SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa: 1 curr_seq: _GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 102 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 515 n_atoms_counter: 515 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.........((((((.........))))))....((((((....))))))......((((((......))))))............................_ nucl1: 14, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 13, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 12, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 11, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 10, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 9, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 39, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 38, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 37, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 37, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 36, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 35, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 34, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 61, chain1: 0, <---> nucl2: 68, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 61, chainIndex_2: 0, nuclIndex_2: 68 nucl1: 60, chain1: 0, <---> nucl2: 69, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 60, chainIndex_2: 0, nuclIndex_2: 69 nucl1: 59, chain1: 0, <---> nucl2: 70, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 70 nucl1: 58, chain1: 0, <---> nucl2: 71, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 71 nucl1: 57, chain1: 0, <---> nucl2: 72, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 72 nucl1: 56, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 73 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 102.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa: 1 curr_seq: _GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 102 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 515 n_atoms_counter: 515 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.........((((((.........))))))....((((((....))))))......((((((......))))))............................_ nucl1: 14, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 13, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 12, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 11, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 10, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 9, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 39, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 38, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 37, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 37, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 36, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 35, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 34, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 61, chain1: 0, <---> nucl2: 68, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 61, chainIndex_2: 0, nuclIndex_2: 68 nucl1: 60, chain1: 0, <---> nucl2: 69, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 60, chainIndex_2: 0, nuclIndex_2: 69 nucl1: 59, chain1: 0, <---> nucl2: 70, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 70 nucl1: 58, chain1: 0, <---> nucl2: 71, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 71 nucl1: 57, chain1: 0, <---> nucl2: 72, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 72 nucl1: 56, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 73 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 102.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa: 1 curr_seq: _GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 102 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 515 n_atoms_counter: 515 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.........((((((.........))))))....((((((....))))))......((((((......))))))............................_ nucl1: 14, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 13, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 12, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 11, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 10, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 9, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 39, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 38, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 37, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 37, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 36, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 35, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 34, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 61, chain1: 0, <---> nucl2: 68, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 61, chainIndex_2: 0, nuclIndex_2: 68 nucl1: 60, chain1: 0, <---> nucl2: 69, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 60, chainIndex_2: 0, nuclIndex_2: 69 nucl1: 59, chain1: 0, <---> nucl2: 70, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 70 nucl1: 58, chain1: 0, <---> nucl2: 71, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 71 nucl1: 57, chain1: 0, <---> nucl2: 72, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 72 nucl1: 56, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 73 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 102.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa: 1 curr_seq: _GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 102 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 515 n_atoms_counter: 515 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.........((((((.........))))))....((((((....))))))......((((((......))))))............................_ nucl1: 14, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 13, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 12, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 11, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 10, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 9, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 39, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 38, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 37, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 37, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 36, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 35, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 34, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 61, chain1: 0, <---> nucl2: 68, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 61, chainIndex_2: 0, nuclIndex_2: 68 nucl1: 60, chain1: 0, <---> nucl2: 69, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 60, chainIndex_2: 0, nuclIndex_2: 69 nucl1: 59, chain1: 0, <---> nucl2: 70, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 70 nucl1: 58, chain1: 0, <---> nucl2: 71, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 71 nucl1: 57, chain1: 0, <---> nucl2: 72, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 72 nucl1: 56, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 73 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 102.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa: 1 curr_seq: _GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 102 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 515 n_atoms_counter: 515 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.........((((((.........))))))....((((((....))))))......((((((......))))))............................_ nucl1: 14, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 13, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 12, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 11, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 10, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 9, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 39, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 38, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 37, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 37, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 36, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 35, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 34, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 61, chain1: 0, <---> nucl2: 68, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 61, chainIndex_2: 0, nuclIndex_2: 68 nucl1: 60, chain1: 0, <---> nucl2: 69, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 60, chainIndex_2: 0, nuclIndex_2: 69 nucl1: 59, chain1: 0, <---> nucl2: 70, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 70 nucl1: 58, chain1: 0, <---> nucl2: 71, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 71 nucl1: 57, chain1: 0, <---> nucl2: 72, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 72 nucl1: 56, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 73 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 102.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa: 1 curr_seq: _GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 102 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 515 n_atoms_counter: 515 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.........((((((.........))))))....((((((....))))))......((((((......))))))............................_ nucl1: 14, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 13, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 12, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 11, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 10, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 9, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 39, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 38, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 37, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 37, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 36, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 35, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 34, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 61, chain1: 0, <---> nucl2: 68, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 61, chainIndex_2: 0, nuclIndex_2: 68 nucl1: 60, chain1: 0, <---> nucl2: 69, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 60, chainIndex_2: 0, nuclIndex_2: 69 nucl1: 59, chain1: 0, <---> nucl2: 70, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 70 nucl1: 58, chain1: 0, <---> nucl2: 71, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 71 nucl1: 57, chain1: 0, <---> nucl2: 72, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 72 nucl1: 56, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 73 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 102.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa: 1 curr_seq: _GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 102 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 515 n_atoms_counter: 515 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.........((((((.........))))))....((((((....))))))......((((((......))))))............................_ nucl1: 14, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 13, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 12, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 11, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 10, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 9, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 39, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 38, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 37, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 37, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 36, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 35, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 34, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 61, chain1: 0, <---> nucl2: 68, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 61, chainIndex_2: 0, nuclIndex_2: 68 nucl1: 60, chain1: 0, <---> nucl2: 69, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 60, chainIndex_2: 0, nuclIndex_2: 69 nucl1: 59, chain1: 0, <---> nucl2: 70, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 70 nucl1: 58, chain1: 0, <---> nucl2: 71, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 71 nucl1: 57, chain1: 0, <---> nucl2: 72, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 72 nucl1: 56, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 73 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 102.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa: 1 curr_seq: _GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 102 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 515 n_atoms_counter: 515 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.........((((((.........))))))....((((((....))))))......((((((......))))))............................_ nucl1: 14, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 13, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 12, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 11, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 10, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 9, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 39, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 38, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 37, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 37, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 36, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 35, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 34, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 61, chain1: 0, <---> nucl2: 68, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 61, chainIndex_2: 0, nuclIndex_2: 68 nucl1: 60, chain1: 0, <---> nucl2: 69, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 60, chainIndex_2: 0, nuclIndex_2: 69 nucl1: 59, chain1: 0, <---> nucl2: 70, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 70 nucl1: 58, chain1: 0, <---> nucl2: 71, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 71 nucl1: 57, chain1: 0, <---> nucl2: 72, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 72 nucl1: 56, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 73 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 102.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa: 1 curr_seq: _GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 102 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 515 n_atoms_counter: 515 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.........((((((.........))))))....((((((....))))))......((((((......))))))............................_ nucl1: 14, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 13, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 12, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 11, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 10, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 9, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 39, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 38, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 37, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 37, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 36, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 35, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 34, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 61, chain1: 0, <---> nucl2: 68, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 61, chainIndex_2: 0, nuclIndex_2: 68 nucl1: 60, chain1: 0, <---> nucl2: 69, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 60, chainIndex_2: 0, nuclIndex_2: 69 nucl1: 59, chain1: 0, <---> nucl2: 70, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 70 nucl1: 58, chain1: 0, <---> nucl2: 71, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 71 nucl1: 57, chain1: 0, <---> nucl2: 72, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 72 nucl1: 56, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 73 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 102.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/test-55316fe3/inputs/seq.fa: 1 curr_seq: _GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGUACCUUUGACUGGUUUCCACAUCCGGUCCAAGCACGGUUUUUACCGUGUUCGUUCGGCGGGCGUGCCCGUCGUUCUCUAAAUACGAAAAUGGAGGUAUCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 102 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 515 n_atoms_counter: 515 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.........((((((.........))))))....((((((....))))))......((((((......))))))............................_ nucl1: 14, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 13, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 12, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 11, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 10, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 9, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 39, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 38, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 37, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 37, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 36, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 35, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 34, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 61, chain1: 0, <---> nucl2: 68, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 61, chainIndex_2: 0, nuclIndex_2: 68 nucl1: 60, chain1: 0, <---> nucl2: 69, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 60, chainIndex_2: 0, nuclIndex_2: 69 nucl1: 59, chain1: 0, <---> nucl2: 70, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 70 nucl1: 58, chain1: 0, <---> nucl2: 71, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 71 nucl1: 57, chain1: 0, <---> nucl2: 72, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 72 nucl1: 56, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 73 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 102.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: 403.159013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 403.159013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.025314 (E_RNA) where: Base-Base interactions energy: -12.799 where: short stacking energy: -12.799 Base-Backbone interact. energy: -0.000 local terms energy: -397.226431 where: bonds (distance) C4'-P energy: -99.101 bonds (distance) P-C4' energy: -92.149 flat angles C4'-P-C4' energy: -74.891 flat angles P-C4'-P energy: -85.667 tors. eta vs tors. theta energy: -45.418 Dist. restrs. and SS energy: 813.184 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: 403.159013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 403.159013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.025314 (E_RNA) where: Base-Base interactions energy: -12.799 where: short stacking energy: -12.799 Base-Backbone interact. energy: -0.000 local terms energy: -397.226431 where: bonds (distance) C4'-P energy: -99.101 bonds (distance) P-C4' energy: -92.149 flat angles C4'-P-C4' energy: -74.891 flat angles P-C4'-P energy: -85.667 tors. eta vs tors. theta energy: -45.418 Dist. restrs. and SS energy: 813.184 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: 403.159013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 403.159013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.025314 (E_RNA) where: Base-Base interactions energy: -12.799 where: short stacking energy: -12.799 Base-Backbone interact. energy: -0.000 local terms energy: -397.226431 where: bonds (distance) C4'-P energy: -99.101 bonds (distance) P-C4' energy: -92.149 flat angles C4'-P-C4' energy: -74.891 flat angles P-C4'-P energy: -85.667 tors. eta vs tors. theta energy: -45.418 Dist. restrs. and SS energy: 813.184 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: 403.159013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 403.159013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.025314 (E_RNA) where: Base-Base interactions energy: -12.799 where: short stacking energy: -12.799 Base-Backbone interact. energy: -0.000 local terms energy: -397.226431 where: bonds (distance) C4'-P energy: -99.101 bonds (distance) P-C4' energy: -92.149 flat angles C4'-P-C4' energy: -74.891 flat angles P-C4'-P energy: -85.667 tors. eta vs tors. theta energy: -45.418 Dist. restrs. and SS energy: 813.184 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: 403.159013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 403.159013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.025314 (E_RNA) where: Base-Base interactions energy: -12.799 where: short stacking energy: -12.799 Base-Backbone interact. energy: -0.000 local terms energy: -397.226431 where: bonds (distance) C4'-P energy: -99.101 bonds (distance) P-C4' energy: -92.149 flat angles C4'-P-C4' energy: -74.891 flat angles P-C4'-P energy: -85.667 tors. eta vs tors. theta energy: -45.418 Dist. restrs. and SS energy: 813.184 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: 403.159013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 403.159013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.025314 (E_RNA) where: Base-Base interactions energy: -12.799 where: short stacking energy: -12.799 Base-Backbone interact. energy: -0.000 local terms energy: -397.226431 where: bonds (distance) C4'-P energy: -99.101 bonds (distance) P-C4' energy: -92.149 flat angles C4'-P-C4' energy: -74.891 flat angles P-C4'-P energy: -85.667 tors. eta vs tors. theta energy: -45.418 Dist. restrs. and SS energy: 813.184 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: 403.159013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 403.159013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.025314 (E_RNA) where: Base-Base interactions energy: -12.799 where: short stacking energy: -12.799 Base-Backbone interact. energy: -0.000 local terms energy: -397.226431 where: bonds (distance) C4'-P energy: -99.101 bonds (distance) P-C4' energy: -92.149 flat angles C4'-P-C4' energy: -74.891 flat angles P-C4'-P energy: -85.667 tors. eta vs tors. theta energy: -45.418 Dist. restrs. and SS energy: 813.184 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: 403.159013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 403.159013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.025314 (E_RNA) where: Base-Base interactions energy: -12.799 where: short stacking energy: -12.799 Base-Backbone interact. energy: -0.000 local terms energy: -397.226431 where: bonds (distance) C4'-P energy: -99.101 bonds (distance) P-C4' energy: -92.149 flat angles C4'-P-C4' energy: -74.891 flat angles P-C4'-P energy: -85.667 tors. eta vs tors. theta energy: -45.418 Dist. restrs. and SS energy: 813.184 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: 403.159013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 403.159013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.025314 (E_RNA) where: Base-Base interactions energy: -12.799 where: short stacking energy: -12.799 Base-Backbone interact. energy: -0.000 local terms energy: -397.226431 where: bonds (distance) C4'-P energy: -99.101 bonds (distance) P-C4' energy: -92.149 flat angles C4'-P-C4' energy: -74.891 flat angles P-C4'-P energy: -85.667 tors. eta vs tors. theta energy: -45.418 Dist. restrs. and SS energy: 813.184 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: 403.159013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 403.159013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.025314 (E_RNA) where: Base-Base interactions energy: -12.799 where: short stacking energy: -12.799 Base-Backbone interact. energy: -0.000 local terms energy: -397.226431 where: bonds (distance) C4'-P energy: -99.101 bonds (distance) P-C4' energy: -92.149 flat angles C4'-P-C4' energy: -74.891 flat angles P-C4'-P energy: -85.667 tors. eta vs tors. theta energy: -45.418 Dist. restrs. and SS energy: 813.184 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -653.253512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.253512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.159099 (E_RNA) where: Base-Base interactions energy: -394.578 where: short stacking energy: -202.034 Base-Backbone interact. energy: -1.026 local terms energy: -288.554693 where: bonds (distance) C4'-P energy: -67.141 bonds (distance) P-C4' energy: -62.159 flat angles C4'-P-C4' energy: -72.444 flat angles P-C4'-P energy: -39.379 tors. eta vs tors. theta energy: -47.432 Dist. restrs. and SS energy: 30.906 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -691.509207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.509207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.042319 (E_RNA) where: Base-Base interactions energy: -415.406 where: short stacking energy: -208.869 Base-Backbone interact. energy: -0.230 local terms energy: -281.406491 where: bonds (distance) C4'-P energy: -65.831 bonds (distance) P-C4' energy: -72.078 flat angles C4'-P-C4' energy: -64.193 flat angles P-C4'-P energy: -38.512 tors. eta vs tors. theta energy: -40.792 Dist. restrs. and SS energy: 5.533 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -681.226041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.226041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.600849 (E_RNA) where: Base-Base interactions energy: -398.237 where: short stacking energy: -220.824 Base-Backbone interact. energy: -1.749 local terms energy: -285.615160 where: bonds (distance) C4'-P energy: -66.372 bonds (distance) P-C4' energy: -65.148 flat angles C4'-P-C4' energy: -63.922 flat angles P-C4'-P energy: -42.508 tors. eta vs tors. theta energy: -47.666 Dist. restrs. and SS energy: 4.375 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -510.348517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.348517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.669910 (E_RNA) where: Base-Base interactions energy: -278.955 where: short stacking energy: -159.663 Base-Backbone interact. energy: -0.441 local terms energy: -247.273175 where: bonds (distance) C4'-P energy: -61.011 bonds (distance) P-C4' energy: -59.878 flat angles C4'-P-C4' energy: -67.759 flat angles P-C4'-P energy: -29.567 tors. eta vs tors. theta energy: -29.057 Dist. restrs. and SS energy: 16.321 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -597.961343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.961343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.639469 (E_RNA) where: Base-Base interactions energy: -361.705 where: short stacking energy: -180.893 Base-Backbone interact. energy: 0.760 local terms energy: -246.694659 where: bonds (distance) C4'-P energy: -53.248 bonds (distance) P-C4' energy: -57.830 flat angles C4'-P-C4' energy: -66.439 flat angles P-C4'-P energy: -41.642 tors. eta vs tors. theta energy: -27.535 Dist. restrs. and SS energy: 9.678 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -593.113168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.113168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.837168 (E_RNA) where: Base-Base interactions energy: -351.851 where: short stacking energy: -185.071 Base-Backbone interact. energy: -1.308 local terms energy: -245.678374 where: bonds (distance) C4'-P energy: -56.588 bonds (distance) P-C4' energy: -62.130 flat angles C4'-P-C4' energy: -61.204 flat angles P-C4'-P energy: -39.154 tors. eta vs tors. theta energy: -26.602 Dist. restrs. and SS energy: 5.724 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -562.928091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.928091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.300610 (E_RNA) where: Base-Base interactions energy: -335.787 where: short stacking energy: -184.071 Base-Backbone interact. energy: 0.160 local terms energy: -243.674161 where: bonds (distance) C4'-P energy: -50.285 bonds (distance) P-C4' energy: -67.113 flat angles C4'-P-C4' energy: -61.539 flat angles P-C4'-P energy: -27.038 tors. eta vs tors. theta energy: -37.699 Dist. restrs. and SS energy: 16.373 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -526.891499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.891499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.846421 (E_RNA) where: Base-Base interactions energy: -318.127 where: short stacking energy: -148.197 Base-Backbone interact. energy: -1.005 local terms energy: -219.714641 where: bonds (distance) C4'-P energy: -46.474 bonds (distance) P-C4' energy: -55.395 flat angles C4'-P-C4' energy: -55.355 flat angles P-C4'-P energy: -33.858 tors. eta vs tors. theta energy: -28.632 Dist. restrs. and SS energy: 11.955 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -436.733725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.733725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.387200 (E_RNA) where: Base-Base interactions energy: -248.400 where: short stacking energy: -124.719 Base-Backbone interact. energy: 1.267 local terms energy: -197.254489 where: bonds (distance) C4'-P energy: -57.433 bonds (distance) P-C4' energy: -46.456 flat angles C4'-P-C4' energy: -44.909 flat angles P-C4'-P energy: -31.131 tors. eta vs tors. theta energy: -17.326 Dist. restrs. and SS energy: 7.653 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -434.928344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.928344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.207523 (E_RNA) where: Base-Base interactions energy: -270.512 where: short stacking energy: -124.514 Base-Backbone interact. energy: -0.940 local terms energy: -178.755469 where: bonds (distance) C4'-P energy: -55.873 bonds (distance) P-C4' energy: -49.611 flat angles C4'-P-C4' energy: -44.055 flat angles P-C4'-P energy: -24.042 tors. eta vs tors. theta energy: -5.174 Dist. restrs. and SS energy: 15.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -740.123500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.123500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.726101 (E_RNA) where: Base-Base interactions energy: -449.319 where: short stacking energy: -240.956 Base-Backbone interact. energy: -0.052 local terms energy: -309.355801 where: bonds (distance) C4'-P energy: -70.109 bonds (distance) P-C4' energy: -61.733 flat angles C4'-P-C4' energy: -69.653 flat angles P-C4'-P energy: -47.390 tors. eta vs tors. theta energy: -60.471 Dist. restrs. and SS energy: 18.603 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -750.456914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.456914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.585866 (E_RNA) where: Base-Base interactions energy: -462.959 where: short stacking energy: -231.687 Base-Backbone interact. energy: -1.625 local terms energy: -288.001711 where: bonds (distance) C4'-P energy: -63.035 bonds (distance) P-C4' energy: -65.823 flat angles C4'-P-C4' energy: -66.521 flat angles P-C4'-P energy: -39.355 tors. eta vs tors. theta energy: -53.268 Dist. restrs. and SS energy: 2.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -760.277634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -760.277634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.634607 (E_RNA) where: Base-Base interactions energy: -480.565 where: short stacking energy: -226.568 Base-Backbone interact. energy: -1.406 local terms energy: -279.663520 where: bonds (distance) C4'-P energy: -64.118 bonds (distance) P-C4' energy: -68.682 flat angles C4'-P-C4' energy: -61.126 flat angles P-C4'-P energy: -36.460 tors. eta vs tors. theta energy: -49.278 Dist. restrs. and SS energy: 1.357 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -717.532939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.532939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.299191 (E_RNA) where: Base-Base interactions energy: -448.145 where: short stacking energy: -211.512 Base-Backbone interact. energy: -0.503 local terms energy: -274.651876 where: bonds (distance) C4'-P energy: -62.754 bonds (distance) P-C4' energy: -67.724 flat angles C4'-P-C4' energy: -62.793 flat angles P-C4'-P energy: -33.130 tors. eta vs tors. theta energy: -48.252 Dist. restrs. and SS energy: 5.766 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -498.711116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.711116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.469797 (E_RNA) where: Base-Base interactions energy: -284.775 where: short stacking energy: -147.083 Base-Backbone interact. energy: -0.077 local terms energy: -233.618166 where: bonds (distance) C4'-P energy: -54.599 bonds (distance) P-C4' energy: -57.103 flat angles C4'-P-C4' energy: -66.028 flat angles P-C4'-P energy: -34.650 tors. eta vs tors. theta energy: -21.239 Dist. restrs. and SS energy: 19.759 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -665.907995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.907995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.404014 (E_RNA) where: Base-Base interactions energy: -422.858 where: short stacking energy: -189.594 Base-Backbone interact. energy: 0.237 local terms energy: -246.783128 where: bonds (distance) C4'-P energy: -51.246 bonds (distance) P-C4' energy: -54.564 flat angles C4'-P-C4' energy: -56.647 flat angles P-C4'-P energy: -34.826 tors. eta vs tors. theta energy: -49.499 Dist. restrs. and SS energy: 3.496 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -634.655733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -634.655733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.562722 (E_RNA) where: Base-Base interactions energy: -398.422 where: short stacking energy: -179.146 Base-Backbone interact. energy: 0.191 local terms energy: -239.331503 where: bonds (distance) C4'-P energy: -53.920 bonds (distance) P-C4' energy: -53.973 flat angles C4'-P-C4' energy: -54.205 flat angles P-C4'-P energy: -24.506 tors. eta vs tors. theta energy: -52.727 Dist. restrs. and SS energy: 2.907 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -563.440773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.440773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.868427 (E_RNA) where: Base-Base interactions energy: -355.121 where: short stacking energy: -179.894 Base-Backbone interact. energy: -1.136 local terms energy: -212.610840 where: bonds (distance) C4'-P energy: -45.413 bonds (distance) P-C4' energy: -49.175 flat angles C4'-P-C4' energy: -59.347 flat angles P-C4'-P energy: -35.745 tors. eta vs tors. theta energy: -22.931 Dist. restrs. and SS energy: 5.428 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -534.683467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.683467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.513976 (E_RNA) where: Base-Base interactions energy: -323.417 where: short stacking energy: -137.717 Base-Backbone interact. energy: 0.006 local terms energy: -219.102898 where: bonds (distance) C4'-P energy: -59.388 bonds (distance) P-C4' energy: -51.987 flat angles C4'-P-C4' energy: -63.825 flat angles P-C4'-P energy: -34.472 tors. eta vs tors. theta energy: -9.430 Dist. restrs. and SS energy: 7.831 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -456.348926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.348926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.578539 (E_RNA) where: Base-Base interactions energy: -301.269 where: short stacking energy: -123.371 Base-Backbone interact. energy: 1.030 local terms energy: -164.339337 where: bonds (distance) C4'-P energy: -38.293 bonds (distance) P-C4' energy: -49.814 flat angles C4'-P-C4' energy: -38.017 flat angles P-C4'-P energy: -33.790 tors. eta vs tors. theta energy: -4.425 Dist. restrs. and SS energy: 8.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -819.726566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.726566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -821.080357 (E_RNA) where: Base-Base interactions energy: -527.964 where: short stacking energy: -248.757 Base-Backbone interact. energy: 1.531 local terms energy: -294.647805 where: bonds (distance) C4'-P energy: -61.719 bonds (distance) P-C4' energy: -66.815 flat angles C4'-P-C4' energy: -61.246 flat angles P-C4'-P energy: -46.011 tors. eta vs tors. theta energy: -58.857 Dist. restrs. and SS energy: 1.354 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -728.067964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.067964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.118475 (E_RNA) where: Base-Base interactions energy: -463.342 where: short stacking energy: -209.534 Base-Backbone interact. energy: -1.189 local terms energy: -278.587397 where: bonds (distance) C4'-P energy: -62.874 bonds (distance) P-C4' energy: -62.682 flat angles C4'-P-C4' energy: -63.224 flat angles P-C4'-P energy: -44.982 tors. eta vs tors. theta energy: -44.826 Dist. restrs. and SS energy: 15.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -813.787763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.787763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.650365 (E_RNA) where: Base-Base interactions energy: -539.742 where: short stacking energy: -238.539 Base-Backbone interact. energy: 0.815 local terms energy: -275.722912 where: bonds (distance) C4'-P energy: -53.017 bonds (distance) P-C4' energy: -64.489 flat angles C4'-P-C4' energy: -63.859 flat angles P-C4'-P energy: -40.441 tors. eta vs tors. theta energy: -53.916 Dist. restrs. and SS energy: 0.863 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -756.524677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.524677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.267081 (E_RNA) where: Base-Base interactions energy: -510.076 where: short stacking energy: -238.934 Base-Backbone interact. energy: 3.865 local terms energy: -252.056297 where: bonds (distance) C4'-P energy: -59.661 bonds (distance) P-C4' energy: -63.050 flat angles C4'-P-C4' energy: -58.133 flat angles P-C4'-P energy: -23.934 tors. eta vs tors. theta energy: -47.278 Dist. restrs. and SS energy: 1.742 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -757.454338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -757.454338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.731615 (E_RNA) where: Base-Base interactions energy: -495.961 where: short stacking energy: -238.493 Base-Backbone interact. energy: 1.406 local terms energy: -264.176772 where: bonds (distance) C4'-P energy: -57.347 bonds (distance) P-C4' energy: -56.273 flat angles C4'-P-C4' energy: -62.810 flat angles P-C4'-P energy: -34.361 tors. eta vs tors. theta energy: -53.385 Dist. restrs. and SS energy: 1.277 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -497.516815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.516815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.050920 (E_RNA) where: Base-Base interactions energy: -289.798 where: short stacking energy: -154.981 Base-Backbone interact. energy: -2.196 local terms energy: -220.057333 where: bonds (distance) C4'-P energy: -49.903 bonds (distance) P-C4' energy: -57.307 flat angles C4'-P-C4' energy: -46.946 flat angles P-C4'-P energy: -36.790 tors. eta vs tors. theta energy: -29.112 Dist. restrs. and SS energy: 14.534 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -659.028628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.028628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.086062 (E_RNA) where: Base-Base interactions energy: -413.734 where: short stacking energy: -189.945 Base-Backbone interact. energy: -1.356 local terms energy: -245.995668 where: bonds (distance) C4'-P energy: -67.560 bonds (distance) P-C4' energy: -59.661 flat angles C4'-P-C4' energy: -53.204 flat angles P-C4'-P energy: -32.890 tors. eta vs tors. theta energy: -32.680 Dist. restrs. and SS energy: 2.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -637.697974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -637.697974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -641.285956 (E_RNA) where: Base-Base interactions energy: -417.460 where: short stacking energy: -177.298 Base-Backbone interact. energy: -0.585 local terms energy: -223.241279 where: bonds (distance) C4'-P energy: -67.224 bonds (distance) P-C4' energy: -57.723 flat angles C4'-P-C4' energy: -48.093 flat angles P-C4'-P energy: -24.102 tors. eta vs tors. theta energy: -26.099 Dist. restrs. and SS energy: 3.588 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -572.868830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.868830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.803800 (E_RNA) where: Base-Base interactions energy: -366.577 where: short stacking energy: -166.281 Base-Backbone interact. energy: -1.379 local terms energy: -209.847691 where: bonds (distance) C4'-P energy: -44.229 bonds (distance) P-C4' energy: -53.766 flat angles C4'-P-C4' energy: -57.843 flat angles P-C4'-P energy: -16.255 tors. eta vs tors. theta energy: -37.755 Dist. restrs. and SS energy: 4.935 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -582.817277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.817277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.198512 (E_RNA) where: Base-Base interactions energy: -371.171 where: short stacking energy: -170.774 Base-Backbone interact. energy: -0.233 local terms energy: -214.793756 where: bonds (distance) C4'-P energy: -41.449 bonds (distance) P-C4' energy: -61.728 flat angles C4'-P-C4' energy: -49.904 flat angles P-C4'-P energy: -25.730 tors. eta vs tors. theta energy: -35.982 Dist. restrs. and SS energy: 3.381 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -848.019209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.019209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -848.281152 (E_RNA) where: Base-Base interactions energy: -541.715 where: short stacking energy: -275.257 Base-Backbone interact. energy: -0.726 local terms energy: -305.840450 where: bonds (distance) C4'-P energy: -65.438 bonds (distance) P-C4' energy: -65.646 flat angles C4'-P-C4' energy: -72.184 flat angles P-C4'-P energy: -38.477 tors. eta vs tors. theta energy: -64.095 Dist. restrs. and SS energy: 0.262 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -875.569779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.569779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.020174 (E_RNA) where: Base-Base interactions energy: -580.689 where: short stacking energy: -279.562 Base-Backbone interact. energy: -1.134 local terms energy: -294.196876 where: bonds (distance) C4'-P energy: -51.745 bonds (distance) P-C4' energy: -62.631 flat angles C4'-P-C4' energy: -69.895 flat angles P-C4'-P energy: -43.320 tors. eta vs tors. theta energy: -66.605 Dist. restrs. and SS energy: 0.450 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -722.162312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.162312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.474254 (E_RNA) where: Base-Base interactions energy: -448.831 where: short stacking energy: -225.220 Base-Backbone interact. energy: -1.720 local terms energy: -286.922776 where: bonds (distance) C4'-P energy: -69.615 bonds (distance) P-C4' energy: -64.148 flat angles C4'-P-C4' energy: -63.886 flat angles P-C4'-P energy: -41.541 tors. eta vs tors. theta energy: -47.733 Dist. restrs. and SS energy: 15.312 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -797.587795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.587795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -798.502257 (E_RNA) where: Base-Base interactions energy: -532.724 where: short stacking energy: -242.078 Base-Backbone interact. energy: 3.281 local terms energy: -269.058910 where: bonds (distance) C4'-P energy: -59.216 bonds (distance) P-C4' energy: -50.074 flat angles C4'-P-C4' energy: -67.171 flat angles P-C4'-P energy: -37.082 tors. eta vs tors. theta energy: -55.517 Dist. restrs. and SS energy: 0.914 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -758.482106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.482106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.717333 (E_RNA) where: Base-Base interactions energy: -498.031 where: short stacking energy: -232.415 Base-Backbone interact. energy: -0.968 local terms energy: -260.718367 where: bonds (distance) C4'-P energy: -57.584 bonds (distance) P-C4' energy: -57.391 flat angles C4'-P-C4' energy: -63.343 flat angles P-C4'-P energy: -40.282 tors. eta vs tors. theta energy: -42.119 Dist. restrs. and SS energy: 1.235 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -693.684171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.684171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.901190 (E_RNA) where: Base-Base interactions energy: -444.805 where: short stacking energy: -190.407 Base-Backbone interact. energy: 1.090 local terms energy: -257.185612 where: bonds (distance) C4'-P energy: -61.451 bonds (distance) P-C4' energy: -61.990 flat angles C4'-P-C4' energy: -57.777 flat angles P-C4'-P energy: -27.955 tors. eta vs tors. theta energy: -48.013 Dist. restrs. and SS energy: 7.217 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -502.941343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.941343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.022371 (E_RNA) where: Base-Base interactions energy: -303.416 where: short stacking energy: -150.713 Base-Backbone interact. energy: -0.794 local terms energy: -211.812217 where: bonds (distance) C4'-P energy: -52.354 bonds (distance) P-C4' energy: -57.844 flat angles C4'-P-C4' energy: -47.971 flat angles P-C4'-P energy: -33.699 tors. eta vs tors. theta energy: -19.944 Dist. restrs. and SS energy: 13.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -676.958225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.958225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.627750 (E_RNA) where: Base-Base interactions energy: -431.846 where: short stacking energy: -196.083 Base-Backbone interact. energy: 0.164 local terms energy: -246.945876 where: bonds (distance) C4'-P energy: -53.258 bonds (distance) P-C4' energy: -57.065 flat angles C4'-P-C4' energy: -47.742 flat angles P-C4'-P energy: -40.974 tors. eta vs tors. theta energy: -47.907 Dist. restrs. and SS energy: 1.670 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -649.483616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.483616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.380104 (E_RNA) where: Base-Base interactions energy: -437.278 where: short stacking energy: -195.052 Base-Backbone interact. energy: -0.767 local terms energy: -213.335481 where: bonds (distance) C4'-P energy: -49.128 bonds (distance) P-C4' energy: -58.251 flat angles C4'-P-C4' energy: -38.902 flat angles P-C4'-P energy: -30.281 tors. eta vs tors. theta energy: -36.774 Dist. restrs. and SS energy: 1.896 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -660.660696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.660696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.307437 (E_RNA) where: Base-Base interactions energy: -430.952 where: short stacking energy: -204.841 Base-Backbone interact. energy: -1.476 local terms energy: -232.879065 where: bonds (distance) C4'-P energy: -44.006 bonds (distance) P-C4' energy: -58.402 flat angles C4'-P-C4' energy: -53.912 flat angles P-C4'-P energy: -29.478 tors. eta vs tors. theta energy: -47.081 Dist. restrs. and SS energy: 4.647 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -972.160218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.160218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.740747 (E_RNA) where: Base-Base interactions energy: -657.191 where: short stacking energy: -285.876 Base-Backbone interact. energy: -0.308 local terms energy: -315.242317 where: bonds (distance) C4'-P energy: -60.050 bonds (distance) P-C4' energy: -61.531 flat angles C4'-P-C4' energy: -71.808 flat angles P-C4'-P energy: -54.105 tors. eta vs tors. theta energy: -67.747 Dist. restrs. and SS energy: 0.581 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -855.327662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.327662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -856.426214 (E_RNA) where: Base-Base interactions energy: -539.693 where: short stacking energy: -280.278 Base-Backbone interact. energy: -0.493 local terms energy: -316.240178 where: bonds (distance) C4'-P energy: -59.684 bonds (distance) P-C4' energy: -66.901 flat angles C4'-P-C4' energy: -68.858 flat angles P-C4'-P energy: -44.655 tors. eta vs tors. theta energy: -76.142 Dist. restrs. and SS energy: 1.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -866.994445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.994445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.796755 (E_RNA) where: Base-Base interactions energy: -559.868 where: short stacking energy: -269.172 Base-Backbone interact. energy: -0.463 local terms energy: -307.465582 where: bonds (distance) C4'-P energy: -62.098 bonds (distance) P-C4' energy: -63.888 flat angles C4'-P-C4' energy: -63.879 flat angles P-C4'-P energy: -46.049 tors. eta vs tors. theta energy: -71.552 Dist. restrs. and SS energy: 0.802 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -638.354007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.354007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.071114 (E_RNA) where: Base-Base interactions energy: -389.457 where: short stacking energy: -191.712 Base-Backbone interact. energy: -1.497 local terms energy: -261.117196 where: bonds (distance) C4'-P energy: -62.218 bonds (distance) P-C4' energy: -54.999 flat angles C4'-P-C4' energy: -60.217 flat angles P-C4'-P energy: -46.195 tors. eta vs tors. theta energy: -37.488 Dist. restrs. and SS energy: 13.717 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -782.344035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.344035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.336383 (E_RNA) where: Base-Base interactions energy: -514.086 where: short stacking energy: -237.882 Base-Backbone interact. energy: 1.602 local terms energy: -278.851951 where: bonds (distance) C4'-P energy: -62.565 bonds (distance) P-C4' energy: -56.965 flat angles C4'-P-C4' energy: -66.040 flat angles P-C4'-P energy: -36.064 tors. eta vs tors. theta energy: -57.217 Dist. restrs. and SS energy: 8.992 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -687.413285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.413285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.082568 (E_RNA) where: Base-Base interactions energy: -433.191 where: short stacking energy: -205.718 Base-Backbone interact. energy: -0.707 local terms energy: -256.183923 where: bonds (distance) C4'-P energy: -58.212 bonds (distance) P-C4' energy: -58.262 flat angles C4'-P-C4' energy: -63.132 flat angles P-C4'-P energy: -30.564 tors. eta vs tors. theta energy: -46.015 Dist. restrs. and SS energy: 2.669 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -751.947241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.947241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.445210 (E_RNA) where: Base-Base interactions energy: -486.235 where: short stacking energy: -214.470 Base-Backbone interact. energy: -0.721 local terms energy: -265.489667 where: bonds (distance) C4'-P energy: -52.753 bonds (distance) P-C4' energy: -67.779 flat angles C4'-P-C4' energy: -52.191 flat angles P-C4'-P energy: -40.349 tors. eta vs tors. theta energy: -52.418 Dist. restrs. and SS energy: 0.498 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -574.084682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.084682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.391859 (E_RNA) where: Base-Base interactions energy: -357.431 where: short stacking energy: -163.445 Base-Backbone interact. energy: -0.657 local terms energy: -221.304154 where: bonds (distance) C4'-P energy: -51.249 bonds (distance) P-C4' energy: -61.184 flat angles C4'-P-C4' energy: -46.763 flat angles P-C4'-P energy: -40.849 tors. eta vs tors. theta energy: -21.258 Dist. restrs. and SS energy: 5.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -702.098451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.098451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.983784 (E_RNA) where: Base-Base interactions energy: -465.561 where: short stacking energy: -199.825 Base-Backbone interact. energy: 0.544 local terms energy: -237.966690 where: bonds (distance) C4'-P energy: -44.410 bonds (distance) P-C4' energy: -55.662 flat angles C4'-P-C4' energy: -61.083 flat angles P-C4'-P energy: -30.633 tors. eta vs tors. theta energy: -46.178 Dist. restrs. and SS energy: 0.885 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -643.779600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.779600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.896422 (E_RNA) where: Base-Base interactions energy: -425.239 where: short stacking energy: -179.317 Base-Backbone interact. energy: -0.826 local terms energy: -219.831404 where: bonds (distance) C4'-P energy: -53.809 bonds (distance) P-C4' energy: -56.105 flat angles C4'-P-C4' energy: -52.920 flat angles P-C4'-P energy: -18.605 tors. eta vs tors. theta energy: -38.393 Dist. restrs. and SS energy: 2.