P energy: -94.509 bonds (distance) P-C4' energy: -78.434 flat angles C4'-P-C4' energy: -86.763 flat angles P-C4'-P energy: -60.220 tors. eta vs tors. theta energy: -51.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -691.666514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.666514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.666514 (E_RNA) where: Base-Base interactions energy: -396.642 where: short stacking energy: -186.187 Base-Backbone interact. energy: 1.760 local terms energy: -296.784616 where: bonds (distance) C4'-P energy: -79.105 bonds (distance) P-C4' energy: -81.225 flat angles C4'-P-C4' energy: -87.314 flat angles P-C4'-P energy: -34.973 tors. eta vs tors. theta energy: -14.167 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -510.495433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.495433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.495433 (E_RNA) where: Base-Base interactions energy: -231.530 where: short stacking energy: -131.891 Base-Backbone interact. energy: 2.060 local terms energy: -281.025221 where: bonds (distance) C4'-P energy: -88.658 bonds (distance) P-C4' energy: -86.827 flat angles C4'-P-C4' energy: -48.005 flat angles P-C4'-P energy: -53.697 tors. eta vs tors. theta energy: -3.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -366.083575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.083575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.083575 (E_RNA) where: Base-Base interactions energy: -137.906 where: short stacking energy: -86.228 Base-Backbone interact. energy: -0.689 local terms energy: -227.488130 where: bonds (distance) C4'-P energy: -70.155 bonds (distance) P-C4' energy: -75.238 flat angles C4'-P-C4' energy: -50.106 flat angles P-C4'-P energy: -47.107 tors. eta vs tors. theta energy: 15.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)