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -968.290810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -968.290810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -968.597225 (E_RNA) where: Base-Base interactions energy: -663.171 where: short stacking energy: -286.069 Base-Backbone interact. energy: -0.907 local terms energy: -304.519339 where: bonds (distance) C4'-P energy: -65.984 bonds (distance) P-C4' energy: -59.958 flat angles C4'-P-C4' energy: -62.368 flat angles P-C4'-P energy: -48.490 tors. eta vs tors. theta energy: -67.719 Dist. restrs. and SS energy: 0.306 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -924.815166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -924.815166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -925.766288 (E_RNA) where: Base-Base interactions energy: -620.984 where: short stacking energy: -267.119 Base-Backbone interact. energy: -1.762 local terms energy: -303.019756 where: bonds (distance) C4'-P energy: -54.642 bonds (distance) P-C4' energy: -68.719 flat angles C4'-P-C4' energy: -59.622 flat angles P-C4'-P energy: -50.359 tors. eta vs tors. theta energy: -69.677 Dist. restrs. and SS energy: 0.951 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -821.674943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -821.674943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -822.793703 (E_RNA) where: Base-Base interactions energy: -523.231 where: short stacking energy: -257.543 Base-Backbone interact. energy: -0.174 local terms energy: -299.388366 where: bonds (distance) C4'-P energy: -58.942 bonds (distance) P-C4' energy: -62.804 flat angles C4'-P-C4' energy: -74.055 flat angles P-C4'-P energy: -39.456 tors. eta vs tors. theta energy: -64.132 Dist. restrs. and SS energy: 1.119 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -815.244101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.244101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -816.607543 (E_RNA) where: Base-Base interactions energy: -540.506 where: short stacking energy: -227.817 Base-Backbone interact. energy: -0.341 local terms energy: -275.760795 where: bonds (distance) C4'-P energy: -54.699 bonds (distance) P-C4' energy: -68.823 flat angles C4'-P-C4' energy: -70.191 flat angles P-C4'-P energy: -32.048 tors. eta vs tors. theta energy: -49.999 Dist. restrs. and SS energy: 1.363 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -691.188608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.188608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.933871 (E_RNA) where: Base-Base interactions energy: -448.414 where: short stacking energy: -200.187 Base-Backbone interact. energy: 0.670 local terms energy: -261.189607 where: bonds (distance) C4'-P energy: -49.844 bonds (distance) P-C4' energy: -66.645 flat angles C4'-P-C4' energy: -59.489 flat angles P-C4'-P energy: -41.794 tors. eta vs tors. theta energy: -43.418 Dist. restrs. and SS energy: 17.745 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -784.412249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.412249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.670336 (E_RNA) where: Base-Base interactions energy: -511.597 where: short stacking energy: -225.873 Base-Backbone interact. energy: -1.186 local terms energy: -271.887493 where: bonds (distance) C4'-P energy: -57.328 bonds (distance) P-C4' energy: -60.735 flat angles C4'-P-C4' energy: -65.821 flat angles P-C4'-P energy: -41.712 tors. eta vs tors. theta energy: -46.291 Dist. restrs. and SS energy: 0.258 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -635.430310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.430310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.700242 (E_RNA) where: Base-Base interactions energy: -399.304 where: short stacking energy: -189.941 Base-Backbone interact. energy: -0.906 local terms energy: -247.489721 where: bonds (distance) C4'-P energy: -50.135 bonds (distance) P-C4' energy: -57.213 flat angles C4'-P-C4' energy: -62.966 flat angles P-C4'-P energy: -37.519 tors. eta vs tors. theta energy: -39.657 Dist. restrs. and SS energy: 12.270 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -731.801944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.801944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.268065 (E_RNA) where: Base-Base interactions energy: -486.501 where: short stacking energy: -218.060 Base-Backbone interact. energy: -2.591 local terms energy: -243.175772 where: bonds (distance) C4'-P energy: -62.422 bonds (distance) P-C4' energy: -49.314 flat angles C4'-P-C4' energy: -58.005 flat angles P-C4'-P energy: -29.003 tors. eta vs tors. theta energy: -44.432 Dist. restrs. and SS energy: 0.466 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -595.831037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.831037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.407672 (E_RNA) where: Base-Base interactions energy: -369.415 where: short stacking energy: -158.876 Base-Backbone interact. energy: -1.193 local terms energy: -230.799606 where: bonds (distance) C4'-P energy: -54.417 bonds (distance) P-C4' energy: -53.854 flat angles C4'-P-C4' energy: -62.429 flat angles P-C4'-P energy: -26.070 tors. eta vs tors. theta energy: -34.030 Dist. restrs. and SS energy: 5.577 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -636.274967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.274967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.850196 (E_RNA) where: Base-Base interactions energy: -417.457 where: short stacking energy: -173.980 Base-Backbone interact. energy: -0.329 local terms energy: -219.064474 where: bonds (distance) C4'-P energy: -57.887 bonds (distance) P-C4' energy: -50.872 flat angles C4'-P-C4' energy: -49.401 flat angles P-C4'-P energy: -27.059 tors. eta vs tors. theta energy: -33.845 Dist. restrs. and SS energy: 0.575 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -1013.436710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1013.436710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1014.271473 (E_RNA) where: Base-Base interactions energy: -678.873 where: short stacking energy: -292.834 Base-Backbone interact. energy: -0.668 local terms energy: -334.730274 where: bonds (distance) C4'-P energy: -71.973 bonds (distance) P-C4' energy: -71.649 flat angles C4'-P-C4' energy: -65.679 flat angles P-C4'-P energy: -47.177 tors. eta vs tors. theta energy: -78.253 Dist. restrs. and SS energy: 0.835 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -935.243969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -935.243969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -935.812134 (E_RNA) where: Base-Base interactions energy: -646.103 where: short stacking energy: -274.499 Base-Backbone interact. energy: -0.124 local terms energy: -289.585914 where: bonds (distance) C4'-P energy: -57.358 bonds (distance) P-C4' energy: -59.060 flat angles C4'-P-C4' energy: -68.420 flat angles P-C4'-P energy: -42.468 tors. eta vs tors. theta energy: -62.279 Dist. restrs. and SS energy: 0.568 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -872.687656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.687656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -873.321518 (E_RNA) where: Base-Base interactions energy: -573.471 where: short stacking energy: -242.673 Base-Backbone interact. energy: -1.390 local terms energy: -298.460815 where: bonds (distance) C4'-P energy: -55.035 bonds (distance) P-C4' energy: -74.179 flat angles C4'-P-C4' energy: -69.127 flat angles P-C4'-P energy: -40.916 tors. eta vs tors. theta energy: -59.204 Dist. restrs. and SS energy: 0.634 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -829.769411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.769411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -830.981570 (E_RNA) where: Base-Base interactions energy: -556.436 where: short stacking energy: -254.654 Base-Backbone interact. energy: -0.104 local terms energy: -274.441609 where: bonds (distance) C4'-P energy: -46.486 bonds (distance) P-C4' energy: -67.401 flat angles C4'-P-C4' energy: -61.930 flat angles P-C4'-P energy: -33.096 tors. eta vs tors. theta energy: -65.529 Dist. restrs. and SS energy: 1.212 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -862.740093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.740093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -862.917646 (E_RNA) where: Base-Base interactions energy: -578.805 where: short stacking energy: -236.993 Base-Backbone interact. energy: -0.251 local terms energy: -283.861748 where: bonds (distance) C4'-P energy: -53.762 bonds (distance) P-C4' energy: -67.442 flat angles C4'-P-C4' energy: -66.738 flat angles P-C4'-P energy: -41.576 tors. eta vs tors. theta energy: -54.343 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -668.454885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.454885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.801681 (E_RNA) where: Base-Base interactions energy: -438.966 where: short stacking energy: -211.838 Base-Backbone interact. energy: -1.793 local terms energy: -244.042355 where: bonds (distance) C4'-P energy: -40.749 bonds (distance) P-C4' energy: -65.642 flat angles C4'-P-C4' energy: -57.635 flat angles P-C4'-P energy: -34.030 tors. eta vs tors. theta energy: -45.986 Dist. restrs. and SS energy: 16.347 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -772.599359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.599359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.862023 (E_RNA) where: Base-Base interactions energy: -505.165 where: short stacking energy: -217.899 Base-Backbone interact. energy: 0.440 local terms energy: -268.137381 where: bonds (distance) C4'-P energy: -57.869 bonds (distance) P-C4' energy: -70.175 flat angles C4'-P-C4' energy: -53.614 flat angles P-C4'-P energy: -38.366 tors. eta vs tors. theta energy: -48.113 Dist. restrs. and SS energy: 0.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -607.358216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.358216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.258338 (E_RNA) where: Base-Base interactions energy: -373.344 where: short stacking energy: -170.086 Base-Backbone interact. energy: -1.448 local terms energy: -238.466529 where: bonds (distance) C4'-P energy: -55.766 bonds (distance) P-C4' energy: -65.116 flat angles C4'-P-C4' energy: -54.803 flat angles P-C4'-P energy: -38.347 tors. eta vs tors. theta energy: -24.434 Dist. restrs. and SS energy: 5.900 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -690.455535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.455535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.828427 (E_RNA) where: Base-Base interactions energy: -455.314 where: short stacking energy: -195.068 Base-Backbone interact. energy: 0.841 local terms energy: -236.355695 where: bonds (distance) C4'-P energy: -48.368 bonds (distance) P-C4' energy: -56.575 flat angles C4'-P-C4' energy: -52.442 flat angles P-C4'-P energy: -39.127 tors. eta vs tors. theta energy: -39.843 Dist. restrs. and SS energy: 0.373 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -557.835549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.835549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.520802 (E_RNA) where: Base-Base interactions energy: -384.992 where: short stacking energy: -159.146 Base-Backbone interact. energy: 0.945 local terms energy: -181.474296 where: bonds (distance) C4'-P energy: -43.884 bonds (distance) P-C4' energy: -41.524 flat angles C4'-P-C4' energy: -51.799 flat angles P-C4'-P energy: -25.534 tors. eta vs tors. theta energy: -18.732 Dist. restrs. and SS energy: 7.685 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -1050.584722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1050.584722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1050.892872 (E_RNA) where: Base-Base interactions energy: -719.726 where: short stacking energy: -320.286 Base-Backbone interact. energy: -1.065 local terms energy: -330.101040 where: bonds (distance) C4'-P energy: -61.911 bonds (distance) P-C4' energy: -70.180 flat angles C4'-P-C4' energy: -78.129 flat angles P-C4'-P energy: -35.523 tors. eta vs tors. theta energy: -84.359 Dist. restrs. and SS energy: 0.308 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -944.077818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -944.077818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -944.619875 (E_RNA) where: Base-Base interactions energy: -621.355 where: short stacking energy: -292.811 Base-Backbone interact. energy: -0.151 local terms energy: -323.114432 where: bonds (distance) C4'-P energy: -76.743 bonds (distance) P-C4' energy: -61.974 flat angles C4'-P-C4' energy: -74.073 flat angles P-C4'-P energy: -38.714 tors. eta vs tors. theta energy: -71.610 Dist. restrs. and SS energy: 0.542 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -937.127439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.127439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.471727 (E_RNA) where: Base-Base interactions energy: -637.372 where: short stacking energy: -268.651 Base-Backbone interact. energy: -4.142 local terms energy: -295.957612 where: bonds (distance) C4'-P energy: -55.266 bonds (distance) P-C4' energy: -54.351 flat angles C4'-P-C4' energy: -66.221 flat angles P-C4'-P energy: -54.495 tors. eta vs tors. theta energy: -65.625 Dist. restrs. and SS energy: 0.344 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -886.942613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -886.942613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.135407 (E_RNA) where: Base-Base interactions energy: -595.350 where: short stacking energy: -260.952 Base-Backbone interact. energy: -0.085 local terms energy: -291.700875 where: bonds (distance) C4'-P energy: -52.146 bonds (distance) P-C4' energy: -56.080 flat angles C4'-P-C4' energy: -67.467 flat angles P-C4'-P energy: -46.095 tors. eta vs tors. theta energy: -69.912 Dist. restrs. and SS energy: 0.193 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -768.011442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.011442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.604464 (E_RNA) where: Base-Base interactions energy: -504.581 where: short stacking energy: -228.961 Base-Backbone interact. energy: -0.187 local terms energy: -264.836803 where: bonds (distance) C4'-P energy: -56.417 bonds (distance) P-C4' energy: -56.110 flat angles C4'-P-C4' energy: -62.066 flat angles P-C4'-P energy: -38.241 tors. eta vs tors. theta energy: -52.002 Dist. restrs. and SS energy: 1.593 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -810.326175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.326175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -811.159536 (E_RNA) where: Base-Base interactions energy: -539.542 where: short stacking energy: -233.318 Base-Backbone interact. energy: -0.519 local terms energy: -271.098858 where: bonds (distance) C4'-P energy: -58.323 bonds (distance) P-C4' energy: -61.766 flat angles C4'-P-C4' energy: -69.973 flat angles P-C4'-P energy: -32.249 tors. eta vs tors. theta energy: -48.789 Dist. restrs. and SS energy: 0.833 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -606.165366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.165366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.321521 (E_RNA) where: Base-Base interactions energy: -389.335 where: short stacking energy: -181.191 Base-Backbone interact. energy: 5.633 local terms energy: -236.620115 where: bonds (distance) C4'-P energy: -55.268 bonds (distance) P-C4' energy: -54.773 flat angles C4'-P-C4' energy: -54.417 flat angles P-C4'-P energy: -38.690 tors. eta vs tors. theta energy: -33.472 Dist. restrs. and SS energy: 14.156 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -683.729643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.729643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.124394 (E_RNA) where: Base-Base interactions energy: -453.475 where: short stacking energy: -194.861 Base-Backbone interact. energy: 1.032 local terms energy: -231.681433 where: bonds (distance) C4'-P energy: -52.058 bonds (distance) P-C4' energy: -49.745 flat angles C4'-P-C4' energy: -56.456 flat angles P-C4'-P energy: -41.220 tors. eta vs tors. theta energy: -32.202 Dist. restrs. and SS energy: 0.395 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -613.831871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.831871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.763100 (E_RNA) where: Base-Base interactions energy: -383.912 where: short stacking energy: -168.528 Base-Backbone interact. energy: 3.819 local terms energy: -241.670097 where: bonds (distance) C4'-P energy: -52.283 bonds (distance) P-C4' energy: -58.056 flat angles C4'-P-C4' energy: -58.837 flat angles P-C4'-P energy: -41.613 tors. eta vs tors. theta energy: -30.882 Dist. restrs. and SS energy: 7.931 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -669.540651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.540651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.584490 (E_RNA) where: Base-Base interactions energy: -446.131 where: short stacking energy: -173.414 Base-Backbone interact. energy: -0.548 local terms energy: -223.905658 where: bonds (distance) C4'-P energy: -53.796 bonds (distance) P-C4' energy: -53.972 flat angles C4'-P-C4' energy: -51.452 flat angles P-C4'-P energy: -34.155 tors. eta vs tors. theta energy: -30.532 Dist. restrs. and SS energy: 1.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -1048.219324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1048.219324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1048.555280 (E_RNA) where: Base-Base interactions energy: -717.437 where: short stacking energy: -316.976 Base-Backbone interact. energy: 0.889 local terms energy: -332.007533 where: bonds (distance) C4'-P energy: -70.642 bonds (distance) P-C4' energy: -61.669 flat angles C4'-P-C4' energy: -75.739 flat angles P-C4'-P energy: -40.081 tors. eta vs tors. theta energy: -83.877 Dist. restrs. and SS energy: 0.336 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -945.231715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.231715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.848705 (E_RNA) where: Base-Base interactions energy: -623.753 where: short stacking energy: -282.560 Base-Backbone interact. energy: -0.743 local terms energy: -321.353216 where: bonds (distance) C4'-P energy: -64.795 bonds (distance) P-C4' energy: -64.541 flat angles C4'-P-C4' energy: -73.407 flat angles P-C4'-P energy: -50.262 tors. eta vs tors. theta energy: -68.347 Dist. restrs. and SS energy: 0.617 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -962.171504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -962.171504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.416283 (E_RNA) where: Base-Base interactions energy: -668.036 where: short stacking energy: -261.070 Base-Backbone interact. energy: -1.838 local terms energy: -292.541851 where: bonds (distance) C4'-P energy: -60.666 bonds (distance) P-C4' energy: -60.058 flat angles C4'-P-C4' energy: -69.485 flat angles P-C4'-P energy: -38.638 tors. eta vs tors. theta energy: -63.696 Dist. restrs. and SS energy: 0.245 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -894.545828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.545828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -894.808811 (E_RNA) where: Base-Base interactions energy: -585.648 where: short stacking energy: -250.056 Base-Backbone interact. energy: -1.417 local terms energy: -307.744026 where: bonds (distance) C4'-P energy: -60.756 bonds (distance) P-C4' energy: -63.935 flat angles C4'-P-C4' energy: -68.400 flat angles P-C4'-P energy: -48.344 tors. eta vs tors. theta energy: -66.309 Dist. restrs. and SS energy: 0.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -833.948669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.948669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.242549 (E_RNA) where: Base-Base interactions energy: -538.307 where: short stacking energy: -228.913 Base-Backbone interact. energy: -0.191 local terms energy: -295.743810 where: bonds (distance) C4'-P energy: -57.667 bonds (distance) P-C4' energy: -61.266 flat angles C4'-P-C4' energy: -72.057 flat angles P-C4'-P energy: -45.276 tors. eta vs tors. theta energy: -59.478 Dist. restrs. and SS energy: 0.294 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -745.235142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.235142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.049924 (E_RNA) where: Base-Base interactions energy: -484.747 where: short stacking energy: -212.899 Base-Backbone interact. energy: -1.097 local terms energy: -262.205897 where: bonds (distance) C4'-P energy: -62.968 bonds (distance) P-C4' energy: -61.643 flat angles C4'-P-C4' energy: -62.328 flat angles P-C4'-P energy: -25.653 tors. eta vs tors. theta energy: -49.615 Dist. restrs. and SS energy: 2.815 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -716.945686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.945686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.524484 (E_RNA) where: Base-Base interactions energy: -479.900 where: short stacking energy: -228.048 Base-Backbone interact. energy: -0.510 local terms energy: -237.114294 where: bonds (distance) C4'-P energy: -45.689 bonds (distance) P-C4' energy: -52.655 flat angles C4'-P-C4' energy: -54.603 flat angles P-C4'-P energy: -34.311 tors. eta vs tors. theta energy: -49.857 Dist. restrs. and SS energy: 0.579 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -677.629064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.629064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.370536 (E_RNA) where: Base-Base interactions energy: -446.104 where: short stacking energy: -183.868 Base-Backbone interact. energy: -1.052 local terms energy: -239.215091 where: bonds (distance) C4'-P energy: -54.200 bonds (distance) P-C4' energy: -54.469 flat angles C4'-P-C4' energy: -48.279 flat angles P-C4'-P energy: -35.321 tors. eta vs tors. theta energy: -46.946 Dist. restrs. and SS energy: 8.741 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -722.833189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.833189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.053548 (E_RNA) where: Base-Base interactions energy: -469.173 where: short stacking energy: -199.438 Base-Backbone interact. energy: -0.362 local terms energy: -253.518687 where: bonds (distance) C4'-P energy: -44.290 bonds (distance) P-C4' energy: -62.625 flat angles C4'-P-C4' energy: -64.378 flat angles P-C4'-P energy: -37.191 tors. eta vs tors. theta energy: -45.035 Dist. restrs. and SS energy: 0.220 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -613.182877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.182877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.530715 (E_RNA) where: Base-Base interactions energy: -403.396 where: short stacking energy: -172.205 Base-Backbone interact. energy: 0.205 local terms energy: -212.340083 where: bonds (distance) C4'-P energy: -41.829 bonds (distance) P-C4' energy: -46.352 flat angles C4'-P-C4' energy: -55.132 flat angles P-C4'-P energy: -40.651 tors. eta vs tors. theta energy: -28.376 Dist. restrs. and SS energy: 2.348 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -1042.670394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1042.670394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1043.100028 (E_RNA) where: Base-Base interactions energy: -712.476 where: short stacking energy: -312.106 Base-Backbone interact. energy: -1.318 local terms energy: -329.305839 where: bonds (distance) C4'-P energy: -55.710 bonds (distance) P-C4' energy: -64.695 flat angles C4'-P-C4' energy: -71.215 flat angles P-C4'-P energy: -50.801 tors. eta vs tors. theta energy: -86.885 Dist. restrs. and SS energy: 0.430 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -983.109103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -983.109103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.690716 (E_RNA) where: Base-Base interactions energy: -648.342 where: short stacking energy: -301.572 Base-Backbone interact. energy: -0.403 local terms energy: -335.945756 where: bonds (distance) C4'-P energy: -68.641 bonds (distance) P-C4' energy: -63.981 flat angles C4'-P-C4' energy: -66.173 flat angles P-C4'-P energy: -50.712 tors. eta vs tors. theta energy: -86.438 Dist. restrs. and SS energy: 1.582 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -950.937056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -950.937056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -951.282414 (E_RNA) where: Base-Base interactions energy: -672.390 where: short stacking energy: -269.257 Base-Backbone interact. energy: -0.980 local terms energy: -277.911869 where: bonds (distance) C4'-P energy: -51.702 bonds (distance) P-C4' energy: -64.629 flat angles C4'-P-C4' energy: -65.632 flat angles P-C4'-P energy: -40.371 tors. eta vs tors. theta energy: -55.577 Dist. restrs. and SS energy: 0.345 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -881.633543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -881.633543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.576498 (E_RNA) where: Base-Base interactions energy: -572.376 where: short stacking energy: -256.042 Base-Backbone interact. energy: -1.648 local terms energy: -308.552530 where: bonds (distance) C4'-P energy: -61.974 bonds (distance) P-C4' energy: -69.909 flat angles C4'-P-C4' energy: -62.847 flat angles P-C4'-P energy: -46.194 tors. eta vs tors. theta energy: -67.629 Dist. restrs. and SS energy: 0.943 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -838.753219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.753219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -839.301075 (E_RNA) where: Base-Base interactions energy: -539.971 where: short stacking energy: -251.242 Base-Backbone interact. energy: -0.665 local terms energy: -298.664219 where: bonds (distance) C4'-P energy: -62.631 bonds (distance) P-C4' energy: -62.377 flat angles C4'-P-C4' energy: -66.735 flat angles P-C4'-P energy: -39.419 tors. eta vs tors. theta energy: -67.501 Dist. restrs. and SS energy: 0.548 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -752.846107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.846107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.273955 (E_RNA) where: Base-Base interactions energy: -480.220 where: short stacking energy: -223.728 Base-Backbone interact. energy: 0.472 local terms energy: -273.526285 where: bonds (distance) C4'-P energy: -60.283 bonds (distance) P-C4' energy: -63.690 flat angles C4'-P-C4' energy: -54.198 flat angles P-C4'-P energy: -43.702 tors. eta vs tors. theta energy: -51.654 Dist. restrs. and SS energy: 0.428 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -747.649586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.649586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.354875 (E_RNA) where: Base-Base interactions energy: -482.557 where: short stacking energy: -202.209 Base-Backbone interact. energy: 1.892 local terms energy: -267.689707 where: bonds (distance) C4'-P energy: -61.769 bonds (distance) P-C4' energy: -65.899 flat angles C4'-P-C4' energy: -61.958 flat angles P-C4'-P energy: -27.924 tors. eta vs tors. theta energy: -50.139 Dist. restrs. and SS energy: 0.705 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -787.643428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -787.643428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.423930 (E_RNA) where: Base-Base interactions energy: -527.653 where: short stacking energy: -208.084 Base-Backbone interact. energy: -1.344 local terms energy: -259.427148 where: bonds (distance) C4'-P energy: -47.835 bonds (distance) P-C4' energy: -64.951 flat angles C4'-P-C4' energy: -56.101 flat angles P-C4'-P energy: -42.278 tors. eta vs tors. theta energy: -48.262 Dist. restrs. and SS energy: 0.781 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -625.887614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -625.887614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.282629 (E_RNA) where: Base-Base interactions energy: -422.276 where: short stacking energy: -190.360 Base-Backbone interact. energy: -1.221 local terms energy: -209.785017 where: bonds (distance) C4'-P energy: -33.373 bonds (distance) P-C4' energy: -56.842 flat angles C4'-P-C4' energy: -57.173 flat angles P-C4'-P energy: -29.214 tors. eta vs tors. theta energy: -33.183 Dist. restrs. and SS energy: 7.395 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -639.911639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -639.911639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.157553 (E_RNA) where: Base-Base interactions energy: -413.709 where: short stacking energy: -164.335 Base-Backbone interact. energy: 0.723 local terms energy: -227.171501 where: bonds (distance) C4'-P energy: -48.142 bonds (distance) P-C4' energy: -63.909 flat angles C4'-P-C4' energy: -48.361 flat angles P-C4'-P energy: -38.099 tors. eta vs tors. theta energy: -28.661 Dist. restrs. and SS energy: 0.246 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -1050.107442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1050.107442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1050.564030 (E_RNA) where: Base-Base interactions energy: -733.506 where: short stacking energy: -320.917 Base-Backbone interact. energy: 0.054 local terms energy: -317.111577 where: bonds (distance) C4'-P energy: -65.278 bonds (distance) P-C4' energy: -59.790 flat angles C4'-P-C4' energy: -67.001 flat angles P-C4'-P energy: -46.030 tors. eta vs tors. theta energy: -79.013 Dist. restrs. and SS energy: 0.457 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -936.749820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -936.749820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.025361 (E_RNA) where: Base-Base interactions energy: -619.556 where: short stacking energy: -281.712 Base-Backbone interact. energy: -0.226 local terms energy: -319.243425 where: bonds (distance) C4'-P energy: -65.635 bonds (distance) P-C4' energy: -62.274 flat angles C4'-P-C4' energy: -70.065 flat angles P-C4'-P energy: -45.585 tors. eta vs tors. theta energy: -75.685 Dist. restrs. and SS energy: 2.276 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -994.815944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.815944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -994.977850 (E_RNA) where: Base-Base interactions energy: -690.408 where: short stacking energy: -299.288 Base-Backbone interact. energy: -0.439 local terms energy: -304.130267 where: bonds (distance) C4'-P energy: -51.551 bonds (distance) P-C4' energy: -70.266 flat angles C4'-P-C4' energy: -63.163 flat angles P-C4'-P energy: -41.138 tors. eta vs tors. theta energy: -78.013 Dist. restrs. and SS energy: 0.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -873.223682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -873.223682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -873.903957 (E_RNA) where: Base-Base interactions energy: -570.338 where: short stacking energy: -255.868 Base-Backbone interact. energy: -0.302 local terms energy: -303.263990 where: bonds (distance) C4'-P energy: -64.754 bonds (distance) P-C4' energy: -69.600 flat angles C4'-P-C4' energy: -65.510 flat angles P-C4'-P energy: -40.288 tors. eta vs tors. theta energy: -63.112 Dist. restrs. and SS energy: 0.680 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -858.999345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.999345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.186565 (E_RNA) where: Base-Base interactions energy: -583.114 where: short stacking energy: -248.914 Base-Backbone interact. energy: 3.913 local terms energy: -279.985920 where: bonds (distance) C4'-P energy: -62.305 bonds (distance) P-C4' energy: -58.935 flat angles C4'-P-C4' energy: -59.462 flat angles P-C4'-P energy: -34.078 tors. eta vs tors. theta energy: -65.206 Dist. restrs. and SS energy: 0.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -782.966507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.966507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.772168 (E_RNA) where: Base-Base interactions energy: -523.076 where: short stacking energy: -229.376 Base-Backbone interact. energy: -1.568 local terms energy: -259.128496 where: bonds (distance) C4'-P energy: -61.584 bonds (distance) P-C4' energy: -59.810 flat angles C4'-P-C4' energy: -46.958 flat angles P-C4'-P energy: -39.108 tors. eta vs tors. theta energy: -51.667 Dist. restrs. and SS energy: 0.806 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -811.732272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -811.732272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.062187 (E_RNA) where: Base-Base interactions energy: -551.755 where: short stacking energy: -230.158 Base-Backbone interact. energy: -0.141 local terms energy: -260.165522 where: bonds (distance) C4'-P energy: -42.490 bonds (distance) P-C4' energy: -69.246 flat angles C4'-P-C4' energy: -56.314 flat angles P-C4'-P energy: -37.189 tors. eta vs tors. theta energy: -54.926 Dist. restrs. and SS energy: 0.330 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -735.187044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.187044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.633396 (E_RNA) where: Base-Base interactions energy: -504.580 where: short stacking energy: -215.229 Base-Backbone interact. energy: -0.149 local terms energy: -230.904629 where: bonds (distance) C4'-P energy: -52.668 bonds (distance) P-C4' energy: -46.807 flat angles C4'-P-C4' energy: -65.279 flat angles P-C4'-P energy: -25.029 tors. eta vs tors. theta energy: -41.122 Dist. restrs. and SS energy: 0.446 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -686.521364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.521364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.662001 (E_RNA) where: Base-Base interactions energy: -428.232 where: short stacking energy: -194.834 Base-Backbone interact. energy: -0.435 local terms energy: -258.995356 where: bonds (distance) C4'-P energy: -46.386 bonds (distance) P-C4' energy: -63.036 flat angles C4'-P-C4' energy: -62.855 flat angles P-C4'-P energy: -41.258 tors. eta vs tors. theta energy: -45.460 Dist. restrs. and SS energy: 1.141 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -622.396605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.396605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.804529 (E_RNA) where: Base-Base interactions energy: -403.213 where: short stacking energy: -174.495 Base-Backbone interact. energy: 0.321 local terms energy: -221.912730 where: bonds (distance) C4'-P energy: -49.274 bonds (distance) P-C4' energy: -56.664 flat angles C4'-P-C4' energy: -52.581 flat angles P-C4'-P energy: -31.488 tors. eta vs tors. theta energy: -31.906 Dist. restrs. and SS energy: 2.408 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -1073.136316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.136316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.753523 (E_RNA) where: Base-Base interactions energy: -738.049 where: short stacking energy: -314.366 Base-Backbone interact. energy: -2.025 local terms energy: -333.679896 where: bonds (distance) C4'-P energy: -62.367 bonds (distance) P-C4' energy: -69.749 flat angles C4'-P-C4' energy: -71.363 flat angles P-C4'-P energy: -46.898 tors. eta vs tors. theta energy: -83.302 Dist. restrs. and SS energy: 0.617 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -997.955388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.955388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -997.985832 (E_RNA) where: Base-Base interactions energy: -679.593 where: short stacking energy: -286.264 Base-Backbone interact. energy: 1.081 local terms energy: -319.474515 where: bonds (distance) C4'-P energy: -58.184 bonds (distance) P-C4' energy: -61.785 flat angles C4'-P-C4' energy: -74.975 flat angles P-C4'-P energy: -49.685 tors. eta vs tors. theta energy: -74.845 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -949.589101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -949.589101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -950.156203 (E_RNA) where: Base-Base interactions energy: -636.595 where: short stacking energy: -281.370 Base-Backbone interact. energy: -0.058 local terms energy: -313.503461 where: bonds (distance) C4'-P energy: -58.122 bonds (distance) P-C4' energy: -54.331 flat angles C4'-P-C4' energy: -72.760 flat angles P-C4'-P energy: -49.373 tors. eta vs tors. theta energy: -78.917 Dist. restrs. and SS energy: 0.567 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -906.101930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -906.101930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -906.854571 (E_RNA) where: Base-Base interactions energy: -607.454 where: short stacking energy: -274.909 Base-Backbone interact. energy: -1.328 local terms energy: -298.072544 where: bonds (distance) C4'-P energy: -64.304 bonds (distance) P-C4' energy: -60.055 flat angles C4'-P-C4' energy: -67.411 flat angles P-C4'-P energy: -38.743 tors. eta vs tors. theta energy: -67.560 Dist. restrs. and SS energy: 0.753 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -855.362504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.362504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.621205 (E_RNA) where: Base-Base interactions energy: -556.275 where: short stacking energy: -238.723 Base-Backbone interact. energy: -1.630 local terms energy: -297.716207 where: bonds (distance) C4'-P energy: -61.448 bonds (distance) P-C4' energy: -66.639 flat angles C4'-P-C4' energy: -73.513 flat angles P-C4'-P energy: -39.035 tors. eta vs tors. theta energy: -57.082 Dist. restrs. and SS energy: 0.259 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -842.168135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -842.168135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.123435 (E_RNA) where: Base-Base interactions energy: -560.384 where: short stacking energy: -229.666 Base-Backbone interact. energy: -1.669 local terms energy: -281.070189 where: bonds (distance) C4'-P energy: -61.612 bonds (distance) P-C4' energy: -60.997 flat angles C4'-P-C4' energy: -68.190 flat angles P-C4'-P energy: -32.992 tors. eta vs tors. theta energy: -57.279 Dist. restrs. and SS energy: 0.955 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -770.665498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.665498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.196103 (E_RNA) where: Base-Base interactions energy: -497.034 where: short stacking energy: -219.489 Base-Backbone interact. energy: 0.017 local terms energy: -274.178779 where: bonds (distance) C4'-P energy: -51.376 bonds (distance) P-C4' energy: -53.863 flat angles C4'-P-C4' energy: -68.267 flat angles P-C4'-P energy: -48.515 tors. eta vs tors. theta energy: -52.158 Dist. restrs. and SS energy: 0.531 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -727.610265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.610265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.170784 (E_RNA) where: Base-Base interactions energy: -447.957 where: short stacking energy: -210.231 Base-Backbone interact. energy: -1.136 local terms energy: -279.077386 where: bonds (distance) C4'-P energy: -55.491 bonds (distance) P-C4' energy: -66.304 flat angles C4'-P-C4' energy: -66.423 flat angles P-C4'-P energy: -46.779 tors. eta vs tors. theta energy: -44.081 Dist. restrs. and SS energy: 0.561 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -697.680685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.680685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.609780 (E_RNA) where: Base-Base interactions energy: -464.837 where: short stacking energy: -216.584 Base-Backbone interact. energy: -0.359 local terms energy: -233.414216 where: bonds (distance) C4'-P energy: -41.519 bonds (distance) P-C4' energy: -54.240 flat angles C4'-P-C4' energy: -60.459 flat angles P-C4'-P energy: -31.540 tors. eta vs tors. theta energy: -45.656 Dist. restrs. and SS energy: 0.929 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -613.773782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.773782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.279668 (E_RNA) where: Base-Base interactions energy: -415.219 where: short stacking energy: -168.223 Base-Backbone interact. energy: -0.475 local terms energy: -200.585893 where: bonds (distance) C4'-P energy: -40.520 bonds (distance) P-C4' energy: -51.195 flat angles C4'-P-C4' energy: -59.736 flat angles P-C4'-P energy: -30.257 tors. eta vs tors. theta energy: -18.878 Dist. restrs. and SS energy: 2.506 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -1072.874176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1072.874176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.106498 (E_RNA) where: Base-Base interactions energy: -728.832 where: short stacking energy: -333.400 Base-Backbone interact. energy: -0.312 local terms energy: -343.963261 where: bonds (distance) C4'-P energy: -66.524 bonds (distance) P-C4' energy: -70.076 flat angles C4'-P-C4' energy: -75.179 flat angles P-C4'-P energy: -42.905 tors. eta vs tors. theta energy: -89.279 Dist. restrs. and SS energy: 0.232 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -994.652470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.652470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -995.093843 (E_RNA) where: Base-Base interactions energy: -677.373 where: short stacking energy: -292.004 Base-Backbone interact. energy: -3.555 local terms energy: -314.164992 where: bonds (distance) C4'-P energy: -55.642 bonds (distance) P-C4' energy: -63.332 flat angles C4'-P-C4' energy: -69.692 flat angles P-C4'-P energy: -46.873 tors. eta vs tors. theta energy: -78.626 Dist. restrs. and SS energy: 0.441 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -952.944621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -952.944621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.979354 (E_RNA) where: Base-Base interactions energy: -656.647 where: short stacking energy: -284.351 Base-Backbone interact. energy: -2.597 local terms energy: -294.735463 where: bonds (distance) C4'-P energy: -59.714 bonds (distance) P-C4' energy: -60.323 flat angles C4'-P-C4' energy: -69.381 flat angles P-C4'-P energy: -36.775 tors. eta vs tors. theta energy: -68.541 Dist. restrs. and SS energy: 1.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -896.823593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.823593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.158602 (E_RNA) where: Base-Base interactions energy: -608.473 where: short stacking energy: -274.516 Base-Backbone interact. energy: -1.614 local terms energy: -287.071009 where: bonds (distance) C4'-P energy: -63.795 bonds (distance) P-C4' energy: -61.129 flat angles C4'-P-C4' energy: -58.829 flat angles P-C4'-P energy: -36.977 tors. eta vs tors. theta energy: -66.341 Dist. restrs. and SS energy: 0.335 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -901.428527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -901.428527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.781829 (E_RNA) where: Base-Base interactions energy: -602.903 where: short stacking energy: -264.124 Base-Backbone interact. energy: 0.662 local terms energy: -299.540931 where: bonds (distance) C4'-P energy: -56.007 bonds (distance) P-C4' energy: -65.885 flat angles C4'-P-C4' energy: -69.245 flat angles P-C4'-P energy: -43.571 tors. eta vs tors. theta energy: -64.832 Dist. restrs. and SS energy: 0.353 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -814.443102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.443102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.138258 (E_RNA) where: Base-Base interactions energy: -527.043 where: short stacking energy: -241.453 Base-Backbone interact. energy: -0.540 local terms energy: -287.555569 where: bonds (distance) C4'-P energy: -55.962 bonds (distance) P-C4' energy: -58.676 flat angles C4'-P-C4' energy: -65.725 flat angles P-C4'-P energy: -48.629 tors. eta vs tors. theta energy: -58.563 Dist. restrs. and SS energy: 0.695 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -791.223743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.223743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -792.213400 (E_RNA) where: Base-Base interactions energy: -532.242 where: short stacking energy: -253.927 Base-Backbone interact. energy: -0.814 local terms energy: -259.157450 where: bonds (distance) C4'-P energy: -55.413 bonds (distance) P-C4' energy: -59.146 flat angles C4'-P-C4' energy: -61.124 flat angles P-C4'-P energy: -31.271 tors. eta vs tors. theta energy: -52.204 Dist. restrs. and SS energy: 0.990 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -714.004898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.004898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.143549 (E_RNA) where: Base-Base interactions energy: -453.331 where: short stacking energy: -202.738 Base-Backbone interact. energy: -0.629 local terms energy: -260.184055 where: bonds (distance) C4'-P energy: -62.753 bonds (distance) P-C4' energy: -59.337 flat angles C4'-P-C4' energy: -64.082 flat angles P-C4'-P energy: -27.571 tors. eta vs tors. theta energy: -46.441 Dist. restrs. and SS energy: 0.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -638.305640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.305640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.845464 (E_RNA) where: Base-Base interactions energy: -406.485 where: short stacking energy: -184.031 Base-Backbone interact. energy: -1.643 local terms energy: -235.718072 where: bonds (distance) C4'-P energy: -50.569 bonds (distance) P-C4' energy: -57.894 flat angles C4'-P-C4' energy: -53.368 flat angles P-C4'-P energy: -32.203 tors. eta vs tors. theta energy: -41.685 Dist. restrs. and SS energy: 5.540 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -669.318624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.318624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.494940 (E_RNA) where: Base-Base interactions energy: -450.937 where: short stacking energy: -174.361 Base-Backbone interact. energy: -0.825 local terms energy: -217.732260 where: bonds (distance) C4'-P energy: -49.357 bonds (distance) P-C4' energy: -54.345 flat angles C4'-P-C4' energy: -45.351 flat angles P-C4'-P energy: -34.788 tors. eta vs tors. theta energy: -33.891 Dist. restrs. and SS energy: 0.176 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -1102.649197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.649197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1103.695983 (E_RNA) where: Base-Base interactions energy: -767.616 where: short stacking energy: -345.043 Base-Backbone interact. energy: 0.172 local terms energy: -336.252582 where: bonds (distance) C4'-P energy: -67.398 bonds (distance) P-C4' energy: -66.435 flat angles C4'-P-C4' energy: -77.076 flat angles P-C4'-P energy: -36.941 tors. eta vs tors. theta energy: -88.403 Dist. restrs. and SS energy: 1.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -1025.389664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.389664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1025.497002 (E_RNA) where: Base-Base interactions energy: -699.875 where: short stacking energy: -286.982 Base-Backbone interact. energy: -1.276 local terms energy: -324.345669 where: bonds (distance) C4'-P energy: -64.739 bonds (distance) P-C4' energy: -67.082 flat angles C4'-P-C4' energy: -70.609 flat angles P-C4'-P energy: -41.872 tors. eta vs tors. theta energy: -80.045 Dist. restrs. and SS energy: 0.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -975.873832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.873832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -976.132816 (E_RNA) where: Base-Base interactions energy: -660.168 where: short stacking energy: -288.943 Base-Backbone interact. energy: -2.936 local terms energy: -313.029222 where: bonds (distance) C4'-P energy: -63.655 bonds (distance) P-C4' energy: -62.054 flat angles C4'-P-C4' energy: -71.046 flat angles P-C4'-P energy: -42.125 tors. eta vs tors. theta energy: -74.150 Dist. restrs. and SS energy: 0.259 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -957.336411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -957.336411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -957.474075 (E_RNA) where: Base-Base interactions energy: -638.874 where: short stacking energy: -278.741 Base-Backbone interact. energy: -0.959 local terms energy: -317.641346 where: bonds (distance) C4'-P energy: -64.923 bonds (distance) P-C4' energy: -68.351 flat angles C4'-P-C4' energy: -63.428 flat angles P-C4'-P energy: -43.304 tors. eta vs tors. theta energy: -77.634 Dist. restrs. and SS energy: 0.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -891.360753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -891.360753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -891.586709 (E_RNA) where: Base-Base interactions energy: -591.456 where: short stacking energy: -266.131 Base-Backbone interact. energy: -0.449 local terms energy: -299.681980 where: bonds (distance) C4'-P energy: -63.321 bonds (distance) P-C4' energy: -66.089 flat angles C4'-P-C4' energy: -70.833 flat angles P-C4'-P energy: -35.001 tors. eta vs tors. theta energy: -64.438 Dist. restrs. and SS energy: 0.226 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -818.924793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.924793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.217824 (E_RNA) where: Base-Base interactions energy: -538.312 where: short stacking energy: -237.178 Base-Backbone interact. energy: -2.101 local terms energy: -278.805398 where: bonds (distance) C4'-P energy: -66.539 bonds (distance) P-C4' energy: -59.915 flat angles C4'-P-C4' energy: -67.012 flat angles P-C4'-P energy: -38.645 tors. eta vs tors. theta energy: -46.694 Dist. restrs. and SS energy: 0.293 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -810.747831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.747831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -810.914260 (E_RNA) where: Base-Base interactions energy: -540.918 where: short stacking energy: -241.450 Base-Backbone interact. energy: 1.425 local terms energy: -271.421746 where: bonds (distance) C4'-P energy: -64.605 bonds (distance) P-C4' energy: -71.619 flat angles C4'-P-C4' energy: -56.278 flat angles P-C4'-P energy: -23.544 tors. eta vs tors. theta energy: -55.375 Dist. restrs. and SS energy: 0.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -725.532668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.532668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.974151 (E_RNA) where: Base-Base interactions energy: -475.525 where: short stacking energy: -203.573 Base-Backbone interact. energy: -2.138 local terms energy: -248.311740 where: bonds (distance) C4'-P energy: -60.404 bonds (distance) P-C4' energy: -54.432 flat angles C4'-P-C4' energy: -51.335 flat angles P-C4'-P energy: -32.618 tors. eta vs tors. theta energy: -49.523 Dist. restrs. and SS energy: 0.441 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -650.313562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.313562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -660.725843 (E_RNA) where: Base-Base interactions energy: -423.825 where: short stacking energy: -197.845 Base-Backbone interact. energy: -0.205 local terms energy: -236.696070 where: bonds (distance) C4'-P energy: -40.679 bonds (distance) P-C4' energy: -65.272 flat angles C4'-P-C4' energy: -54.220 flat angles P-C4'-P energy: -32.772 tors. eta vs tors. theta energy: -43.753 Dist. restrs. and SS energy: 10.412 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -674.677268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.677268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.214453 (E_RNA) where: Base-Base interactions energy: -430.866 where: short stacking energy: -183.174 Base-Backbone interact. energy: -2.007 local terms energy: -242.341544 where: bonds (distance) C4'-P energy: -59.126 bonds (distance) P-C4' energy: -54.139 flat angles C4'-P-C4' energy: -65.901 flat angles P-C4'-P energy: -31.458 tors. eta vs tors. theta energy: -31.716 Dist. restrs. and SS energy: 0.537 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -1091.669548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.669548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1092.389908 (E_RNA) where: Base-Base interactions energy: -741.358 where: short stacking energy: -335.582 Base-Backbone interact. energy: -1.610 local terms energy: -349.421073 where: bonds (distance) C4'-P energy: -61.567 bonds (distance) P-C4' energy: -74.216 flat angles C4'-P-C4' energy: -75.558 flat angles P-C4'-P energy: -45.315 tors. eta vs tors. theta energy: -92.765 Dist. restrs. and SS energy: 0.720 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -1054.493924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1054.493924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1055.096613 (E_RNA) where: Base-Base interactions energy: -724.176 where: short stacking energy: -309.466 Base-Backbone interact. energy: -0.718 local terms energy: -330.202383 where: bonds (distance) C4'-P energy: -63.755 bonds (distance) P-C4' energy: -67.414 flat angles C4'-P-C4' energy: -71.963 flat angles P-C4'-P energy: -48.353 tors. eta vs tors. theta energy: -78.717 Dist. restrs. and SS energy: 0.603 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -976.869524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -976.869524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -977.219802 (E_RNA) where: Base-Base interactions energy: -648.566 where: short stacking energy: -283.212 Base-Backbone interact. energy: -2.006 local terms energy: -326.648098 where: bonds (distance) C4'-P energy: -55.727 bonds (distance) P-C4' energy: -74.619 flat angles C4'-P-C4' energy: -71.006 flat angles P-C4'-P energy: -50.561 tors. eta vs tors. theta energy: -74.735 Dist. restrs. and SS energy: 0.350 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -956.581353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -956.581353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.818538 (E_RNA) where: Base-Base interactions energy: -652.959 where: short stacking energy: -284.815 Base-Backbone interact. energy: -0.910 local terms energy: -302.949098 where: bonds (distance) C4'-P energy: -61.401 bonds (distance) P-C4' energy: -64.320 flat angles C4'-P-C4' energy: -63.894 flat angles P-C4'-P energy: -33.289 tors. eta vs tors. theta energy: -80.046 Dist. restrs. and SS energy: 0.237 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -907.892257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.892257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -908.365600 (E_RNA) where: Base-Base interactions energy: -603.500 where: short stacking energy: -268.747 Base-Backbone interact. energy: 0.929 local terms energy: -305.794096 where: bonds (distance) C4'-P energy: -55.888 bonds (distance) P-C4' energy: -55.125 flat angles C4'-P-C4' energy: -70.480 flat angles P-C4'-P energy: -52.667 tors. eta vs tors. theta energy: -71.635 Dist. restrs. and SS energy: 0.473 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -876.499345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -876.499345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.639336 (E_RNA) where: Base-Base interactions energy: -578.980 where: short stacking energy: -260.862 Base-Backbone interact. energy: -1.556 local terms energy: -296.102945 where: bonds (distance) C4'-P energy: -63.484 bonds (distance) P-C4' energy: -60.850 flat angles C4'-P-C4' energy: -64.195 flat angles P-C4'-P energy: -41.449 tors. eta vs tors. theta energy: -66.125 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -806.899360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.899360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -807.234696 (E_RNA) where: Base-Base interactions energy: -525.556 where: short stacking energy: -250.636 Base-Backbone interact. energy: -1.262 local terms energy: -280.416403 where: bonds (distance) C4'-P energy: -55.371 bonds (distance) P-C4' energy: -55.998 flat angles C4'-P-C4' energy: -65.277 flat angles P-C4'-P energy: -43.206 tors. eta vs tors. theta energy: -60.564 Dist. restrs. and SS energy: 0.335 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -743.791717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -743.791717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.886782 (E_RNA) where: Base-Base interactions energy: -502.412 where: short stacking energy: -204.440 Base-Backbone interact. energy: 0.405 local terms energy: -241.879943 where: bonds (distance) C4'-P energy: -53.187 bonds (distance) P-C4' energy: -60.342 flat angles C4'-P-C4' energy: -60.539 flat angles P-C4'-P energy: -28.610 tors. eta vs tors. theta energy: -39.202 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -685.940153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.940153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.766351 (E_RNA) where: Base-Base interactions energy: -453.079 where: short stacking energy: -202.870 Base-Backbone interact. energy: 2.577 local terms energy: -236.264637 where: bonds (distance) C4'-P energy: -49.235 bonds (distance) P-C4' energy: -56.672 flat angles C4'-P-C4' energy: -56.093 flat angles P-C4'-P energy: -30.372 tors. eta vs tors. theta energy: -43.893 Dist. restrs. and SS energy: 0.826 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -615.362568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.362568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.058860 (E_RNA) where: Base-Base interactions energy: -397.248 where: short stacking energy: -172.184 Base-Backbone interact. energy: -0.586 local terms energy: -226.225177 where: bonds (distance) C4'-P energy: -46.508 bonds (distance) P-C4' energy: -59.791 flat angles C4'-P-C4' energy: -44.813 flat angles P-C4'-P energy: -39.104 tors. eta vs tors. theta energy: -36.010 Dist. restrs. and SS energy: 8.696 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -1060.930581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.930581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.181421 (E_RNA) where: Base-Base interactions energy: -735.183 where: short stacking energy: -325.395 Base-Backbone interact. energy: 2.096 local terms energy: -328.095021 where: bonds (distance) C4'-P energy: -66.845 bonds (distance) P-C4' energy: -64.062 flat angles C4'-P-C4' energy: -70.753 flat angles P-C4'-P energy: -46.322 tors. eta vs tors. theta energy: -80.112 Dist. restrs. and SS energy: 0.251 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -1087.105139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.105139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1087.920164 (E_RNA) where: Base-Base interactions energy: -775.735 where: short stacking energy: -298.246 Base-Backbone interact. energy: -1.086 local terms energy: -311.098722 where: bonds (distance) C4'-P energy: -65.774 bonds (distance) P-C4' energy: -49.250 flat angles C4'-P-C4' energy: -75.856 flat angles P-C4'-P energy: -44.721 tors. eta vs tors. theta energy: -75.498 Dist. restrs. and SS energy: 0.815 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -980.008839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.008839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -980.247928 (E_RNA) where: Base-Base interactions energy: -669.381 where: short stacking energy: -318.757 Base-Backbone interact. energy: -3.997 local terms energy: -306.869822 where: bonds (distance) C4'-P energy: -49.904 bonds (distance) P-C4' energy: -68.523 flat angles C4'-P-C4' energy: -63.709 flat angles P-C4'-P energy: -36.582 tors. eta vs tors. theta energy: -88.152 Dist. restrs. and SS energy: 0.239 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -960.582802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.582802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.914531 (E_RNA) where: Base-Base interactions energy: -654.949 where: short stacking energy: -289.633 Base-Backbone interact. energy: -1.823 local terms energy: -304.142331 where: bonds (distance) C4'-P energy: -59.830 bonds (distance) P-C4' energy: -55.197 flat angles C4'-P-C4' energy: -66.304 flat angles P-C4'-P energy: -48.594 tors. eta vs tors. theta energy: -74.218 Dist. restrs. and SS energy: 0.332 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -850.726429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.726429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -850.818364 (E_RNA) where: Base-Base interactions energy: -558.213 where: short stacking energy: -235.126 Base-Backbone interact. energy: -1.061 local terms energy: -291.544771 where: bonds (distance) C4'-P energy: -66.088 bonds (distance) P-C4' energy: -59.460 flat angles C4'-P-C4' energy: -62.000 flat angles P-C4'-P energy: -43.255 tors. eta vs tors. theta energy: -60.743 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -846.478662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.478662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -846.798798 (E_RNA) where: Base-Base interactions energy: -584.359 where: short stacking energy: -247.815 Base-Backbone interact. energy: -1.100 local terms energy: -261.339739 where: bonds (distance) C4'-P energy: -46.373 bonds (distance) P-C4' energy: -52.766 flat angles C4'-P-C4' energy: -57.959 flat angles P-C4'-P energy: -33.425 tors. eta vs tors. theta energy: -70.817 Dist. restrs. and SS energy: 0.320 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -812.133236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.133236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.520832 (E_RNA) where: Base-Base interactions energy: -544.921 where: short stacking energy: -235.352 Base-Backbone interact. energy: 2.112 local terms energy: -269.711789 where: bonds (distance) C4'-P energy: -58.799 bonds (distance) P-C4' energy: -55.931 flat angles C4'-P-C4' energy: -68.264 flat angles P-C4'-P energy: -35.816 tors. eta vs tors. theta energy: -50.902 Dist. restrs. and SS energy: 0.388 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -779.608289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.608289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.090658 (E_RNA) where: Base-Base interactions energy: -521.543 where: short stacking energy: -207.968 Base-Backbone interact. energy: -1.052 local terms energy: -257.495612 where: bonds (distance) C4'-P energy: -52.347 bonds (distance) P-C4' energy: -62.615 flat angles C4'-P-C4' energy: -57.193 flat angles P-C4'-P energy: -32.968 tors. eta vs tors. theta energy: -52.373 Dist. restrs. and SS energy: 0.482 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -682.828349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.828349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.413275 (E_RNA) where: Base-Base interactions energy: -445.815 where: short stacking energy: -189.124 Base-Backbone interact. energy: 2.916 local terms energy: -240.514046 where: bonds (distance) C4'-P energy: -39.155 bonds (distance) P-C4' energy: -58.497 flat angles C4'-P-C4' energy: -62.193 flat angles P-C4'-P energy: -36.655 tors. eta vs tors. theta energy: -44.015 Dist. restrs. and SS energy: 0.585 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -620.403545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -620.403545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.106826 (E_RNA) where: Base-Base interactions energy: -426.273 where: short stacking energy: -198.659 Base-Backbone interact. energy: -1.798 local terms energy: -198.036434 where: bonds (distance) C4'-P energy: -43.193 bonds (distance) P-C4' energy: -41.884 flat angles C4'-P-C4' energy: -61.338 flat angles P-C4'-P energy: -12.295 tors. eta vs tors. theta energy: -39.326 Dist. restrs. and SS energy: 5.703 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -1108.242787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1108.242787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1109.570208 (E_RNA) where: Base-Base interactions energy: -767.854 where: short stacking energy: -318.382 Base-Backbone interact. energy: -0.365 local terms energy: -341.351016 where: bonds (distance) C4'-P energy: -59.262 bonds (distance) P-C4' energy: -65.602 flat angles C4'-P-C4' energy: -78.891 flat angles P-C4'-P energy: -57.110 tors. eta vs tors. theta energy: -80.485 Dist. restrs. and SS energy: 1.327 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -1042.233080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1042.233080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1042.746676 (E_RNA) where: Base-Base interactions energy: -707.273 where: short stacking energy: -319.185 Base-Backbone interact. energy: -1.772 local terms energy: -333.701874 where: bonds (distance) C4'-P energy: -65.571 bonds (distance) P-C4' energy: -70.367 flat angles C4'-P-C4' energy: -72.483 flat angles P-C4'-P energy: -44.400 tors. eta vs tors. theta energy: -80.880 Dist. restrs. and SS energy: 0.514 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -1000.329689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1000.329689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.625006 (E_RNA) where: Base-Base interactions energy: -683.061 where: short stacking energy: -307.725 Base-Backbone interact. energy: -0.660 local terms energy: -316.904941 where: bonds (distance) C4'-P energy: -66.452 bonds (distance) P-C4' energy: -58.785 flat angles C4'-P-C4' energy: -67.092 flat angles P-C4'-P energy: -37.728 tors. eta vs tors. theta energy: -86.848 Dist. restrs. and SS energy: 0.295 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -945.922129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.922129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -946.040076 (E_RNA) where: Base-Base interactions energy: -642.076 where: short stacking energy: -289.298 Base-Backbone interact. energy: 0.119 local terms energy: -304.083232 where: bonds (distance) C4'-P energy: -60.927 bonds (distance) P-C4' energy: -55.776 flat angles C4'-P-C4' energy: -71.007 flat angles P-C4'-P energy: -48.805 tors. eta vs tors. theta energy: -67.568 Dist. restrs. and SS energy: 0.118 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -878.173484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.173484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -878.535918 (E_RNA) where: Base-Base interactions energy: -589.598 where: short stacking energy: -264.214 Base-Backbone interact. energy: -0.353 local terms energy: -288.584357 where: bonds (distance) C4'-P energy: -51.670 bonds (distance) P-C4' energy: -55.337 flat angles C4'-P-C4' energy: -66.440 flat angles P-C4'-P energy: -46.953 tors. eta vs tors. theta energy: -68.184 Dist. restrs. and SS energy: 0.362 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -833.958102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.958102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.596052 (E_RNA) where: Base-Base interactions energy: -556.609 where: short stacking energy: -223.699 Base-Backbone interact. energy: -1.008 local terms energy: -276.978657 where: bonds (distance) C4'-P energy: -65.217 bonds (distance) P-C4' energy: -58.082 flat angles C4'-P-C4' energy: -72.308 flat angles P-C4'-P energy: -27.645 tors. eta vs tors. theta energy: -53.727 Dist. restrs. and SS energy: 0.638 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -770.336486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.336486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.993606 (E_RNA) where: Base-Base interactions energy: -500.944 where: short stacking energy: -223.768 Base-Backbone interact. energy: -0.916 local terms energy: -269.133138 where: bonds (distance) C4'-P energy: -52.347 bonds (distance) P-C4' energy: -61.188 flat angles C4'-P-C4' energy: -64.036 flat angles P-C4'-P energy: -41.599 tors. eta vs tors. theta energy: -49.964 Dist. restrs. and SS energy: 0.657 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -751.095060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.095060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.249257 (E_RNA) where: Base-Base interactions energy: -486.712 where: short stacking energy: -207.891 Base-Backbone interact. energy: -1.569 local terms energy: -262.969113 where: bonds (distance) C4'-P energy: -49.010 bonds (distance) P-C4' energy: -62.451 flat angles C4'-P-C4' energy: -63.443 flat angles P-C4'-P energy: -38.682 tors. eta vs tors. theta energy: -49.383 Dist. restrs. and SS energy: 0.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -685.400431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.400431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.837905 (E_RNA) where: Base-Base interactions energy: -455.875 where: short stacking energy: -195.045 Base-Backbone interact. energy: 0.947 local terms energy: -230.910254 where: bonds (distance) C4'-P energy: -51.735 bonds (distance) P-C4' energy: -48.213 flat angles C4'-P-C4' energy: -56.597 flat angles P-C4'-P energy: -32.436 tors. eta vs tors. theta energy: -41.930 Dist. restrs. and SS energy: 0.437 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -655.471350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.471350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.595268 (E_RNA) where: Base-Base interactions energy: -429.727 where: short stacking energy: -189.892 Base-Backbone interact. energy: -3.148 local terms energy: -229.719957 where: bonds (distance) C4'-P energy: -55.559 bonds (distance) P-C4' energy: -44.931 flat angles C4'-P-C4' energy: -59.762 flat angles P-C4'-P energy: -32.753 tors. eta vs tors. theta energy: -36.716 Dist. restrs. and SS energy: 7.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -1097.863584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1097.863584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1098.731689 (E_RNA) where: Base-Base interactions energy: -763.721 where: short stacking energy: -303.409 Base-Backbone interact. energy: -1.396 local terms energy: -333.615151 where: bonds (distance) C4'-P energy: -64.775 bonds (distance) P-C4' energy: -65.649 flat angles C4'-P-C4' energy: -68.218 flat angles P-C4'-P energy: -56.004 tors. eta vs tors. theta energy: -78.969 Dist. restrs. and SS energy: 0.868 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -1066.284979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1066.284979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1066.557365 (E_RNA) where: Base-Base interactions energy: -722.457 where: short stacking energy: -313.472 Base-Backbone interact. energy: -1.908 local terms energy: -342.192727 where: bonds (distance) C4'-P energy: -71.852 bonds (distance) P-C4' energy: -53.754 flat angles C4'-P-C4' energy: -76.383 flat angles P-C4'-P energy: -44.651 tors. eta vs tors. theta energy: -95.552 Dist. restrs. and SS energy: 0.272 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -1004.254977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.254977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1004.754659 (E_RNA) where: Base-Base interactions energy: -690.552 where: short stacking energy: -298.183 Base-Backbone interact. energy: -1.249 local terms energy: -312.954381 where: bonds (distance) C4'-P energy: -60.795 bonds (distance) P-C4' energy: -57.153 flat angles C4'-P-C4' energy: -68.197 flat angles P-C4'-P energy: -43.201 tors. eta vs tors. theta energy: -83.609 Dist. restrs. and SS energy: 0.500 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -949.293900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -949.293900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.565401 (E_RNA) where: Base-Base interactions energy: -634.006 where: short stacking energy: -280.055 Base-Backbone interact. energy: -1.529 local terms energy: -314.030918 where: bonds (distance) C4'-P energy: -64.153 bonds (distance) P-C4' energy: -64.554 flat angles C4'-P-C4' energy: -68.208 flat angles P-C4'-P energy: -36.301 tors. eta vs tors. theta energy: -80.814 Dist. restrs. and SS energy: 0.272 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -911.022207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -911.022207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.870293 (E_RNA) where: Base-Base interactions energy: -619.355 where: short stacking energy: -263.514 Base-Backbone interact. energy: -1.301 local terms energy: -291.214474 where: bonds (distance) C4'-P energy: -59.036 bonds (distance) P-C4' energy: -60.129 flat angles C4'-P-C4' energy: -57.345 flat angles P-C4'-P energy: -47.588 tors. eta vs tors. theta energy: -67.116 Dist. restrs. and SS energy: 0.848 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -828.816074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -828.816074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.651429 (E_RNA) where: Base-Base interactions energy: -547.918 where: short stacking energy: -253.998 Base-Backbone interact. energy: 2.989 local terms energy: -284.722467 where: bonds (distance) C4'-P energy: -59.094 bonds (distance) P-C4' energy: -57.649 flat angles C4'-P-C4' energy: -61.237 flat angles P-C4'-P energy: -47.251 tors. eta vs tors. theta energy: -59.491 Dist. restrs. and SS energy: 0.835 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -748.804707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.804707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.393611 (E_RNA) where: Base-Base interactions energy: -497.321 where: short stacking energy: -222.577 Base-Backbone interact. energy: -1.995 local terms energy: -250.077659 where: bonds (distance) C4'-P energy: -53.028 bonds (distance) P-C4' energy: -43.891 flat angles C4'-P-C4' energy: -57.068 flat angles P-C4'-P energy: -41.155 tors. eta vs tors. theta energy: -54.936 Dist. restrs. and SS energy: 0.589 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -711.276891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.276891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.644419 (E_RNA) where: Base-Base interactions energy: -463.145 where: short stacking energy: -186.053 Base-Backbone interact. energy: -0.606 local terms energy: -247.893156 where: bonds (distance) C4'-P energy: -44.800 bonds (distance) P-C4' energy: -60.908 flat angles C4'-P-C4' energy: -63.329 flat angles P-C4'-P energy: -40.360 tors. eta vs tors. theta energy: -38.496 Dist. restrs. and SS energy: 0.368 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -717.947913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.947913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.121426 (E_RNA) where: Base-Base interactions energy: -477.328 where: short stacking energy: -204.643 Base-Backbone interact. energy: -0.361 local terms energy: -240.432157 where: bonds (distance) C4'-P energy: -53.847 bonds (distance) P-C4' energy: -42.200 flat angles C4'-P-C4' energy: -53.235 flat angles P-C4'-P energy: -42.990 tors. eta vs tors. theta energy: -48.161 Dist. restrs. and SS energy: 0.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -638.213611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.213611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.702699 (E_RNA) where: Base-Base interactions energy: -438.356 where: short stacking energy: -193.935 Base-Backbone interact. energy: 1.275 local terms energy: -207.621908 where: bonds (distance) C4'-P energy: -37.525 bonds (distance) P-C4' energy: -60.281 flat angles C4'-P-C4' energy: -49.269 flat angles P-C4'-P energy: -20.396 tors. eta vs tors. theta energy: -40.151 Dist. restrs. and SS energy: 6.489 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -1113.452267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1113.452267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1113.521106 (E_RNA) where: Base-Base interactions energy: -770.529 where: short stacking energy: -345.504 Base-Backbone interact. energy: -0.954 local terms energy: -342.038128 where: bonds (distance) C4'-P energy: -63.296 bonds (distance) P-C4' energy: -61.083 flat angles C4'-P-C4' energy: -74.644 flat angles P-C4'-P energy: -51.849 tors. eta vs tors. theta energy: -91.166 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -1057.797002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.797002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1058.397212 (E_RNA) where: Base-Base interactions energy: -730.254 where: short stacking energy: -295.220 Base-Backbone interact. energy: -2.033 local terms energy: -326.110698 where: bonds (distance) C4'-P energy: -63.893 bonds (distance) P-C4' energy: -59.150 flat angles C4'-P-C4' energy: -77.126 flat angles P-C4'-P energy: -44.308 tors. eta vs tors. theta energy: -81.635 Dist. restrs. and SS energy: 0.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -1004.232436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.232436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1004.399610 (E_RNA) where: Base-Base interactions energy: -686.522 where: short stacking energy: -305.884 Base-Backbone interact. energy: -0.575 local terms energy: -317.302183 where: bonds (distance) C4'-P energy: -49.046 bonds (distance) P-C4' energy: -61.972 flat angles C4'-P-C4' energy: -68.559 flat angles P-C4'-P energy: -49.351 tors. eta vs tors. theta energy: -88.373 Dist. restrs. and SS energy: 0.167 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -986.643579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -986.643579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -987.340174 (E_RNA) where: Base-Base interactions energy: -667.085 where: short stacking energy: -301.818 Base-Backbone interact. energy: -0.934 local terms energy: -319.321325 where: bonds (distance) C4'-P energy: -61.134 bonds (distance) P-C4' energy: -53.696 flat angles C4'-P-C4' energy: -72.523 flat angles P-C4'-P energy: -41.959 tors. eta vs tors. theta energy: -90.009 Dist. restrs. and SS energy: 0.697 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -870.968355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -870.968355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.277757 (E_RNA) where: Base-Base interactions energy: -594.299 where: short stacking energy: -242.269 Base-Backbone interact. energy: -0.564 local terms energy: -276.414992 where: bonds (distance) C4'-P energy: -47.819 bonds (distance) P-C4' energy: -55.141 flat angles C4'-P-C4' energy: -65.759 flat angles P-C4'-P energy: -51.147 tors. eta vs tors. theta energy: -56.549 Dist. restrs. and SS energy: 0.309 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -856.394897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.394897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -857.019951 (E_RNA) where: Base-Base interactions energy: -588.408 where: short stacking energy: -235.279 Base-Backbone interact. energy: 0.988 local terms energy: -269.600083 where: bonds (distance) C4'-P energy: -55.452 bonds (distance) P-C4' energy: -57.623 flat angles C4'-P-C4' energy: -62.122 flat angles P-C4'-P energy: -39.151 tors. eta vs tors. theta energy: -55.251 Dist. restrs. and SS energy: 0.625 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -773.539012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -773.539012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.194635 (E_RNA) where: Base-Base interactions energy: -510.275 where: short stacking energy: -225.299 Base-Backbone interact. energy: -0.747 local terms energy: -263.172096 where: bonds (distance) C4'-P energy: -49.974 bonds (distance) P-C4' energy: -57.780 flat angles C4'-P-C4' energy: -67.379 flat angles P-C4'-P energy: -43.041 tors. eta vs tors. theta energy: -44.998 Dist. restrs. and SS energy: 0.656 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -696.392810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.392810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.481734 (E_RNA) where: Base-Base interactions energy: -456.166 where: short stacking energy: -199.046 Base-Backbone interact. energy: 1.743 local terms energy: -242.058838 where: bonds (distance) C4'-P energy: -53.698 bonds (distance) P-C4' energy: -54.960 flat angles C4'-P-C4' energy: -44.835 flat angles P-C4'-P energy: -48.076 tors. eta vs tors. theta energy: -40.489 Dist. restrs. and SS energy: 0.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -621.631171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.631171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -627.675400 (E_RNA) where: Base-Base interactions energy: -394.252 where: short stacking energy: -175.161 Base-Backbone interact. energy: 5.359 local terms energy: -238.782706 where: bonds (distance) C4'-P energy: -56.890 bonds (distance) P-C4' energy: -44.476 flat angles C4'-P-C4' energy: -60.419 flat angles P-C4'-P energy: -44.340 tors. eta vs tors. theta energy: -32.658 Dist. restrs. and SS energy: 6.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -686.905922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.905922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.106368 (E_RNA) where: Base-Base interactions energy: -430.690 where: short stacking energy: -166.969 Base-Backbone interact. energy: 0.724 local terms energy: -257.140007 where: bonds (distance) C4'-P energy: -56.088 bonds (distance) P-C4' energy: -55.089 flat angles C4'-P-C4' energy: -61.870 flat angles P-C4'-P energy: -44.498 tors. eta vs tors. theta energy: -39.595 Dist. restrs. and SS energy: 0.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -1127.393750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1127.393750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1127.877166 (E_RNA) where: Base-Base interactions energy: -773.529 where: short stacking energy: -326.773 Base-Backbone interact. energy: -1.319 local terms energy: -353.028936 where: bonds (distance) C4'-P energy: -60.356 bonds (distance) P-C4' energy: -73.745 flat angles C4'-P-C4' energy: -79.317 flat angles P-C4'-P energy: -51.975 tors. eta vs tors. theta energy: -87.636 Dist. restrs. and SS energy: 0.483 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -1057.936330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.936330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.211705 (E_RNA) where: Base-Base interactions energy: -727.493 where: short stacking energy: -307.088 Base-Backbone interact. energy: -1.284 local terms energy: -330.434271 where: bonds (distance) C4'-P energy: -61.419 bonds (distance) P-C4' energy: -64.041 flat angles C4'-P-C4' energy: -77.718 flat angles P-C4'-P energy: -51.763 tors. eta vs tors. theta energy: -75.493 Dist. restrs. and SS energy: 1.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -1015.674752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1015.674752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1016.091194 (E_RNA) where: Base-Base interactions energy: -690.449 where: short stacking energy: -294.914 Base-Backbone interact. energy: 0.302 local terms energy: -325.943452 where: bonds (distance) C4'-P energy: -60.205 bonds (distance) P-C4' energy: -62.449 flat angles C4'-P-C4' energy: -71.066 flat angles P-C4'-P energy: -44.852 tors. eta vs tors. theta energy: -87.372 Dist. restrs. and SS energy: 0.416 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -957.918553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -957.918553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.112915 (E_RNA) where: Base-Base interactions energy: -653.319 where: short stacking energy: -291.477 Base-Backbone interact. energy: 3.663 local terms energy: -308.457316 where: bonds (distance) C4'-P energy: -61.608 bonds (distance) P-C4' energy: -59.398 flat angles C4'-P-C4' energy: -63.718 flat angles P-C4'-P energy: -43.939 tors. eta vs tors. theta energy: -79.794 Dist. restrs. and SS energy: 0.194 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -805.585292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -805.585292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -805.766947 (E_RNA) where: Base-Base interactions energy: -536.551 where: short stacking energy: -234.556 Base-Backbone interact. energy: 0.789 local terms energy: -270.004669 where: bonds (distance) C4'-P energy: -51.294 bonds (distance) P-C4' energy: -58.991 flat angles C4'-P-C4' energy: -53.065 flat angles P-C4'-P energy: -44.234 tors. eta vs tors. theta energy: -62.421 Dist. restrs. and SS energy: 0.182 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -851.945294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -851.945294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -852.065153 (E_RNA) where: Base-Base interactions energy: -573.705 where: short stacking energy: -243.502 Base-Backbone interact. energy: -1.048 local terms energy: -277.312800 where: bonds (distance) C4'-P energy: -51.209 bonds (distance) P-C4' energy: -63.179 flat angles C4'-P-C4' energy: -70.028 flat angles P-C4'-P energy: -37.515 tors. eta vs tors. theta energy: -55.382 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -788.442244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -788.442244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.565484 (E_RNA) where: Base-Base interactions energy: -531.331 where: short stacking energy: -229.556 Base-Backbone interact. energy: 1.091 local terms energy: -258.325863 where: bonds (distance) C4'-P energy: -56.307 bonds (distance) P-C4' energy: -61.608 flat angles C4'-P-C4' energy: -55.113 flat angles P-C4'-P energy: -30.042 tors. eta vs tors. theta energy: -55.257 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -720.826641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.826641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.588755 (E_RNA) where: Base-Base interactions energy: -482.832 where: short stacking energy: -225.430 Base-Backbone interact. energy: 1.626 local terms energy: -240.382721 where: bonds (distance) C4'-P energy: -38.361 bonds (distance) P-C4' energy: -56.263 flat angles C4'-P-C4' energy: -57.268 flat angles P-C4'-P energy: -35.530 tors. eta vs tors. theta energy: -52.960 Dist. restrs. and SS energy: 0.762 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -633.386275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.386275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.677403 (E_RNA) where: Base-Base interactions energy: -415.413 where: short stacking energy: -188.826 Base-Backbone interact. energy: -0.662 local terms energy: -224.601718 where: bonds (distance) C4'-P energy: -45.218 bonds (distance) P-C4' energy: -58.004 flat angles C4'-P-C4' energy: -45.673 flat angles P-C4'-P energy: -39.542 tors. eta vs tors. theta energy: -36.165 Dist. restrs. and SS energy: 7.291 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -679.371304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.371304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.267357 (E_RNA) where: Base-Base interactions energy: -441.969 where: short stacking energy: -191.154 Base-Backbone interact. energy: -1.453 local terms energy: -236.844962 where: bonds (distance) C4'-P energy: -54.089 bonds (distance) P-C4' energy: -54.302 flat angles C4'-P-C4' energy: -64.823 flat angles P-C4'-P energy: -27.105 tors. eta vs tors. theta energy: -36.526 Dist. restrs. and SS energy: 0.896 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -1109.237929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1109.237929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1109.570597 (E_RNA) where: Base-Base interactions energy: -757.709 where: short stacking energy: -328.593 Base-Backbone interact. energy: -3.134 local terms energy: -348.727628 where: bonds (distance) C4'-P energy: -66.653 bonds (distance) P-C4' energy: -69.406 flat angles C4'-P-C4' energy: -73.758 flat angles P-C4'-P energy: -46.445 tors. eta vs tors. theta energy: -92.466 Dist. restrs. and SS energy: 0.333 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -1064.199293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.199293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1064.750980 (E_RNA) where: Base-Base interactions energy: -738.808 where: short stacking energy: -324.382 Base-Backbone interact. energy: -0.866 local terms energy: -325.076764 where: bonds (distance) C4'-P energy: -60.574 bonds (distance) P-C4' energy: -65.872 flat angles C4'-P-C4' energy: -67.657 flat angles P-C4'-P energy: -46.676 tors. eta vs tors. theta energy: -84.298 Dist. restrs. and SS energy: 0.552 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -1026.043270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.043270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1026.213053 (E_RNA) where: Base-Base interactions energy: -713.466 where: short stacking energy: -315.607 Base-Backbone interact. energy: -0.620 local terms energy: -312.127218 where: bonds (distance) C4'-P energy: -60.327 bonds (distance) P-C4' energy: -59.116 flat angles C4'-P-C4' energy: -69.667 flat angles P-C4'-P energy: -38.111 tors. eta vs tors. theta energy: -84.906 Dist. restrs. and SS energy: 0.170 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -971.513686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -971.513686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -971.754049 (E_RNA) where: Base-Base interactions energy: -667.569 where: short stacking energy: -296.862 Base-Backbone interact. energy: -0.696 local terms energy: -303.488938 where: bonds (distance) C4'-P energy: -55.089 bonds (distance) P-C4' energy: -58.849 flat angles C4'-P-C4' energy: -65.975 flat angles P-C4'-P energy: -48.333 tors. eta vs tors. theta energy: -75.242 Dist. restrs. and SS energy: 0.240 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -894.049424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.049424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -894.119476 (E_RNA) where: Base-Base interactions energy: -592.445 where: short stacking energy: -247.042 Base-Backbone interact. energy: 0.959 local terms energy: -302.633011 where: bonds (distance) C4'-P energy: -57.958 bonds (distance) P-C4' energy: -65.147 flat angles C4'-P-C4' energy: -74.049 flat angles P-C4'-P energy: -44.950 tors. eta vs tors. theta energy: -60.529 Dist. restrs. and SS energy: 0.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -824.438678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.438678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.863749 (E_RNA) where: Base-Base interactions energy: -541.570 where: short stacking energy: -255.815 Base-Backbone interact. energy: 0.137 local terms energy: -283.430925 where: bonds (distance) C4'-P energy: -56.890 bonds (distance) P-C4' energy: -55.734 flat angles C4'-P-C4' energy: -66.877 flat angles P-C4'-P energy: -41.346 tors. eta vs tors. theta energy: -62.583 Dist. restrs. and SS energy: 0.425 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -803.117912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.117912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -804.150396 (E_RNA) where: Base-Base interactions energy: -537.109 where: short stacking energy: -235.644 Base-Backbone interact. energy: 2.303 local terms energy: -269.345237 where: bonds (distance) C4'-P energy: -56.237 bonds (distance) P-C4' energy: -47.303 flat angles C4'-P-C4' energy: -65.486 flat angles P-C4'-P energy: -38.032 tors. eta vs tors. theta energy: -62.287 Dist. restrs. and SS energy: 1.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -712.841146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.841146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.495729 (E_RNA) where: Base-Base interactions energy: -463.920 where: short stacking energy: -204.732 Base-Backbone interact. energy: -0.507 local terms energy: -249.068422 where: bonds (distance) C4'-P energy: -53.882 bonds (distance) P-C4' energy: -61.747 flat angles C4'-P-C4' energy: -59.198 flat angles P-C4'-P energy: -34.384 tors. eta vs tors. theta energy: -39.857 Dist. restrs. and SS energy: 0.655 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -680.286016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.286016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.972514 (E_RNA) where: Base-Base interactions energy: -461.262 where: short stacking energy: -180.620 Base-Backbone interact. energy: 0.246 local terms energy: -219.956946 where: bonds (distance) C4'-P energy: -50.592 bonds (distance) P-C4' energy: -42.138 flat angles C4'-P-C4' energy: -65.013 flat angles P-C4'-P energy: -31.056 tors. eta vs tors. theta energy: -31.158 Dist. restrs. and SS energy: 0.686 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -581.380582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -581.380582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.842582 (E_RNA) where: Base-Base interactions energy: -368.249 where: short stacking energy: -145.539 Base-Backbone interact. energy: -1.089 local terms energy: -216.504623 where: bonds (distance) C4'-P energy: -52.356 bonds (distance) P-C4' energy: -68.731 flat angles C4'-P-C4' energy: -46.651 flat angles P-C4'-P energy: -25.905 tors. eta vs tors. theta energy: -22.861 Dist. restrs. and SS energy: 4.462 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -1109.348254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1109.348254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1109.849641 (E_RNA) where: Base-Base interactions energy: -747.493 where: short stacking energy: -321.262 Base-Backbone interact. energy: 0.046 local terms energy: -362.401784 where: bonds (distance) C4'-P energy: -72.954 bonds (distance) P-C4' energy: -66.678 flat angles C4'-P-C4' energy: -77.016 flat angles P-C4'-P energy: -54.599 tors. eta vs tors. theta energy: -91.154 Dist. restrs. and SS energy: 0.501 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -1096.491664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.491664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1097.701145 (E_RNA) where: Base-Base interactions energy: -751.393 where: short stacking energy: -311.621 Base-Backbone interact. energy: -2.335 local terms energy: -343.973726 where: bonds (distance) C4'-P energy: -62.054 bonds (distance) P-C4' energy: -66.988 flat angles C4'-P-C4' energy: -76.734 flat angles P-C4'-P energy: -50.060 tors. eta vs tors. theta energy: -88.138 Dist. restrs. and SS energy: 1.209 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -1023.626328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.626328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1024.011320 (E_RNA) where: Base-Base interactions energy: -685.806 where: short stacking energy: -296.001 Base-Backbone interact. energy: -0.056 local terms energy: -338.149552 where: bonds (distance) C4'-P energy: -61.583 bonds (distance) P-C4' energy: -69.773 flat angles C4'-P-C4' energy: -66.496 flat angles P-C4'-P energy: -53.097 tors. eta vs tors. theta energy: -87.200 Dist. restrs. and SS energy: 0.385 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -980.270378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.270378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -981.067522 (E_RNA) where: Base-Base interactions energy: -662.514 where: short stacking energy: -279.201 Base-Backbone interact. energy: 0.219 local terms energy: -318.772518 where: bonds (distance) C4'-P energy: -67.161 bonds (distance) P-C4' energy: -71.957 flat angles C4'-P-C4' energy: -73.800 flat angles P-C4'-P energy: -29.115 tors. eta vs tors. theta energy: -76.740 Dist. restrs. and SS energy: 0.797 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -925.916133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -925.916133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.218819 (E_RNA) where: Base-Base interactions energy: -617.144 where: short stacking energy: -268.291 Base-Backbone interact. energy: -1.020 local terms energy: -308.054997 where: bonds (distance) C4'-P energy: -59.630 bonds (distance) P-C4' energy: -58.885 flat angles C4'-P-C4' energy: -71.896 flat angles P-C4'-P energy: -49.034 tors. eta vs tors. theta energy: -68.610 Dist. restrs. and SS energy: 0.303 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -837.575890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.575890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.925437 (E_RNA) where: Base-Base interactions energy: -553.724 where: short stacking energy: -247.285 Base-Backbone interact. energy: -1.208 local terms energy: -282.993093 where: bonds (distance) C4'-P energy: -50.138 bonds (distance) P-C4' energy: -64.453 flat angles C4'-P-C4' energy: -65.765 flat angles P-C4'-P energy: -31.826 tors. eta vs tors. theta energy: -70.811 Dist. restrs. and SS energy: 0.350 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -763.452903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.452903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.712375 (E_RNA) where: Base-Base interactions energy: -529.461 where: short stacking energy: -224.719 Base-Backbone interact. energy: -3.017 local terms energy: -231.234643 where: bonds (distance) C4'-P energy: -42.944 bonds (distance) P-C4' energy: -49.690 flat angles C4'-P-C4' energy: -57.534 flat angles P-C4'-P energy: -36.509 tors. eta vs tors. theta energy: -44.557 Dist. restrs. and SS energy: 0.259 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -711.363060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.363060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.698017 (E_RNA) where: Base-Base interactions energy: -472.574 where: short stacking energy: -216.233 Base-Backbone interact. energy: 0.170 local terms energy: -239.293958 where: bonds (distance) C4'-P energy: -57.166 bonds (distance) P-C4' energy: -56.455 flat angles C4'-P-C4' energy: -54.502 flat angles P-C4'-P energy: -42.210 tors. eta vs tors. theta energy: -28.960 Dist. restrs. and SS energy: 0.335 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -746.753832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.753832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.171418 (E_RNA) where: Base-Base interactions energy: -510.298 where: short stacking energy: -204.084 Base-Backbone interact. energy: 4.553 local terms energy: -241.426791 where: bonds (distance) C4'-P energy: -50.091 bonds (distance) P-C4' energy: -43.863 flat angles C4'-P-C4' energy: -68.003 flat angles P-C4'-P energy: -39.794 tors. eta vs tors. theta energy: -39.676 Dist. restrs. and SS energy: 0.418 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -620.094121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -620.094121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.144711 (E_RNA) where: Base-Base interactions energy: -404.830 where: short stacking energy: -194.430 Base-Backbone interact. energy: 0.936 local terms energy: -225.251093 where: bonds (distance) C4'-P energy: -46.622 bonds (distance) P-C4' energy: -58.175 flat angles C4'-P-C4' energy: -46.651 flat angles P-C4'-P energy: -43.905 tors. eta vs tors. theta energy: -29.898 Dist. restrs. and SS energy: 9.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -1109.565702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1109.565702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1110.339891 (E_RNA) where: Base-Base interactions energy: -766.582 where: short stacking energy: -321.518 Base-Backbone interact. energy: 0.740 local terms energy: -344.498291 where: bonds (distance) C4'-P energy: -59.806 bonds (distance) P-C4' energy: -72.681 flat angles C4'-P-C4' energy: -76.142 flat angles P-C4'-P energy: -45.084 tors. eta vs tors. theta energy: -90.786 Dist. restrs. and SS energy: 0.774 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -1066.861599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1066.861599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1066.998043 (E_RNA) where: Base-Base interactions energy: -723.446 where: short stacking energy: -311.579 Base-Backbone interact. energy: -0.262 local terms energy: -343.289960 where: bonds (distance) C4'-P energy: -56.978 bonds (distance) P-C4' energy: -67.403 flat angles C4'-P-C4' energy: -73.650 flat angles P-C4'-P energy: -55.522 tors. eta vs tors. theta energy: -89.736 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -1001.061349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.061349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1001.797791 (E_RNA) where: Base-Base interactions energy: -679.315 where: short stacking energy: -306.006 Base-Backbone interact. energy: -1.403 local terms energy: -321.080137 where: bonds (distance) C4'-P energy: -62.878 bonds (distance) P-C4' energy: -57.727 flat angles C4'-P-C4' energy: -68.667 flat angles P-C4'-P energy: -52.516 tors. eta vs tors. theta energy: -79.291 Dist. restrs. and SS energy: 0.736 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -972.113506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.113506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.910180 (E_RNA) where: Base-Base interactions energy: -675.924 where: short stacking energy: -283.476 Base-Backbone interact. energy: 2.433 local terms energy: -299.419194 where: bonds (distance) C4'-P energy: -61.504 bonds (distance) P-C4' energy: -59.972 flat angles C4'-P-C4' energy: -55.980 flat angles P-C4'-P energy: -44.491 tors. eta vs tors. theta energy: -77.471 Dist. restrs. and SS energy: 0.797 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -918.911316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -918.911316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.276592 (E_RNA) where: Base-Base interactions energy: -633.376 where: short stacking energy: -276.313 Base-Backbone interact. energy: -1.711 local terms energy: -284.190164 where: bonds (distance) C4'-P energy: -48.943 bonds (distance) P-C4' energy: -56.707 flat angles C4'-P-C4' energy: -69.972 flat angles P-C4'-P energy: -39.844 tors. eta vs tors. theta energy: -68.724 Dist. restrs. and SS energy: 0.365 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -833.279000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.279000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.400429 (E_RNA) where: Base-Base interactions energy: -555.367 where: short stacking energy: -247.667 Base-Backbone interact. energy: -1.127 local terms energy: -276.906624 where: bonds (distance) C4'-P energy: -55.011 bonds (distance) P-C4' energy: -61.100 flat angles C4'-P-C4' energy: -65.709 flat angles P-C4'-P energy: -37.088 tors. eta vs tors. theta energy: -57.998 Dist. restrs. and SS energy: 0.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -791.224332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.224332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -792.405781 (E_RNA) where: Base-Base interactions energy: -523.099 where: short stacking energy: -225.827 Base-Backbone interact. energy: -2.727 local terms energy: -266.579971 where: bonds (distance) C4'-P energy: -52.842 bonds (distance) P-C4' energy: -56.708 flat angles C4'-P-C4' energy: -63.173 flat angles P-C4'-P energy: -37.136 tors. eta vs tors. theta energy: -56.721 Dist. restrs. and SS energy: 1.181 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -697.568794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.568794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.033240 (E_RNA) where: Base-Base interactions energy: -460.566 where: short stacking energy: -202.153 Base-Backbone interact. energy: 1.070 local terms energy: -238.536802 where: bonds (distance) C4'-P energy: -50.085 bonds (distance) P-C4' energy: -56.081 flat angles C4'-P-C4' energy: -48.001 flat angles P-C4'-P energy: -34.950 tors. eta vs tors. theta energy: -49.420 Dist. restrs. and SS energy: 0.464 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -754.785995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -754.785995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.368766 (E_RNA) where: Base-Base interactions energy: -498.840 where: short stacking energy: -208.611 Base-Backbone interact. energy: -2.653 local terms energy: -253.875479 where: bonds (distance) C4'-P energy: -50.332 bonds (distance) P-C4' energy: -61.505 flat angles C4'-P-C4' energy: -65.462 flat angles P-C4'-P energy: -31.468 tors. eta vs tors. theta energy: -45.108 Dist. restrs. and SS energy: 0.583 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -602.714311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.714311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.815815 (E_RNA) where: Base-Base interactions energy: -401.800 where: short stacking energy: -192.930 Base-Backbone interact. energy: 1.857 local terms energy: -210.873161 where: bonds (distance) C4'-P energy: -58.119 bonds (distance) P-C4' energy: -37.407 flat angles C4'-P-C4' energy: -46.032 flat angles P-C4'-P energy: -30.798 tors. eta vs tors. theta energy: -38.517 Dist. restrs. and SS energy: 8.102 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -1089.551220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.551220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1089.786433 (E_RNA) where: Base-Base interactions energy: -751.749 where: short stacking energy: -308.710 Base-Backbone interact. energy: -1.026 local terms energy: -337.012074 where: bonds (distance) C4'-P energy: -70.051 bonds (distance) P-C4' energy: -66.530 flat angles C4'-P-C4' energy: -69.112 flat angles P-C4'-P energy: -47.651 tors. eta vs tors. theta energy: -83.668 Dist. restrs. and SS energy: 0.235 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -1056.872059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1056.872059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1056.933428 (E_RNA) where: Base-Base interactions energy: -730.622 where: short stacking energy: -316.808 Base-Backbone interact. energy: -0.688 local terms energy: -325.623444 where: bonds (distance) C4'-P energy: -61.338 bonds (distance) P-C4' energy: -59.600 flat angles C4'-P-C4' energy: -65.363 flat angles P-C4'-P energy: -52.996 tors. eta vs tors. theta energy: -86.326 Dist. restrs. and SS energy: 0.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -1037.209965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.209965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1037.569548 (E_RNA) where: Base-Base interactions energy: -700.894 where: short stacking energy: -298.804 Base-Backbone interact. energy: -3.058 local terms energy: -333.617048 where: bonds (distance) C4'-P energy: -59.449 bonds (distance) P-C4' energy: -71.515 flat angles C4'-P-C4' energy: -73.691 flat angles P-C4'-P energy: -44.679 tors. eta vs tors. theta energy: -84.283 Dist. restrs. and SS energy: 0.360 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -972.386502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.386502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.686846 (E_RNA) where: Base-Base interactions energy: -664.512 where: short stacking energy: -291.552 Base-Backbone interact. energy: -0.703 local terms energy: -307.472378 where: bonds (distance) C4'-P energy: -65.056 bonds (distance) P-C4' energy: -61.280 flat angles C4'-P-C4' energy: -67.033 flat angles P-C4'-P energy: -37.915 tors. eta vs tors. theta energy: -76.188 Dist. restrs. and SS energy: 0.300 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -924.706538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -924.706538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -925.436154 (E_RNA) where: Base-Base interactions energy: -650.452 where: short stacking energy: -264.148 Base-Backbone interact. energy: -1.591 local terms energy: -273.393435 where: bonds (distance) C4'-P energy: -50.177 bonds (distance) P-C4' energy: -55.597 flat angles C4'-P-C4' energy: -60.633 flat angles P-C4'-P energy: -34.241 tors. eta vs tors. theta energy: -72.745 Dist. restrs. and SS energy: 0.730 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -829.118817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.118817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.540806 (E_RNA) where: Base-Base interactions energy: -541.201 where: short stacking energy: -237.270 Base-Backbone interact. energy: -2.070 local terms energy: -286.269399 where: bonds (distance) C4'-P energy: -59.339 bonds (distance) P-C4' energy: -62.793 flat angles C4'-P-C4' energy: -67.345 flat angles P-C4'-P energy: -43.497 tors. eta vs tors. theta energy: -53.295 Dist. restrs. and SS energy: 0.422 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -788.227787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -788.227787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.447607 (E_RNA) where: Base-Base interactions energy: -522.405 where: short stacking energy: -232.665 Base-Backbone interact. energy: -0.961 local terms energy: -265.081219 where: bonds (distance) C4'-P energy: -63.682 bonds (distance) P-C4' energy: -55.027 flat angles C4'-P-C4' energy: -59.396 flat angles P-C4'-P energy: -31.994 tors. eta vs tors. theta energy: -54.982 Dist. restrs. and SS energy: 0.220 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -799.856790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.856790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.207856 (E_RNA) where: Base-Base interactions energy: -537.392 where: short stacking energy: -228.330 Base-Backbone interact. energy: 0.098 local terms energy: -262.913973 where: bonds (distance) C4'-P energy: -60.419 bonds (distance) P-C4' energy: -59.972 flat angles C4'-P-C4' energy: -56.712 flat angles P-C4'-P energy: -37.660 tors. eta vs tors. theta energy: -48.151 Dist. restrs. and SS energy: 0.351 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -674.693330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.693330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.092043 (E_RNA) where: Base-Base interactions energy: -431.775 where: short stacking energy: -180.333 Base-Backbone interact. energy: -2.301 local terms energy: -241.016385 where: bonds (distance) C4'-P energy: -60.756 bonds (distance) P-C4' energy: -49.854 flat angles C4'-P-C4' energy: -54.666 flat angles P-C4'-P energy: -39.933 tors. eta vs tors. theta energy: -35.808 Dist. restrs. and SS energy: 0.399 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -610.011242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -610.011242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.946063 (E_RNA) where: Base-Base interactions energy: -408.198 where: short stacking energy: -188.817 Base-Backbone interact. energy: -0.795 local terms energy: -213.953095 where: bonds (distance) C4'-P energy: -46.942 bonds (distance) P-C4' energy: -40.317 flat angles C4'-P-C4' energy: -53.694 flat angles P-C4'-P energy: -31.715 tors. eta vs tors. theta energy: -41.285 Dist. restrs. and SS energy: 12.935 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -1049.946270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1049.946270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1050.481208 (E_RNA) where: Base-Base interactions energy: -733.210 where: short stacking energy: -313.344 Base-Backbone interact. energy: -0.788 local terms energy: -316.483172 where: bonds (distance) C4'-P energy: -61.610 bonds (distance) P-C4' energy: -64.768 flat angles C4'-P-C4' energy: -65.314 flat angles P-C4'-P energy: -46.127 tors. eta vs tors. theta energy: -78.664 Dist. restrs. and SS energy: 0.535 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -1067.420646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.420646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1068.420359 (E_RNA) where: Base-Base interactions energy: -743.227 where: short stacking energy: -314.806 Base-Backbone interact. energy: -4.786 local terms energy: -320.407165 where: bonds (distance) C4'-P energy: -66.969 bonds (distance) P-C4' energy: -63.997 flat angles C4'-P-C4' energy: -67.249 flat angles P-C4'-P energy: -42.246 tors. eta vs tors. theta energy: -79.946 Dist. restrs. and SS energy: 1.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -1042.718141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1042.718141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1042.978544 (E_RNA) where: Base-Base interactions energy: -704.076 where: short stacking energy: -298.680 Base-Backbone interact. energy: -1.524 local terms energy: -337.378329 where: bonds (distance) C4'-P energy: -59.725 bonds (distance) P-C4' energy: -65.097 flat angles C4'-P-C4' energy: -83.139 flat angles P-C4'-P energy: -47.247 tors. eta vs tors. theta energy: -82.170 Dist. restrs. and SS energy: 0.260 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -967.500537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -967.500537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -968.070727 (E_RNA) where: Base-Base interactions energy: -664.174 where: short stacking energy: -286.362 Base-Backbone interact. energy: -0.386 local terms energy: -303.511115 where: bonds (distance) C4'-P energy: -58.585 bonds (distance) P-C4' energy: -65.529 flat angles C4'-P-C4' energy: -69.697 flat angles P-C4'-P energy: -37.337 tors. eta vs tors. theta energy: -72.364 Dist. restrs. and SS energy: 0.570 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -939.583471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -939.583471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.620197 (E_RNA) where: Base-Base interactions energy: -650.119 where: short stacking energy: -268.577 Base-Backbone interact. energy: -0.575 local terms energy: -289.926097 where: bonds (distance) C4'-P energy: -50.682 bonds (distance) P-C4' energy: -60.750 flat angles C4'-P-C4' energy: -69.775 flat angles P-C4'-P energy: -44.614 tors. eta vs tors. theta energy: -64.105 Dist. restrs. and SS energy: 1.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -808.175331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -808.175331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -808.582950 (E_RNA) where: Base-Base interactions energy: -555.300 where: short stacking energy: -224.507 Base-Backbone interact. energy: 1.241 local terms energy: -254.524018 where: bonds (distance) C4'-P energy: -63.360 bonds (distance) P-C4' energy: -54.156 flat angles C4'-P-C4' energy: -53.050 flat angles P-C4'-P energy: -38.090 tors. eta vs tors. theta energy: -45.868 Dist. restrs. and SS energy: 0.408 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -779.720175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.720175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.409798 (E_RNA) where: Base-Base interactions energy: -517.311 where: short stacking energy: -216.945 Base-Backbone interact. energy: -0.806 local terms energy: -262.292810 where: bonds (distance) C4'-P energy: -49.065 bonds (distance) P-C4' energy: -57.233 flat angles C4'-P-C4' energy: -70.154 flat angles P-C4'-P energy: -37.296 tors. eta vs tors. theta energy: -48.544 Dist. restrs. and SS energy: 0.690 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -752.406869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.406869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.923730 (E_RNA) where: Base-Base interactions energy: -499.980 where: short stacking energy: -205.029 Base-Backbone interact. energy: -1.211 local terms energy: -251.732014 where: bonds (distance) C4'-P energy: -58.499 bonds (distance) P-C4' energy: -52.924 flat angles C4'-P-C4' energy: -58.510 flat angles P-C4'-P energy: -36.885 tors. eta vs tors. theta energy: -44.914 Dist. restrs. and SS energy: 0.517 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -619.772333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.772333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -625.850139 (E_RNA) where: Base-Base interactions energy: -395.320 where: short stacking energy: -172.360 Base-Backbone interact. energy: -1.033 local terms energy: -229.497090 where: bonds (distance) C4'-P energy: -44.068 bonds (distance) P-C4' energy: -58.872 flat angles C4'-P-C4' energy: -52.710 flat angles P-C4'-P energy: -36.947 tors. eta vs tors. theta energy: -36.900 Dist. restrs. and SS energy: 6.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -671.977459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.977459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.987143 (E_RNA) where: Base-Base interactions energy: -453.724 where: short stacking energy: -181.391 Base-Backbone interact. energy: 1.120 local terms energy: -220.382874 where: bonds (distance) C4'-P energy: -62.837 bonds (distance) P-C4' energy: -53.786 flat angles C4'-P-C4' energy: -45.230 flat angles P-C4'-P energy: -30.744 tors. eta vs tors. theta energy: -27.785 Dist. restrs. and SS energy: 1.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -1071.038339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1071.038339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1071.212104 (E_RNA) where: Base-Base interactions energy: -734.186 where: short stacking energy: -310.318 Base-Backbone interact. energy: -1.338 local terms energy: -335.688250 where: bonds (distance) C4'-P energy: -65.351 bonds (distance) P-C4' energy: -62.903 flat angles C4'-P-C4' energy: -74.315 flat angles P-C4'-P energy: -53.758 tors. eta vs tors. theta energy: -79.362 Dist. restrs. and SS energy: 0.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -1074.605226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1074.605226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1075.680612 (E_RNA) where: Base-Base interactions energy: -743.470 where: short stacking energy: -307.937 Base-Backbone interact. energy: -1.467 local terms energy: -330.743036 where: bonds (distance) C4'-P energy: -65.767 bonds (distance) P-C4' energy: -62.160 flat angles C4'-P-C4' energy: -75.477 flat angles P-C4'-P energy: -40.050 tors. eta vs tors. theta energy: -87.289 Dist. restrs. and SS energy: 1.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -1021.734691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.734691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1022.025356 (E_RNA) where: Base-Base interactions energy: -709.210 where: short stacking energy: -297.685 Base-Backbone interact. energy: -1.507 local terms energy: -311.308721 where: bonds (distance) C4'-P energy: -64.042 bonds (distance) P-C4' energy: -57.412 flat angles C4'-P-C4' energy: -63.979 flat angles P-C4'-P energy: -47.419 tors. eta vs tors. theta energy: -78.456 Dist. restrs. and SS energy: 0.291 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -998.558328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -998.558328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.727796 (E_RNA) where: Base-Base interactions energy: -719.849 where: short stacking energy: -300.470 Base-Backbone interact. energy: -0.183 local terms energy: -278.696462 where: bonds (distance) C4'-P energy: -55.499 bonds (distance) P-C4' energy: -47.349 flat angles C4'-P-C4' energy: -69.387 flat angles P-C4'-P energy: -37.192 tors. eta vs tors. theta energy: -69.269 Dist. restrs. and SS energy: 0.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -946.568064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -946.568064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -946.835855 (E_RNA) where: Base-Base interactions energy: -651.602 where: short stacking energy: -266.723 Base-Backbone interact. energy: -1.253 local terms energy: -293.980038 where: bonds (distance) C4'-P energy: -60.600 bonds (distance) P-C4' energy: -56.653 flat angles C4'-P-C4' energy: -69.583 flat angles P-C4'-P energy: -41.695 tors. eta vs tors. theta energy: -65.448 Dist. restrs. and SS energy: 0.268 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -785.773022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.773022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.177534 (E_RNA) where: Base-Base interactions energy: -516.975 where: short stacking energy: -218.315 Base-Backbone interact. energy: 0.041 local terms energy: -269.243262 where: bonds (distance) C4'-P energy: -54.114 bonds (distance) P-C4' energy: -65.305 flat angles C4'-P-C4' energy: -62.044 flat angles P-C4'-P energy: -37.591 tors. eta vs tors. theta energy: -50.189 Dist. restrs. and SS energy: 0.405 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -834.515512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.515512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.771184 (E_RNA) where: Base-Base interactions energy: -550.359 where: short stacking energy: -221.395 Base-Backbone interact. energy: 1.917 local terms energy: -286.329055 where: bonds (distance) C4'-P energy: -60.379 bonds (distance) P-C4' energy: -55.664 flat angles C4'-P-C4' energy: -71.112 flat angles P-C4'-P energy: -46.183 tors. eta vs tors. theta energy: -52.991 Dist. restrs. and SS energy: 0.256 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -767.702442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.702442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.125093 (E_RNA) where: Base-Base interactions energy: -514.979 where: short stacking energy: -223.650 Base-Backbone interact. energy: -1.000 local terms energy: -253.145613 where: bonds (distance) C4'-P energy: -50.582 bonds (distance) P-C4' energy: -65.786 flat angles C4'-P-C4' energy: -55.637 flat angles P-C4'-P energy: -37.475 tors. eta vs tors. theta energy: -43.665 Dist. restrs. and SS energy: 1.423 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -652.155856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -652.155856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.833570 (E_RNA) where: Base-Base interactions energy: -432.952 where: short stacking energy: -172.302 Base-Backbone interact. energy: -0.912 local terms energy: -219.969773 where: bonds (distance) C4'-P energy: -55.129 bonds (distance) P-C4' energy: -52.095 flat angles C4'-P-C4' energy: -52.300 flat angles P-C4'-P energy: -30.395 tors. eta vs tors. theta energy: -30.051 Dist. restrs. and SS energy: 1.678 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -667.216429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.216429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.667843 (E_RNA) where: Base-Base interactions energy: -442.485 where: short stacking energy: -183.245 Base-Backbone interact. energy: 1.464 local terms energy: -226.646660 where: bonds (distance) C4'-P energy: -47.064 bonds (distance) P-C4' energy: -63.031 flat angles C4'-P-C4' energy: -56.744 flat angles P-C4'-P energy: -24.555 tors. eta vs tors. theta energy: -35.253 Dist. restrs. and SS energy: 0.451 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -1121.743098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1121.743098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1122.027866 (E_RNA) where: Base-Base interactions energy: -777.627 where: short stacking energy: -328.405 Base-Backbone interact. energy: -3.690 local terms energy: -340.710737 where: bonds (distance) C4'-P energy: -62.303 bonds (distance) P-C4' energy: -61.512 flat angles C4'-P-C4' energy: -72.673 flat angles P-C4'-P energy: -48.186 tors. eta vs tors. theta energy: -96.037 Dist. restrs. and SS energy: 0.285 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -1046.443012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1046.443012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1046.962936 (E_RNA) where: Base-Base interactions energy: -711.210 where: short stacking energy: -311.642 Base-Backbone interact. energy: -1.871 local terms energy: -333.882354 where: bonds (distance) C4'-P energy: -66.937 bonds (distance) P-C4' energy: -54.233 flat angles C4'-P-C4' energy: -76.300 flat angles P-C4'-P energy: -53.235 tors. eta vs tors. theta energy: -83.177 Dist. restrs. and SS energy: 0.520 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -1053.285254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.285254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1054.036631 (E_RNA) where: Base-Base interactions energy: -741.695 where: short stacking energy: -296.880 Base-Backbone interact. energy: 0.187 local terms energy: -312.528556 where: bonds (distance) C4'-P energy: -68.253 bonds (distance) P-C4' energy: -67.419 flat angles C4'-P-C4' energy: -54.097 flat angles P-C4'-P energy: -48.780 tors. eta vs tors. theta energy: -73.981 Dist. restrs. and SS energy: 0.751 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -1011.336564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.336564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.515613 (E_RNA) where: Base-Base interactions energy: -704.141 where: short stacking energy: -292.552 Base-Backbone interact. energy: 0.751 local terms energy: -308.125002 where: bonds (distance) C4'-P energy: -66.872 bonds (distance) P-C4' energy: -60.285 flat angles C4'-P-C4' energy: -60.477 flat angles P-C4'-P energy: -39.333 tors. eta vs tors. theta energy: -81.159 Dist. restrs. and SS energy: 0.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -890.245357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -890.245357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -890.657032 (E_RNA) where: Base-Base interactions energy: -617.880 where: short stacking energy: -258.066 Base-Backbone interact. energy: 1.196 local terms energy: -273.972582 where: bonds (distance) C4'-P energy: -66.788 bonds (distance) P-C4' energy: -44.394 flat angles C4'-P-C4' energy: -57.327 flat angles P-C4'-P energy: -37.091 tors. eta vs tors. theta energy: -68.372 Dist. restrs. and SS energy: 0.412 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -860.525002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.525002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.864000 (E_RNA) where: Base-Base interactions energy: -585.476 where: short stacking energy: -249.879 Base-Backbone interact. energy: -1.488 local terms energy: -273.899496 where: bonds (distance) C4'-P energy: -61.416 bonds (distance) P-C4' energy: -65.960 flat angles C4'-P-C4' energy: -54.643 flat angles P-C4'-P energy: -27.733 tors. eta vs tors. theta energy: -64.148 Dist. restrs. and SS energy: 0.339 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -803.009720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.009720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -803.489176 (E_RNA) where: Base-Base interactions energy: -510.805 where: short stacking energy: -224.459 Base-Backbone interact. energy: -1.369 local terms energy: -291.314989 where: bonds (distance) C4'-P energy: -60.688 bonds (distance) P-C4' energy: -73.107 flat angles C4'-P-C4' energy: -58.535 flat angles P-C4'-P energy: -45.908 tors. eta vs tors. theta energy: -53.077 Dist. restrs. and SS energy: 0.479 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -791.599287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.599287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.822219 (E_RNA) where: Base-Base interactions energy: -533.977 where: short stacking energy: -228.106 Base-Backbone interact. energy: -0.257 local terms energy: -257.588393 where: bonds (distance) C4'-P energy: -49.636 bonds (distance) P-C4' energy: -56.448 flat angles C4'-P-C4' energy: -58.454 flat angles P-C4'-P energy: -33.729 tors. eta vs tors. theta energy: -59.321 Dist. restrs. and SS energy: 0.223 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -659.816771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.816771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.010230 (E_RNA) where: Base-Base interactions energy: -428.954 where: short stacking energy: -175.398 Base-Backbone interact. energy: -0.476 local terms energy: -233.579853 where: bonds (distance) C4'-P energy: -60.126 bonds (distance) P-C4' energy: -54.262 flat angles C4'-P-C4' energy: -60.986 flat angles P-C4'-P energy: -30.719 tors. eta vs tors. theta energy: -27.487 Dist. restrs. and SS energy: 3.193 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -708.664401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.664401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.907853 (E_RNA) where: Base-Base interactions energy: -472.888 where: short stacking energy: -207.481 Base-Backbone interact. energy: -0.248 local terms energy: -235.771549 where: bonds (distance) C4'-P energy: -36.118 bonds (distance) P-C4' energy: -57.917 flat angles C4'-P-C4' energy: -51.266 flat angles P-C4'-P energy: -32.338 tors. eta vs tors. theta energy: -58.132 Dist. restrs. and SS energy: 0.243 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -1118.324193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1118.324193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1119.121215 (E_RNA) where: Base-Base interactions energy: -785.257 where: short stacking energy: -308.689 Base-Backbone interact. energy: -0.837 local terms energy: -333.027564 where: bonds (distance) C4'-P energy: -65.588 bonds (distance) P-C4' energy: -68.241 flat angles C4'-P-C4' energy: -72.395 flat angles P-C4'-P energy: -43.822 tors. eta vs tors. theta energy: -82.983 Dist. restrs. and SS energy: 0.797 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -1068.975864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.975864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1069.477161 (E_RNA) where: Base-Base interactions energy: -732.095 where: short stacking energy: -302.414 Base-Backbone interact. energy: 1.155 local terms energy: -338.536530 where: bonds (distance) C4'-P energy: -71.223 bonds (distance) P-C4' energy: -63.800 flat angles C4'-P-C4' energy: -74.548 flat angles P-C4'-P energy: -47.291 tors. eta vs tors. theta energy: -81.675 Dist. restrs. and SS energy: 0.501 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -1046.664754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1046.664754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1046.695551 (E_RNA) where: Base-Base interactions energy: -729.962 where: short stacking energy: -303.807 Base-Backbone interact. energy: -1.468 local terms energy: -315.265586 where: bonds (distance) C4'-P energy: -63.505 bonds (distance) P-C4' energy: -59.759 flat angles C4'-P-C4' energy: -65.558 flat angles P-C4'-P energy: -45.889 tors. eta vs tors. theta energy: -80.556 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -984.880988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.880988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -985.076683 (E_RNA) where: Base-Base interactions energy: -676.398 where: short stacking energy: -254.397 Base-Backbone interact. energy: -1.873 local terms energy: -306.805549 where: bonds (distance) C4'-P energy: -63.188 bonds (distance) P-C4' energy: -61.689 flat angles C4'-P-C4' energy: -69.257 flat angles P-C4'-P energy: -43.227 tors. eta vs tors. theta energy: -69.444 Dist. restrs. and SS energy: 0.196 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -916.420840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -916.420840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -916.908233 (E_RNA) where: Base-Base interactions energy: -628.199 where: short stacking energy: -280.779 Base-Backbone interact. energy: -0.592 local terms energy: -288.117524 where: bonds (distance) C4'-P energy: -49.413 bonds (distance) P-C4' energy: -67.736 flat angles C4'-P-C4' energy: -65.324 flat angles P-C4'-P energy: -30.406 tors. eta vs tors. theta energy: -75.239 Dist. restrs. and SS energy: 0.487 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -866.760435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.760435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.260140 (E_RNA) where: Base-Base interactions energy: -592.474 where: short stacking energy: -267.670 Base-Backbone interact. energy: -1.102 local terms energy: -273.684348 where: bonds (distance) C4'-P energy: -52.220 bonds (distance) P-C4' energy: -56.910 flat angles C4'-P-C4' energy: -58.681 flat angles P-C4'-P energy: -43.275 tors. eta vs tors. theta energy: -62.599 Dist. restrs. and SS energy: 0.500 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -853.489356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.489356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -854.001092 (E_RNA) where: Base-Base interactions energy: -569.070 where: short stacking energy: -262.417 Base-Backbone interact. energy: -0.486 local terms energy: -284.444760 where: bonds (distance) C4'-P energy: -52.307 bonds (distance) P-C4' energy: -59.926 flat angles C4'-P-C4' energy: -62.774 flat angles P-C4'-P energy: -50.160 tors. eta vs tors. theta energy: -59.278 Dist. restrs. and SS energy: 0.512 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -797.228114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.228114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.353151 (E_RNA) where: Base-Base interactions energy: -554.642 where: short stacking energy: -222.607 Base-Backbone interact. energy: -1.468 local terms energy: -241.242573 where: bonds (distance) C4'-P energy: -44.916 bonds (distance) P-C4' energy: -56.623 flat angles C4'-P-C4' energy: -63.821 flat angles P-C4'-P energy: -30.395 tors. eta vs tors. theta energy: -45.487 Dist. restrs. and SS energy: 0.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -657.998083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.998083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.862556 (E_RNA) where: Base-Base interactions energy: -422.871 where: short stacking energy: -178.677 Base-Backbone interact. energy: -2.957 local terms energy: -236.034914 where: bonds (distance) C4'-P energy: -52.024 bonds (distance) P-C4' energy: -59.860 flat angles C4'-P-C4' energy: -52.780 flat angles P-C4'-P energy: -37.719 tors. eta vs tors. theta energy: -33.652 Dist. restrs. and SS energy: 3.864 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -691.918517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.918517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.032980 (E_RNA) where: Base-Base interactions energy: -446.367 where: short stacking energy: -181.115 Base-Backbone interact. energy: -0.361 local terms energy: -245.304582 where: bonds (distance) C4'-P energy: -58.280 bonds (distance) P-C4' energy: -54.453 flat angles C4'-P-C4' energy: -58.541 flat angles P-C4'-P energy: -32.843 tors. eta vs tors. theta energy: -41.188 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -1101.503558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1101.503558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1102.147474 (E_RNA) where: Base-Base interactions energy: -764.647 where: short stacking energy: -310.630 Base-Backbone interact. energy: -3.500 local terms energy: -334.000795 where: bonds (distance) C4'-P energy: -57.283 bonds (distance) P-C4' energy: -68.381 flat angles C4'-P-C4' energy: -69.850 flat angles P-C4'-P energy: -47.474 tors. eta vs tors. theta energy: -91.013 Dist. restrs. and SS energy: 0.644 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -1056.473759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1056.473759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1057.099481 (E_RNA) where: Base-Base interactions energy: -714.756 where: short stacking energy: -315.341 Base-Backbone interact. energy: -1.157 local terms energy: -341.185912 where: bonds (distance) C4'-P energy: -69.807 bonds (distance) P-C4' energy: -69.811 flat angles C4'-P-C4' energy: -66.078 flat angles P-C4'-P energy: -49.547 tors. eta vs tors. theta energy: -85.943 Dist. restrs. and SS energy: 0.626 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -1032.420772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1032.420772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1032.920200 (E_RNA) where: Base-Base interactions energy: -700.676 where: short stacking energy: -303.566 Base-Backbone interact. energy: -0.671 local terms energy: -331.573978 where: bonds (distance) C4'-P energy: -57.041 bonds (distance) P-C4' energy: -63.797 flat angles C4'-P-C4' energy: -74.224 flat angles P-C4'-P energy: -61.942 tors. eta vs tors. theta energy: -74.570 Dist. restrs. and SS energy: 0.499 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -1027.080310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1027.080310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1027.366335 (E_RNA) where: Base-Base interactions energy: -718.295 where: short stacking energy: -296.805 Base-Backbone interact. energy: -1.272 local terms energy: -307.799614 where: bonds (distance) C4'-P energy: -56.213 bonds (distance) P-C4' energy: -62.609 flat angles C4'-P-C4' energy: -70.525 flat angles P-C4'-P energy: -46.519 tors. eta vs tors. theta energy: -71.933 Dist. restrs. and SS energy: 0.286 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -948.073087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -948.073087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -948.442518 (E_RNA) where: Base-Base interactions energy: -647.982 where: short stacking energy: -268.037 Base-Backbone interact. energy: 0.676 local terms energy: -301.136830 where: bonds (distance) C4'-P energy: -61.808 bonds (distance) P-C4' energy: -62.000 flat angles C4'-P-C4' energy: -66.618 flat angles P-C4'-P energy: -38.454 tors. eta vs tors. theta energy: -72.256 Dist. restrs. and SS energy: 0.369 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -897.064085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.064085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.208178 (E_RNA) where: Base-Base interactions energy: -608.098 where: short stacking energy: -256.528 Base-Backbone interact. energy: -0.115 local terms energy: -288.995222 where: bonds (distance) C4'-P energy: -45.636 bonds (distance) P-C4' energy: -65.266 flat angles C4'-P-C4' energy: -68.368 flat angles P-C4'-P energy: -45.194 tors. eta vs tors. theta energy: -64.531 Dist. restrs. and SS energy: 0.144 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -825.191379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -825.191379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -825.934658 (E_RNA) where: Base-Base interactions energy: -550.839 where: short stacking energy: -234.577 Base-Backbone interact. energy: -0.948 local terms energy: -274.147779 where: bonds (distance) C4'-P energy: -52.016 bonds (distance) P-C4' energy: -57.450 flat angles C4'-P-C4' energy: -62.451 flat angles P-C4'-P energy: -42.108 tors. eta vs tors. theta energy: -60.124 Dist. restrs. and SS energy: 0.743 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -803.750967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.750967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -804.000565 (E_RNA) where: Base-Base interactions energy: -566.575 where: short stacking energy: -225.049 Base-Backbone interact. energy: -1.093 local terms energy: -236.332295 where: bonds (distance) C4'-P energy: -49.597 bonds (distance) P-C4' energy: -49.110 flat angles C4'-P-C4' energy: -56.734 flat angles P-C4'-P energy: -24.514 tors. eta vs tors. theta energy: -56.378 Dist. restrs. and SS energy: 0.250 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -709.485954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.485954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.275460 (E_RNA) where: Base-Base interactions energy: -452.192 where: short stacking energy: -203.845 Base-Backbone interact. energy: -0.605 local terms energy: -257.478195 where: bonds (distance) C4'-P energy: -62.501 bonds (distance) P-C4' energy: -53.385 flat angles C4'-P-C4' energy: -59.249 flat angles P-C4'-P energy: -35.966 tors. eta vs tors. theta energy: -46.377 Dist. restrs. and SS energy: 0.790 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -642.162080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.162080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.251498 (E_RNA) where: Base-Base interactions energy: -417.085 where: short stacking energy: -177.908 Base-Backbone interact. energy: 3.009 local terms energy: -229.175619 where: bonds (distance) C4'-P energy: -58.910 bonds (distance) P-C4' energy: -57.516 flat angles C4'-P-C4' energy: -52.372 flat angles P-C4'-P energy: -30.832 tors. eta vs tors. theta energy: -29.544 Dist. restrs. and SS energy: 1.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -1115.823914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1115.823914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1116.148629 (E_RNA) where: Base-Base interactions energy: -756.726 where: short stacking energy: -313.690 Base-Backbone interact. energy: -1.931 local terms energy: -357.491526 where: bonds (distance) C4'-P energy: -67.217 bonds (distance) P-C4' energy: -72.604 flat angles C4'-P-C4' energy: -72.974 flat angles P-C4'-P energy: -53.698 tors. eta vs tors. theta energy: -90.998 Dist. restrs. and SS energy: 0.325 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -1089.600466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.600466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1089.864069 (E_RNA) where: Base-Base interactions energy: -746.688 where: short stacking energy: -312.055 Base-Backbone interact. energy: -2.987 local terms energy: -340.189574 where: bonds (distance) C4'-P energy: -67.318 bonds (distance) P-C4' energy: -62.773 flat angles C4'-P-C4' energy: -75.436 flat angles P-C4'-P energy: -47.793 tors. eta vs tors. theta energy: -86.870 Dist. restrs. and SS energy: 0.264 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -999.316822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.316822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -999.669595 (E_RNA) where: Base-Base interactions energy: -685.785 where: short stacking energy: -296.419 Base-Backbone interact. energy: 0.244 local terms energy: -314.128913 where: bonds (distance) C4'-P energy: -63.706 bonds (distance) P-C4' energy: -62.439 flat angles C4'-P-C4' energy: -61.731 flat angles P-C4'-P energy: -46.006 tors. eta vs tors. theta energy: -80.247 Dist. restrs. and SS energy: 0.353 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -1025.250693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.250693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1025.713807 (E_RNA) where: Base-Base interactions energy: -715.664 where: short stacking energy: -285.212 Base-Backbone interact. energy: -1.997 local terms energy: -308.053094 where: bonds (distance) C4'-P energy: -68.760 bonds (distance) P-C4' energy: -58.627 flat angles C4'-P-C4' energy: -68.038 flat angles P-C4'-P energy: -41.145 tors. eta vs tors. theta energy: -71.484 Dist. restrs. and SS energy: 0.463 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -924.041401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -924.041401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.525214 (E_RNA) where: Base-Base interactions energy: -646.378 where: short stacking energy: -262.649 Base-Backbone interact. energy: 2.442 local terms energy: -280.588632 where: bonds (distance) C4'-P energy: -49.328 bonds (distance) P-C4' energy: -49.358 flat angles C4'-P-C4' energy: -65.056 flat angles P-C4'-P energy: -45.755 tors. eta vs tors. theta energy: -71.092 Dist. restrs. and SS energy: 0.484 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -914.302696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -914.302696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -914.587483 (E_RNA) where: Base-Base interactions energy: -626.038 where: short stacking energy: -267.621 Base-Backbone interact. energy: -0.541 local terms energy: -288.008151 where: bonds (distance) C4'-P energy: -55.951 bonds (distance) P-C4' energy: -50.640 flat angles C4'-P-C4' energy: -68.472 flat angles P-C4'-P energy: -49.796 tors. eta vs tors. theta energy: -63.149 Dist. restrs. and SS energy: 0.285 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -861.205052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -861.205052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -861.574671 (E_RNA) where: Base-Base interactions energy: -585.513 where: short stacking energy: -244.590 Base-Backbone interact. energy: 1.141 local terms energy: -277.203245 where: bonds (distance) C4'-P energy: -49.325 bonds (distance) P-C4' energy: -51.563 flat angles C4'-P-C4' energy: -68.557 flat angles P-C4'-P energy: -44.772 tors. eta vs tors. theta energy: -62.987 Dist. restrs. and SS energy: 0.370 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -812.890492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.890492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.122274 (E_RNA) where: Base-Base interactions energy: -533.670 where: short stacking energy: -239.438 Base-Backbone interact. energy: -0.178 local terms energy: -279.274510 where: bonds (distance) C4'-P energy: -55.676 bonds (distance) P-C4' energy: -64.813 flat angles C4'-P-C4' energy: -48.937 flat angles P-C4'-P energy: -44.726 tors. eta vs tors. theta energy: -65.124 Dist. restrs. and SS energy: 0.232 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -716.960182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.960182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.189783 (E_RNA) where: Base-Base interactions energy: -491.576 where: short stacking energy: -207.927 Base-Backbone interact. energy: 3.829 local terms energy: -229.442537 where: bonds (distance) C4'-P energy: -48.459 bonds (distance) P-C4' energy: -55.777 flat angles C4'-P-C4' energy: -53.668 flat angles P-C4'-P energy: -27.933 tors. eta vs tors. theta energy: -43.605 Dist. restrs. and SS energy: 0.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -669.856734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.856734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.549746 (E_RNA) where: Base-Base interactions energy: -455.302 where: short stacking energy: -184.584 Base-Backbone interact. energy: 10.398 local terms energy: -225.646231 where: bonds (distance) C4'-P energy: -46.249 bonds (distance) P-C4' energy: -61.042 flat angles C4'-P-C4' energy: -56.037 flat angles P-C4'-P energy: -26.194 tors. eta vs tors. theta energy: -36.125 Dist. restrs. and SS energy: 0.693 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -1134.188510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.188510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1134.262684 (E_RNA) where: Base-Base interactions energy: -782.967 where: short stacking energy: -324.669 Base-Backbone interact. energy: -1.955 local terms energy: -349.340661 where: bonds (distance) C4'-P energy: -67.109 bonds (distance) P-C4' energy: -66.441 flat angles C4'-P-C4' energy: -70.940 flat angles P-C4'-P energy: -55.685 tors. eta vs tors. theta energy: -89.166 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -1087.364636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.364636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1088.049440 (E_RNA) where: Base-Base interactions energy: -743.698 where: short stacking energy: -307.381 Base-Backbone interact. energy: -0.824 local terms energy: -343.527899 where: bonds (distance) C4'-P energy: -69.647 bonds (distance) P-C4' energy: -65.960 flat angles C4'-P-C4' energy: -72.334 flat angles P-C4'-P energy: -49.668 tors. eta vs tors. theta energy: -85.920 Dist. restrs. and SS energy: 0.685 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -1000.150950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1000.150950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.381570 (E_RNA) where: Base-Base interactions energy: -674.147 where: short stacking energy: -301.365 Base-Backbone interact. energy: 1.687 local terms energy: -327.921648 where: bonds (distance) C4'-P energy: -54.736 bonds (distance) P-C4' energy: -67.430 flat angles C4'-P-C4' energy: -71.724 flat angles P-C4'-P energy: -53.027 tors. eta vs tors. theta energy: -81.005 Dist. restrs. and SS energy: 0.231 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -1018.715110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1018.715110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1019.147010 (E_RNA) where: Base-Base interactions energy: -734.196 where: short stacking energy: -288.781 Base-Backbone interact. energy: -2.675 local terms energy: -282.275752 where: bonds (distance) C4'-P energy: -51.715 bonds (distance) P-C4' energy: -63.232 flat angles C4'-P-C4' energy: -67.800 flat angles P-C4'-P energy: -24.912 tors. eta vs tors. theta energy: -74.617 Dist. restrs. and SS energy: 0.432 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -952.331217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -952.331217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.073280 (E_RNA) where: Base-Base interactions energy: -660.918 where: short stacking energy: -281.638 Base-Backbone interact. energy: -1.183 local terms energy: -290.971661 where: bonds (distance) C4'-P energy: -51.659 bonds (distance) P-C4' energy: -52.670 flat angles C4'-P-C4' energy: -68.556 flat angles P-C4'-P energy: -42.063 tors. eta vs tors. theta energy: -76.023 Dist. restrs. and SS energy: 0.742 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -927.724098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.724098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.091045 (E_RNA) where: Base-Base interactions energy: -656.705 where: short stacking energy: -282.135 Base-Backbone interact. energy: -2.899 local terms energy: -268.486827 where: bonds (distance) C4'-P energy: -50.577 bonds (distance) P-C4' energy: -61.263 flat angles C4'-P-C4' energy: -57.417 flat angles P-C4'-P energy: -32.621 tors. eta vs tors. theta energy: -66.608 Dist. restrs. and SS energy: 0.367 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -815.245199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.245199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.820685 (E_RNA) where: Base-Base interactions energy: -547.936 where: short stacking energy: -237.452 Base-Backbone interact. energy: 0.983 local terms energy: -268.868112 where: bonds (distance) C4'-P energy: -45.803 bonds (distance) P-C4' energy: -62.448 flat angles C4'-P-C4' energy: -56.870 flat angles P-C4'-P energy: -38.814 tors. eta vs tors. theta energy: -64.934 Dist. restrs. and SS energy: 0.575 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -791.064081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.064081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.382852 (E_RNA) where: Base-Base interactions energy: -534.120 where: short stacking energy: -223.470 Base-Backbone interact. energy: 0.572 local terms energy: -257.834855 where: bonds (distance) C4'-P energy: -53.406 bonds (distance) P-C4' energy: -58.702 flat angles C4'-P-C4' energy: -63.541 flat angles P-C4'-P energy: -43.180 tors. eta vs tors. theta energy: -39.006 Dist. restrs. and SS energy: 0.319 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -694.502180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.502180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.863081 (E_RNA) where: Base-Base interactions energy: -457.075 where: short stacking energy: -199.536 Base-Backbone interact. energy: 7.123 local terms energy: -244.910622 where: bonds (distance) C4'-P energy: -54.042 bonds (distance) P-C4' energy: -54.078 flat angles C4'-P-C4' energy: -61.034 flat angles P-C4'-P energy: -36.180 tors. eta vs tors. theta energy: -39.577 Dist. restrs. and SS energy: 0.361 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -695.261683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.261683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.718798 (E_RNA) where: Base-Base interactions energy: -448.547 where: short stacking energy: -205.925 Base-Backbone interact. energy: -0.785 local terms energy: -246.386074 where: bonds (distance) C4'-P energy: -49.965 bonds (distance) P-C4' energy: -52.917 flat angles C4'-P-C4' energy: -56.049 flat angles P-C4'-P energy: -45.672 tors. eta vs tors. theta energy: -41.784 Dist. restrs. and SS energy: 0.457 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -1158.132535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1158.132535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1158.244096 (E_RNA) where: Base-Base interactions energy: -786.267 where: short stacking energy: -314.324 Base-Backbone interact. energy: -3.107 local terms energy: -368.870216 where: bonds (distance) C4'-P energy: -72.713 bonds (distance) P-C4' energy: -73.233 flat angles C4'-P-C4' energy: -76.115 flat angles P-C4'-P energy: -54.081 tors. eta vs tors. theta energy: -92.729 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -1076.645261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.645261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1078.121127 (E_RNA) where: Base-Base interactions energy: -744.934 where: short stacking energy: -331.904 Base-Backbone interact. energy: -1.826 local terms energy: -331.361452 where: bonds (distance) C4'-P energy: -66.538 bonds (distance) P-C4' energy: -54.001 flat angles C4'-P-C4' energy: -71.111 flat angles P-C4'-P energy: -53.164 tors. eta vs tors. theta energy: -86.548 Dist. restrs. and SS energy: 1.476 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -994.172025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.172025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -994.564218 (E_RNA) where: Base-Base interactions energy: -684.707 where: short stacking energy: -294.505 Base-Backbone interact. energy: -0.879 local terms energy: -308.978668 where: bonds (distance) C4'-P energy: -55.472 bonds (distance) P-C4' energy: -58.418 flat angles C4'-P-C4' energy: -75.431 flat angles P-C4'-P energy: -39.422 tors. eta vs tors. theta energy: -80.235 Dist. restrs. and SS energy: 0.392 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -977.940088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.940088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -979.114330 (E_RNA) where: Base-Base interactions energy: -677.960 where: short stacking energy: -295.931 Base-Backbone interact. energy: 0.678 local terms energy: -301.832622 where: bonds (distance) C4'-P energy: -55.971 bonds (distance) P-C4' energy: -62.372 flat angles C4'-P-C4' energy: -62.576 flat angles P-C4'-P energy: -38.693 tors. eta vs tors. theta energy: -82.221 Dist. restrs. and SS energy: 1.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -982.564246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.564246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.259044 (E_RNA) where: Base-Base interactions energy: -697.604 where: short stacking energy: -283.618 Base-Backbone interact. energy: -1.040 local terms energy: -284.614461 where: bonds (distance) C4'-P energy: -49.660 bonds (distance) P-C4' energy: -66.975 flat angles C4'-P-C4' energy: -61.387 flat angles P-C4'-P energy: -42.462 tors. eta vs tors. theta energy: -64.131 Dist. restrs. and SS energy: 0.695 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -936.861415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -936.861415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.305752 (E_RNA) where: Base-Base interactions energy: -627.460 where: short stacking energy: -265.337 Base-Backbone interact. energy: -0.182 local terms energy: -309.663936 where: bonds (distance) C4'-P energy: -63.138 bonds (distance) P-C4' energy: -65.232 flat angles C4'-P-C4' energy: -69.703 flat angles P-C4'-P energy: -42.988 tors. eta vs tors. theta energy: -68.603 Dist. restrs. and SS energy: 0.444 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -848.732275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.732275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -848.951547 (E_RNA) where: Base-Base interactions energy: -573.559 where: short stacking energy: -258.519 Base-Backbone interact. energy: -0.281 local terms energy: -275.111548 where: bonds (distance) C4'-P energy: -46.571 bonds (distance) P-C4' energy: -61.777 flat angles C4'-P-C4' energy: -59.418 flat angles P-C4'-P energy: -38.290 tors. eta vs tors. theta energy: -69.055 Dist. restrs. and SS energy: 0.219 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -765.742236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.742236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.216869 (E_RNA) where: Base-Base interactions energy: -522.465 where: short stacking energy: -217.039 Base-Backbone interact. energy: -0.061 local terms energy: -243.690998 where: bonds (distance) C4'-P energy: -53.725 bonds (distance) P-C4' energy: -49.288 flat angles C4'-P-C4' energy: -57.914 flat angles P-C4'-P energy: -33.651 tors. eta vs tors. theta energy: -49.114 Dist. restrs. and SS energy: 0.475 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -672.810301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.810301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.075721 (E_RNA) where: Base-Base interactions energy: -460.656 where: short stacking energy: -196.047 Base-Backbone interact. energy: 6.565 local terms energy: -218.985074 where: bonds (distance) C4'-P energy: -41.714 bonds (distance) P-C4' energy: -53.080 flat angles C4'-P-C4' energy: -48.945 flat angles P-C4'-P energy: -39.815 tors. eta vs tors. theta energy: -35.431 Dist. restrs. and SS energy: 0.265 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -672.877063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.877063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.177237 (E_RNA) where: Base-Base interactions energy: -460.233 where: short stacking energy: -208.178 Base-Backbone interact. energy: -0.596 local terms energy: -212.348423 where: bonds (distance) C4'-P energy: -41.054 bonds (distance) P-C4' energy: -50.965 flat angles C4'-P-C4' energy: -51.652 flat angles P-C4'-P energy: -28.421 tors. eta vs tors. theta energy: -40.256 Dist. restrs. and SS energy: 0.300 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -1141.154439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1141.154439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1141.220320 (E_RNA) where: Base-Base interactions energy: -793.975 where: short stacking energy: -310.887 Base-Backbone interact. energy: -2.430 local terms energy: -344.814846 where: bonds (distance) C4'-P energy: -62.491 bonds (distance) P-C4' energy: -72.505 flat angles C4'-P-C4' energy: -71.712 flat angles P-C4'-P energy: -48.065 tors. eta vs tors. theta energy: -90.043 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -1072.528896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1072.528896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.658249 (E_RNA) where: Base-Base interactions energy: -731.517 where: short stacking energy: -317.905 Base-Backbone interact. energy: -1.423 local terms energy: -340.718951 where: bonds (distance) C4'-P energy: -67.831 bonds (distance) P-C4' energy: -66.743 flat angles C4'-P-C4' energy: -73.811 flat angles P-C4'-P energy: -48.319 tors. eta vs tors. theta energy: -84.015 Dist. restrs. and SS energy: 1.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -1020.435353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.435353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.627437 (E_RNA) where: Base-Base interactions energy: -700.124 where: short stacking energy: -310.307 Base-Backbone interact. energy: -0.865 local terms energy: -319.638317 where: bonds (distance) C4'-P energy: -50.862 bonds (distance) P-C4' energy: -66.922 flat angles C4'-P-C4' energy: -68.647 flat angles P-C4'-P energy: -45.943 tors. eta vs tors. theta energy: -87.265 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -989.911633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.911633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -990.011293 (E_RNA) where: Base-Base interactions energy: -674.999 where: short stacking energy: -286.613 Base-Backbone interact. energy: -0.702 local terms energy: -314.309956 where: bonds (distance) C4'-P energy: -59.451 bonds (distance) P-C4' energy: -57.262 flat angles C4'-P-C4' energy: -70.024 flat angles P-C4'-P energy: -45.647 tors. eta vs tors. theta energy: -81.927 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -1005.003575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.003575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1005.324822 (E_RNA) where: Base-Base interactions energy: -699.012 where: short stacking energy: -297.052 Base-Backbone interact. energy: -1.504 local terms energy: -304.808962 where: bonds (distance) C4'-P energy: -58.445 bonds (distance) P-C4' energy: -55.756 flat angles C4'-P-C4' energy: -62.281 flat angles P-C4'-P energy: -45.575 tors. eta vs tors. theta energy: -82.751 Dist. restrs. and SS energy: 0.321 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -896.776231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.776231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.706523 (E_RNA) where: Base-Base interactions energy: -604.312 where: short stacking energy: -240.089 Base-Backbone interact. energy: -1.323 local terms energy: -292.071121 where: bonds (distance) C4'-P energy: -47.763 bonds (distance) P-C4' energy: -67.691 flat angles C4'-P-C4' energy: -61.320 flat angles P-C4'-P energy: -44.031 tors. eta vs tors. theta energy: -71.266 Dist. restrs. and SS energy: 0.930 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -810.772191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.772191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -811.309019 (E_RNA) where: Base-Base interactions energy: -532.362 where: short stacking energy: -229.497 Base-Backbone interact. energy: -1.276 local terms energy: -277.670559 where: bonds (distance) C4'-P energy: -61.813 bonds (distance) P-C4' energy: -52.697 flat angles C4'-P-C4' energy: -58.928 flat angles P-C4'-P energy: -42.378 tors. eta vs tors. theta energy: -61.854 Dist. restrs. and SS energy: 0.537 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -764.286003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -764.286003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -764.450316 (E_RNA) where: Base-Base interactions energy: -500.513 where: short stacking energy: -231.231 Base-Backbone interact. energy: 0.148 local terms energy: -264.085560 where: bonds (distance) C4'-P energy: -63.379 bonds (distance) P-C4' energy: -53.611 flat angles C4'-P-C4' energy: -62.799 flat angles P-C4'-P energy: -34.283 tors. eta vs tors. theta energy: -50.014 Dist. restrs. and SS energy: 0.164 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -691.170205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.170205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.610051 (E_RNA) where: Base-Base interactions energy: -449.072 where: short stacking energy: -197.653 Base-Backbone interact. energy: 0.489 local terms energy: -243.027458 where: bonds (distance) C4'-P energy: -57.216 bonds (distance) P-C4' energy: -52.517 flat angles C4'-P-C4' energy: -56.607 flat angles P-C4'-P energy: -41.390 tors. eta vs tors. theta energy: -35.298 Dist. restrs. and SS energy: 0.440 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -661.920336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.920336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.168361 (E_RNA) where: Base-Base interactions energy: -441.851 where: short stacking energy: -188.825 Base-Backbone interact. energy: 5.451 local terms energy: -225.767425 where: bonds (distance) C4'-P energy: -45.717 bonds (distance) P-C4' energy: -63.851 flat angles C4'-P-C4' energy: -44.724 flat angles P-C4'-P energy: -36.429 tors. eta vs tors. theta energy: -35.046 Dist. restrs. and SS energy: 0.248 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -1160.664737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1160.664737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1160.810292 (E_RNA) where: Base-Base interactions energy: -812.502 where: short stacking energy: -341.804 Base-Backbone interact. energy: 1.259 local terms energy: -349.567138 where: bonds (distance) C4'-P energy: -61.044 bonds (distance) P-C4' energy: -68.396 flat angles C4'-P-C4' energy: -73.432 flat angles P-C4'-P energy: -47.052 tors. eta vs tors. theta energy: -99.643 Dist. restrs. and SS energy: 0.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -1058.262570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.262570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1058.972833 (E_RNA) where: Base-Base interactions energy: -724.734 where: short stacking energy: -313.668 Base-Backbone interact. energy: -0.152 local terms energy: -334.086659 where: bonds (distance) C4'-P energy: -69.171 bonds (distance) P-C4' energy: -62.505 flat angles C4'-P-C4' energy: -77.308 flat angles P-C4'-P energy: -46.704 tors. eta vs tors. theta energy: -78.399 Dist. restrs. and SS energy: 0.710 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -1014.520771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.520771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1014.768209 (E_RNA) where: Base-Base interactions energy: -703.233 where: short stacking energy: -298.660 Base-Backbone interact. energy: -1.472 local terms energy: -310.062829 where: bonds (distance) C4'-P energy: -55.066 bonds (distance) P-C4' energy: -59.672 flat angles C4'-P-C4' energy: -64.224 flat angles P-C4'-P energy: -49.807 tors. eta vs tors. theta energy: -81.294 Dist. restrs. and SS energy: 0.247 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -977.407128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.407128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -977.742621 (E_RNA) where: Base-Base interactions energy: -670.796 where: short stacking energy: -279.049 Base-Backbone interact. energy: -0.966 local terms energy: -305.980509 where: bonds (distance) C4'-P energy: -54.880 bonds (distance) P-C4' energy: -67.942 flat angles C4'-P-C4' energy: -72.906 flat angles P-C4'-P energy: -42.583 tors. eta vs tors. theta energy: -67.669 Dist. restrs. and SS energy: 0.335 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -988.527863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -988.527863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -988.947458 (E_RNA) where: Base-Base interactions energy: -690.329 where: short stacking energy: -290.398 Base-Backbone interact. energy: -0.936 local terms energy: -297.682889 where: bonds (distance) C4'-P energy: -52.276 bonds (distance) P-C4' energy: -54.009 flat angles C4'-P-C4' energy: -70.229 flat angles P-C4'-P energy: -52.342 tors. eta vs tors. theta energy: -68.827 Dist. restrs. and SS energy: 0.420 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -837.500209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.500209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.949150 (E_RNA) where: Base-Base interactions energy: -572.583 where: short stacking energy: -259.549 Base-Backbone interact. energy: -0.143 local terms energy: -265.223996 where: bonds (distance) C4'-P energy: -46.981 bonds (distance) P-C4' energy: -53.815 flat angles C4'-P-C4' energy: -57.285 flat angles P-C4'-P energy: -36.618 tors. eta vs tors. theta energy: -70.525 Dist. restrs. and SS energy: 0.449 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -887.054968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.054968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.408324 (E_RNA) where: Base-Base interactions energy: -600.448 where: short stacking energy: -250.467 Base-Backbone interact. energy: -1.778 local terms energy: -285.182850 where: bonds (distance) C4'-P energy: -58.181 bonds (distance) P-C4' energy: -59.922 flat angles C4'-P-C4' energy: -56.359 flat angles P-C4'-P energy: -52.704 tors. eta vs tors. theta energy: -58.017 Dist. restrs. and SS energy: 0.353 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -754.038475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -754.038475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.415258 (E_RNA) where: Base-Base interactions energy: -492.408 where: short stacking energy: -211.488 Base-Backbone interact. energy: -1.659 local terms energy: -260.348706 where: bonds (distance) C4'-P energy: -65.217 bonds (distance) P-C4' energy: -54.835 flat angles C4'-P-C4' energy: -55.773 flat angles P-C4'-P energy: -39.265 tors. eta vs tors. theta energy: -45.258 Dist. restrs. and SS energy: 0.377 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -693.512478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.512478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.030768 (E_RNA) where: Base-Base interactions energy: -466.983 where: short stacking energy: -195.360 Base-Backbone interact. energy: -1.338 local terms energy: -225.709709 where: bonds (distance) C4'-P energy: -42.827 bonds (distance) P-C4' energy: -54.155 flat angles C4'-P-C4' energy: -60.430 flat angles P-C4'-P energy: -28.761 tors. eta vs tors. theta energy: -39.536 Dist. restrs. and SS energy: 0.518 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -678.611030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.611030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.135523 (E_RNA) where: Base-Base interactions energy: -454.159 where: short stacking energy: -194.378 Base-Backbone interact. energy: 11.395 local terms energy: -237.371439 where: bonds (distance) C4'-P energy: -49.384 bonds (distance) P-C4' energy: -58.664 flat angles C4'-P-C4' energy: -47.816 flat angles P-C4'-P energy: -37.338 tors. eta vs tors. theta energy: -44.170 Dist. restrs. and SS energy: 1.524 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -1145.383438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1145.383438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1145.383438 (E_RNA) where: Base-Base interactions energy: -800.770 where: short stacking energy: -327.767 Base-Backbone interact. energy: -3.347 local terms energy: -341.266041 where: bonds (distance) C4'-P energy: -75.109 bonds (distance) P-C4' energy: -65.463 flat angles C4'-P-C4' energy: -71.047 flat angles P-C4'-P energy: -45.387 tors. eta vs tors. theta energy: -84.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -1037.086709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.086709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.150388 (E_RNA) where: Base-Base interactions energy: -718.499 where: short stacking energy: -297.528 Base-Backbone interact. energy: -1.927 local terms energy: -317.724300 where: bonds (distance) C4'-P energy: -66.458 bonds (distance) P-C4' energy: -61.302 flat angles C4'-P-C4' energy: -64.908 flat angles P-C4'-P energy: -46.898 tors. eta vs tors. theta energy: -78.159 Dist. restrs. and SS energy: 1.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -1019.432742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.432742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1019.956734 (E_RNA) where: Base-Base interactions energy: -695.922 where: short stacking energy: -306.219 Base-Backbone interact. energy: -1.154 local terms energy: -322.880766 where: bonds (distance) C4'-P energy: -56.570 bonds (distance) P-C4' energy: -65.238 flat angles C4'-P-C4' energy: -62.028 flat angles P-C4'-P energy: -54.992 tors. eta vs tors. theta energy: -84.053 Dist. restrs. and SS energy: 0.524 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -991.252798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -991.252798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -991.732329 (E_RNA) where: Base-Base interactions energy: -676.525 where: short stacking energy: -301.584 Base-Backbone interact. energy: -0.184 local terms energy: -315.023291 where: bonds (distance) C4'-P energy: -61.743 bonds (distance) P-C4' energy: -63.375 flat angles C4'-P-C4' energy: -74.112 flat angles P-C4'-P energy: -40.282 tors. eta vs tors. theta energy: -75.511 Dist. restrs. and SS energy: 0.480 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -980.356701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.356701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -981.395712 (E_RNA) where: Base-Base interactions energy: -678.711 where: short stacking energy: -288.209 Base-Backbone interact. energy: 1.093 local terms energy: -303.777758 where: bonds (distance) C4'-P energy: -47.725 bonds (distance) P-C4' energy: -54.821 flat angles C4'-P-C4' energy: -72.883 flat angles P-C4'-P energy: -47.934 tors. eta vs tors. theta energy: -80.414 Dist. restrs. and SS energy: 1.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -845.245868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.245868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.571705 (E_RNA) where: Base-Base interactions energy: -568.508 where: short stacking energy: -238.256 Base-Backbone interact. energy: -4.314 local terms energy: -272.749743 where: bonds (distance) C4'-P energy: -61.460 bonds (distance) P-C4' energy: -55.636 flat angles C4'-P-C4' energy: -67.560 flat angles P-C4'-P energy: -33.292 tors. eta vs tors. theta energy: -54.803 Dist. restrs. and SS energy: 0.326 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -899.312906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -899.312906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -899.777280 (E_RNA) where: Base-Base interactions energy: -638.206 where: short stacking energy: -274.387 Base-Backbone interact. energy: 2.599 local terms energy: -264.170847 where: bonds (distance) C4'-P energy: -53.470 bonds (distance) P-C4' energy: -38.429 flat angles C4'-P-C4' energy: -65.062 flat angles P-C4'-P energy: -35.110 tors. eta vs tors. theta energy: -72.099 Dist. restrs. and SS energy: 0.464 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -728.719854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.719854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.058221 (E_RNA) where: Base-Base interactions energy: -480.108 where: short stacking energy: -202.651 Base-Backbone interact. energy: 0.449 local terms energy: -249.398836 where: bonds (distance) C4'-P energy: -54.468 bonds (distance) P-C4' energy: -66.666 flat angles C4'-P-C4' energy: -60.403 flat angles P-C4'-P energy: -29.748 tors. eta vs tors. theta energy: -38.114 Dist. restrs. and SS energy: 0.338 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -697.854202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.854202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.670386 (E_RNA) where: Base-Base interactions energy: -472.046 where: short stacking energy: -199.545 Base-Backbone interact. energy: -0.376 local terms energy: -226.248775 where: bonds (distance) C4'-P energy: -37.447 bonds (distance) P-C4' energy: -55.827 flat angles C4'-P-C4' energy: -52.497 flat angles P-C4'-P energy: -32.947 tors. eta vs tors. theta energy: -47.530 Dist. restrs. and SS energy: 0.816 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -680.544667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.544667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.811362 (E_RNA) where: Base-Base interactions energy: -430.356 where: short stacking energy: -190.758 Base-Backbone interact. energy: -0.502 local terms energy: -250.953092 where: bonds (distance) C4'-P energy: -57.108 bonds (distance) P-C4' energy: -64.188 flat angles C4'-P-C4' energy: -53.626 flat angles P-C4'-P energy: -38.388 tors. eta vs tors. theta energy: -37.643 Dist. restrs. and SS energy: 1.267 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -1145.840752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1145.840752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1145.976592 (E_RNA) where: Base-Base interactions energy: -806.456 where: short stacking energy: -349.979 Base-Backbone interact. energy: -1.939 local terms energy: -337.582291 where: bonds (distance) C4'-P energy: -65.786 bonds (distance) P-C4' energy: -59.683 flat angles C4'-P-C4' energy: -67.077 flat angles P-C4'-P energy: -43.609 tors. eta vs tors. theta energy: -101.428 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -1055.249669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.249669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1056.039178 (E_RNA) where: Base-Base interactions energy: -724.418 where: short stacking energy: -324.299 Base-Backbone interact. energy: 1.503 local terms energy: -333.124239 where: bonds (distance) C4'-P energy: -61.029 bonds (distance) P-C4' energy: -59.557 flat angles C4'-P-C4' energy: -72.490 flat angles P-C4'-P energy: -48.025 tors. eta vs tors. theta energy: -92.022 Dist. restrs. and SS energy: 0.790 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -1025.751558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.751558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1025.943919 (E_RNA) where: Base-Base interactions energy: -712.404 where: short stacking energy: -279.517 Base-Backbone interact. energy: -2.484 local terms energy: -311.055513 where: bonds (distance) C4'-P energy: -57.766 bonds (distance) P-C4' energy: -53.699 flat angles C4'-P-C4' energy: -67.940 flat angles P-C4'-P energy: -52.726 tors. eta vs tors. theta energy: -78.925 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -1020.516879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.516879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.666651 (E_RNA) where: Base-Base interactions energy: -719.791 where: short stacking energy: -301.521 Base-Backbone interact. energy: -2.276 local terms energy: -298.598853 where: bonds (distance) C4'-P energy: -51.171 bonds (distance) P-C4' energy: -57.772 flat angles C4'-P-C4' energy: -64.120 flat angles P-C4'-P energy: -45.672 tors. eta vs tors. theta energy: -79.864 Dist. restrs. and SS energy: 0.150 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -977.682934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.682934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.446181 (E_RNA) where: Base-Base interactions energy: -658.800 where: short stacking energy: -277.766 Base-Backbone interact. energy: -0.636 local terms energy: -319.010304 where: bonds (distance) C4'-P energy: -58.716 bonds (distance) P-C4' energy: -70.245 flat angles C4'-P-C4' energy: -72.255 flat angles P-C4'-P energy: -48.173 tors. eta vs tors. theta energy: -69.622 Dist. restrs. and SS energy: 0.763 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -971.963117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -971.963117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.241954 (E_RNA) where: Base-Base interactions energy: -655.298 where: short stacking energy: -260.665 Base-Backbone interact. energy: -0.567 local terms energy: -316.377199 where: bonds (distance) C4'-P energy: -61.850 bonds (distance) P-C4' energy: -61.702 flat angles C4'-P-C4' energy: -71.122 flat angles P-C4'-P energy: -45.168 tors. eta vs tors. theta energy: -76.536 Dist. restrs. and SS energy: 0.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -838.775065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.775065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -839.313897 (E_RNA) where: Base-Base interactions energy: -594.599 where: short stacking energy: -239.869 Base-Backbone interact. energy: -1.191 local terms energy: -243.524662 where: bonds (distance) C4'-P energy: -45.318 bonds (distance) P-C4' energy: -40.245 flat angles C4'-P-C4' energy: -63.424 flat angles P-C4'-P energy: -38.891 tors. eta vs tors. theta energy: -55.647 Dist. restrs. and SS energy: 0.539 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -780.782820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -780.782820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.902506 (E_RNA) where: Base-Base interactions energy: -532.939 where: short stacking energy: -226.332 Base-Backbone interact. energy: -1.528 local terms energy: -246.436134 where: bonds (distance) C4'-P energy: -53.128 bonds (distance) P-C4' energy: -56.600 flat angles C4'-P-C4' energy: -54.403 flat angles P-C4'-P energy: -38.180 tors. eta vs tors. theta energy: -44.124 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -680.517557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.517557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.160373 (E_RNA) where: Base-Base interactions energy: -448.366 where: short stacking energy: -176.706 Base-Backbone interact. energy: -0.438 local terms energy: -232.355886 where: bonds (distance) C4'-P energy: -47.770 bonds (distance) P-C4' energy: -57.918 flat angles C4'-P-C4' energy: -65.717 flat angles P-C4'-P energy: -31.523 tors. eta vs tors. theta energy: -29.429 Dist. restrs. and SS energy: 0.643 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -681.299359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.299359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.577174 (E_RNA) where: Base-Base interactions energy: -451.916 where: short stacking energy: -190.083 Base-Backbone interact. energy: -0.860 local terms energy: -228.800888 where: bonds (distance) C4'-P energy: -50.104 bonds (distance) P-C4' energy: -61.346 flat angles C4'-P-C4' energy: -54.372 flat angles P-C4'-P energy: -33.430 tors. eta vs tors. theta energy: -29.550 Dist. restrs. and SS energy: 0.278 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -1162.433837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1162.433837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1162.711664 (E_RNA) where: Base-Base interactions energy: -823.581 where: short stacking energy: -353.121 Base-Backbone interact. energy: -2.898 local terms energy: -336.233531 where: bonds (distance) C4'-P energy: -60.838 bonds (distance) P-C4' energy: -62.132 flat angles C4'-P-C4' energy: -72.038 flat angles P-C4'-P energy: -43.423 tors. eta vs tors. theta energy: -97.803 Dist. restrs. and SS energy: 0.278 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -1055.026107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.026107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1055.900251 (E_RNA) where: Base-Base interactions energy: -731.751 where: short stacking energy: -325.709 Base-Backbone interact. energy: -2.641 local terms energy: -321.508459 where: bonds (distance) C4'-P energy: -54.733 bonds (distance) P-C4' energy: -68.294 flat angles C4'-P-C4' energy: -64.419 flat angles P-C4'-P energy: -41.466 tors. eta vs tors. theta energy: -92.596 Dist. restrs. and SS energy: 0.874 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -1021.324444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.324444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.890787 (E_RNA) where: Base-Base interactions energy: -708.254 where: short stacking energy: -289.528 Base-Backbone interact. energy: -1.581 local terms energy: -312.056431 where: bonds (distance) C4'-P energy: -58.381 bonds (distance) P-C4' energy: -69.588 flat angles C4'-P-C4' energy: -69.507 flat angles P-C4'-P energy: -36.096 tors. eta vs tors. theta energy: -78.484 Dist. restrs. and SS energy: 0.566 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -1002.698770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1002.698770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1003.055618 (E_RNA) where: Base-Base interactions energy: -690.216 where: short stacking energy: -286.168 Base-Backbone interact. energy: -2.617 local terms energy: -310.222511 where: bonds (distance) C4'-P energy: -55.658 bonds (distance) P-C4' energy: -65.213 flat angles C4'-P-C4' energy: -72.558 flat angles P-C4'-P energy: -39.056 tors. eta vs tors. theta energy: -77.737 Dist. restrs. and SS energy: 0.357 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -999.934639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.934639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.409596 (E_RNA) where: Base-Base interactions energy: -691.860 where: short stacking energy: -277.690 Base-Backbone interact. energy: -1.993 local terms energy: -306.557144 where: bonds (distance) C4'-P energy: -59.463 bonds (distance) P-C4' energy: -63.682 flat angles C4'-P-C4' energy: -72.975 flat angles P-C4'-P energy: -33.385 tors. eta vs tors. theta energy: -77.052 Dist. restrs. and SS energy: 0.475 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -936.563623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -936.563623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.014140 (E_RNA) where: Base-Base interactions energy: -663.089 where: short stacking energy: -278.349 Base-Backbone interact. energy: -0.457 local terms energy: -273.468538 where: bonds (distance) C4'-P energy: -46.916 bonds (distance) P-C4' energy: -55.136 flat angles C4'-P-C4' energy: -59.971 flat angles P-C4'-P energy: -39.243 tors. eta vs tors. theta energy: -72.203 Dist. restrs. and SS energy: 0.451 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -838.829821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.829821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -839.190405 (E_RNA) where: Base-Base interactions energy: -573.089 where: short stacking energy: -240.776 Base-Backbone interact. energy: -4.726 local terms energy: -261.374795 where: bonds (distance) C4'-P energy: -57.873 bonds (distance) P-C4' energy: -59.840 flat angles C4'-P-C4' energy: -57.360 flat angles P-C4'-P energy: -29.848 tors. eta vs tors. theta energy: -56.454 Dist. restrs. and SS energy: 0.361 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -792.272106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -792.272106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -792.985393 (E_RNA) where: Base-Base interactions energy: -532.914 where: short stacking energy: -237.375 Base-Backbone interact. energy: 0.266 local terms energy: -260.337531 where: bonds (distance) C4'-P energy: -60.212 bonds (distance) P-C4' energy: -51.536 flat angles C4'-P-C4' energy: -56.842 flat angles P-C4'-P energy: -28.936 tors. eta vs tors. theta energy: -62.812 Dist. restrs. and SS energy: 0.713 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -712.887916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.887916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.419717 (E_RNA) where: Base-Base interactions energy: -473.823 where: short stacking energy: -200.349 Base-Backbone interact. energy: 0.324 local terms energy: -239.921094 where: bonds (distance) C4'-P energy: -49.120 bonds (distance) P-C4' energy: -57.997 flat angles C4'-P-C4' energy: -45.574 flat angles P-C4'-P energy: -38.806 tors. eta vs tors. theta energy: -48.425 Dist. restrs. and SS energy: 0.532 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -713.548658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.548658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.159425 (E_RNA) where: Base-Base interactions energy: -471.248 where: short stacking energy: -197.219 Base-Backbone interact. energy: -0.392 local terms energy: -242.519428 where: bonds (distance) C4'-P energy: -49.996 bonds (distance) P-C4' energy: -61.561 flat angles C4'-P-C4' energy: -66.885 flat angles P-C4'-P energy: -28.496 tors. eta vs tors. theta energy: -35.582 Dist. restrs. and SS energy: 0.611 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -1168.384402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1168.384402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1168.556793 (E_RNA) where: Base-Base interactions energy: -821.240 where: short stacking energy: -341.385 Base-Backbone interact. energy: 0.644 local terms energy: -347.960936 where: bonds (distance) C4'-P energy: -63.598 bonds (distance) P-C4' energy: -67.083 flat angles C4'-P-C4' energy: -77.779 flat angles P-C4'-P energy: -41.493 tors. eta vs tors. theta energy: -98.009 Dist. restrs. and SS energy: 0.172 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -1076.814068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.814068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1077.160509 (E_RNA) where: Base-Base interactions energy: -740.413 where: short stacking energy: -317.833 Base-Backbone interact. energy: -1.329 local terms energy: -335.418658 where: bonds (distance) C4'-P energy: -58.080 bonds (distance) P-C4' energy: -64.355 flat angles C4'-P-C4' energy: -77.291 flat angles P-C4'-P energy: -45.837 tors. eta vs tors. theta energy: -89.857 Dist. restrs. and SS energy: 0.346 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -1026.132788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.132788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1027.513872 (E_RNA) where: Base-Base interactions energy: -694.241 where: short stacking energy: -322.141 Base-Backbone interact. energy: 1.544 local terms energy: -334.817216 where: bonds (distance) C4'-P energy: -66.678 bonds (distance) P-C4' energy: -61.287 flat angles C4'-P-C4' energy: -68.776 flat angles P-C4'-P energy: -45.755 tors. eta vs tors. theta energy: -92.323 Dist. restrs. and SS energy: 1.381 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -1023.058644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.058644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1023.505904 (E_RNA) where: Base-Base interactions energy: -723.241 where: short stacking energy: -295.093 Base-Backbone interact. energy: -1.233 local terms energy: -299.032351 where: bonds (distance) C4'-P energy: -60.126 bonds (distance) P-C4' energy: -58.167 flat angles C4'-P-C4' energy: -57.103 flat angles P-C4'-P energy: -49.343 tors. eta vs tors. theta energy: -74.293 Dist. restrs. and SS energy: 0.447 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -987.546241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.546241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -987.973770 (E_RNA) where: Base-Base interactions energy: -695.138 where: short stacking energy: -297.223 Base-Backbone interact. energy: -0.972 local terms energy: -291.863537 where: bonds (distance) C4'-P energy: -54.241 bonds (distance) P-C4' energy: -54.580 flat angles C4'-P-C4' energy: -65.424 flat angles P-C4'-P energy: -47.390 tors. eta vs tors. theta energy: -70.229 Dist. restrs. and SS energy: 0.428 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -970.049833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -970.049833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -971.472160 (E_RNA) where: Base-Base interactions energy: -663.218 where: short stacking energy: -282.224 Base-Backbone interact. energy: -2.228 local terms energy: -306.026000 where: bonds (distance) C4'-P energy: -62.689 bonds (distance) P-C4' energy: -61.017 flat angles C4'-P-C4' energy: -65.038 flat angles P-C4'-P energy: -45.349 tors. eta vs tors. theta energy: -71.933 Dist. restrs. and SS energy: 1.422 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -818.314553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.314553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.031631 (E_RNA) where: Base-Base interactions energy: -555.339 where: short stacking energy: -227.848 Base-Backbone interact. energy: -1.311 local terms energy: -262.381153 where: bonds (distance) C4'-P energy: -54.208 bonds (distance) P-C4' energy: -64.562 flat angles C4'-P-C4' energy: -51.276 flat angles P-C4'-P energy: -39.939 tors. eta vs tors. theta energy: -52.397 Dist. restrs. and SS energy: 0.717 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -793.515220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -793.515220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.067740 (E_RNA) where: Base-Base interactions energy: -527.726 where: short stacking energy: -223.309 Base-Backbone interact. energy: -2.699 local terms energy: -263.642645 where: bonds (distance) C4'-P energy: -49.183 bonds (distance) P-C4' energy: -58.215 flat angles C4'-P-C4' energy: -61.893 flat angles P-C4'-P energy: -42.024 tors. eta vs tors. theta energy: -52.327 Dist. restrs. and SS energy: 0.553 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -758.952165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.952165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.436940 (E_RNA) where: Base-Base interactions energy: -504.261 where: short stacking energy: -209.519 Base-Backbone interact. energy: -0.339 local terms energy: -254.837151 where: bonds (distance) C4'-P energy: -57.899 bonds (distance) P-C4' energy: -58.065 flat angles C4'-P-C4' energy: -58.014 flat angles P-C4'-P energy: -38.891 tors. eta vs tors. theta energy: -41.967 Dist. restrs. and SS energy: 0.485 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -647.032051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.032051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.310751 (E_RNA) where: Base-Base interactions energy: -431.785 where: short stacking energy: -183.267 Base-Backbone interact. energy: 1.389 local terms energy: -216.915348 where: bonds (distance) C4'-P energy: -46.612 bonds (distance) P-C4' energy: -55.927 flat angles C4'-P-C4' energy: -59.000 flat angles P-C4'-P energy: -19.312 tors. eta vs tors. theta energy: -36.064 Dist. restrs. and SS energy: 0.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -1160.559425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1160.559425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1160.754601 (E_RNA) where: Base-Base interactions energy: -810.595 where: short stacking energy: -338.707 Base-Backbone interact. energy: -2.296 local terms energy: -347.863298 where: bonds (distance) C4'-P energy: -61.985 bonds (distance) P-C4' energy: -68.718 flat angles C4'-P-C4' energy: -77.780 flat angles P-C4'-P energy: -45.150 tors. eta vs tors. theta energy: -94.230 Dist. restrs. and SS energy: 0.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -1077.253367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1077.253367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1077.373819 (E_RNA) where: Base-Base interactions energy: -742.431 where: short stacking energy: -311.937 Base-Backbone interact. energy: 1.890 local terms energy: -336.832208 where: bonds (distance) C4'-P energy: -64.567 bonds (distance) P-C4' energy: -73.019 flat angles C4'-P-C4' energy: -68.977 flat angles P-C4'-P energy: -43.258 tors. eta vs tors. theta energy: -87.010 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -1087.775239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.775239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1087.960189 (E_RNA) where: Base-Base interactions energy: -748.877 where: short stacking energy: -311.145 Base-Backbone interact. energy: -1.969 local terms energy: -337.113820 where: bonds (distance) C4'-P energy: -71.046 bonds (distance) P-C4' energy: -69.532 flat angles C4'-P-C4' energy: -74.459 flat angles P-C4'-P energy: -34.669 tors. eta vs tors. theta energy: -87.407 Dist. restrs. and SS energy: 0.185 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -998.753271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -998.753271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -999.363641 (E_RNA) where: Base-Base interactions energy: -679.178 where: short stacking energy: -290.854 Base-Backbone interact. energy: 0.166 local terms energy: -320.351158 where: bonds (distance) C4'-P energy: -74.050 bonds (distance) P-C4' energy: -48.545 flat angles C4'-P-C4' energy: -73.224 flat angles P-C4'-P energy: -45.025 tors. eta vs tors. theta energy: -79.506 Dist. restrs. and SS energy: 0.610 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -982.120783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.120783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -982.281337 (E_RNA) where: Base-Base interactions energy: -690.054 where: short stacking energy: -293.604 Base-Backbone interact. energy: -0.875 local terms energy: -291.352234 where: bonds (distance) C4'-P energy: -57.129 bonds (distance) P-C4' energy: -52.545 flat angles C4'-P-C4' energy: -63.893 flat angles P-C4'-P energy: -41.798 tors. eta vs tors. theta energy: -75.987 Dist. restrs. and SS energy: 0.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -972.631109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.631109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.916137 (E_RNA) where: Base-Base interactions energy: -689.146 where: short stacking energy: -277.835 Base-Backbone interact. energy: -2.318 local terms energy: -281.451727 where: bonds (distance) C4'-P energy: -52.470 bonds (distance) P-C4' energy: -54.623 flat angles C4'-P-C4' energy: -63.902 flat angles P-C4'-P energy: -35.198 tors. eta vs tors. theta energy: -75.259 Dist. restrs. and SS energy: 0.285 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -820.932559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.932559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -821.254202 (E_RNA) where: Base-Base interactions energy: -546.596 where: short stacking energy: -237.186 Base-Backbone interact. energy: -0.659 local terms energy: -273.999746 where: bonds (distance) C4'-P energy: -58.458 bonds (distance) P-C4' energy: -55.176 flat angles C4'-P-C4' energy: -62.912 flat angles P-C4'-P energy: -40.072 tors. eta vs tors. theta energy: -57.383 Dist. restrs. and SS energy: 0.322 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -778.728058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.728058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.082439 (E_RNA) where: Base-Base interactions energy: -497.556 where: short stacking energy: -223.294 Base-Backbone interact. energy: -1.155 local terms energy: -280.370606 where: bonds (distance) C4'-P energy: -53.928 bonds (distance) P-C4' energy: -62.211 flat angles C4'-P-C4' energy: -71.518 flat angles P-C4'-P energy: -31.694 tors. eta vs tors. theta energy: -61.019 Dist. restrs. and SS energy: 0.354 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -734.043598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.043598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.718705 (E_RNA) where: Base-Base interactions energy: -493.330 where: short stacking energy: -209.648 Base-Backbone interact. energy: -1.837 local terms energy: -239.551954 where: bonds (distance) C4'-P energy: -55.254 bonds (distance) P-C4' energy: -57.028 flat angles C4'-P-C4' energy: -51.785 flat angles P-C4'-P energy: -31.614 tors. eta vs tors. theta energy: -43.870 Dist. restrs. and SS energy: 0.675 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -659.348980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.348980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.836112 (E_RNA) where: Base-Base interactions energy: -421.443 where: short stacking energy: -182.829 Base-Backbone interact. energy: -0.637 local terms energy: -237.755409 where: bonds (distance) C4'-P energy: -62.508 bonds (distance) P-C4' energy: -54.558 flat angles C4'-P-C4' energy: -52.731 flat angles P-C4'-P energy: -37.394 tors. eta vs tors. theta energy: -30.565 Dist. restrs. and SS energy: 0.487 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -1162.724459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1162.724459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1163.028204 (E_RNA) where: Base-Base interactions energy: -816.571 where: short stacking energy: -330.245 Base-Backbone interact. energy: -2.562 local terms energy: -343.894621 where: bonds (distance) C4'-P energy: -65.348 bonds (distance) P-C4' energy: -62.271 flat angles C4'-P-C4' energy: -73.546 flat angles P-C4'-P energy: -45.579 tors. eta vs tors. theta energy: -97.150 Dist. restrs. and SS energy: 0.304 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -1121.063404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1121.063404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1121.575303 (E_RNA) where: Base-Base interactions energy: -811.703 where: short stacking energy: -308.598 Base-Backbone interact. energy: 1.047 local terms energy: -310.918912 where: bonds (distance) C4'-P energy: -52.264 bonds (distance) P-C4' energy: -60.143 flat angles C4'-P-C4' energy: -70.347 flat angles P-C4'-P energy: -43.371 tors. eta vs tors. theta energy: -84.794 Dist. restrs. and SS energy: 0.512 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -1059.651068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.651068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.781580 (E_RNA) where: Base-Base interactions energy: -741.166 where: short stacking energy: -310.513 Base-Backbone interact. energy: -2.089 local terms energy: -316.526891 where: bonds (distance) C4'-P energy: -58.122 bonds (distance) P-C4' energy: -58.416 flat angles C4'-P-C4' energy: -70.055 flat angles P-C4'-P energy: -41.993 tors. eta vs tors. theta energy: -87.940 Dist. restrs. and SS energy: 0.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -1005.938057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.938057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1006.654759 (E_RNA) where: Base-Base interactions energy: -690.961 where: short stacking energy: -293.584 Base-Backbone interact. energy: -2.871 local terms energy: -312.822684 where: bonds (distance) C4'-P energy: -47.803 bonds (distance) P-C4' energy: -65.262 flat angles C4'-P-C4' energy: -73.616 flat angles P-C4'-P energy: -42.654 tors. eta vs tors. theta energy: -83.487 Dist. restrs. and SS energy: 0.717 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -972.218764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.218764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.876165 (E_RNA) where: Base-Base interactions energy: -653.746 where: short stacking energy: -278.799 Base-Backbone interact. energy: -1.022 local terms energy: -318.107625 where: bonds (distance) C4'-P energy: -69.683 bonds (distance) P-C4' energy: -64.913 flat angles C4'-P-C4' energy: -63.023 flat angles P-C4'-P energy: -39.281 tors. eta vs tors. theta energy: -81.207 Dist. restrs. and SS energy: 0.657 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -928.485406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -928.485406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.632940 (E_RNA) where: Base-Base interactions energy: -640.992 where: short stacking energy: -268.052 Base-Backbone interact. energy: -0.132 local terms energy: -287.508894 where: bonds (distance) C4'-P energy: -53.729 bonds (distance) P-C4' energy: -56.418 flat angles C4'-P-C4' energy: -65.810 flat angles P-C4'-P energy: -33.504 tors. eta vs tors. theta energy: -78.047 Dist. restrs. and SS energy: 0.148 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -841.186534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.186534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -842.126088 (E_RNA) where: Base-Base interactions energy: -584.990 where: short stacking energy: -240.393 Base-Backbone interact. energy: -0.824 local terms energy: -256.312551 where: bonds (distance) C4'-P energy: -55.169 bonds (distance) P-C4' energy: -59.758 flat angles C4'-P-C4' energy: -55.184 flat angles P-C4'-P energy: -32.572 tors. eta vs tors. theta energy: -53.629 Dist. restrs. and SS energy: 0.940 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -746.253840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.253840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.807179 (E_RNA) where: Base-Base interactions energy: -513.455 where: short stacking energy: -235.601 Base-Backbone interact. energy: -1.797 local terms energy: -231.555975 where: bonds (distance) C4'-P energy: -42.321 bonds (distance) P-C4' energy: -60.635 flat angles C4'-P-C4' energy: -50.930 flat angles P-C4'-P energy: -31.612 tors. eta vs tors. theta energy: -46.058 Dist. restrs. and SS energy: 0.553 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -729.623511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.623511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.392308 (E_RNA) where: Base-Base interactions energy: -491.307 where: short stacking energy: -207.737 Base-Backbone interact. energy: -0.114 local terms energy: -238.971405 where: bonds (distance) C4'-P energy: -40.800 bonds (distance) P-C4' energy: -50.873 flat angles C4'-P-C4' energy: -61.653 flat angles P-C4'-P energy: -37.320 tors. eta vs tors. theta energy: -48.326 Dist. restrs. and SS energy: 0.769 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -669.652502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.652502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.433783 (E_RNA) where: Base-Base interactions energy: -428.311 where: short stacking energy: -189.637 Base-Backbone interact. energy: -0.103 local terms energy: -242.019469 where: bonds (distance) C4'-P energy: -58.853 bonds (distance) P-C4' energy: -43.696 flat angles C4'-P-C4' energy: -48.389 flat angles P-C4'-P energy: -37.786 tors. eta vs tors. theta energy: -53.296 Dist. restrs. and SS energy: 0.781 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -1152.163138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1152.163138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1152.341612 (E_RNA) where: Base-Base interactions energy: -805.492 where: short stacking energy: -340.808 Base-Backbone interact. energy: -1.110 local terms energy: -345.739692 where: bonds (distance) C4'-P energy: -64.844 bonds (distance) P-C4' energy: -67.670 flat angles C4'-P-C4' energy: -72.515 flat angles P-C4'-P energy: -43.361 tors. eta vs tors. theta energy: -97.349 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -1126.358929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1126.358929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1126.536204 (E_RNA) where: Base-Base interactions energy: -791.037 where: short stacking energy: -338.272 Base-Backbone interact. energy: -2.458 local terms energy: -333.040925 where: bonds (distance) C4'-P energy: -61.084 bonds (distance) P-C4' energy: -58.333 flat angles C4'-P-C4' energy: -79.701 flat angles P-C4'-P energy: -44.849 tors. eta vs tors. theta energy: -89.073 Dist. restrs. and SS energy: 0.177 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -1026.475267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.475267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1026.631135 (E_RNA) where: Base-Base interactions energy: -714.465 where: short stacking energy: -288.517 Base-Backbone interact. energy: -0.488 local terms energy: -311.677709 where: bonds (distance) C4'-P energy: -48.952 bonds (distance) P-C4' energy: -68.019 flat angles C4'-P-C4' energy: -68.928 flat angles P-C4'-P energy: -52.896 tors. eta vs tors. theta energy: -72.882 Dist. restrs. and SS energy: 0.156 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -999.825166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.825166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.294285 (E_RNA) where: Base-Base interactions energy: -688.183 where: short stacking energy: -273.486 Base-Backbone interact. energy: -2.659 local terms energy: -309.451885 where: bonds (distance) C4'-P energy: -60.842 bonds (distance) P-C4' energy: -58.924 flat angles C4'-P-C4' energy: -70.057 flat angles P-C4'-P energy: -43.573 tors. eta vs tors. theta energy: -76.055 Dist. restrs. and SS energy: 0.469 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -968.094888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -968.094888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -968.235944 (E_RNA) where: Base-Base interactions energy: -656.105 where: short stacking energy: -281.660 Base-Backbone interact. energy: -0.523 local terms energy: -311.607636 where: bonds (distance) C4'-P energy: -69.985 bonds (distance) P-C4' energy: -58.531 flat angles C4'-P-C4' energy: -71.845 flat angles P-C4'-P energy: -32.986 tors. eta vs tors. theta energy: -78.261 Dist. restrs. and SS energy: 0.141 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -952.738234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -952.738234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.214697 (E_RNA) where: Base-Base interactions energy: -645.669 where: short stacking energy: -276.948 Base-Backbone interact. energy: -1.568 local terms energy: -305.977881 where: bonds (distance) C4'-P energy: -52.785 bonds (distance) P-C4' energy: -59.720 flat angles C4'-P-C4' energy: -68.495 flat angles P-C4'-P energy: -43.523 tors. eta vs tors. theta energy: -81.455 Dist. restrs. and SS energy: 0.476 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -813.580642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.580642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.859420 (E_RNA) where: Base-Base interactions energy: -551.748 where: short stacking energy: -226.200 Base-Backbone interact. energy: 1.392 local terms energy: -263.503520 where: bonds (distance) C4'-P energy: -51.990 bonds (distance) P-C4' energy: -54.653 flat angles C4'-P-C4' energy: -64.892 flat angles P-C4'-P energy: -37.385 tors. eta vs tors. theta energy: -54.583 Dist. restrs. and SS energy: 0.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -783.623964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.623964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.891606 (E_RNA) where: Base-Base interactions energy: -515.217 where: short stacking energy: -220.449 Base-Backbone interact. energy: 0.526 local terms energy: -269.200166 where: bonds (distance) C4'-P energy: -59.340 bonds (distance) P-C4' energy: -54.024 flat angles C4'-P-C4' energy: -53.511 flat angles P-C4'-P energy: -40.519 tors. eta vs tors. theta energy: -61.806 Dist. restrs. and SS energy: 0.268 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -719.154572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.154572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.620488 (E_RNA) where: Base-Base interactions energy: -473.735 where: short stacking energy: -204.787 Base-Backbone interact. energy: -0.689 local terms energy: -245.196629 where: bonds (distance) C4'-P energy: -58.121 bonds (distance) P-C4' energy: -52.058 flat angles C4'-P-C4' energy: -57.639 flat angles P-C4'-P energy: -32.865 tors. eta vs tors. theta energy: -44.514 Dist. restrs. and SS energy: 0.466 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -686.030577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.030577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.202039 (E_RNA) where: Base-Base interactions energy: -450.480 where: short stacking energy: -197.955 Base-Backbone interact. energy: 0.532 local terms energy: -236.253597 where: bonds (distance) C4'-P energy: -53.323 bonds (distance) P-C4' energy: -42.494 flat angles C4'-P-C4' energy: -51.946 flat angles P-C4'-P energy: -38.666 tors. eta vs tors. theta energy: -49.824 Dist. restrs. and SS energy: 0.171 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -1157.242566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1157.242566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1157.391490 (E_RNA) where: Base-Base interactions energy: -802.235 where: short stacking energy: -335.099 Base-Backbone interact. energy: -0.770 local terms energy: -354.385933 where: bonds (distance) C4'-P energy: -61.086 bonds (distance) P-C4' energy: -67.836 flat angles C4'-P-C4' energy: -72.002 flat angles P-C4'-P energy: -55.626 tors. eta vs tors. theta energy: -97.837 Dist. restrs. and SS energy: 0.149 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -1115.380085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1115.380085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1115.725609 (E_RNA) where: Base-Base interactions energy: -806.907 where: short stacking energy: -336.860 Base-Backbone interact. energy: -1.082 local terms energy: -307.736966 where: bonds (distance) C4'-P energy: -54.532 bonds (distance) P-C4' energy: -61.673 flat angles C4'-P-C4' energy: -66.885 flat angles P-C4'-P energy: -37.950 tors. eta vs tors. theta energy: -86.697 Dist. restrs. and SS energy: 0.346 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -1027.709501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1027.709501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1028.081374 (E_RNA) where: Base-Base interactions energy: -692.946 where: short stacking energy: -297.111 Base-Backbone interact. energy: 1.044 local terms energy: -336.179139 where: bonds (distance) C4'-P energy: -68.326 bonds (distance) P-C4' energy: -65.903 flat angles C4'-P-C4' energy: -72.630 flat angles P-C4'-P energy: -49.852 tors. eta vs tors. theta energy: -79.469 Dist. restrs. and SS energy: 0.372 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -1010.451567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.451567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1010.758782 (E_RNA) where: Base-Base interactions energy: -689.070 where: short stacking energy: -285.913 Base-Backbone interact. energy: -0.082 local terms energy: -321.606298 where: bonds (distance) C4'-P energy: -63.127 bonds (distance) P-C4' energy: -58.153 flat angles C4'-P-C4' energy: -74.874 flat angles P-C4'-P energy: -46.337 tors. eta vs tors. theta energy: -79.114 Dist. restrs. and SS energy: 0.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -975.425684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.425684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.996524 (E_RNA) where: Base-Base interactions energy: -663.227 where: short stacking energy: -278.073 Base-Backbone interact. energy: -0.667 local terms energy: -312.102707 where: bonds (distance) C4'-P energy: -62.717 bonds (distance) P-C4' energy: -54.707 flat angles C4'-P-C4' energy: -76.487 flat angles P-C4'-P energy: -37.445 tors. eta vs tors. theta energy: -80.746 Dist. restrs. and SS energy: 0.571 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -915.601902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -915.601902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -916.302033 (E_RNA) where: Base-Base interactions energy: -657.605 where: short stacking energy: -257.551 Base-Backbone interact. energy: 1.536 local terms energy: -260.233198 where: bonds (distance) C4'-P energy: -55.640 bonds (distance) P-C4' energy: -53.945 flat angles C4'-P-C4' energy: -57.948 flat angles P-C4'-P energy: -33.000 tors. eta vs tors. theta energy: -59.701 Dist. restrs. and SS energy: 0.700 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -816.671306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -816.671306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -816.947655 (E_RNA) where: Base-Base interactions energy: -554.296 where: short stacking energy: -237.197 Base-Backbone interact. energy: 0.547 local terms energy: -263.198888 where: bonds (distance) C4'-P energy: -52.497 bonds (distance) P-C4' energy: -58.711 flat angles C4'-P-C4' energy: -54.761 flat angles P-C4'-P energy: -42.812 tors. eta vs tors. theta energy: -54.418 Dist. restrs. and SS energy: 0.276 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -786.970784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.970784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.153329 (E_RNA) where: Base-Base interactions energy: -529.932 where: short stacking energy: -222.857 Base-Backbone interact. energy: -0.665 local terms energy: -257.555734 where: bonds (distance) C4'-P energy: -52.149 bonds (distance) P-C4' energy: -46.650 flat angles C4'-P-C4' energy: -64.537 flat angles P-C4'-P energy: -45.039 tors. eta vs tors. theta energy: -49.180 Dist. restrs. and SS energy: 1.183 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -749.466077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -749.466077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.114467 (E_RNA) where: Base-Base interactions energy: -494.525 where: short stacking energy: -227.162 Base-Backbone interact. energy: -0.664 local terms energy: -254.925571 where: bonds (distance) C4'-P energy: -48.216 bonds (distance) P-C4' energy: -64.180 flat angles C4'-P-C4' energy: -51.390 flat angles P-C4'-P energy: -37.432 tors. eta vs tors. theta energy: -53.708 Dist. restrs. and SS energy: 0.648 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -777.272453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.272453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.551096 (E_RNA) where: Base-Base interactions energy: -543.569 where: short stacking energy: -235.961 Base-Backbone interact. energy: 2.311 local terms energy: -236.292650 where: bonds (distance) C4'-P energy: -50.252 bonds (distance) P-C4' energy: -47.036 flat angles C4'-P-C4' energy: -55.999 flat angles P-C4'-P energy: -29.080 tors. eta vs tors. theta energy: -53.925 Dist. restrs. and SS energy: 0.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -1136.826125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1136.826125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1137.087806 (E_RNA) where: Base-Base interactions energy: -804.479 where: short stacking energy: -345.705 Base-Backbone interact. energy: -1.669 local terms energy: -330.940169 where: bonds (distance) C4'-P energy: -58.417 bonds (distance) P-C4' energy: -66.265 flat angles C4'-P-C4' energy: -79.447 flat angles P-C4'-P energy: -34.321 tors. eta vs tors. theta energy: -92.491 Dist. restrs. and SS energy: 0.262 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -1136.024397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1136.024397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1136.241578 (E_RNA) where: Base-Base interactions energy: -792.818 where: short stacking energy: -347.282 Base-Backbone interact. energy: -3.035 local terms energy: -340.388797 where: bonds (distance) C4'-P energy: -51.723 bonds (distance) P-C4' energy: -67.249 flat angles C4'-P-C4' energy: -80.247 flat angles P-C4'-P energy: -39.703 tors. eta vs tors. theta energy: -101.466 Dist. restrs. and SS energy: 0.217 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -1042.830013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1042.830013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1042.936389 (E_RNA) where: Base-Base interactions energy: -723.067 where: short stacking energy: -306.382 Base-Backbone interact. energy: -0.627 local terms energy: -319.242495 where: bonds (distance) C4'-P energy: -59.362 bonds (distance) P-C4' energy: -56.889 flat angles C4'-P-C4' energy: -76.163 flat angles P-C4'-P energy: -47.928 tors. eta vs tors. theta energy: -78.900 Dist. restrs. and SS energy: 0.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -1034.393395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1034.393395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1034.757107 (E_RNA) where: Base-Base interactions energy: -691.535 where: short stacking energy: -307.912 Base-Backbone interact. energy: -2.127 local terms energy: -341.095055 where: bonds (distance) C4'-P energy: -62.331 bonds (distance) P-C4' energy: -63.527 flat angles C4'-P-C4' energy: -75.759 flat angles P-C4'-P energy: -51.124 tors. eta vs tors. theta energy: -88.355 Dist. restrs. and SS energy: 0.364 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -994.742813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.742813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -995.083901 (E_RNA) where: Base-Base interactions energy: -695.128 where: short stacking energy: -293.702 Base-Backbone interact. energy: -1.915 local terms energy: -298.040891 where: bonds (distance) C4'-P energy: -51.856 bonds (distance) P-C4' energy: -69.321 flat angles C4'-P-C4' energy: -66.769 flat angles P-C4'-P energy: -31.247 tors. eta vs tors. theta energy: -78.848 Dist. restrs. and SS energy: 0.341 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -932.154604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -932.154604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -932.632133 (E_RNA) where: Base-Base interactions energy: -652.609 where: short stacking energy: -267.372 Base-Backbone interact. energy: 2.386 local terms energy: -282.409672 where: bonds (distance) C4'-P energy: -58.223 bonds (distance) P-C4' energy: -56.493 flat angles C4'-P-C4' energy: -56.530 flat angles P-C4'-P energy: -32.470 tors. eta vs tors. theta energy: -78.693 Dist. restrs. and SS energy: 0.478 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -768.599849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.599849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.755466 (E_RNA) where: Base-Base interactions energy: -509.769 where: short stacking energy: -221.555 Base-Backbone interact. energy: -1.310 local terms energy: -257.676053 where: bonds (distance) C4'-P energy: -57.575 bonds (distance) P-C4' energy: -57.305 flat angles C4'-P-C4' energy: -53.309 flat angles P-C4'-P energy: -41.748 tors. eta vs tors. theta energy: -47.740 Dist. restrs. and SS energy: 0.156 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -775.381761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.381761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.056492 (E_RNA) where: Base-Base interactions energy: -512.015 where: short stacking energy: -226.163 Base-Backbone interact. energy: -1.890 local terms energy: -262.151093 where: bonds (distance) C4'-P energy: -58.008 bonds (distance) P-C4' energy: -58.828 flat angles C4'-P-C4' energy: -54.689 flat angles P-C4'-P energy: -41.090 tors. eta vs tors. theta energy: -49.537 Dist. restrs. and SS energy: 0.675 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -756.207523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.207523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.598512 (E_RNA) where: Base-Base interactions energy: -501.017 where: short stacking energy: -209.911 Base-Backbone interact. energy: 0.304 local terms energy: -255.886022 where: bonds (distance) C4'-P energy: -47.313 bonds (distance) P-C4' energy: -59.693 flat angles C4'-P-C4' energy: -60.772 flat angles P-C4'-P energy: -29.197 tors. eta vs tors. theta energy: -58.910 Dist. restrs. and SS energy: 0.391 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -693.651863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.651863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.746840 (E_RNA) where: Base-Base interactions energy: -461.772 where: short stacking energy: -195.720 Base-Backbone interact. energy: -0.298 local terms energy: -231.677016 where: bonds (distance) C4'-P energy: -41.413 bonds (distance) P-C4' energy: -57.836 flat angles C4'-P-C4' energy: -52.207 flat angles P-C4'-P energy: -38.984 tors. eta vs tors. theta energy: -41.238 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -1122.189201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1122.189201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1122.554666 (E_RNA) where: Base-Base interactions energy: -785.727 where: short stacking energy: -332.823 Base-Backbone interact. energy: -1.194 local terms energy: -335.633180 where: bonds (distance) C4'-P energy: -68.005 bonds (distance) P-C4' energy: -64.627 flat angles C4'-P-C4' energy: -74.157 flat angles P-C4'-P energy: -38.903 tors. eta vs tors. theta energy: -89.942 Dist. restrs. and SS energy: 0.365 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -1133.648124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1133.648124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1134.391795 (E_RNA) where: Base-Base interactions energy: -793.864 where: short stacking energy: -346.163 Base-Backbone interact. energy: -4.026 local terms energy: -336.501624 where: bonds (distance) C4'-P energy: -52.123 bonds (distance) P-C4' energy: -70.041 flat angles C4'-P-C4' energy: -77.340 flat angles P-C4'-P energy: -49.252 tors. eta vs tors. theta energy: -87.746 Dist. restrs. and SS energy: 0.744 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -1055.977521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.977521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1056.975728 (E_RNA) where: Base-Base interactions energy: -735.356 where: short stacking energy: -311.700 Base-Backbone interact. energy: 0.797 local terms energy: -322.416235 where: bonds (distance) C4'-P energy: -56.840 bonds (distance) P-C4' energy: -67.670 flat angles C4'-P-C4' energy: -69.684 flat angles P-C4'-P energy: -42.966 tors. eta vs tors. theta energy: -85.255 Dist. restrs. and SS energy: 0.998 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -987.093393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.093393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -987.591853 (E_RNA) where: Base-Base interactions energy: -676.363 where: short stacking energy: -292.381 Base-Backbone interact. energy: -3.216 local terms energy: -308.013505 where: bonds (distance) C4'-P energy: -59.686 bonds (distance) P-C4' energy: -64.706 flat angles C4'-P-C4' energy: -68.224 flat angles P-C4'-P energy: -36.841 tors. eta vs tors. theta energy: -78.556 Dist. restrs. and SS energy: 0.498 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -985.230141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.230141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -986.238312 (E_RNA) where: Base-Base interactions energy: -679.983 where: short stacking energy: -278.749 Base-Backbone interact. energy: 1.530 local terms energy: -307.785087 where: bonds (distance) C4'-P energy: -56.413 bonds (distance) P-C4' energy: -68.160 flat angles C4'-P-C4' energy: -65.575 flat angles P-C4'-P energy: -43.482 tors. eta vs tors. theta energy: -74.155 Dist. restrs. and SS energy: 1.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -944.036950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -944.036950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -944.828626 (E_RNA) where: Base-Base interactions energy: -655.152 where: short stacking energy: -272.887 Base-Backbone interact. energy: -1.593 local terms energy: -288.083201 where: bonds (distance) C4'-P energy: -55.692 bonds (distance) P-C4' energy: -56.264 flat angles C4'-P-C4' energy: -63.199 flat angles P-C4'-P energy: -37.331 tors. eta vs tors. theta energy: -75.598 Dist. restrs. and SS energy: 0.792 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -776.421743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.421743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.818699 (E_RNA) where: Base-Base interactions energy: -491.651 where: short stacking energy: -220.151 Base-Backbone interact. energy: 0.355 local terms energy: -285.522904 where: bonds (distance) C4'-P energy: -53.567 bonds (distance) P-C4' energy: -57.834 flat angles C4'-P-C4' energy: -72.923 flat angles P-C4'-P energy: -49.723 tors. eta vs tors. theta energy: -51.475 Dist. restrs. and SS energy: 0.397 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -748.110358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.110358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.488533 (E_RNA) where: Base-Base interactions energy: -510.718 where: short stacking energy: -221.863 Base-Backbone interact. energy: -2.172 local terms energy: -235.598634 where: bonds (distance) C4'-P energy: -54.582 bonds (distance) P-C4' energy: -59.544 flat angles C4'-P-C4' energy: -42.065 flat angles P-C4'-P energy: -36.846 tors. eta vs tors. theta energy: -42.561 Dist. restrs. and SS energy: 0.378 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -701.509503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.509503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.097575 (E_RNA) where: Base-Base interactions energy: -474.007 where: short stacking energy: -201.851 Base-Backbone interact. energy: -1.562 local terms energy: -226.528131 where: bonds (distance) C4'-P energy: -50.847 bonds (distance) P-C4' energy: -51.689 flat angles C4'-P-C4' energy: -53.914 flat angles P-C4'-P energy: -27.083 tors. eta vs tors. theta energy: -42.995 Dist. restrs. and SS energy: 0.588 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -677.455670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.455670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.674246 (E_RNA) where: Base-Base interactions energy: -445.700 where: short stacking energy: -193.723 Base-Backbone interact. energy: 5.183 local terms energy: -237.157322 where: bonds (distance) C4'-P energy: -58.501 bonds (distance) P-C4' energy: -50.442 flat angles C4'-P-C4' energy: -51.522 flat angles P-C4'-P energy: -31.991 tors. eta vs tors. theta energy: -44.701 Dist. restrs. and SS energy: 0.219 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -1120.060967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1120.060967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1120.095813 (E_RNA) where: Base-Base interactions energy: -783.079 where: short stacking energy: -335.367 Base-Backbone interact. energy: -0.448 local terms energy: -336.569162 where: bonds (distance) C4'-P energy: -60.767 bonds (distance) P-C4' energy: -63.253 flat angles C4'-P-C4' energy: -73.614 flat angles P-C4'-P energy: -42.445 tors. eta vs tors. theta energy: -96.490 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -1123.086299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1123.086299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1123.872675 (E_RNA) where: Base-Base interactions energy: -780.002 where: short stacking energy: -337.085 Base-Backbone interact. energy: -1.711 local terms energy: -342.160182 where: bonds (distance) C4'-P energy: -56.204 bonds (distance) P-C4' energy: -68.220 flat angles C4'-P-C4' energy: -76.631 flat angles P-C4'-P energy: -42.046 tors. eta vs tors. theta energy: -99.059 Dist. restrs. and SS energy: 0.786 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -1053.312590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.312590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1053.672446 (E_RNA) where: Base-Base interactions energy: -723.210 where: short stacking energy: -294.852 Base-Backbone interact. energy: -2.665 local terms energy: -327.798150 where: bonds (distance) C4'-P energy: -58.402 bonds (distance) P-C4' energy: -69.070 flat angles C4'-P-C4' energy: -73.928 flat angles P-C4'-P energy: -49.350 tors. eta vs tors. theta energy: -77.048 Dist. restrs. and SS energy: 0.360 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -993.069866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -993.069866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -993.246477 (E_RNA) where: Base-Base interactions energy: -694.033 where: short stacking energy: -279.052 Base-Backbone interact. energy: 0.204 local terms energy: -299.417309 where: bonds (distance) C4'-P energy: -58.354 bonds (distance) P-C4' energy: -51.984 flat angles C4'-P-C4' energy: -66.206 flat angles P-C4'-P energy: -49.790 tors. eta vs tors. theta energy: -73.083 Dist. restrs. and SS energy: 0.177 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -992.084999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -992.084999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -992.815016 (E_RNA) where: Base-Base interactions energy: -699.283 where: short stacking energy: -295.504 Base-Backbone interact. energy: -0.756 local terms energy: -292.775561 where: bonds (distance) C4'-P energy: -50.085 bonds (distance) P-C4' energy: -65.760 flat angles C4'-P-C4' energy: -65.765 flat angles P-C4'-P energy: -34.624 tors. eta vs tors. theta energy: -76.540 Dist. restrs. and SS energy: 0.730 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -921.239998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.239998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -921.941850 (E_RNA) where: Base-Base interactions energy: -620.217 where: short stacking energy: -274.571 Base-Backbone interact. energy: -0.643 local terms energy: -301.081358 where: bonds (distance) C4'-P energy: -52.269 bonds (distance) P-C4' energy: -60.664 flat angles C4'-P-C4' energy: -67.023 flat angles P-C4'-P energy: -43.859 tors. eta vs tors. theta energy: -77.267 Dist. restrs. and SS energy: 0.702 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -829.860557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.860557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -830.121783 (E_RNA) where: Base-Base interactions energy: -570.843 where: short stacking energy: -234.675 Base-Backbone interact. energy: -1.451 local terms energy: -257.828090 where: bonds (distance) C4'-P energy: -60.718 bonds (distance) P-C4' energy: -53.541 flat angles C4'-P-C4' energy: -61.602 flat angles P-C4'-P energy: -26.829 tors. eta vs tors. theta energy: -55.138 Dist. restrs. and SS energy: 0.261 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -787.512096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -787.512096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.705844 (E_RNA) where: Base-Base interactions energy: -530.974 where: short stacking energy: -240.965 Base-Backbone interact. energy: -0.087 local terms energy: -256.645415 where: bonds (distance) C4'-P energy: -47.109 bonds (distance) P-C4' energy: -57.819 flat angles C4'-P-C4' energy: -55.018 flat angles P-C4'-P energy: -37.966 tors. eta vs tors. theta energy: -58.733 Dist. restrs. and SS energy: 0.194 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -691.048130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.048130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.067236 (E_RNA) where: Base-Base interactions energy: -451.585 where: short stacking energy: -198.250 Base-Backbone interact. energy: 2.059 local terms energy: -242.541608 where: bonds (distance) C4'-P energy: -48.174 bonds (distance) P-C4' energy: -56.858 flat angles C4'-P-C4' energy: -50.320 flat angles P-C4'-P energy: -40.706 tors. eta vs tors. theta energy: -46.483 Dist. restrs. and SS energy: 1.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -697.615171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.615171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.838159 (E_RNA) where: Base-Base interactions energy: -452.375 where: short stacking energy: -199.158 Base-Backbone interact. energy: 4.734 local terms energy: -250.197891 where: bonds (distance) C4'-P energy: -59.213 bonds (distance) P-C4' energy: -51.258 flat angles C4'-P-C4' energy: -64.613 flat angles P-C4'-P energy: -27.383 tors. eta vs tors. theta energy: -47.730 Dist. restrs. and SS energy: 0.223 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -1115.567515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1115.567515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1116.110643 (E_RNA) where: Base-Base interactions energy: -783.576 where: short stacking energy: -339.406 Base-Backbone interact. energy: 0.275 local terms energy: -332.809247 where: bonds (distance) C4'-P energy: -68.675 bonds (distance) P-C4' energy: -64.984 flat angles C4'-P-C4' energy: -70.914 flat angles P-C4'-P energy: -34.972 tors. eta vs tors. theta energy: -93.264 Dist. restrs. and SS energy: 0.543 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -1121.701546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1121.701546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1121.976713 (E_RNA) where: Base-Base interactions energy: -800.466 where: short stacking energy: -334.952 Base-Backbone interact. energy: -1.929 local terms energy: -319.582414 where: bonds (distance) C4'-P energy: -64.400 bonds (distance) P-C4' energy: -59.656 flat angles C4'-P-C4' energy: -66.918 flat angles P-C4'-P energy: -42.940 tors. eta vs tors. theta energy: -85.670 Dist. restrs. and SS energy: 0.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -1089.133478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.133478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1089.208057 (E_RNA) where: Base-Base interactions energy: -769.677 where: short stacking energy: -318.368 Base-Backbone interact. energy: 0.355 local terms energy: -319.885332 where: bonds (distance) C4'-P energy: -62.368 bonds (distance) P-C4' energy: -54.952 flat angles C4'-P-C4' energy: -72.017 flat angles P-C4'-P energy: -46.034 tors. eta vs tors. theta energy: -84.514 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -1014.111335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.111335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1014.616609 (E_RNA) where: Base-Base interactions energy: -687.678 where: short stacking energy: -303.961 Base-Backbone interact. energy: -0.111 local terms energy: -326.827515 where: bonds (distance) C4'-P energy: -68.016 bonds (distance) P-C4' energy: -55.938 flat angles C4'-P-C4' energy: -69.574 flat angles P-C4'-P energy: -48.418 tors. eta vs tors. theta energy: -84.881 Dist. restrs. and SS energy: 0.505 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -1034.606979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1034.606979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1035.110874 (E_RNA) where: Base-Base interactions energy: -734.148 where: short stacking energy: -289.727 Base-Backbone interact. energy: -2.772 local terms energy: -298.190504 where: bonds (distance) C4'-P energy: -59.546 bonds (distance) P-C4' energy: -58.770 flat angles C4'-P-C4' energy: -64.301 flat angles P-C4'-P energy: -46.026 tors. eta vs tors. theta energy: -69.547 Dist. restrs. and SS energy: 0.504 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -961.410794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -961.410794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.666628 (E_RNA) where: Base-Base interactions energy: -648.652 where: short stacking energy: -291.038 Base-Backbone interact. energy: -0.697 local terms energy: -312.317957 where: bonds (distance) C4'-P energy: -64.925 bonds (distance) P-C4' energy: -60.442 flat angles C4'-P-C4' energy: -68.136 flat angles P-C4'-P energy: -45.256 tors. eta vs tors. theta energy: -73.559 Dist. restrs. and SS energy: 0.256 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -840.056304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.056304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -840.696290 (E_RNA) where: Base-Base interactions energy: -557.546 where: short stacking energy: -239.580 Base-Backbone interact. energy: -1.679 local terms energy: -281.471972 where: bonds (distance) C4'-P energy: -63.297 bonds (distance) P-C4' energy: -60.782 flat angles C4'-P-C4' energy: -64.601 flat angles P-C4'-P energy: -35.784 tors. eta vs tors. theta energy: -57.008 Dist. restrs. and SS energy: 0.640 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -768.307339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.307339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.893778 (E_RNA) where: Base-Base interactions energy: -496.195 where: short stacking energy: -225.473 Base-Backbone interact. energy: -0.794 local terms energy: -271.904818 where: bonds (distance) C4'-P energy: -45.666 bonds (distance) P-C4' energy: -57.411 flat angles C4'-P-C4' energy: -63.821 flat angles P-C4'-P energy: -42.567 tors. eta vs tors. theta energy: -62.440 Dist. restrs. and SS energy: 0.586 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -708.785447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.785447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.128366 (E_RNA) where: Base-Base interactions energy: -479.162 where: short stacking energy: -216.262 Base-Backbone interact. energy: -0.619 local terms energy: -229.347391 where: bonds (distance) C4'-P energy: -48.047 bonds (distance) P-C4' energy: -54.579 flat angles C4'-P-C4' energy: -44.286 flat angles P-C4'-P energy: -33.303 tors. eta vs tors. theta energy: -49.133 Dist. restrs. and SS energy: 0.343 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -694.356019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.356019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.963534 (E_RNA) where: Base-Base interactions energy: -458.765 where: short stacking energy: -211.143 Base-Backbone interact. energy: -2.363 local terms energy: -233.835183 where: bonds (distance) C4'-P energy: -51.469 bonds (distance) P-C4' energy: -47.335 flat angles C4'-P-C4' energy: -51.689 flat angles P-C4'-P energy: -31.950 tors. eta vs tors. theta energy: -51.392 Dist. restrs. and SS energy: 0.608 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -1117.234132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1117.234132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1117.277077 (E_RNA) where: Base-Base interactions energy: -781.124 where: short stacking energy: -343.695 Base-Backbone interact. energy: 0.388 local terms energy: -336.541119 where: bonds (distance) C4'-P energy: -63.318 bonds (distance) P-C4' energy: -68.314 flat angles C4'-P-C4' energy: -66.068 flat angles P-C4'-P energy: -44.753 tors. eta vs tors. theta energy: -94.089 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -1102.306772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.306772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1102.570396 (E_RNA) where: Base-Base interactions energy: -759.946 where: short stacking energy: -319.573 Base-Backbone interact. energy: -2.150 local terms energy: -340.474550 where: bonds (distance) C4'-P energy: -66.637 bonds (distance) P-C4' energy: -63.764 flat angles C4'-P-C4' energy: -75.687 flat angles P-C4'-P energy: -47.250 tors. eta vs tors. theta energy: -87.137 Dist. restrs. and SS energy: 0.264 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -1061.218163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.218163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.400109 (E_RNA) where: Base-Base interactions energy: -729.068 where: short stacking energy: -299.764 Base-Backbone interact. energy: -1.752 local terms energy: -330.580675 where: bonds (distance) C4'-P energy: -57.770 bonds (distance) P-C4' energy: -67.437 flat angles C4'-P-C4' energy: -72.391 flat angles P-C4'-P energy: -42.627 tors. eta vs tors. theta energy: -90.356 Dist. restrs. and SS energy: 0.182 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -1037.986290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.986290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.277629 (E_RNA) where: Base-Base interactions energy: -708.583 where: short stacking energy: -293.641 Base-Backbone interact. energy: 0.847 local terms energy: -330.541874 where: bonds (distance) C4'-P energy: -63.700 bonds (distance) P-C4' energy: -61.862 flat angles C4'-P-C4' energy: -70.057 flat angles P-C4'-P energy: -52.875 tors. eta vs tors. theta energy: -82.048 Dist. restrs. and SS energy: 0.291 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -1019.268973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.268973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1019.455999 (E_RNA) where: Base-Base interactions energy: -712.049 where: short stacking energy: -286.686 Base-Backbone interact. energy: -2.114 local terms energy: -305.293019 where: bonds (distance) C4'-P energy: -53.730 bonds (distance) P-C4' energy: -63.682 flat angles C4'-P-C4' energy: -76.010 flat angles P-C4'-P energy: -42.271 tors. eta vs tors. theta energy: -69.599 Dist. restrs. and SS energy: 0.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -953.868799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -953.868799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -954.124537 (E_RNA) where: Base-Base interactions energy: -661.826 where: short stacking energy: -292.822 Base-Backbone interact. energy: -0.186 local terms energy: -292.112834 where: bonds (distance) C4'-P energy: -52.926 bonds (distance) P-C4' energy: -57.005 flat angles C4'-P-C4' energy: -64.747 flat angles P-C4'-P energy: -43.266 tors. eta vs tors. theta energy: -74.169 Dist. restrs. and SS energy: 0.256 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -829.112137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.112137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -830.039410 (E_RNA) where: Base-Base interactions energy: -549.159 where: short stacking energy: -231.595 Base-Backbone interact. energy: 2.364 local terms energy: -283.244836 where: bonds (distance) C4'-P energy: -67.050 bonds (distance) P-C4' energy: -59.716 flat angles C4'-P-C4' energy: -62.548 flat angles P-C4'-P energy: -38.796 tors. eta vs tors. theta energy: -55.135 Dist. restrs. and SS energy: 0.927 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -746.323623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.323623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.755961 (E_RNA) where: Base-Base interactions energy: -480.536 where: short stacking energy: -213.610 Base-Backbone interact. energy: 3.182 local terms energy: -269.401783 where: bonds (distance) C4'-P energy: -60.939 bonds (distance) P-C4' energy: -60.974 flat angles C4'-P-C4' energy: -61.373 flat angles P-C4'-P energy: -32.828 tors. eta vs tors. theta energy: -53.288 Dist. restrs. and SS energy: 0.432 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -707.323352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.323352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.446658 (E_RNA) where: Base-Base interactions energy: -459.398 where: short stacking energy: -192.519 Base-Backbone interact. energy: -1.484 local terms energy: -247.564306 where: bonds (distance) C4'-P energy: -50.007 bonds (distance) P-C4' energy: -48.620 flat angles C4'-P-C4' energy: -60.301 flat angles P-C4'-P energy: -36.638 tors. eta vs tors. theta energy: -51.998 Dist. restrs. and SS energy: 1.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -673.968953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.968953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.201123 (E_RNA) where: Base-Base interactions energy: -439.688 where: short stacking energy: -197.856 Base-Backbone interact. energy: 3.155 local terms energy: -237.667930 where: bonds (distance) C4'-P energy: -55.249 bonds (distance) P-C4' energy: -48.122 flat angles C4'-P-C4' energy: -60.333 flat angles P-C4'-P energy: -35.383 tors. eta vs tors. theta energy: -38.581 Dist. restrs. and SS energy: 0.232 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -1130.336444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1130.336444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1130.741651 (E_RNA) where: Base-Base interactions energy: -778.002 where: short stacking energy: -334.548 Base-Backbone interact. energy: -0.406 local terms energy: -352.333094 where: bonds (distance) C4'-P energy: -67.212 bonds (distance) P-C4' energy: -71.057 flat angles C4'-P-C4' energy: -77.839 flat angles P-C4'-P energy: -42.929 tors. eta vs tors. theta energy: -93.296 Dist. restrs. and SS energy: 0.405 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -1073.780520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.780520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.851980 (E_RNA) where: Base-Base interactions energy: -745.870 where: short stacking energy: -319.378 Base-Backbone interact. energy: -1.702 local terms energy: -326.279263 where: bonds (distance) C4'-P energy: -61.807 bonds (distance) P-C4' energy: -67.733 flat angles C4'-P-C4' energy: -69.710 flat angles P-C4'-P energy: -45.414 tors. eta vs tors. theta energy: -81.615 Dist. restrs. and SS energy: 0.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -1049.882463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1049.882463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1050.067625 (E_RNA) where: Base-Base interactions energy: -714.653 where: short stacking energy: -305.645 Base-Backbone interact. energy: -0.072 local terms energy: -335.342759 where: bonds (distance) C4'-P energy: -58.845 bonds (distance) P-C4' energy: -65.987 flat angles C4'-P-C4' energy: -75.298 flat angles P-C4'-P energy: -47.810 tors. eta vs tors. theta energy: -87.403 Dist. restrs. and SS energy: 0.185 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -1043.287072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.287072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1043.649563 (E_RNA) where: Base-Base interactions energy: -727.107 where: short stacking energy: -299.264 Base-Backbone interact. energy: -0.117 local terms energy: -316.425523 where: bonds (distance) C4'-P energy: -65.550 bonds (distance) P-C4' energy: -62.807 flat angles C4'-P-C4' energy: -66.698 flat angles P-C4'-P energy: -43.143 tors. eta vs tors. theta energy: -78.228 Dist. restrs. and SS energy: 0.362 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -1011.884216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.884216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.991314 (E_RNA) where: Base-Base interactions energy: -707.051 where: short stacking energy: -298.865 Base-Backbone interact. energy: 0.328 local terms energy: -305.267801 where: bonds (distance) C4'-P energy: -53.586 bonds (distance) P-C4' energy: -54.951 flat angles C4'-P-C4' energy: -70.019 flat angles P-C4'-P energy: -46.431 tors. eta vs tors. theta energy: -80.281 Dist. restrs. and SS energy: 0.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -972.590502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.590502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.785329 (E_RNA) where: Base-Base interactions energy: -676.828 where: short stacking energy: -280.876 Base-Backbone interact. energy: -1.371 local terms energy: -294.586009 where: bonds (distance) C4'-P energy: -61.510 bonds (distance) P-C4' energy: -60.835 flat angles C4'-P-C4' energy: -61.701 flat angles P-C4'-P energy: -32.103 tors. eta vs tors. theta energy: -78.437 Dist. restrs. and SS energy: 0.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -848.548467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.548467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.444254 (E_RNA) where: Base-Base interactions energy: -580.540 where: short stacking energy: -240.777 Base-Backbone interact. energy: 0.276 local terms energy: -269.180375 where: bonds (distance) C4'-P energy: -48.043 bonds (distance) P-C4' energy: -53.759 flat angles C4'-P-C4' energy: -63.780 flat angles P-C4'-P energy: -44.012 tors. eta vs tors. theta energy: -59.587 Dist. restrs. and SS energy: 0.896 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -739.457222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -739.457222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.295470 (E_RNA) where: Base-Base interactions energy: -480.849 where: short stacking energy: -207.117 Base-Backbone interact. energy: -0.658 local terms energy: -258.788505 where: bonds (distance) C4'-P energy: -56.180 bonds (distance) P-C4' energy: -55.708 flat angles C4'-P-C4' energy: -64.925 flat angles P-C4'-P energy: -29.915 tors. eta vs tors. theta energy: -52.061 Dist. restrs. and SS energy: 0.838 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -774.121407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -774.121407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.486817 (E_RNA) where: Base-Base interactions energy: -511.501 where: short stacking energy: -223.263 Base-Backbone interact. energy: -0.933 local terms energy: -263.052746 where: bonds (distance) C4'-P energy: -66.494 bonds (distance) P-C4' energy: -51.731 flat angles C4'-P-C4' energy: -65.364 flat angles P-C4'-P energy: -23.603 tors. eta vs tors. theta energy: -55.860 Dist. restrs. and SS energy: 1.365 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -666.248443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.248443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.560926 (E_RNA) where: Base-Base interactions energy: -433.302 where: short stacking energy: -183.702 Base-Backbone interact. energy: 0.325 local terms energy: -233.583361 where: bonds (distance) C4'-P energy: -46.202 bonds (distance) P-C4' energy: -47.738 flat angles C4'-P-C4' energy: -62.452 flat angles P-C4'-P energy: -42.087 tors. eta vs tors. theta energy: -35.105 Dist. restrs. and SS energy: 0.312 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -1142.012068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1142.012068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1142.252998 (E_RNA) where: Base-Base interactions energy: -811.796 where: short stacking energy: -339.972 Base-Backbone interact. energy: -0.935 local terms energy: -329.521635 where: bonds (distance) C4'-P energy: -61.442 bonds (distance) P-C4' energy: -67.756 flat angles C4'-P-C4' energy: -74.446 flat angles P-C4'-P energy: -36.985 tors. eta vs tors. theta energy: -88.893 Dist. restrs. and SS energy: 0.241 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -1054.369461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1054.369461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1054.626870 (E_RNA) where: Base-Base interactions energy: -735.232 where: short stacking energy: -322.119 Base-Backbone interact. energy: -1.868 local terms energy: -317.527247 where: bonds (distance) C4'-P energy: -48.961 bonds (distance) P-C4' energy: -62.498 flat angles C4'-P-C4' energy: -72.391 flat angles P-C4'-P energy: -51.287 tors. eta vs tors. theta energy: -82.390 Dist. restrs. and SS energy: 0.257 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -1063.381750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.381750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1063.886026 (E_RNA) where: Base-Base interactions energy: -729.146 where: short stacking energy: -314.183 Base-Backbone interact. energy: -0.128 local terms energy: -334.612169 where: bonds (distance) C4'-P energy: -62.851 bonds (distance) P-C4' energy: -63.965 flat angles C4'-P-C4' energy: -70.306 flat angles P-C4'-P energy: -47.275 tors. eta vs tors. theta energy: -90.217 Dist. restrs. and SS energy: 0.504 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -999.734975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.734975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.462514 (E_RNA) where: Base-Base interactions energy: -679.601 where: short stacking energy: -273.803 Base-Backbone interact. energy: 1.806 local terms energy: -322.667915 where: bonds (distance) C4'-P energy: -59.699 bonds (distance) P-C4' energy: -71.655 flat angles C4'-P-C4' energy: -69.453 flat angles P-C4'-P energy: -45.300 tors. eta vs tors. theta energy: -76.561 Dist. restrs. and SS energy: 0.728 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -1014.864253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.864253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1015.582627 (E_RNA) where: Base-Base interactions energy: -702.784 where: short stacking energy: -278.282 Base-Backbone interact. energy: -0.626 local terms energy: -312.172730 where: bonds (distance) C4'-P energy: -56.917 bonds (distance) P-C4' energy: -61.971 flat angles C4'-P-C4' energy: -72.371 flat angles P-C4'-P energy: -36.195 tors. eta vs tors. theta energy: -84.719 Dist. restrs. and SS energy: 0.718 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -958.454961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -958.454961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.959544 (E_RNA) where: Base-Base interactions energy: -676.198 where: short stacking energy: -282.871 Base-Backbone interact. energy: -0.210 local terms energy: -282.550774 where: bonds (distance) C4'-P energy: -56.119 bonds (distance) P-C4' energy: -56.442 flat angles C4'-P-C4' energy: -57.570 flat angles P-C4'-P energy: -42.811 tors. eta vs tors. theta energy: -69.608 Dist. restrs. and SS energy: 0.505 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -843.588056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.588056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.916635 (E_RNA) where: Base-Base interactions energy: -550.220 where: short stacking energy: -240.399 Base-Backbone interact. energy: -2.141 local terms energy: -291.555951 where: bonds (distance) C4'-P energy: -56.878 bonds (distance) P-C4' energy: -53.814 flat angles C4'-P-C4' energy: -70.069 flat angles P-C4'-P energy: -42.736 tors. eta vs tors. theta energy: -68.059 Dist. restrs. and SS energy: 0.329 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -782.753648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.753648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.453676 (E_RNA) where: Base-Base interactions energy: -499.181 where: short stacking energy: -219.327 Base-Backbone interact. energy: -0.883 local terms energy: -283.389184 where: bonds (distance) C4'-P energy: -62.305 bonds (distance) P-C4' energy: -62.013 flat angles C4'-P-C4' energy: -64.669 flat angles P-C4'-P energy: -41.504 tors. eta vs tors. theta energy: -52.898 Dist. restrs. and SS energy: 0.700 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -692.307122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.307122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.496975 (E_RNA) where: Base-Base interactions energy: -450.632 where: short stacking energy: -195.889 Base-Backbone interact. energy: -1.593 local terms energy: -240.272217 where: bonds (distance) C4'-P energy: -54.253 bonds (distance) P-C4' energy: -60.760 flat angles C4'-P-C4' energy: -56.843 flat angles P-C4'-P energy: -37.993 tors. eta vs tors. theta energy: -30.423 Dist. restrs. and SS energy: 0.190 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -673.779613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.779613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.045019 (E_RNA) where: Base-Base interactions energy: -445.205 where: short stacking energy: -201.270 Base-Backbone interact. energy: -1.247 local terms energy: -227.592413 where: bonds (distance) C4'-P energy: -57.536 bonds (distance) P-C4' energy: -34.492 flat angles C4'-P-C4' energy: -53.861 flat angles P-C4'-P energy: -31.546 tors. eta vs tors. theta energy: -50.158 Dist. restrs. and SS energy: 0.265 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -1143.860062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1143.860062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1144.166730 (E_RNA) where: Base-Base interactions energy: -797.644 where: short stacking energy: -353.428 Base-Backbone interact. energy: 7.683 local terms energy: -354.205337 where: bonds (distance) C4'-P energy: -64.589 bonds (distance) P-C4' energy: -74.064 flat angles C4'-P-C4' energy: -74.843 flat angles P-C4'-P energy: -47.576 tors. eta vs tors. theta energy: -93.132 Dist. restrs. and SS energy: 0.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -1073.152635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.152635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.582710 (E_RNA) where: Base-Base interactions energy: -742.632 where: short stacking energy: -324.304 Base-Backbone interact. energy: -1.395 local terms energy: -329.556326 where: bonds (distance) C4'-P energy: -60.081 bonds (distance) P-C4' energy: -60.209 flat angles C4'-P-C4' energy: -74.603 flat angles P-C4'-P energy: -50.393 tors. eta vs tors. theta energy: -84.271 Dist. restrs. and SS energy: 0.430 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -1017.962909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1017.962909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1018.485129 (E_RNA) where: Base-Base interactions energy: -689.508 where: short stacking energy: -305.865 Base-Backbone interact. energy: -1.199 local terms energy: -327.777856 where: bonds (distance) C4'-P energy: -67.483 bonds (distance) P-C4' energy: -56.539 flat angles C4'-P-C4' energy: -69.540 flat angles P-C4'-P energy: -46.325 tors. eta vs tors. theta energy: -87.890 Dist. restrs. and SS energy: 0.522 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -1034.996659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1034.996659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1035.521214 (E_RNA) where: Base-Base interactions energy: -701.067 where: short stacking energy: -283.944 Base-Backbone interact. energy: -0.708 local terms energy: -333.745901 where: bonds (distance) C4'-P energy: -58.574 bonds (distance) P-C4' energy: -74.363 flat angles C4'-P-C4' energy: -70.578 flat angles P-C4'-P energy: -53.105 tors. eta vs tors. theta energy: -77.126 Dist. restrs. and SS energy: 0.525 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -932.914911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -932.914911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -933.187066 (E_RNA) where: Base-Base interactions energy: -645.423 where: short stacking energy: -262.561 Base-Backbone interact. energy: -0.670 local terms energy: -287.093842 where: bonds (distance) C4'-P energy: -51.535 bonds (distance) P-C4' energy: -54.715 flat angles C4'-P-C4' energy: -69.755 flat angles P-C4'-P energy: -43.524 tors. eta vs tors. theta energy: -67.566 Dist. restrs. and SS energy: 0.272 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -971.261605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -971.261605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -971.715573 (E_RNA) where: Base-Base interactions energy: -664.038 where: short stacking energy: -272.808 Base-Backbone interact. energy: -1.319 local terms energy: -306.358875 where: bonds (distance) C4'-P energy: -63.207 bonds (distance) P-C4' energy: -54.415 flat angles C4'-P-C4' energy: -66.696 flat angles P-C4'-P energy: -46.138 tors. eta vs tors. theta energy: -75.903 Dist. restrs. and SS energy: 0.454 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -807.974113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -807.974113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -808.290927 (E_RNA) where: Base-Base interactions energy: -540.962 where: short stacking energy: -236.240 Base-Backbone interact. energy: -1.228 local terms energy: -266.101064 where: bonds (distance) C4'-P energy: -47.216 bonds (distance) P-C4' energy: -62.781 flat angles C4'-P-C4' energy: -66.225 flat angles P-C4'-P energy: -33.531 tors. eta vs tors. theta energy: -56.349 Dist. restrs. and SS energy: 0.317 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -794.218270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.218270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.357780 (E_RNA) where: Base-Base interactions energy: -529.363 where: short stacking energy: -233.931 Base-Backbone interact. energy: 0.329 local terms energy: -265.324048 where: bonds (distance) C4'-P energy: -54.987 bonds (distance) P-C4' energy: -48.137 flat angles C4'-P-C4' energy: -60.772 flat angles P-C4'-P energy: -35.623 tors. eta vs tors. theta energy: -65.806 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -708.742548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.742548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.369198 (E_RNA) where: Base-Base interactions energy: -464.983 where: short stacking energy: -193.722 Base-Backbone interact. energy: 0.605 local terms energy: -244.990645 where: bonds (distance) C4'-P energy: -49.087 bonds (distance) P-C4' energy: -55.854 flat angles C4'-P-C4' energy: -51.614 flat angles P-C4'-P energy: -43.898 tors. eta vs tors. theta energy: -44.537 Dist. restrs. and SS energy: 0.627 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -652.832813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -652.832813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.076353 (E_RNA) where: Base-Base interactions energy: -442.575 where: short stacking energy: -184.960 Base-Backbone interact. energy: -1.400 local terms energy: -210.101209 where: bonds (distance) C4'-P energy: -50.205 bonds (distance) P-C4' energy: -53.944 flat angles C4'-P-C4' energy: -38.862 flat angles P-C4'-P energy: -33.660 tors. eta vs tors. theta energy: -33.431 Dist. restrs. and SS energy: 1.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -1124.958785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1124.958785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1125.245055 (E_RNA) where: Base-Base interactions energy: -775.997 where: short stacking energy: -340.292 Base-Backbone interact. energy: -1.364 local terms energy: -347.884732 where: bonds (distance) C4'-P energy: -71.557 bonds (distance) P-C4' energy: -66.381 flat angles C4'-P-C4' energy: -71.229 flat angles P-C4'-P energy: -42.853 tors. eta vs tors. theta energy: -95.865 Dist. restrs. and SS energy: 0.286 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -1095.141250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.141250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1095.769464 (E_RNA) where: Base-Base interactions energy: -757.382 where: short stacking energy: -318.268 Base-Backbone interact. energy: 0.136 local terms energy: -338.523335 where: bonds (distance) C4'-P energy: -60.356 bonds (distance) P-C4' energy: -67.683 flat angles C4'-P-C4' energy: -72.740 flat angles P-C4'-P energy: -48.457 tors. eta vs tors. theta energy: -89.288 Dist. restrs. and SS energy: 0.628 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -1056.595045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1056.595045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1056.774306 (E_RNA) where: Base-Base interactions energy: -740.402 where: short stacking energy: -312.788 Base-Backbone interact. energy: -1.028 local terms energy: -315.343676 where: bonds (distance) C4'-P energy: -56.001 bonds (distance) P-C4' energy: -64.269 flat angles C4'-P-C4' energy: -67.753 flat angles P-C4'-P energy: -44.307 tors. eta vs tors. theta energy: -83.013 Dist. restrs. and SS energy: 0.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -1001.424758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.424758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1001.477629 (E_RNA) where: Base-Base interactions energy: -677.449 where: short stacking energy: -295.668 Base-Backbone interact. energy: -1.754 local terms energy: -322.274321 where: bonds (distance) C4'-P energy: -54.187 bonds (distance) P-C4' energy: -70.439 flat angles C4'-P-C4' energy: -69.419 flat angles P-C4'-P energy: -46.027 tors. eta vs tors. theta energy: -82.202 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -972.501209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.501209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.808949 (E_RNA) where: Base-Base interactions energy: -701.351 where: short stacking energy: -283.527 Base-Backbone interact. energy: 0.835 local terms energy: -272.292199 where: bonds (distance) C4'-P energy: -47.098 bonds (distance) P-C4' energy: -60.213 flat angles C4'-P-C4' energy: -56.212 flat angles P-C4'-P energy: -43.020 tors. eta vs tors. theta energy: -65.749 Dist. restrs. and SS energy: 0.308 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -933.361199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -933.361199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -933.733509 (E_RNA) where: Base-Base interactions energy: -639.682 where: short stacking energy: -277.990 Base-Backbone interact. energy: -1.006 local terms energy: -293.045490 where: bonds (distance) C4'-P energy: -53.649 bonds (distance) P-C4' energy: -68.744 flat angles C4'-P-C4' energy: -70.647 flat angles P-C4'-P energy: -33.997 tors. eta vs tors. theta energy: -66.008 Dist. restrs. and SS energy: 0.372 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -832.596397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.596397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.705448 (E_RNA) where: Base-Base interactions energy: -557.573 where: short stacking energy: -232.633 Base-Backbone interact. energy: 2.285 local terms energy: -277.417558 where: bonds (distance) C4'-P energy: -62.123 bonds (distance) P-C4' energy: -65.714 flat angles C4'-P-C4' energy: -53.222 flat angles P-C4'-P energy: -39.085 tors. eta vs tors. theta energy: -57.274 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -765.086070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.086070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.293665 (E_RNA) where: Base-Base interactions energy: -497.853 where: short stacking energy: -220.023 Base-Backbone interact. energy: -1.031 local terms energy: -266.408988 where: bonds (distance) C4'-P energy: -54.835 bonds (distance) P-C4' energy: -69.378 flat angles C4'-P-C4' energy: -59.453 flat angles P-C4'-P energy: -31.240 tors. eta vs tors. theta energy: -51.503 Dist. restrs. and SS energy: 0.208 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -685.561050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.561050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.957298 (E_RNA) where: Base-Base interactions energy: -436.637 where: short stacking energy: -196.397 Base-Backbone interact. energy: 1.209 local terms energy: -250.528682 where: bonds (distance) C4'-P energy: -62.732 bonds (distance) P-C4' energy: -63.110 flat angles C4'-P-C4' energy: -54.103 flat angles P-C4'-P energy: -33.280 tors. eta vs tors. theta energy: -37.304 Dist. restrs. and SS energy: 0.396 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -698.897713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.897713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.875195 (E_RNA) where: Base-Base interactions energy: -450.834 where: short stacking energy: -177.949 Base-Backbone interact. energy: -1.079 local terms energy: -247.962347 where: bonds (distance) C4'-P energy: -58.918 bonds (distance) P-C4' energy: -68.666 flat angles C4'-P-C4' energy: -58.559 flat angles P-C4'-P energy: -30.177 tors. eta vs tors. theta energy: -31.642 Dist. restrs. and SS energy: 0.977 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -1141.925674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1141.925674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1142.119220 (E_RNA) where: Base-Base interactions energy: -791.792 where: short stacking energy: -333.940 Base-Backbone interact. energy: -1.830 local terms energy: -348.496479 where: bonds (distance) C4'-P energy: -58.735 bonds (distance) P-C4' energy: -70.476 flat angles C4'-P-C4' energy: -76.914 flat angles P-C4'-P energy: -49.875 tors. eta vs tors. theta energy: -92.497 Dist. restrs. and SS energy: 0.194 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -1089.348222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.348222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1090.115706 (E_RNA) where: Base-Base interactions energy: -751.903 where: short stacking energy: -319.696 Base-Backbone interact. energy: -2.815 local terms energy: -335.398520 where: bonds (distance) C4'-P energy: -63.844 bonds (distance) P-C4' energy: -68.616 flat angles C4'-P-C4' energy: -69.890 flat angles P-C4'-P energy: -53.380 tors. eta vs tors. theta energy: -79.668 Dist. restrs. and SS energy: 0.767 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -1064.206392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.206392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1064.548100 (E_RNA) where: Base-Base interactions energy: -748.824 where: short stacking energy: -313.439 Base-Backbone interact. energy: -1.819 local terms energy: -313.904948 where: bonds (distance) C4'-P energy: -53.603 bonds (distance) P-C4' energy: -60.989 flat angles C4'-P-C4' energy: -68.078 flat angles P-C4'-P energy: -44.659 tors. eta vs tors. theta energy: -86.575 Dist. restrs. and SS energy: 0.342 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -1045.638181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.638181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1045.776202 (E_RNA) where: Base-Base interactions energy: -714.826 where: short stacking energy: -311.493 Base-Backbone interact. energy: -0.772 local terms energy: -330.177525 where: bonds (distance) C4'-P energy: -63.688 bonds (distance) P-C4' energy: -64.127 flat angles C4'-P-C4' energy: -70.903 flat angles P-C4'-P energy: -47.307 tors. eta vs tors. theta energy: -84.152 Dist. restrs. and SS energy: 0.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -980.545515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.545515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -980.841345 (E_RNA) where: Base-Base interactions energy: -674.146 where: short stacking energy: -273.740 Base-Backbone interact. energy: 1.274 local terms energy: -307.969484 where: bonds (distance) C4'-P energy: -51.660 bonds (distance) P-C4' energy: -62.988 flat angles C4'-P-C4' energy: -65.488 flat angles P-C4'-P energy: -47.851 tors. eta vs tors. theta energy: -79.983 Dist. restrs. and SS energy: 0.296 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -905.661250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -905.661250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -906.317628 (E_RNA) where: Base-Base interactions energy: -617.402 where: short stacking energy: -255.183 Base-Backbone interact. energy: -0.345 local terms energy: -288.570322 where: bonds (distance) C4'-P energy: -58.679 bonds (distance) P-C4' energy: -54.168 flat angles C4'-P-C4' energy: -66.940 flat angles P-C4'-P energy: -43.713 tors. eta vs tors. theta energy: -65.070 Dist. restrs. and SS energy: 0.656 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -823.200331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -823.200331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.868182 (E_RNA) where: Base-Base interactions energy: -556.683 where: short stacking energy: -257.473 Base-Backbone interact. energy: -0.214 local terms energy: -266.971027 where: bonds (distance) C4'-P energy: -63.891 bonds (distance) P-C4' energy: -46.763 flat angles C4'-P-C4' energy: -59.488 flat angles P-C4'-P energy: -34.841 tors. eta vs tors. theta energy: -61.989 Dist. restrs. and SS energy: 0.668 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -798.425082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.425082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.153524 (E_RNA) where: Base-Base interactions energy: -517.159 where: short stacking energy: -222.627 Base-Backbone interact. energy: -0.805 local terms energy: -281.190382 where: bonds (distance) C4'-P energy: -55.346 bonds (distance) P-C4' energy: -59.888 flat angles C4'-P-C4' energy: -58.829 flat angles P-C4'-P energy: -45.342 tors. eta vs tors. theta energy: -61.786 Dist. restrs. and SS energy: 0.728 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -706.613456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.613456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.824052 (E_RNA) where: Base-Base interactions energy: -465.450 where: short stacking energy: -214.699 Base-Backbone interact. energy: 0.932 local terms energy: -242.306259 where: bonds (distance) C4'-P energy: -52.185 bonds (distance) P-C4' energy: -57.352 flat angles C4'-P-C4' energy: -57.627 flat angles P-C4'-P energy: -37.312 tors. eta vs tors. theta energy: -37.831 Dist. restrs. and SS energy: 0.211 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -681.175199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.175199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.264230 (E_RNA) where: Base-Base interactions energy: -447.430 where: short stacking energy: -189.460 Base-Backbone interact. energy: -1.794 local terms energy: -233.040166 where: bonds (distance) C4'-P energy: -47.770 bonds (distance) P-C4' energy: -55.133 flat angles C4'-P-C4' energy: -62.618 flat angles P-C4'-P energy: -37.520 tors. eta vs tors. theta energy: -29.998 Dist. restrs. and SS energy: 1.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -1125.834819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1125.834819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1126.461967 (E_RNA) where: Base-Base interactions energy: -776.103 where: short stacking energy: -340.919 Base-Backbone interact. energy: -2.534 local terms energy: -347.824907 where: bonds (distance) C4'-P energy: -64.768 bonds (distance) P-C4' energy: -62.386 flat angles C4'-P-C4' energy: -76.529 flat angles P-C4'-P energy: -50.716 tors. eta vs tors. theta energy: -93.426 Dist. restrs. and SS energy: 0.627 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -1085.275593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.275593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1086.008053 (E_RNA) where: Base-Base interactions energy: -748.782 where: short stacking energy: -315.749 Base-Backbone interact. energy: -0.699 local terms energy: -336.526490 where: bonds (distance) C4'-P energy: -62.365 bonds (distance) P-C4' energy: -69.087 flat angles C4'-P-C4' energy: -70.616 flat angles P-C4'-P energy: -51.337 tors. eta vs tors. theta energy: -83.123 Dist. restrs. and SS energy: 0.732 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -1060.599134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.599134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.241010 (E_RNA) where: Base-Base interactions energy: -738.304 where: short stacking energy: -315.064 Base-Backbone interact. energy: -2.454 local terms energy: -320.482480 where: bonds (distance) C4'-P energy: -52.764 bonds (distance) P-C4' energy: -66.125 flat angles C4'-P-C4' energy: -70.716 flat angles P-C4'-P energy: -48.132 tors. eta vs tors. theta energy: -82.746 Dist. restrs. and SS energy: 0.642 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -1014.805860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.805860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1015.352099 (E_RNA) where: Base-Base interactions energy: -703.564 where: short stacking energy: -294.056 Base-Backbone interact. energy: 1.068 local terms energy: -312.855790 where: bonds (distance) C4'-P energy: -65.579 bonds (distance) P-C4' energy: -59.681 flat angles C4'-P-C4' energy: -62.598 flat angles P-C4'-P energy: -43.954 tors. eta vs tors. theta energy: -81.044 Dist. restrs. and SS energy: 0.546 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -966.699151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.699151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -967.402891 (E_RNA) where: Base-Base interactions energy: -650.159 where: short stacking energy: -272.269 Base-Backbone interact. energy: -0.668 local terms energy: -316.575728 where: bonds (distance) C4'-P energy: -61.171 bonds (distance) P-C4' energy: -65.431 flat angles C4'-P-C4' energy: -67.449 flat angles P-C4'-P energy: -45.474 tors. eta vs tors. theta energy: -77.050 Dist. restrs. and SS energy: 0.704 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -934.835532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -934.835532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -936.017379 (E_RNA) where: Base-Base interactions energy: -621.905 where: short stacking energy: -285.207 Base-Backbone interact. energy: -0.703 local terms energy: -313.409075 where: bonds (distance) C4'-P energy: -66.067 bonds (distance) P-C4' energy: -48.850 flat angles C4'-P-C4' energy: -69.131 flat angles P-C4'-P energy: -52.086 tors. eta vs tors. theta energy: -77.276 Dist. restrs. and SS energy: 1.182 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -801.774983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -801.774983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -802.041150 (E_RNA) where: Base-Base interactions energy: -545.843 where: short stacking energy: -231.098 Base-Backbone interact. energy: 0.162 local terms energy: -256.360755 where: bonds (distance) C4'-P energy: -59.887 bonds (distance) P-C4' energy: -54.913 flat angles C4'-P-C4' energy: -60.776 flat angles P-C4'-P energy: -32.678 tors. eta vs tors. theta energy: -48.107 Dist. restrs. and SS energy: 0.266 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -773.618470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -773.618470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -773.846981 (E_RNA) where: Base-Base interactions energy: -520.011 where: short stacking energy: -219.547 Base-Backbone interact. energy: 0.003 local terms energy: -253.838996 where: bonds (distance) C4'-P energy: -46.012 bonds (distance) P-C4' energy: -61.684 flat angles C4'-P-C4' energy: -57.813 flat angles P-C4'-P energy: -33.715 tors. eta vs tors. theta energy: -54.614 Dist. restrs. and SS energy: 0.229 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -735.168547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.168547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.465299 (E_RNA) where: Base-Base interactions energy: -487.835 where: short stacking energy: -210.301 Base-Backbone interact. energy: 1.282 local terms energy: -248.911868 where: bonds (distance) C4'-P energy: -52.900 bonds (distance) P-C4' energy: -58.381 flat angles C4'-P-C4' energy: -57.610 flat angles P-C4'-P energy: -27.097 tors. eta vs tors. theta energy: -52.925 Dist. restrs. and SS energy: 0.297 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -694.331996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.331996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.303782 (E_RNA) where: Base-Base interactions energy: -462.401 where: short stacking energy: -191.435 Base-Backbone interact. energy: -1.333 local terms energy: -231.569028 where: bonds (distance) C4'-P energy: -42.585 bonds (distance) P-C4' energy: -54.711 flat angles C4'-P-C4' energy: -50.926 flat angles P-C4'-P energy: -45.802 tors. eta vs tors. theta energy: -37.546 Dist. restrs. and SS energy: 0.972 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -1134.736570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.736570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1135.216622 (E_RNA) where: Base-Base interactions energy: -786.535 where: short stacking energy: -334.312 Base-Backbone interact. energy: -1.405 local terms energy: -347.276663 where: bonds (distance) C4'-P energy: -61.291 bonds (distance) P-C4' energy: -62.356 flat angles C4'-P-C4' energy: -77.933 flat angles P-C4'-P energy: -48.206 tors. eta vs tors. theta energy: -97.490 Dist. restrs. and SS energy: 0.480 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -1085.071195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.071195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1085.454508 (E_RNA) where: Base-Base interactions energy: -750.393 where: short stacking energy: -308.215 Base-Backbone interact. energy: -1.187 local terms energy: -333.874670 where: bonds (distance) C4'-P energy: -62.278 bonds (distance) P-C4' energy: -53.082 flat angles C4'-P-C4' energy: -79.780 flat angles P-C4'-P energy: -55.198 tors. eta vs tors. theta energy: -83.536 Dist. restrs. and SS energy: 0.383 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -1082.384864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1082.384864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1083.024440 (E_RNA) where: Base-Base interactions energy: -748.516 where: short stacking energy: -310.044 Base-Backbone interact. energy: 1.223 local terms energy: -335.731172 where: bonds (distance) C4'-P energy: -63.325 bonds (distance) P-C4' energy: -62.282 flat angles C4'-P-C4' energy: -68.640 flat angles P-C4'-P energy: -55.637 tors. eta vs tors. theta energy: -85.847 Dist. restrs. and SS energy: 0.640 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -1046.247216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1046.247216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1046.348912 (E_RNA) where: Base-Base interactions energy: -733.303 where: short stacking energy: -306.469 Base-Backbone interact. energy: -0.460 local terms energy: -312.585744 where: bonds (distance) C4'-P energy: -59.030 bonds (distance) P-C4' energy: -60.208 flat angles C4'-P-C4' energy: -69.991 flat angles P-C4'-P energy: -43.023 tors. eta vs tors. theta energy: -80.333 Dist. restrs. and SS energy: 0.102 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -955.630073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -955.630073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.972528 (E_RNA) where: Base-Base interactions energy: -652.902 where: short stacking energy: -267.137 Base-Backbone interact. energy: -1.225 local terms energy: -301.845520 where: bonds (distance) C4'-P energy: -52.895 bonds (distance) P-C4' energy: -61.971 flat angles C4'-P-C4' energy: -67.149 flat angles P-C4'-P energy: -42.052 tors. eta vs tors. theta energy: -77.778 Dist. restrs. and SS energy: 0.342 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -921.929069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.929069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.241303 (E_RNA) where: Base-Base interactions energy: -623.988 where: short stacking energy: -260.724 Base-Backbone interact. energy: -0.057 local terms energy: -298.196105 where: bonds (distance) C4'-P energy: -61.979 bonds (distance) P-C4' energy: -71.817 flat angles C4'-P-C4' energy: -53.733 flat angles P-C4'-P energy: -41.952 tors. eta vs tors. theta energy: -68.715 Dist. restrs. and SS energy: 0.312 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -819.339320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.339320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.743822 (E_RNA) where: Base-Base interactions energy: -535.952 where: short stacking energy: -247.490 Base-Backbone interact. energy: -0.797 local terms energy: -282.994279 where: bonds (distance) C4'-P energy: -66.759 bonds (distance) P-C4' energy: -65.705 flat angles C4'-P-C4' energy: -54.172 flat angles P-C4'-P energy: -37.104 tors. eta vs tors. theta energy: -59.254 Dist. restrs. and SS energy: 0.405 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -742.272699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.272699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.076462 (E_RNA) where: Base-Base interactions energy: -491.653 where: short stacking energy: -221.830 Base-Backbone interact. energy: 0.052 local terms energy: -251.474752 where: bonds (distance) C4'-P energy: -34.264 bonds (distance) P-C4' energy: -64.781 flat angles C4'-P-C4' energy: -54.510 flat angles P-C4'-P energy: -48.199 tors. eta vs tors. theta energy: -49.721 Dist. restrs. and SS energy: 0.804 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -737.574583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.574583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.777015 (E_RNA) where: Base-Base interactions energy: -480.574 where: short stacking energy: -215.818 Base-Backbone interact. energy: 2.508 local terms energy: -259.710716 where: bonds (distance) C4'-P energy: -53.963 bonds (distance) P-C4' energy: -56.128 flat angles C4'-P-C4' energy: -62.126 flat angles P-C4'-P energy: -34.229 tors. eta vs tors. theta energy: -53.265 Dist. restrs. and SS energy: 0.202 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -697.045744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.045744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.803287 (E_RNA) where: Base-Base interactions energy: -452.074 where: short stacking energy: -197.398 Base-Backbone interact. energy: -1.950 local terms energy: -243.779504 where: bonds (distance) C4'-P energy: -50.201 bonds (distance) P-C4' energy: -61.851 flat angles C4'-P-C4' energy: -49.788 flat angles P-C4'-P energy: -34.826 tors. eta vs tors. theta energy: -47.114 Dist. restrs. and SS energy: 0.758 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -1150.698185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1150.698185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1150.906367 (E_RNA) where: Base-Base interactions energy: -802.724 where: short stacking energy: -317.842 Base-Backbone interact. energy: -1.066 local terms energy: -347.116380 where: bonds (distance) C4'-P energy: -68.729 bonds (distance) P-C4' energy: -66.654 flat angles C4'-P-C4' energy: -73.475 flat angles P-C4'-P energy: -48.280 tors. eta vs tors. theta energy: -89.978 Dist. restrs. and SS energy: 0.208 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -1076.524162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.524162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1076.624802 (E_RNA) where: Base-Base interactions energy: -731.477 where: short stacking energy: -307.127 Base-Backbone interact. energy: -0.425 local terms energy: -344.723245 where: bonds (distance) C4'-P energy: -70.582 bonds (distance) P-C4' energy: -66.491 flat angles C4'-P-C4' energy: -77.893 flat angles P-C4'-P energy: -44.983 tors. eta vs tors. theta energy: -84.774 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -1059.949016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.949016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1060.914438 (E_RNA) where: Base-Base interactions energy: -740.568 where: short stacking energy: -296.473 Base-Backbone interact. energy: -1.447 local terms energy: -318.899562 where: bonds (distance) C4'-P energy: -66.063 bonds (distance) P-C4' energy: -56.967 flat angles C4'-P-C4' energy: -66.039 flat angles P-C4'-P energy: -56.183 tors. eta vs tors. theta energy: -73.648 Dist. restrs. and SS energy: 0.965 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -1016.302553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.302553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1016.725417 (E_RNA) where: Base-Base interactions energy: -696.134 where: short stacking energy: -294.386 Base-Backbone interact. energy: -1.317 local terms energy: -319.273500 where: bonds (distance) C4'-P energy: -65.607 bonds (distance) P-C4' energy: -62.316 flat angles C4'-P-C4' energy: -61.753 flat angles P-C4'-P energy: -45.341 tors. eta vs tors. theta energy: -84.256 Dist. restrs. and SS energy: 0.423 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -963.245971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.245971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.769774 (E_RNA) where: Base-Base interactions energy: -643.595 where: short stacking energy: -277.784 Base-Backbone interact. energy: -0.944 local terms energy: -319.230849 where: bonds (distance) C4'-P energy: -68.844 bonds (distance) P-C4' energy: -53.870 flat angles C4'-P-C4' energy: -67.482 flat angles P-C4'-P energy: -50.121 tors. eta vs tors. theta energy: -78.913 Dist. restrs. and SS energy: 0.524 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -929.657068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -929.657068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -929.807883 (E_RNA) where: Base-Base interactions energy: -639.744 where: short stacking energy: -274.478 Base-Backbone interact. energy: -0.990 local terms energy: -289.073920 where: bonds (distance) C4'-P energy: -54.258 bonds (distance) P-C4' energy: -49.180 flat angles C4'-P-C4' energy: -67.277 flat angles P-C4'-P energy: -37.940 tors. eta vs tors. theta energy: -80.419 Dist. restrs. and SS energy: 0.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -800.827679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.827679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -801.363028 (E_RNA) where: Base-Base interactions energy: -528.344 where: short stacking energy: -247.704 Base-Backbone interact. energy: -1.299 local terms energy: -271.720582 where: bonds (distance) C4'-P energy: -56.042 bonds (distance) P-C4' energy: -52.746 flat angles C4'-P-C4' energy: -64.945 flat angles P-C4'-P energy: -42.382 tors. eta vs tors. theta energy: -55.606 Dist. restrs. and SS energy: 0.535 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -773.523735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -773.523735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -773.950028 (E_RNA) where: Base-Base interactions energy: -512.511 where: short stacking energy: -217.378 Base-Backbone interact. energy: 0.270 local terms energy: -261.708840 where: bonds (distance) C4'-P energy: -62.406 bonds (distance) P-C4' energy: -59.287 flat angles C4'-P-C4' energy: -60.704 flat angles P-C4'-P energy: -25.562 tors. eta vs tors. theta energy: -53.749 Dist. restrs. and SS energy: 0.426 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -738.309707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.309707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.153494 (E_RNA) where: Base-Base interactions energy: -480.166 where: short stacking energy: -228.235 Base-Backbone interact. energy: -0.376 local terms energy: -258.611496 where: bonds (distance) C4'-P energy: -51.721 bonds (distance) P-C4' energy: -52.058 flat angles C4'-P-C4' energy: -63.802 flat angles P-C4'-P energy: -32.426 tors. eta vs tors. theta energy: -58.605 Dist. restrs. and SS energy: 0.844 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -685.656336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.656336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.042806 (E_RNA) where: Base-Base interactions energy: -481.059 where: short stacking energy: -188.866 Base-Backbone interact. energy: -1.856 local terms energy: -203.128474 where: bonds (distance) C4'-P energy: -54.028 bonds (distance) P-C4' energy: -45.865 flat angles C4'-P-C4' energy: -41.959 flat angles P-C4'-P energy: -29.355 tors. eta vs tors. theta energy: -31.922 Dist. restrs. and SS energy: 0.386 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -1118.706593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1118.706593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1118.818576 (E_RNA) where: Base-Base interactions energy: -780.582 where: short stacking energy: -333.130 Base-Backbone interact. energy: -1.613 local terms energy: -336.623556 where: bonds (distance) C4'-P energy: -56.331 bonds (distance) P-C4' energy: -63.208 flat angles C4'-P-C4' energy: -78.162 flat angles P-C4'-P energy: -44.788 tors. eta vs tors. theta energy: -94.135 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -1122.558590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1122.558590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1123.113920 (E_RNA) where: Base-Base interactions energy: -780.034 where: short stacking energy: -341.477 Base-Backbone interact. energy: 0.269 local terms energy: -343.348500 where: bonds (distance) C4'-P energy: -59.471 bonds (distance) P-C4' energy: -62.924 flat angles C4'-P-C4' energy: -74.435 flat angles P-C4'-P energy: -54.397 tors. eta vs tors. theta energy: -92.121 Dist. restrs. and SS energy: 0.555 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -1082.435534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1082.435534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1082.751427 (E_RNA) where: Base-Base interactions energy: -765.224 where: short stacking energy: -310.408 Base-Backbone interact. energy: -1.941 local terms energy: -315.586786 where: bonds (distance) C4'-P energy: -56.429 bonds (distance) P-C4' energy: -64.221 flat angles C4'-P-C4' energy: -75.470 flat angles P-C4'-P energy: -35.384 tors. eta vs tors. theta energy: -84.082 Dist. restrs. and SS energy: 0.316 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -1021.423590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.423590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.669929 (E_RNA) where: Base-Base interactions energy: -735.591 where: short stacking energy: -298.391 Base-Backbone interact. energy: -1.832 local terms energy: -284.246551 where: bonds (distance) C4'-P energy: -53.248 bonds (distance) P-C4' energy: -51.371 flat angles C4'-P-C4' energy: -61.934 flat angles P-C4'-P energy: -48.656 tors. eta vs tors. theta energy: -69.037 Dist. restrs. and SS energy: 0.246 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -955.040738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -955.040738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.398783 (E_RNA) where: Base-Base interactions energy: -652.006 where: short stacking energy: -284.321 Base-Backbone interact. energy: -0.179 local terms energy: -304.213230 where: bonds (distance) C4'-P energy: -54.040 bonds (distance) P-C4' energy: -60.515 flat angles C4'-P-C4' energy: -69.503 flat angles P-C4'-P energy: -49.382 tors. eta vs tors. theta energy: -70.773 Dist. restrs. and SS energy: 1.358 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -929.235131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -929.235131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -929.795269 (E_RNA) where: Base-Base interactions energy: -649.844 where: short stacking energy: -274.223 Base-Backbone interact. energy: 1.201 local terms energy: -281.152183 where: bonds (distance) C4'-P energy: -45.237 bonds (distance) P-C4' energy: -48.193 flat angles C4'-P-C4' energy: -72.302 flat angles P-C4'-P energy: -44.413 tors. eta vs tors. theta energy: -71.007 Dist. restrs. and SS energy: 0.560 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -820.749320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.749320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.925159 (E_RNA) where: Base-Base interactions energy: -548.559 where: short stacking energy: -225.762 Base-Backbone interact. energy: -0.073 local terms energy: -272.293613 where: bonds (distance) C4'-P energy: -54.929 bonds (distance) P-C4' energy: -65.530 flat angles C4'-P-C4' energy: -59.753 flat angles P-C4'-P energy: -40.696 tors. eta vs tors. theta energy: -51.385 Dist. restrs. and SS energy: 0.176 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -767.836746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.836746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.484143 (E_RNA) where: Base-Base interactions energy: -525.824 where: short stacking energy: -205.508 Base-Backbone interact. energy: 0.202 local terms energy: -242.861496 where: bonds (distance) C4'-P energy: -45.428 bonds (distance) P-C4' energy: -62.227 flat angles C4'-P-C4' energy: -56.190 flat angles P-C4'-P energy: -33.157 tors. eta vs tors. theta energy: -45.861 Dist. restrs. and SS energy: 0.647 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -701.793278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.793278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.000527 (E_RNA) where: Base-Base interactions energy: -445.666 where: short stacking energy: -189.314 Base-Backbone interact. energy: -0.307 local terms energy: -256.027661 where: bonds (distance) C4'-P energy: -51.769 bonds (distance) P-C4' energy: -65.279 flat angles C4'-P-C4' energy: -59.572 flat angles P-C4'-P energy: -41.136 tors. eta vs tors. theta energy: -38.271 Dist. restrs. and SS energy: 0.207 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -704.214928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.214928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.696411 (E_RNA) where: Base-Base interactions energy: -468.045 where: short stacking energy: -178.448 Base-Backbone interact. energy: -2.152 local terms energy: -234.499662 where: bonds (distance) C4'-P energy: -48.045 bonds (distance) P-C4' energy: -58.592 flat angles C4'-P-C4' energy: -56.140 flat angles P-C4'-P energy: -30.437 tors. eta vs tors. theta energy: -41.285 Dist. restrs. and SS energy: 0.481 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -1112.064872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1112.064872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1112.537271 (E_RNA) where: Base-Base interactions energy: -772.519 where: short stacking energy: -323.469 Base-Backbone interact. energy: -0.515 local terms energy: -339.502710 where: bonds (distance) C4'-P energy: -73.824 bonds (distance) P-C4' energy: -61.815 flat angles C4'-P-C4' energy: -69.102 flat angles P-C4'-P energy: -40.522 tors. eta vs tors. theta energy: -94.240 Dist. restrs. and SS energy: 0.472 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -1122.529681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1122.529681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1122.907698 (E_RNA) where: Base-Base interactions energy: -789.770 where: short stacking energy: -336.744 Base-Backbone interact. energy: 0.716 local terms energy: -333.853902 where: bonds (distance) C4'-P energy: -53.874 bonds (distance) P-C4' energy: -66.149 flat angles C4'-P-C4' energy: -73.966 flat angles P-C4'-P energy: -44.627 tors. eta vs tors. theta energy: -95.238 Dist. restrs. and SS energy: 0.378 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -1078.373232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.373232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1078.808375 (E_RNA) where: Base-Base interactions energy: -770.667 where: short stacking energy: -318.993 Base-Backbone interact. energy: -1.077 local terms energy: -307.064430 where: bonds (distance) C4'-P energy: -57.494 bonds (distance) P-C4' energy: -64.495 flat angles C4'-P-C4' energy: -55.439 flat angles P-C4'-P energy: -40.582 tors. eta vs tors. theta energy: -89.054 Dist. restrs. and SS energy: 0.435 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -1024.789662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1024.789662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1025.041021 (E_RNA) where: Base-Base interactions energy: -703.594 where: short stacking energy: -300.466 Base-Backbone interact. energy: -0.641 local terms energy: -320.805979 where: bonds (distance) C4'-P energy: -62.339 bonds (distance) P-C4' energy: -63.505 flat angles C4'-P-C4' energy: -70.996 flat angles P-C4'-P energy: -49.192 tors. eta vs tors. theta energy: -74.773 Dist. restrs. and SS energy: 0.251 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -963.425784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.425784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.709279 (E_RNA) where: Base-Base interactions energy: -671.394 where: short stacking energy: -272.772 Base-Backbone interact. energy: -2.149 local terms energy: -291.166067 where: bonds (distance) C4'-P energy: -55.271 bonds (distance) P-C4' energy: -55.508 flat angles C4'-P-C4' energy: -63.794 flat angles P-C4'-P energy: -41.205 tors. eta vs tors. theta energy: -75.388 Dist. restrs. and SS energy: 1.283 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -887.973381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.973381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -888.196499 (E_RNA) where: Base-Base interactions energy: -617.271 where: short stacking energy: -257.126 Base-Backbone interact. energy: 3.009 local terms energy: -273.934109 where: bonds (distance) C4'-P energy: -46.076 bonds (distance) P-C4' energy: -54.461 flat angles C4'-P-C4' energy: -61.755 flat angles P-C4'-P energy: -39.591 tors. eta vs tors. theta energy: -72.052 Dist. restrs. and SS energy: 0.223 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -875.024170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.024170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.303475 (E_RNA) where: Base-Base interactions energy: -594.813 where: short stacking energy: -255.241 Base-Backbone interact. energy: 0.636 local terms energy: -282.125915 where: bonds (distance) C4'-P energy: -56.038 bonds (distance) P-C4' energy: -62.472 flat angles C4'-P-C4' energy: -58.310 flat angles P-C4'-P energy: -41.110 tors. eta vs tors. theta energy: -64.196 Dist. restrs. and SS energy: 1.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -744.606536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.606536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.976468 (E_RNA) where: Base-Base interactions energy: -491.378 where: short stacking energy: -207.051 Base-Backbone interact. energy: -1.573 local terms energy: -252.025281 where: bonds (distance) C4'-P energy: -53.604 bonds (distance) P-C4' energy: -50.979 flat angles C4'-P-C4' energy: -52.936 flat angles P-C4'-P energy: -36.729 tors. eta vs tors. theta energy: -57.777 Dist. restrs. and SS energy: 0.370 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -703.866206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.866206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.691685 (E_RNA) where: Base-Base interactions energy: -469.369 where: short stacking energy: -214.976 Base-Backbone interact. energy: -0.766 local terms energy: -234.557010 where: bonds (distance) C4'-P energy: -43.454 bonds (distance) P-C4' energy: -47.924 flat angles C4'-P-C4' energy: -61.459 flat angles P-C4'-P energy: -32.107 tors. eta vs tors. theta energy: -49.613 Dist. restrs. and SS energy: 0.825 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -684.367135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.367135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.215884 (E_RNA) where: Base-Base interactions energy: -449.030 where: short stacking energy: -202.367 Base-Backbone interact. energy: -0.657 local terms energy: -235.529419 where: bonds (distance) C4'-P energy: -56.418 bonds (distance) P-C4' energy: -44.618 flat angles C4'-P-C4' energy: -60.570 flat angles P-C4'-P energy: -33.847 tors. eta vs tors. theta energy: -40.077 Dist. restrs. and SS energy: 0.849 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -1159.812073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1159.812073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1159.944566 (E_RNA) where: Base-Base interactions energy: -811.000 where: short stacking energy: -350.032 Base-Backbone interact. energy: -2.573 local terms energy: -346.371607 where: bonds (distance) C4'-P energy: -68.484 bonds (distance) P-C4' energy: -69.718 flat angles C4'-P-C4' energy: -72.628 flat angles P-C4'-P energy: -42.249 tors. eta vs tors. theta energy: -93.294 Dist. restrs. and SS energy: 0.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -1103.212275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1103.212275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1103.713882 (E_RNA) where: Base-Base interactions energy: -754.855 where: short stacking energy: -313.059 Base-Backbone interact. energy: 1.904 local terms energy: -350.762892 where: bonds (distance) C4'-P energy: -65.294 bonds (distance) P-C4' energy: -72.494 flat angles C4'-P-C4' energy: -70.478 flat angles P-C4'-P energy: -52.137 tors. eta vs tors. theta energy: -90.360 Dist. restrs. and SS energy: 0.502 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -1069.182796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.182796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1069.499738 (E_RNA) where: Base-Base interactions energy: -738.866 where: short stacking energy: -307.121 Base-Backbone interact. energy: 0.511 local terms energy: -331.144505 where: bonds (distance) C4'-P energy: -53.455 bonds (distance) P-C4' energy: -66.235 flat angles C4'-P-C4' energy: -68.031 flat angles P-C4'-P energy: -51.823 tors. eta vs tors. theta energy: -91.601 Dist. restrs. and SS energy: 0.317 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -1005.683216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.683216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1006.269799 (E_RNA) where: Base-Base interactions energy: -706.012 where: short stacking energy: -283.258 Base-Backbone interact. energy: -1.041 local terms energy: -299.217152 where: bonds (distance) C4'-P energy: -54.057 bonds (distance) P-C4' energy: -59.029 flat angles C4'-P-C4' energy: -69.002 flat angles P-C4'-P energy: -55.558 tors. eta vs tors. theta energy: -61.571 Dist. restrs. and SS energy: 0.587 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -960.483495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.483495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.942349 (E_RNA) where: Base-Base interactions energy: -655.853 where: short stacking energy: -285.428 Base-Backbone interact. energy: 1.224 local terms energy: -306.313596 where: bonds (distance) C4'-P energy: -62.888 bonds (distance) P-C4' energy: -50.598 flat angles C4'-P-C4' energy: -66.908 flat angles P-C4'-P energy: -47.336 tors. eta vs tors. theta energy: -78.585 Dist. restrs. and SS energy: 0.459 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -917.879274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -917.879274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -918.031174 (E_RNA) where: Base-Base interactions energy: -641.528 where: short stacking energy: -264.629 Base-Backbone interact. energy: 1.020 local terms energy: -277.523413 where: bonds (distance) C4'-P energy: -49.087 bonds (distance) P-C4' energy: -53.885 flat angles C4'-P-C4' energy: -67.053 flat angles P-C4'-P energy: -43.200 tors. eta vs tors. theta energy: -64.299 Dist. restrs. and SS energy: 0.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -855.639260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.639260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -856.215689 (E_RNA) where: Base-Base interactions energy: -578.672 where: short stacking energy: -240.871 Base-Backbone interact. energy: 0.279 local terms energy: -277.822363 where: bonds (distance) C4'-P energy: -63.681 bonds (distance) P-C4' energy: -54.411 flat angles C4'-P-C4' energy: -57.143 flat angles P-C4'-P energy: -37.504 tors. eta vs tors. theta energy: -65.083 Dist. restrs. and SS energy: 0.576 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -753.649389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.649389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.117545 (E_RNA) where: Base-Base interactions energy: -496.191 where: short stacking energy: -227.414 Base-Backbone interact. energy: 0.299 local terms energy: -258.225355 where: bonds (distance) C4'-P energy: -59.562 bonds (distance) P-C4' energy: -59.396 flat angles C4'-P-C4' energy: -60.883 flat angles P-C4'-P energy: -38.965 tors. eta vs tors. theta energy: -39.419 Dist. restrs. and SS energy: 0.468 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -713.209585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.209585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.331458 (E_RNA) where: Base-Base interactions energy: -476.236 where: short stacking energy: -199.297 Base-Backbone interact. energy: -0.518 local terms energy: -236.578015 where: bonds (distance) C4'-P energy: -54.374 bonds (distance) P-C4' energy: -46.194 flat angles C4'-P-C4' energy: -51.165 flat angles P-C4'-P energy: -31.273 tors. eta vs tors. theta energy: -53.572 Dist. restrs. and SS energy: 0.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -690.368697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.368697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.966293 (E_RNA) where: Base-Base interactions energy: -469.147 where: short stacking energy: -192.851 Base-Backbone interact. energy: 1.715 local terms energy: -223.533450 where: bonds (distance) C4'-P energy: -49.653 bonds (distance) P-C4' energy: -45.091 flat angles C4'-P-C4' energy: -62.599 flat angles P-C4'-P energy: -27.713 tors. eta vs tors. theta energy: -38.478 Dist. restrs. and SS energy: 0.598 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -1144.335559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1144.335559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1144.570324 (E_RNA) where: Base-Base interactions energy: -810.324 where: short stacking energy: -343.894 Base-Backbone interact. energy: 0.891 local terms energy: -335.136758 where: bonds (distance) C4'-P energy: -60.769 bonds (distance) P-C4' energy: -72.676 flat angles C4'-P-C4' energy: -72.052 flat angles P-C4'-P energy: -38.307 tors. eta vs tors. theta energy: -91.333 Dist. restrs. and SS energy: 0.235 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -1109.489299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1109.489299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1110.006737 (E_RNA) where: Base-Base interactions energy: -772.579 where: short stacking energy: -336.402 Base-Backbone interact. energy: -2.186 local terms energy: -335.241378 where: bonds (distance) C4'-P energy: -56.103 bonds (distance) P-C4' energy: -70.704 flat angles C4'-P-C4' energy: -70.585 flat angles P-C4'-P energy: -52.882 tors. eta vs tors. theta energy: -84.967 Dist. restrs. and SS energy: 0.517 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -1065.111151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1065.111151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1065.458670 (E_RNA) where: Base-Base interactions energy: -721.067 where: short stacking energy: -300.449 Base-Backbone interact. energy: 2.110 local terms energy: -346.501572 where: bonds (distance) C4'-P energy: -60.100 bonds (distance) P-C4' energy: -68.547 flat angles C4'-P-C4' energy: -68.674 flat angles P-C4'-P energy: -56.539 tors. eta vs tors. theta energy: -92.641 Dist. restrs. and SS energy: 0.348 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -1018.466174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1018.466174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1018.728757 (E_RNA) where: Base-Base interactions energy: -704.070 where: short stacking energy: -307.434 Base-Backbone interact. energy: 0.655 local terms energy: -315.313551 where: bonds (distance) C4'-P energy: -61.494 bonds (distance) P-C4' energy: -67.100 flat angles C4'-P-C4' energy: -65.322 flat angles P-C4'-P energy: -45.774 tors. eta vs tors. theta energy: -75.624 Dist. restrs. and SS energy: 0.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -942.626739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -942.626739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -942.875086 (E_RNA) where: Base-Base interactions energy: -659.129 where: short stacking energy: -284.193 Base-Backbone interact. energy: 0.070 local terms energy: -283.815888 where: bonds (distance) C4'-P energy: -53.661 bonds (distance) P-C4' energy: -56.260 flat angles C4'-P-C4' energy: -64.816 flat angles P-C4'-P energy: -40.408 tors. eta vs tors. theta energy: -68.671 Dist. restrs. and SS energy: 0.248 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -936.163970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -936.163970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -936.984041 (E_RNA) where: Base-Base interactions energy: -661.137 where: short stacking energy: -278.772 Base-Backbone interact. energy: -0.389 local terms energy: -275.457626 where: bonds (distance) C4'-P energy: -51.754 bonds (distance) P-C4' energy: -63.216 flat angles C4'-P-C4' energy: -56.651 flat angles P-C4'-P energy: -39.789 tors. eta vs tors. theta energy: -64.047 Dist. restrs. and SS energy: 0.820 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -854.641215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -854.641215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.087548 (E_RNA) where: Base-Base interactions energy: -588.025 where: short stacking energy: -240.878 Base-Backbone interact. energy: -1.079 local terms energy: -265.983738 where: bonds (distance) C4'-P energy: -43.198 bonds (distance) P-C4' energy: -54.843 flat angles C4'-P-C4' energy: -67.369 flat angles P-C4'-P energy: -38.297 tors. eta vs tors. theta energy: -62.276 Dist. restrs. and SS energy: 0.446 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -766.878951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.878951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.040784 (E_RNA) where: Base-Base interactions energy: -511.493 where: short stacking energy: -224.171 Base-Backbone interact. energy: -0.591 local terms energy: -254.956823 where: bonds (distance) C4'-P energy: -46.025 bonds (distance) P-C4' energy: -58.096 flat angles C4'-P-C4' energy: -50.765 flat angles P-C4'-P energy: -39.004 tors. eta vs tors. theta energy: -61.067 Dist. restrs. and SS energy: 0.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -751.673132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.673132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.014283 (E_RNA) where: Base-Base interactions energy: -490.416 where: short stacking energy: -213.418 Base-Backbone interact. energy: -1.603 local terms energy: -259.996101 where: bonds (distance) C4'-P energy: -57.383 bonds (distance) P-C4' energy: -51.389 flat angles C4'-P-C4' energy: -57.116 flat angles P-C4'-P energy: -43.071 tors. eta vs tors. theta energy: -51.036 Dist. restrs. and SS energy: 0.341 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -703.524690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.524690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.923554 (E_RNA) where: Base-Base interactions energy: -465.382 where: short stacking energy: -196.379 Base-Backbone interact. energy: -0.558 local terms energy: -237.982788 where: bonds (distance) C4'-P energy: -48.854 bonds (distance) P-C4' energy: -66.140 flat angles C4'-P-C4' energy: -54.406 flat angles P-C4'-P energy: -24.408 tors. eta vs tors. theta energy: -44.174 Dist. restrs. and SS energy: 0.399 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -1150.632464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1150.632464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1151.040038 (E_RNA) where: Base-Base interactions energy: -801.160 where: short stacking energy: -347.086 Base-Backbone interact. energy: 0.208 local terms energy: -350.088764 where: bonds (distance) C4'-P energy: -66.676 bonds (distance) P-C4' energy: -69.887 flat angles C4'-P-C4' energy: -72.737 flat angles P-C4'-P energy: -45.354 tors. eta vs tors. theta energy: -95.435 Dist. restrs. and SS energy: 0.408 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -1072.693909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1072.693909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1072.860338 (E_RNA) where: Base-Base interactions energy: -740.332 where: short stacking energy: -314.513 Base-Backbone interact. energy: -1.004 local terms energy: -331.523503 where: bonds (distance) C4'-P energy: -62.000 bonds (distance) P-C4' energy: -69.182 flat angles C4'-P-C4' energy: -63.092 flat angles P-C4'-P energy: -49.288 tors. eta vs tors. theta energy: -87.963 Dist. restrs. and SS energy: 0.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -1078.692957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.692957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1078.869179 (E_RNA) where: Base-Base interactions energy: -762.826 where: short stacking energy: -309.333 Base-Backbone interact. energy: -1.830 local terms energy: -314.212707 where: bonds (distance) C4'-P energy: -52.445 bonds (distance) P-C4' energy: -64.332 flat angles C4'-P-C4' energy: -76.681 flat angles P-C4'-P energy: -41.448 tors. eta vs tors. theta energy: -79.307 Dist. restrs. and SS energy: 0.176 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -995.221842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -995.221842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -995.666254 (E_RNA) where: Base-Base interactions energy: -669.529 where: short stacking energy: -266.509 Base-Backbone interact. energy: -0.986 local terms energy: -325.151296 where: bonds (distance) C4'-P energy: -62.366 bonds (distance) P-C4' energy: -67.688 flat angles C4'-P-C4' energy: -66.016 flat angles P-C4'-P energy: -49.405 tors. eta vs tors. theta energy: -79.676 Dist. restrs. and SS energy: 0.444 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -1001.842387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.842387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1001.951460 (E_RNA) where: Base-Base interactions energy: -705.643 where: short stacking energy: -307.785 Base-Backbone interact. energy: -0.036 local terms energy: -296.272934 where: bonds (distance) C4'-P energy: -40.971 bonds (distance) P-C4' energy: -53.309 flat angles C4'-P-C4' energy: -66.832 flat angles P-C4'-P energy: -53.301 tors. eta vs tors. theta energy: -81.860 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -925.344323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -925.344323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.442884 (E_RNA) where: Base-Base interactions energy: -615.905 where: short stacking energy: -266.001 Base-Backbone interact. energy: -1.495 local terms energy: -309.043335 where: bonds (distance) C4'-P energy: -54.271 bonds (distance) P-C4' energy: -69.937 flat angles C4'-P-C4' energy: -67.943 flat angles P-C4'-P energy: -32.861 tors. eta vs tors. theta energy: -84.030 Dist. restrs. and SS energy: 1.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -850.367908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.367908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -850.508840 (E_RNA) where: Base-Base interactions energy: -581.194 where: short stacking energy: -246.089 Base-Backbone interact. energy: -0.096 local terms energy: -269.218880 where: bonds (distance) C4'-P energy: -62.311 bonds (distance) P-C4' energy: -57.328 flat angles C4'-P-C4' energy: -66.413 flat angles P-C4'-P energy: -24.884 tors. eta vs tors. theta energy: -58.283 Dist. restrs. and SS energy: 0.141 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -770.221131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.221131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.967503 (E_RNA) where: Base-Base interactions energy: -520.106 where: short stacking energy: -237.555 Base-Backbone interact. energy: -0.355 local terms energy: -250.507206 where: bonds (distance) C4'-P energy: -42.238 bonds (distance) P-C4' energy: -51.472 flat angles C4'-P-C4' energy: -51.599 flat angles P-C4'-P energy: -47.700 tors. eta vs tors. theta energy: -57.497 Dist. restrs. and SS energy: 0.746 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -733.120092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -733.120092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -733.643101 (E_RNA) where: Base-Base interactions energy: -484.571 where: short stacking energy: -198.334 Base-Backbone interact. energy: -0.240 local terms energy: -248.832713 where: bonds (distance) C4'-P energy: -62.521 bonds (distance) P-C4' energy: -55.554 flat angles C4'-P-C4' energy: -66.321 flat angles P-C4'-P energy: -27.043 tors. eta vs tors. theta energy: -37.393 Dist. restrs. and SS energy: 0.523 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -683.185592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.185592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.057467 (E_RNA) where: Base-Base interactions energy: -417.694 where: short stacking energy: -188.677 Base-Backbone interact. energy: -1.650 local terms energy: -264.712893 where: bonds (distance) C4'-P energy: -56.356 bonds (distance) P-C4' energy: -55.949 flat angles C4'-P-C4' energy: -68.080 flat angles P-C4'-P energy: -43.003 tors. eta vs tors. theta energy: -41.325 Dist. restrs. and SS energy: 0.872 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -1141.609850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1141.609850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1141.885030 (E_RNA) where: Base-Base interactions energy: -805.175 where: short stacking energy: -345.690 Base-Backbone interact. energy: 2.122 local terms energy: -338.831388 where: bonds (distance) C4'-P energy: -69.423 bonds (distance) P-C4' energy: -62.003 flat angles C4'-P-C4' energy: -74.847 flat angles P-C4'-P energy: -41.370 tors. eta vs tors. theta energy: -91.189 Dist. restrs. and SS energy: 0.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -1085.056520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.056520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1085.281114 (E_RNA) where: Base-Base interactions energy: -747.320 where: short stacking energy: -307.192 Base-Backbone interact. energy: -2.803 local terms energy: -335.158724 where: bonds (distance) C4'-P energy: -62.721 bonds (distance) P-C4' energy: -67.063 flat angles C4'-P-C4' energy: -73.950 flat angles P-C4'-P energy: -44.959 tors. eta vs tors. theta energy: -86.466 Dist. restrs. and SS energy: 0.225 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -1073.643883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.643883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1074.683443 (E_RNA) where: Base-Base interactions energy: -774.471 where: short stacking energy: -324.261 Base-Backbone interact. energy: -2.577 local terms energy: -297.635774 where: bonds (distance) C4'-P energy: -51.024 bonds (distance) P-C4' energy: -47.028 flat angles C4'-P-C4' energy: -68.663 flat angles P-C4'-P energy: -38.604 tors. eta vs tors. theta energy: -92.317 Dist. restrs. and SS energy: 1.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -1032.145251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1032.145251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1032.770693 (E_RNA) where: Base-Base interactions energy: -723.133 where: short stacking energy: -306.760 Base-Backbone interact. energy: -1.044 local terms energy: -308.594113 where: bonds (distance) C4'-P energy: -67.161 bonds (distance) P-C4' energy: -58.020 flat angles C4'-P-C4' energy: -67.357 flat angles P-C4'-P energy: -44.281 tors. eta vs tors. theta energy: -71.774 Dist. restrs. and SS energy: 0.625 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -966.400554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.400554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.656023 (E_RNA) where: Base-Base interactions energy: -671.759 where: short stacking energy: -279.986 Base-Backbone interact. energy: -2.240 local terms energy: -292.657290 where: bonds (distance) C4'-P energy: -52.931 bonds (distance) P-C4' energy: -55.302 flat angles C4'-P-C4' energy: -67.873 flat angles P-C4'-P energy: -40.943 tors. eta vs tors. theta energy: -75.609 Dist. restrs. and SS energy: 0.255 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -891.127603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -891.127603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -891.445044 (E_RNA) where: Base-Base interactions energy: -590.868 where: short stacking energy: -272.409 Base-Backbone interact. energy: 0.043 local terms energy: -300.619994 where: bonds (distance) C4'-P energy: -59.565 bonds (distance) P-C4' energy: -53.907 flat angles C4'-P-C4' energy: -68.647 flat angles P-C4'-P energy: -49.713 tors. eta vs tors. theta energy: -68.788 Dist. restrs. and SS energy: 0.317 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -844.627867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -844.627867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -844.686508 (E_RNA) where: Base-Base interactions energy: -580.572 where: short stacking energy: -241.380 Base-Backbone interact. energy: -1.904 local terms energy: -262.210957 where: bonds (distance) C4'-P energy: -45.502 bonds (distance) P-C4' energy: -52.450 flat angles C4'-P-C4' energy: -63.318 flat angles P-C4'-P energy: -37.576 tors. eta vs tors. theta energy: -63.365 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -740.543832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.543832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.052478 (E_RNA) where: Base-Base interactions energy: -511.396 where: short stacking energy: -210.996 Base-Backbone interact. energy: -1.193 local terms energy: -228.462767 where: bonds (distance) C4'-P energy: -55.110 bonds (distance) P-C4' energy: -47.590 flat angles C4'-P-C4' energy: -55.644 flat angles P-C4'-P energy: -30.841 tors. eta vs tors. theta energy: -39.278 Dist. restrs. and SS energy: 0.509 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -761.513213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.513213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.268067 (E_RNA) where: Base-Base interactions energy: -480.533 where: short stacking energy: -212.320 Base-Backbone interact. energy: -1.935 local terms energy: -280.799865 where: bonds (distance) C4'-P energy: -65.779 bonds (distance) P-C4' energy: -58.242 flat angles C4'-P-C4' energy: -61.971 flat angles P-C4'-P energy: -41.515 tors. eta vs tors. theta energy: -53.293 Dist. restrs. and SS energy: 1.755 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -658.318884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.318884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.177823 (E_RNA) where: Base-Base interactions energy: -419.735 where: short stacking energy: -177.060 Base-Backbone interact. energy: -1.323 local terms energy: -238.119674 where: bonds (distance) C4'-P energy: -54.998 bonds (distance) P-C4' energy: -54.491 flat angles C4'-P-C4' energy: -52.808 flat angles P-C4'-P energy: -34.419 tors. eta vs tors. theta energy: -41.402 Dist. restrs. and SS energy: 0.859 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -1136.455419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1136.455419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1136.590231 (E_RNA) where: Base-Base interactions energy: -791.540 where: short stacking energy: -339.790 Base-Backbone interact. energy: -1.510 local terms energy: -343.540652 where: bonds (distance) C4'-P energy: -71.791 bonds (distance) P-C4' energy: -69.931 flat angles C4'-P-C4' energy: -72.332 flat angles P-C4'-P energy: -39.166 tors. eta vs tors. theta energy: -90.321 Dist. restrs. and SS energy: 0.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -1099.706366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1099.706366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1100.981628 (E_RNA) where: Base-Base interactions energy: -773.769 where: short stacking energy: -318.493 Base-Backbone interact. energy: -1.047 local terms energy: -326.166200 where: bonds (distance) C4'-P energy: -62.894 bonds (distance) P-C4' energy: -56.049 flat angles C4'-P-C4' energy: -69.958 flat angles P-C4'-P energy: -54.128 tors. eta vs tors. theta energy: -83.137 Dist. restrs. and SS energy: 1.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -1077.693286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1077.693286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1078.010103 (E_RNA) where: Base-Base interactions energy: -752.987 where: short stacking energy: -307.032 Base-Backbone interact. energy: -0.335 local terms energy: -324.688003 where: bonds (distance) C4'-P energy: -58.693 bonds (distance) P-C4' energy: -64.693 flat angles C4'-P-C4' energy: -65.826 flat angles P-C4'-P energy: -48.343 tors. eta vs tors. theta energy: -87.133 Dist. restrs. and SS energy: 0.317 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -1007.027829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1007.027829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1007.359915 (E_RNA) where: Base-Base interactions energy: -695.937 where: short stacking energy: -279.186 Base-Backbone interact. energy: 0.981 local terms energy: -312.403944 where: bonds (distance) C4'-P energy: -56.343 bonds (distance) P-C4' energy: -59.310 flat angles C4'-P-C4' energy: -69.603 flat angles P-C4'-P energy: -45.332 tors. eta vs tors. theta energy: -81.816 Dist. restrs. and SS energy: 0.332 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -961.709044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -961.709044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.208336 (E_RNA) where: Base-Base interactions energy: -663.225 where: short stacking energy: -293.788 Base-Backbone interact. energy: -0.748 local terms energy: -298.235486 where: bonds (distance) C4'-P energy: -49.581 bonds (distance) P-C4' energy: -60.269 flat angles C4'-P-C4' energy: -72.282 flat angles P-C4'-P energy: -44.158 tors. eta vs tors. theta energy: -71.946 Dist. restrs. and SS energy: 0.499 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -853.626668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.626668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -854.475208 (E_RNA) where: Base-Base interactions energy: -579.989 where: short stacking energy: -256.551 Base-Backbone interact. energy: 0.025 local terms energy: -274.511204 where: bonds (distance) C4'-P energy: -45.993 bonds (distance) P-C4' energy: -68.040 flat angles C4'-P-C4' energy: -51.392 flat angles P-C4'-P energy: -42.022 tors. eta vs tors. theta energy: -67.064 Dist. restrs. and SS energy: 0.849 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -869.816373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.816373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -870.600053 (E_RNA) where: Base-Base interactions energy: -577.706 where: short stacking energy: -259.156 Base-Backbone interact. energy: -1.157 local terms energy: -291.737289 where: bonds (distance) C4'-P energy: -51.424 bonds (distance) P-C4' energy: -66.872 flat angles C4'-P-C4' energy: -67.423 flat angles P-C4'-P energy: -41.114 tors. eta vs tors. theta energy: -64.904 Dist. restrs. and SS energy: 0.784 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -748.653780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.653780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.023613 (E_RNA) where: Base-Base interactions energy: -497.791 where: short stacking energy: -213.570 Base-Backbone interact. energy: 0.739 local terms energy: -251.971418 where: bonds (distance) C4'-P energy: -56.824 bonds (distance) P-C4' energy: -53.146 flat angles C4'-P-C4' energy: -57.676 flat angles P-C4'-P energy: -36.712 tors. eta vs tors. theta energy: -47.614 Dist. restrs. and SS energy: 0.370 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -704.092262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.092262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.952881 (E_RNA) where: Base-Base interactions energy: -455.877 where: short stacking energy: -191.335 Base-Backbone interact. energy: -1.250 local terms energy: -247.825975 where: bonds (distance) C4'-P energy: -51.826 bonds (distance) P-C4' energy: -52.046 flat angles C4'-P-C4' energy: -58.175 flat angles P-C4'-P energy: -39.209 tors. eta vs tors. theta energy: -46.569 Dist. restrs. and SS energy: 0.861 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -665.773838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.773838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.099894 (E_RNA) where: Base-Base interactions energy: -444.729 where: short stacking energy: -186.622 Base-Backbone interact. energy: -0.765 local terms energy: -221.606655 where: bonds (distance) C4'-P energy: -54.193 bonds (distance) P-C4' energy: -60.039 flat angles C4'-P-C4' energy: -54.991 flat angles P-C4'-P energy: -17.879 tors. eta vs tors. theta energy: -34.504 Dist. restrs. and SS energy: 1.326 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -1119.780020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1119.780020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1120.193958 (E_RNA) where: Base-Base interactions energy: -785.027 where: short stacking energy: -317.759 Base-Backbone interact. energy: -2.801 local terms energy: -332.365821 where: bonds (distance) C4'-P energy: -64.676 bonds (distance) P-C4' energy: -58.838 flat angles C4'-P-C4' energy: -76.337 flat angles P-C4'-P energy: -47.169 tors. eta vs tors. theta energy: -85.345 Dist. restrs. and SS energy: 0.414 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -1139.125704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1139.125704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1139.427917 (E_RNA) where: Base-Base interactions energy: -796.401 where: short stacking energy: -336.969 Base-Backbone interact. energy: 0.036 local terms energy: -343.062266 where: bonds (distance) C4'-P energy: -62.060 bonds (distance) P-C4' energy: -66.491 flat angles C4'-P-C4' energy: -74.008 flat angles P-C4'-P energy: -42.240 tors. eta vs tors. theta energy: -98.263 Dist. restrs. and SS energy: 0.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -1079.579503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1079.579503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1080.041276 (E_RNA) where: Base-Base interactions energy: -757.562 where: short stacking energy: -319.615 Base-Backbone interact. energy: 0.905 local terms energy: -323.384253 where: bonds (distance) C4'-P energy: -62.615 bonds (distance) P-C4' energy: -63.703 flat angles C4'-P-C4' energy: -71.461 flat angles P-C4'-P energy: -38.396 tors. eta vs tors. theta energy: -87.209 Dist. restrs. and SS energy: 0.462 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -1041.832318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.832318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1042.255526 (E_RNA) where: Base-Base interactions energy: -717.858 where: short stacking energy: -294.547 Base-Backbone interact. energy: 0.257 local terms energy: -324.654678 where: bonds (distance) C4'-P energy: -67.232 bonds (distance) P-C4' energy: -63.470 flat angles C4'-P-C4' energy: -67.208 flat angles P-C4'-P energy: -42.704 tors. eta vs tors. theta energy: -84.041 Dist. restrs. and SS energy: 0.423 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -969.117460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -969.117460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -969.678395 (E_RNA) where: Base-Base interactions energy: -675.750 where: short stacking energy: -298.968 Base-Backbone interact. energy: -1.624 local terms energy: -292.303591 where: bonds (distance) C4'-P energy: -52.281 bonds (distance) P-C4' energy: -48.743 flat angles C4'-P-C4' energy: -71.824 flat angles P-C4'-P energy: -44.187 tors. eta vs tors. theta energy: -75.267 Dist. restrs. and SS energy: 0.561 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -883.250624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -883.250624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -883.570754 (E_RNA) where: Base-Base interactions energy: -605.111 where: short stacking energy: -242.489 Base-Backbone interact. energy: -0.689 local terms energy: -277.770736 where: bonds (distance) C4'-P energy: -60.111 bonds (distance) P-C4' energy: -57.064 flat angles C4'-P-C4' energy: -65.506 flat angles P-C4'-P energy: -40.663 tors. eta vs tors. theta energy: -54.426 Dist. restrs. and SS energy: 0.320 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -855.723510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.723510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -856.317060 (E_RNA) where: Base-Base interactions energy: -578.174 where: short stacking energy: -249.449 Base-Backbone interact. energy: 0.349 local terms energy: -278.492673 where: bonds (distance) C4'-P energy: -55.599 bonds (distance) P-C4' energy: -52.962 flat angles C4'-P-C4' energy: -63.248 flat angles P-C4'-P energy: -41.128 tors. eta vs tors. theta energy: -65.555 Dist. restrs. and SS energy: 0.594 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -742.819305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.819305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.025450 (E_RNA) where: Base-Base interactions energy: -488.501 where: short stacking energy: -212.175 Base-Backbone interact. energy: -1.316 local terms energy: -253.208016 where: bonds (distance) C4'-P energy: -49.256 bonds (distance) P-C4' energy: -48.258 flat angles C4'-P-C4' energy: -66.566 flat angles P-C4'-P energy: -41.652 tors. eta vs tors. theta energy: -47.476 Dist. restrs. and SS energy: 0.206 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -742.194957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.194957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.392348 (E_RNA) where: Base-Base interactions energy: -493.200 where: short stacking energy: -214.318 Base-Backbone interact. energy: 0.248 local terms energy: -250.439914 where: bonds (distance) C4'-P energy: -49.483 bonds (distance) P-C4' energy: -57.248 flat angles C4'-P-C4' energy: -61.032 flat angles P-C4'-P energy: -36.336 tors. eta vs tors. theta energy: -46.340 Dist. restrs. and SS energy: 1.197 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -716.099611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.099611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.576129 (E_RNA) where: Base-Base interactions energy: -500.166 where: short stacking energy: -209.556 Base-Backbone interact. energy: -1.491 local terms energy: -214.919593 where: bonds (distance) C4'-P energy: -41.763 bonds (distance) P-C4' energy: -49.069 flat angles C4'-P-C4' energy: -52.636 flat angles P-C4'-P energy: -22.411 tors. eta vs tors. theta energy: -49.040 Dist. restrs. and SS energy: 0.477 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -1119.774293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1119.774293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1121.321228 (E_RNA) where: Base-Base interactions energy: -788.828 where: short stacking energy: -307.985 Base-Backbone interact. energy: -1.515 local terms energy: -330.977967 where: bonds (distance) C4'-P energy: -62.605 bonds (distance) P-C4' energy: -65.651 flat angles C4'-P-C4' energy: -72.385 flat angles P-C4'-P energy: -48.655 tors. eta vs tors. theta energy: -81.682 Dist. restrs. and SS energy: 1.547 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -1112.622627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1112.622627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1112.702457 (E_RNA) where: Base-Base interactions energy: -774.799 where: short stacking energy: -308.136 Base-Backbone interact. energy: -1.467 local terms energy: -336.436354 where: bonds (distance) C4'-P energy: -65.665 bonds (distance) P-C4' energy: -74.084 flat angles C4'-P-C4' energy: -66.219 flat angles P-C4'-P energy: -46.708 tors. eta vs tors. theta energy: -83.760 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -1101.149558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1101.149558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1101.752589 (E_RNA) where: Base-Base interactions energy: -761.586 where: short stacking energy: -329.494 Base-Backbone interact. energy: -1.654 local terms energy: -338.513444 where: bonds (distance) C4'-P energy: -70.196 bonds (distance) P-C4' energy: -63.361 flat angles C4'-P-C4' energy: -68.440 flat angles P-C4'-P energy: -46.547 tors. eta vs tors. theta energy: -89.969 Dist. restrs. and SS energy: 0.603 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -1038.804781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.804781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1039.561674 (E_RNA) where: Base-Base interactions energy: -744.131 where: short stacking energy: -293.951 Base-Backbone interact. energy: -0.518 local terms energy: -294.912644 where: bonds (distance) C4'-P energy: -56.603 bonds (distance) P-C4' energy: -62.567 flat angles C4'-P-C4' energy: -67.317 flat angles P-C4'-P energy: -40.451 tors. eta vs tors. theta energy: -67.975 Dist. restrs. and SS energy: 0.757 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -991.294254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -991.294254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -991.576961 (E_RNA) where: Base-Base interactions energy: -690.979 where: short stacking energy: -285.834 Base-Backbone interact. energy: -0.645 local terms energy: -299.952870 where: bonds (distance) C4'-P energy: -55.215 bonds (distance) P-C4' energy: -60.612 flat angles C4'-P-C4' energy: -62.298 flat angles P-C4'-P energy: -50.581 tors. eta vs tors. theta energy: -71.246 Dist. restrs. and SS energy: 0.283 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -921.002552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.002552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -921.263842 (E_RNA) where: Base-Base interactions energy: -620.065 where: short stacking energy: -272.595 Base-Backbone interact. energy: -1.007 local terms energy: -300.191902 where: bonds (distance) C4'-P energy: -62.375 bonds (distance) P-C4' energy: -56.747 flat angles C4'-P-C4' energy: -72.122 flat angles P-C4'-P energy: -33.890 tors. eta vs tors. theta energy: -75.058 Dist. restrs. and SS energy: 0.261 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -844.124753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -844.124753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -844.704203 (E_RNA) where: Base-Base interactions energy: -594.643 where: short stacking energy: -237.468 Base-Backbone interact. energy: 2.056 local terms energy: -252.117213 where: bonds (distance) C4'-P energy: -40.528 bonds (distance) P-C4' energy: -50.607 flat angles C4'-P-C4' energy: -70.837 flat angles P-C4'-P energy: -35.327 tors. eta vs tors. theta energy: -54.818 Dist. restrs. and SS energy: 0.579 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -772.357954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.357954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.795563 (E_RNA) where: Base-Base interactions energy: -507.394 where: short stacking energy: -208.737 Base-Backbone interact. energy: 1.139 local terms energy: -266.540107 where: bonds (distance) C4'-P energy: -60.631 bonds (distance) P-C4' energy: -63.482 flat angles C4'-P-C4' energy: -63.940 flat angles P-C4'-P energy: -23.123 tors. eta vs tors. theta energy: -55.365 Dist. restrs. and SS energy: 0.438 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -723.790811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -723.790811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.965946 (E_RNA) where: Base-Base interactions energy: -463.964 where: short stacking energy: -204.317 Base-Backbone interact. energy: 0.091 local terms energy: -260.092558 where: bonds (distance) C4'-P energy: -53.867 bonds (distance) P-C4' energy: -57.431 flat angles C4'-P-C4' energy: -58.395 flat angles P-C4'-P energy: -38.987 tors. eta vs tors. theta energy: -51.411 Dist. restrs. and SS energy: 0.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -729.194402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.194402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.469259 (E_RNA) where: Base-Base interactions energy: -505.876 where: short stacking energy: -199.983 Base-Backbone interact. energy: -1.406 local terms energy: -222.186818 where: bonds (distance) C4'-P energy: -63.508 bonds (distance) P-C4' energy: -41.570 flat angles C4'-P-C4' energy: -47.528 flat angles P-C4'-P energy: -27.898 tors. eta vs tors. theta energy: -41.682 Dist. restrs. and SS energy: 0.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -1160.599774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1160.599774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1160.899559 (E_RNA) where: Base-Base interactions energy: -813.915 where: short stacking energy: -350.060 Base-Backbone interact. energy: 1.237 local terms energy: -348.221216 where: bonds (distance) C4'-P energy: -60.944 bonds (distance) P-C4' energy: -68.195 flat angles C4'-P-C4' energy: -73.649 flat angles P-C4'-P energy: -45.674 tors. eta vs tors. theta energy: -99.760 Dist. restrs. and SS energy: 0.300 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -1099.398807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1099.398807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1100.517040 (E_RNA) where: Base-Base interactions energy: -752.240 where: short stacking energy: -308.703 Base-Backbone interact. energy: -2.170 local terms energy: -346.107303 where: bonds (distance) C4'-P energy: -67.370 bonds (distance) P-C4' energy: -68.285 flat angles C4'-P-C4' energy: -77.528 flat angles P-C4'-P energy: -46.553 tors. eta vs tors. theta energy: -86.370 Dist. restrs. and SS energy: 1.118 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -1089.750455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.750455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1090.316575 (E_RNA) where: Base-Base interactions energy: -757.014 where: short stacking energy: -305.613 Base-Backbone interact. energy: 0.039 local terms energy: -333.341881 where: bonds (distance) C4'-P energy: -62.076 bonds (distance) P-C4' energy: -64.908 flat angles C4'-P-C4' energy: -75.133 flat angles P-C4'-P energy: -46.627 tors. eta vs tors. theta energy: -84.598 Dist. restrs. and SS energy: 0.566 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -1047.140685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.140685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1047.506681 (E_RNA) where: Base-Base interactions energy: -734.068 where: short stacking energy: -297.788 Base-Backbone interact. energy: -0.813 local terms energy: -312.626297 where: bonds (distance) C4'-P energy: -55.761 bonds (distance) P-C4' energy: -67.382 flat angles C4'-P-C4' energy: -58.893 flat angles P-C4'-P energy: -45.470 tors. eta vs tors. theta energy: -85.120 Dist. restrs. and SS energy: 0.366 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -1025.030493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.030493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1025.301257 (E_RNA) where: Base-Base interactions energy: -723.162 where: short stacking energy: -295.129 Base-Backbone interact. energy: -0.957 local terms energy: -301.181662 where: bonds (distance) C4'-P energy: -52.164 bonds (distance) P-C4' energy: -65.180 flat angles C4'-P-C4' energy: -64.688 flat angles P-C4'-P energy: -44.763 tors. eta vs tors. theta energy: -74.386 Dist. restrs. and SS energy: 0.271 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -896.077503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.077503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.156192 (E_RNA) where: Base-Base interactions energy: -605.770 where: short stacking energy: -276.144 Base-Backbone interact. energy: -0.958 local terms energy: -290.428010 where: bonds (distance) C4'-P energy: -53.127 bonds (distance) P-C4' energy: -57.898 flat angles C4'-P-C4' energy: -74.209 flat angles P-C4'-P energy: -36.809 tors. eta vs tors. theta energy: -68.386 Dist. restrs. and SS energy: 1.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -774.086763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -774.086763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.845128 (E_RNA) where: Base-Base interactions energy: -510.728 where: short stacking energy: -221.745 Base-Backbone interact. energy: 0.791 local terms energy: -264.907640 where: bonds (distance) C4'-P energy: -55.411 bonds (distance) P-C4' energy: -54.148 flat angles C4'-P-C4' energy: -64.897 flat angles P-C4'-P energy: -40.775 tors. eta vs tors. theta energy: -49.677 Dist. restrs. and SS energy: 0.758 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -771.432182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.432182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.143594 (E_RNA) where: Base-Base interactions energy: -518.225 where: short stacking energy: -213.235 Base-Backbone interact. energy: -0.606 local terms energy: -253.312245 where: bonds (distance) C4'-P energy: -55.641 bonds (distance) P-C4' energy: -61.319 flat angles C4'-P-C4' energy: -51.435 flat angles P-C4'-P energy: -40.066 tors. eta vs tors. theta energy: -44.851 Dist. restrs. and SS energy: 0.711 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -708.772277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.772277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.126588 (E_RNA) where: Base-Base interactions energy: -465.239 where: short stacking energy: -204.872 Base-Backbone interact. energy: -0.740 local terms energy: -243.147130 where: bonds (distance) C4'-P energy: -56.735 bonds (distance) P-C4' energy: -56.563 flat angles C4'-P-C4' energy: -60.234 flat angles P-C4'-P energy: -26.355 tors. eta vs tors. theta energy: -43.260 Dist. restrs. and SS energy: 0.354 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -714.740530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.740530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.853726 (E_RNA) where: Base-Base interactions energy: -477.482 where: short stacking energy: -212.838 Base-Backbone interact. energy: 0.359 local terms energy: -238.731560 where: bonds (distance) C4'-P energy: -41.091 bonds (distance) P-C4' energy: -50.222 flat angles C4'-P-C4' energy: -60.653 flat angles P-C4'-P energy: -40.228 tors. eta vs tors. theta energy: -46.538 Dist. restrs. and SS energy: 1.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -1161.853373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1161.853373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1162.339873 (E_RNA) where: Base-Base interactions energy: -816.129 where: short stacking energy: -347.025 Base-Backbone interact. energy: -1.964 local terms energy: -344.246715 where: bonds (distance) C4'-P energy: -69.080 bonds (distance) P-C4' energy: -64.467 flat angles C4'-P-C4' energy: -73.299 flat angles P-C4'-P energy: -38.375 tors. eta vs tors. theta energy: -99.026 Dist. restrs. and SS energy: 0.486 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -1108.479769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1108.479769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1108.859933 (E_RNA) where: Base-Base interactions energy: -769.348 where: short stacking energy: -305.409 Base-Backbone interact. energy: 0.064 local terms energy: -339.576257 where: bonds (distance) C4'-P energy: -64.087 bonds (distance) P-C4' energy: -65.524 flat angles C4'-P-C4' energy: -74.020 flat angles P-C4'-P energy: -53.131 tors. eta vs tors. theta energy: -82.814 Dist. restrs. and SS energy: 0.380 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -1091.244772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.244772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1092.999938 (E_RNA) where: Base-Base interactions energy: -766.196 where: short stacking energy: -324.553 Base-Backbone interact. energy: -2.085 local terms energy: -324.718195 where: bonds (distance) C4'-P energy: -47.352 bonds (distance) P-C4' energy: -59.208 flat angles C4'-P-C4' energy: -75.679 flat angles P-C4'-P energy: -55.491 tors. eta vs tors. theta energy: -86.988 Dist. restrs. and SS energy: 1.755 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -1068.638443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.638443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1069.053258 (E_RNA) where: Base-Base interactions energy: -749.116 where: short stacking energy: -311.774 Base-Backbone interact. energy: -1.648 local terms energy: -318.289744 where: bonds (distance) C4'-P energy: -62.548 bonds (distance) P-C4' energy: -64.423 flat angles C4'-P-C4' energy: -74.517 flat angles P-C4'-P energy: -39.202 tors. eta vs tors. theta energy: -77.599 Dist. restrs. and SS energy: 0.415 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -1018.254269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1018.254269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1018.998669 (E_RNA) where: Base-Base interactions energy: -725.348 where: short stacking energy: -300.127 Base-Backbone interact. energy: -1.052 local terms energy: -292.598177 where: bonds (distance) C4'-P energy: -57.964 bonds (distance) P-C4' energy: -62.369 flat angles C4'-P-C4' energy: -67.357 flat angles P-C4'-P energy: -28.994 tors. eta vs tors. theta energy: -75.914 Dist. restrs. and SS energy: 0.744 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -894.421035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.421035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -894.758474 (E_RNA) where: Base-Base interactions energy: -604.730 where: short stacking energy: -259.548 Base-Backbone interact. energy: -2.393 local terms energy: -287.636115 where: bonds (distance) C4'-P energy: -49.059 bonds (distance) P-C4' energy: -59.433 flat angles C4'-P-C4' energy: -68.598 flat angles P-C4'-P energy: -41.917 tors. eta vs tors. theta energy: -68.629 Dist. restrs. and SS energy: 0.337 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -808.848011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -808.848011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.783752 (E_RNA) where: Base-Base interactions energy: -546.401 where: short stacking energy: -250.658 Base-Backbone interact. energy: -0.836 local terms energy: -262.546136 where: bonds (distance) C4'-P energy: -46.423 bonds (distance) P-C4' energy: -58.448 flat angles C4'-P-C4' energy: -63.292 flat angles P-C4'-P energy: -31.759 tors. eta vs tors. theta energy: -62.624 Dist. restrs. and SS energy: 0.936 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -814.537682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.537682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.554216 (E_RNA) where: Base-Base interactions energy: -553.505 where: short stacking energy: -245.472 Base-Backbone interact. energy: -0.192 local terms energy: -261.857504 where: bonds (distance) C4'-P energy: -43.327 bonds (distance) P-C4' energy: -51.332 flat angles C4'-P-C4' energy: -66.997 flat angles P-C4'-P energy: -44.046 tors. eta vs tors. theta energy: -56.155 Dist. restrs. and SS energy: 1.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -744.466397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.466397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.067535 (E_RNA) where: Base-Base interactions energy: -497.189 where: short stacking energy: -208.586 Base-Backbone interact. energy: 2.021 local terms energy: -249.900416 where: bonds (distance) C4'-P energy: -47.455 bonds (distance) P-C4' energy: -56.375 flat angles C4'-P-C4' energy: -53.552 flat angles P-C4'-P energy: -33.011 tors. eta vs tors. theta energy: -59.507 Dist. restrs. and SS energy: 0.601 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -685.656385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.656385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.383574 (E_RNA) where: Base-Base interactions energy: -448.573 where: short stacking energy: -195.205 Base-Backbone interact. energy: -2.529 local terms energy: -235.281464 where: bonds (distance) C4'-P energy: -54.972 bonds (distance) P-C4' energy: -57.986 flat angles C4'-P-C4' energy: -52.271 flat angles P-C4'-P energy: -32.626 tors. eta vs tors. theta energy: -37.427 Dist. restrs. and SS energy: 0.727 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -1141.900302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1141.900302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1142.109480 (E_RNA) where: Base-Base interactions energy: -784.907 where: short stacking energy: -341.472 Base-Backbone interact. energy: 0.475 local terms energy: -357.677588 where: bonds (distance) C4'-P energy: -61.109 bonds (distance) P-C4' energy: -71.720 flat angles C4'-P-C4' energy: -75.319 flat angles P-C4'-P energy: -46.922 tors. eta vs tors. theta energy: -102.608 Dist. restrs. and SS energy: 0.209 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -1097.880858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1097.880858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1098.141067 (E_RNA) where: Base-Base interactions energy: -763.455 where: short stacking energy: -313.332 Base-Backbone interact. energy: -1.401 local terms energy: -333.284984 where: bonds (distance) C4'-P energy: -58.647 bonds (distance) P-C4' energy: -58.295 flat angles C4'-P-C4' energy: -78.888 flat angles P-C4'-P energy: -52.493 tors. eta vs tors. theta energy: -84.961 Dist. restrs. and SS energy: 0.260 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -1088.550799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1088.550799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1088.711186 (E_RNA) where: Base-Base interactions energy: -776.499 where: short stacking energy: -328.194 Base-Backbone interact. energy: -0.376 local terms energy: -311.835724 where: bonds (distance) C4'-P energy: -63.011 bonds (distance) P-C4' energy: -55.843 flat angles C4'-P-C4' energy: -62.783 flat angles P-C4'-P energy: -48.149 tors. eta vs tors. theta energy: -82.051 Dist. restrs. and SS energy: 0.160 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -1060.782447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.782447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.157374 (E_RNA) where: Base-Base interactions energy: -740.371 where: short stacking energy: -308.270 Base-Backbone interact. energy: -1.621 local terms energy: -319.165344 where: bonds (distance) C4'-P energy: -66.817 bonds (distance) P-C4' energy: -48.730 flat angles C4'-P-C4' energy: -65.971 flat angles P-C4'-P energy: -50.353 tors. eta vs tors. theta energy: -87.295 Dist. restrs. and SS energy: 0.375 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -1014.533282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.533282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1014.958792 (E_RNA) where: Base-Base interactions energy: -709.801 where: short stacking energy: -288.168 Base-Backbone interact. energy: -1.616 local terms energy: -303.542096 where: bonds (distance) C4'-P energy: -58.542 bonds (distance) P-C4' energy: -61.455 flat angles C4'-P-C4' energy: -70.846 flat angles P-C4'-P energy: -35.717 tors. eta vs tors. theta energy: -76.981 Dist. restrs. and SS energy: 0.426 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -913.640041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -913.640041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.817964 (E_RNA) where: Base-Base interactions energy: -625.010 where: short stacking energy: -268.047 Base-Backbone interact. energy: -1.492 local terms energy: -287.316022 where: bonds (distance) C4'-P energy: -53.976 bonds (distance) P-C4' energy: -70.696 flat angles C4'-P-C4' energy: -60.993 flat angles P-C4'-P energy: -31.543 tors. eta vs tors. theta energy: -70.107 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -816.413368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -816.413368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -817.138976 (E_RNA) where: Base-Base interactions energy: -543.352 where: short stacking energy: -240.468 Base-Backbone interact. energy: -0.782 local terms energy: -273.005320 where: bonds (distance) C4'-P energy: -62.349 bonds (distance) P-C4' energy: -52.958 flat angles C4'-P-C4' energy: -64.606 flat angles P-C4'-P energy: -37.308 tors. eta vs tors. theta energy: -55.784 Dist. restrs. and SS energy: 0.726 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -743.406340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -743.406340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.713294 (E_RNA) where: Base-Base interactions energy: -495.838 where: short stacking energy: -209.704 Base-Backbone interact. energy: -0.824 local terms energy: -247.051018 where: bonds (distance) C4'-P energy: -53.443 bonds (distance) P-C4' energy: -54.690 flat angles C4'-P-C4' energy: -60.804 flat angles P-C4'-P energy: -26.859 tors. eta vs tors. theta energy: -51.255 Dist. restrs. and SS energy: 0.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -725.119419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.119419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.885987 (E_RNA) where: Base-Base interactions energy: -494.020 where: short stacking energy: -211.151 Base-Backbone interact. energy: -0.671 local terms energy: -231.195228 where: bonds (distance) C4'-P energy: -51.777 bonds (distance) P-C4' energy: -47.119 flat angles C4'-P-C4' energy: -44.053 flat angles P-C4'-P energy: -45.484 tors. eta vs tors. theta energy: -42.764 Dist. restrs. and SS energy: 0.767 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -679.053305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.053305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.571370 (E_RNA) where: Base-Base interactions energy: -443.115 where: short stacking energy: -192.431 Base-Backbone interact. energy: -1.093 local terms energy: -235.363855 where: bonds (distance) C4'-P energy: -61.393 bonds (distance) P-C4' energy: -48.109 flat angles C4'-P-C4' energy: -59.407 flat angles P-C4'-P energy: -33.291 tors. eta vs tors. theta energy: -33.163 Dist. restrs. and SS energy: 0.518 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -1141.560090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1141.560090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1141.807869 (E_RNA) where: Base-Base interactions energy: -788.281 where: short stacking energy: -334.119 Base-Backbone interact. energy: -2.485 local terms energy: -351.041457 where: bonds (distance) C4'-P energy: -71.072 bonds (distance) P-C4' energy: -65.824 flat angles C4'-P-C4' energy: -66.676 flat angles P-C4'-P energy: -50.004 tors. eta vs tors. theta energy: -97.465 Dist. restrs. and SS energy: 0.248 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -1136.361294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1136.361294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1136.540759 (E_RNA) where: Base-Base interactions energy: -788.946 where: short stacking energy: -329.787 Base-Backbone interact. energy: -1.426 local terms energy: -346.168177 where: bonds (distance) C4'-P energy: -68.278 bonds (distance) P-C4' energy: -67.539 flat angles C4'-P-C4' energy: -71.649 flat angles P-C4'-P energy: -47.247 tors. eta vs tors. theta energy: -91.456 Dist. restrs. and SS energy: 0.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -1086.075022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.075022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1086.156402 (E_RNA) where: Base-Base interactions energy: -741.590 where: short stacking energy: -293.473 Base-Backbone interact. energy: -1.286 local terms energy: -343.281308 where: bonds (distance) C4'-P energy: -63.566 bonds (distance) P-C4' energy: -64.988 flat angles C4'-P-C4' energy: -76.435 flat angles P-C4'-P energy: -53.750 tors. eta vs tors. theta energy: -84.542 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -1037.120661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.120661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1037.502023 (E_RNA) where: Base-Base interactions energy: -694.317 where: short stacking energy: -279.222 Base-Backbone interact. energy: -2.484 local terms energy: -340.701382 where: bonds (distance) C4'-P energy: -59.547 bonds (distance) P-C4' energy: -74.048 flat angles C4'-P-C4' energy: -75.588 flat angles P-C4'-P energy: -51.002 tors. eta vs tors. theta energy: -80.517 Dist. restrs. and SS energy: 0.381 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -1016.231496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.231496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1017.166793 (E_RNA) where: Base-Base interactions energy: -714.786 where: short stacking energy: -274.927 Base-Backbone interact. energy: -2.310 local terms energy: -300.070337 where: bonds (distance) C4'-P energy: -54.887 bonds (distance) P-C4' energy: -65.096 flat angles C4'-P-C4' energy: -66.513 flat angles P-C4'-P energy: -33.952 tors. eta vs tors. theta energy: -79.622 Dist. restrs. and SS energy: 0.935 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -931.271485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -931.271485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -932.042769 (E_RNA) where: Base-Base interactions energy: -631.162 where: short stacking energy: -278.859 Base-Backbone interact. energy: 1.219 local terms energy: -302.099721 where: bonds (distance) C4'-P energy: -53.299 bonds (distance) P-C4' energy: -61.796 flat angles C4'-P-C4' energy: -69.059 flat angles P-C4'-P energy: -45.805 tors. eta vs tors. theta energy: -72.141 Dist. restrs. and SS energy: 0.771 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -829.487979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.487979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -830.376194 (E_RNA) where: Base-Base interactions energy: -566.566 where: short stacking energy: -247.114 Base-Backbone interact. energy: -0.348 local terms energy: -263.462820 where: bonds (distance) C4'-P energy: -52.479 bonds (distance) P-C4' energy: -53.032 flat angles C4'-P-C4' energy: -59.798 flat angles P-C4'-P energy: -44.475 tors. eta vs tors. theta energy: -53.677 Dist. restrs. and SS energy: 0.888 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -740.928163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.928163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.340901 (E_RNA) where: Base-Base interactions energy: -488.610 where: short stacking energy: -228.376 Base-Backbone interact. energy: 3.574 local terms energy: -256.305211 where: bonds (distance) C4'-P energy: -48.516 bonds (distance) P-C4' energy: -70.279 flat angles C4'-P-C4' energy: -55.579 flat angles P-C4'-P energy: -31.961 tors. eta vs tors. theta energy: -49.971 Dist. restrs. and SS energy: 0.413 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -727.665280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.665280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.264791 (E_RNA) where: Base-Base interactions energy: -500.202 where: short stacking energy: -216.349 Base-Backbone interact. energy: 4.234 local terms energy: -232.296594 where: bonds (distance) C4'-P energy: -55.028 bonds (distance) P-C4' energy: -54.962 flat angles C4'-P-C4' energy: -39.303 flat angles P-C4'-P energy: -29.287 tors. eta vs tors. theta energy: -53.718 Dist. restrs. and SS energy: 0.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -675.851090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.851090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.405642 (E_RNA) where: Base-Base interactions energy: -446.177 where: short stacking energy: -180.009 Base-Backbone interact. energy: 1.619 local terms energy: -231.847214 where: bonds (distance) C4'-P energy: -56.494 bonds (distance) P-C4' energy: -59.645 flat angles C4'-P-C4' energy: -47.966 flat angles P-C4'-P energy: -32.826 tors. eta vs tors. theta energy: -34.916 Dist. restrs. and SS energy: 0.555 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -1139.692176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1139.692176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1140.091055 (E_RNA) where: Base-Base interactions energy: -801.105 where: short stacking energy: -320.256 Base-Backbone interact. energy: -0.562 local terms energy: -338.424365 where: bonds (distance) C4'-P energy: -64.807 bonds (distance) P-C4' energy: -61.813 flat angles C4'-P-C4' energy: -64.815 flat angles P-C4'-P energy: -57.423 tors. eta vs tors. theta energy: -89.567 Dist. restrs. and SS energy: 0.399 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -1106.821846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1106.821846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1107.343329 (E_RNA) where: Base-Base interactions energy: -776.984 where: short stacking energy: -326.161 Base-Backbone interact. energy: 0.852 local terms energy: -331.211703 where: bonds (distance) C4'-P energy: -59.759 bonds (distance) P-C4' energy: -62.172 flat angles C4'-P-C4' energy: -74.124 flat angles P-C4'-P energy: -45.905 tors. eta vs tors. theta energy: -89.250 Dist. restrs. and SS energy: 0.521 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -1050.562726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1050.562726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1051.405428 (E_RNA) where: Base-Base interactions energy: -724.607 where: short stacking energy: -277.750 Base-Backbone interact. energy: -2.575 local terms energy: -324.223089 where: bonds (distance) C4'-P energy: -70.629 bonds (distance) P-C4' energy: -63.779 flat angles C4'-P-C4' energy: -72.375 flat angles P-C4'-P energy: -39.162 tors. eta vs tors. theta energy: -78.279 Dist. restrs. and SS energy: 0.843 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -1037.309217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.309217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1037.556684 (E_RNA) where: Base-Base interactions energy: -724.220 where: short stacking energy: -292.649 Base-Backbone interact. energy: -0.758 local terms energy: -312.578492 where: bonds (distance) C4'-P energy: -59.871 bonds (distance) P-C4' energy: -50.101 flat angles C4'-P-C4' energy: -67.110 flat angles P-C4'-P energy: -51.143 tors. eta vs tors. theta energy: -84.353 Dist. restrs. and SS energy: 0.247 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -1019.719022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.719022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.059864 (E_RNA) where: Base-Base interactions energy: -711.545 where: short stacking energy: -290.236 Base-Backbone interact. energy: -0.508 local terms energy: -308.006871 where: bonds (distance) C4'-P energy: -55.244 bonds (distance) P-C4' energy: -60.183 flat angles C4'-P-C4' energy: -73.106 flat angles P-C4'-P energy: -40.133 tors. eta vs tors. theta energy: -79.342 Dist. restrs. and SS energy: 0.341 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -965.772377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.772377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.781799 (E_RNA) where: Base-Base interactions energy: -701.917 where: short stacking energy: -298.756 Base-Backbone interact. energy: 0.333 local terms energy: -265.198053 where: bonds (distance) C4'-P energy: -38.665 bonds (distance) P-C4' energy: -43.601 flat angles C4'-P-C4' energy: -66.170 flat angles P-C4'-P energy: -38.047 tors. eta vs tors. theta energy: -78.716 Dist. restrs. and SS energy: 1.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -781.331486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.331486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -781.644772 (E_RNA) where: Base-Base interactions energy: -509.854 where: short stacking energy: -224.237 Base-Backbone interact. energy: -0.180 local terms energy: -271.610691 where: bonds (distance) C4'-P energy: -64.712 bonds (distance) P-C4' energy: -50.545 flat angles C4'-P-C4' energy: -61.964 flat angles P-C4'-P energy: -38.907 tors. eta vs tors. theta energy: -55.483 Dist. restrs. and SS energy: 0.313 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -802.331277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -802.331277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -802.737289 (E_RNA) where: Base-Base interactions energy: -538.049 where: short stacking energy: -221.454 Base-Backbone interact. energy: -1.343 local terms energy: -263.345838 where: bonds (distance) C4'-P energy: -65.516 bonds (distance) P-C4' energy: -56.545 flat angles C4'-P-C4' energy: -52.728 flat angles P-C4'-P energy: -35.389 tors. eta vs tors. theta energy: -53.168 Dist. restrs. and SS energy: 0.406 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -692.203153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.203153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.763226 (E_RNA) where: Base-Base interactions energy: -459.363 where: short stacking energy: -193.495 Base-Backbone interact. energy: 0.328 local terms energy: -233.728415 where: bonds (distance) C4'-P energy: -37.499 bonds (distance) P-C4' energy: -60.812 flat angles C4'-P-C4' energy: -60.571 flat angles P-C4'-P energy: -34.641 tors. eta vs tors. theta energy: -40.206 Dist. restrs. and SS energy: 0.560 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -692.424268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.424268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.414739 (E_RNA) where: Base-Base interactions energy: -472.139 where: short stacking energy: -196.084 Base-Backbone interact. energy: -0.488 local terms energy: -220.787858 where: bonds (distance) C4'-P energy: -49.805 bonds (distance) P-C4' energy: -62.024 flat angles C4'-P-C4' energy: -39.039 flat angles P-C4'-P energy: -34.813 tors. eta vs tors. theta energy: -35.107 Dist. restrs. and SS energy: 0.990 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -1162.153752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1162.153752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1162.628933 (E_RNA) where: Base-Base interactions energy: -830.077 where: short stacking energy: -337.148 Base-Backbone interact. energy: -2.334 local terms energy: -330.217543 where: bonds (distance) C4'-P energy: -60.314 bonds (distance) P-C4' energy: -61.559 flat angles C4'-P-C4' energy: -75.077 flat angles P-C4'-P energy: -49.071 tors. eta vs tors. theta energy: -84.196 Dist. restrs. and SS energy: 0.475 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -1085.602022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.602022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1086.070478 (E_RNA) where: Base-Base interactions energy: -742.042 where: short stacking energy: -307.086 Base-Backbone interact. energy: -2.360 local terms energy: -341.668764 where: bonds (distance) C4'-P energy: -65.013 bonds (distance) P-C4' energy: -69.841 flat angles C4'-P-C4' energy: -73.048 flat angles P-C4'-P energy: -48.941 tors. eta vs tors. theta energy: -84.825 Dist. restrs. and SS energy: 0.468 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -1089.247345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.247345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1089.364688 (E_RNA) where: Base-Base interactions energy: -758.347 where: short stacking energy: -322.615 Base-Backbone interact. energy: -2.032 local terms energy: -328.985364 where: bonds (distance) C4'-P energy: -54.118 bonds (distance) P-C4' energy: -62.339 flat angles C4'-P-C4' energy: -70.696 flat angles P-C4'-P energy: -46.164 tors. eta vs tors. theta energy: -95.669 Dist. restrs. and SS energy: 0.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -1051.503663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.503663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1052.060995 (E_RNA) where: Base-Base interactions energy: -732.891 where: short stacking energy: -285.702 Base-Backbone interact. energy: -0.787 local terms energy: -318.382891 where: bonds (distance) C4'-P energy: -66.061 bonds (distance) P-C4' energy: -59.400 flat angles C4'-P-C4' energy: -64.988 flat angles P-C4'-P energy: -52.618 tors. eta vs tors. theta energy: -75.316 Dist. restrs. and SS energy: 0.557 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -1031.031771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.031771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1031.696461 (E_RNA) where: Base-Base interactions energy: -723.561 where: short stacking energy: -288.759 Base-Backbone interact. energy: -0.243 local terms energy: -307.892914 where: bonds (distance) C4'-P energy: -64.173 bonds (distance) P-C4' energy: -66.225 flat angles C4'-P-C4' energy: -56.318 flat angles P-C4'-P energy: -40.476 tors. eta vs tors. theta energy: -80.701 Dist. restrs. and SS energy: 0.665 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -979.344714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -979.344714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -980.529916 (E_RNA) where: Base-Base interactions energy: -668.984 where: short stacking energy: -287.629 Base-Backbone interact. energy: -1.251 local terms energy: -310.294784 where: bonds (distance) C4'-P energy: -60.091 bonds (distance) P-C4' energy: -63.687 flat angles C4'-P-C4' energy: -67.930 flat angles P-C4'-P energy: -39.882 tors. eta vs tors. theta energy: -78.705 Dist. restrs. and SS energy: 1.185 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -791.484436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.484436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.972184 (E_RNA) where: Base-Base interactions energy: -528.158 where: short stacking energy: -221.360 Base-Backbone interact. energy: 0.541 local terms energy: -264.354945 where: bonds (distance) C4'-P energy: -62.072 bonds (distance) P-C4' energy: -58.495 flat angles C4'-P-C4' energy: -63.205 flat angles P-C4'-P energy: -37.707 tors. eta vs tors. theta energy: -42.876 Dist. restrs. and SS energy: 0.488 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -793.053230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -793.053230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.412087 (E_RNA) where: Base-Base interactions energy: -527.807 where: short stacking energy: -223.237 Base-Backbone interact. energy: -0.979 local terms energy: -264.625240 where: bonds (distance) C4'-P energy: -61.399 bonds (distance) P-C4' energy: -51.491 flat angles C4'-P-C4' energy: -59.414 flat angles P-C4'-P energy: -35.461 tors. eta vs tors. theta energy: -56.860 Dist. restrs. and SS energy: 0.359 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -688.069074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.069074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.522611 (E_RNA) where: Base-Base interactions energy: -458.101 where: short stacking energy: -196.581 Base-Backbone interact. energy: 0.375 local terms energy: -230.796449 where: bonds (distance) C4'-P energy: -52.705 bonds (distance) P-C4' energy: -51.581 flat angles C4'-P-C4' energy: -57.138 flat angles P-C4'-P energy: -36.596 tors. eta vs tors. theta energy: -32.776 Dist. restrs. and SS energy: 0.454 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -680.269302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.269302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.153982 (E_RNA) where: Base-Base interactions energy: -448.129 where: short stacking energy: -192.976 Base-Backbone interact. energy: -0.664 local terms energy: -232.360987 where: bonds (distance) C4'-P energy: -52.630 bonds (distance) P-C4' energy: -42.821 flat angles C4'-P-C4' energy: -56.515 flat angles P-C4'-P energy: -30.871 tors. eta vs tors. theta energy: -49.524 Dist. restrs. and SS energy: 0.885 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -1134.828538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.828538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1135.005738 (E_RNA) where: Base-Base interactions energy: -784.303 where: short stacking energy: -330.402 Base-Backbone interact. energy: -2.314 local terms energy: -348.388117 where: bonds (distance) C4'-P energy: -61.365 bonds (distance) P-C4' energy: -69.635 flat angles C4'-P-C4' energy: -76.560 flat angles P-C4'-P energy: -50.166 tors. eta vs tors. theta energy: -90.662 Dist. restrs. and SS energy: 0.177 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -1113.359098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1113.359098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1113.498316 (E_RNA) where: Base-Base interactions energy: -777.501 where: short stacking energy: -317.687 Base-Backbone interact. energy: -1.048 local terms energy: -334.948915 where: bonds (distance) C4'-P energy: -70.276 bonds (distance) P-C4' energy: -59.747 flat angles C4'-P-C4' energy: -76.243 flat angles P-C4'-P energy: -46.243 tors. eta vs tors. theta energy: -82.440 Dist. restrs. and SS energy: 0.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -1079.278207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1079.278207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1079.521413 (E_RNA) where: Base-Base interactions energy: -753.881 where: short stacking energy: -296.760 Base-Backbone interact. energy: -2.087 local terms energy: -323.553448 where: bonds (distance) C4'-P energy: -58.323 bonds (distance) P-C4' energy: -62.392 flat angles C4'-P-C4' energy: -69.895 flat angles P-C4'-P energy: -49.897 tors. eta vs tors. theta energy: -83.047 Dist. restrs. and SS energy: 0.243 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -1050.173582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1050.173582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1050.516342 (E_RNA) where: Base-Base interactions energy: -748.087 where: short stacking energy: -314.837 Base-Backbone interact. energy: -1.940 local terms energy: -300.489628 where: bonds (distance) C4'-P energy: -59.384 bonds (distance) P-C4' energy: -65.797 flat angles C4'-P-C4' energy: -55.332 flat angles P-C4'-P energy: -40.553 tors. eta vs tors. theta energy: -79.424 Dist. restrs. and SS energy: 0.343 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -1010.584599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.584599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1010.883278 (E_RNA) where: Base-Base interactions energy: -698.313 where: short stacking energy: -282.353 Base-Backbone interact. energy: -2.774 local terms energy: -309.796993 where: bonds (distance) C4'-P energy: -63.803 bonds (distance) P-C4' energy: -67.098 flat angles C4'-P-C4' energy: -73.256 flat angles P-C4'-P energy: -33.049 tors. eta vs tors. theta energy: -72.590 Dist. restrs. and SS energy: 0.299 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -961.728156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -961.728156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.073247 (E_RNA) where: Base-Base interactions energy: -676.072 where: short stacking energy: -291.605 Base-Backbone interact. energy: -0.447 local terms energy: -285.553493 where: bonds (distance) C4'-P energy: -44.691 bonds (distance) P-C4' energy: -55.371 flat angles C4'-P-C4' energy: -64.638 flat angles P-C4'-P energy: -41.915 tors. eta vs tors. theta energy: -78.939 Dist. restrs. and SS energy: 0.345 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -823.530928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -823.530928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.380237 (E_RNA) where: Base-Base interactions energy: -551.580 where: short stacking energy: -244.166 Base-Backbone interact. energy: -1.330 local terms energy: -271.469584 where: bonds (distance) C4'-P energy: -55.987 bonds (distance) P-C4' energy: -60.609 flat angles C4'-P-C4' energy: -56.722 flat angles P-C4'-P energy: -34.838 tors. eta vs tors. theta energy: -63.314 Dist. restrs. and SS energy: 0.849 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -764.685037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -764.685037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.422884 (E_RNA) where: Base-Base interactions energy: -510.960 where: short stacking energy: -217.740 Base-Backbone interact. energy: 4.902 local terms energy: -259.364540 where: bonds (distance) C4'-P energy: -55.641 bonds (distance) P-C4' energy: -64.960 flat angles C4'-P-C4' energy: -59.925 flat angles P-C4'-P energy: -33.269 tors. eta vs tors. theta energy: -45.569 Dist. restrs. and SS energy: 0.738 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -673.808374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.808374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.066761 (E_RNA) where: Base-Base interactions energy: -461.668 where: short stacking energy: -195.279 Base-Backbone interact. energy: -0.462 local terms energy: -211.936537 where: bonds (distance) C4'-P energy: -49.050 bonds (distance) P-C4' energy: -47.734 flat angles C4'-P-C4' energy: -45.223 flat angles P-C4'-P energy: -32.637 tors. eta vs tors. theta energy: -37.292 Dist. restrs. and SS energy: 0.258 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -675.974547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.974547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.576692 (E_RNA) where: Base-Base interactions energy: -463.330 where: short stacking energy: -186.888 Base-Backbone interact. energy: -0.386 local terms energy: -212.860612 where: bonds (distance) C4'-P energy: -48.328 bonds (distance) P-C4' energy: -48.018 flat angles C4'-P-C4' energy: -47.354 flat angles P-C4'-P energy: -25.914 tors. eta vs tors. theta energy: -43.245 Dist. restrs. and SS energy: 0.602 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -1116.211187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1116.211187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1116.239704 (E_RNA) where: Base-Base interactions energy: -780.514 where: short stacking energy: -318.468 Base-Backbone interact. energy: 1.929 local terms energy: -337.655182 where: bonds (distance) C4'-P energy: -62.893 bonds (distance) P-C4' energy: -68.125 flat angles C4'-P-C4' energy: -69.746 flat angles P-C4'-P energy: -50.828 tors. eta vs tors. theta energy: -86.063 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -1095.048581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.048581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1095.163265 (E_RNA) where: Base-Base interactions energy: -767.762 where: short stacking energy: -302.227 Base-Backbone interact. energy: -3.698 local terms energy: -323.703415 where: bonds (distance) C4'-P energy: -55.711 bonds (distance) P-C4' energy: -68.685 flat angles C4'-P-C4' energy: -71.899 flat angles P-C4'-P energy: -46.100 tors. eta vs tors. theta energy: -81.309 Dist. restrs. and SS energy: 0.115 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -1109.010544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1109.010544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1109.325532 (E_RNA) where: Base-Base interactions energy: -772.535 where: short stacking energy: -325.545 Base-Backbone interact. energy: -0.127 local terms energy: -336.663949 where: bonds (distance) C4'-P energy: -64.215 bonds (distance) P-C4' energy: -58.344 flat angles C4'-P-C4' energy: -74.844 flat angles P-C4'-P energy: -47.529 tors. eta vs tors. theta energy: -91.731 Dist. restrs. and SS energy: 0.315 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -1015.324455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1015.324455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1015.911387 (E_RNA) where: Base-Base interactions energy: -696.669 where: short stacking energy: -295.124 Base-Backbone interact. energy: -1.704 local terms energy: -317.537966 where: bonds (distance) C4'-P energy: -56.682 bonds (distance) P-C4' energy: -65.252 flat angles C4'-P-C4' energy: -71.299 flat angles P-C4'-P energy: -40.993 tors. eta vs tors. theta energy: -83.313 Dist. restrs. and SS energy: 0.587 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -997.699685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.699685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -997.957088 (E_RNA) where: Base-Base interactions energy: -703.700 where: short stacking energy: -277.056 Base-Backbone interact. energy: -1.368 local terms energy: -292.889286 where: bonds (distance) C4'-P energy: -55.526 bonds (distance) P-C4' energy: -48.514 flat angles C4'-P-C4' energy: -64.275 flat angles P-C4'-P energy: -39.960 tors. eta vs tors. theta energy: -84.614 Dist. restrs. and SS energy: 0.257 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -957.615461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -957.615461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -957.931200 (E_RNA) where: Base-Base interactions energy: -651.837 where: short stacking energy: -275.587 Base-Backbone interact. energy: -1.024 local terms energy: -305.070312 where: bonds (distance) C4'-P energy: -58.932 bonds (distance) P-C4' energy: -64.388 flat angles C4'-P-C4' energy: -70.961 flat angles P-C4'-P energy: -33.015 tors. eta vs tors. theta energy: -77.775 Dist. restrs. and SS energy: 0.316 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -803.612469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.612469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -804.240387 (E_RNA) where: Base-Base interactions energy: -541.452 where: short stacking energy: -248.736 Base-Backbone interact. energy: -1.110 local terms energy: -261.677704 where: bonds (distance) C4'-P energy: -53.253 bonds (distance) P-C4' energy: -55.419 flat angles C4'-P-C4' energy: -61.068 flat angles P-C4'-P energy: -32.898 tors. eta vs tors. theta energy: -59.040 Dist. restrs. and SS energy: 0.628 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -755.371244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.371244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.909350 (E_RNA) where: Base-Base interactions energy: -497.513 where: short stacking energy: -224.845 Base-Backbone interact. energy: -1.789 local terms energy: -256.607448 where: bonds (distance) C4'-P energy: -56.290 bonds (distance) P-C4' energy: -55.344 flat angles C4'-P-C4' energy: -58.592 flat angles P-C4'-P energy: -31.001 tors. eta vs tors. theta energy: -55.380 Dist. restrs. and SS energy: 0.538 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -682.615809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.615809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.185959 (E_RNA) where: Base-Base interactions energy: -460.378 where: short stacking energy: -190.723 Base-Backbone interact. energy: -0.732 local terms energy: -222.076265 where: bonds (distance) C4'-P energy: -58.825 bonds (distance) P-C4' energy: -54.249 flat angles C4'-P-C4' energy: -39.795 flat angles P-C4'-P energy: -38.370 tors. eta vs tors. theta energy: -30.838 Dist. restrs. and SS energy: 0.570 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -677.727169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.727169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.758101 (E_RNA) where: Base-Base interactions energy: -463.975 where: short stacking energy: -194.007 Base-Backbone interact. energy: -1.587 local terms energy: -213.196498 where: bonds (distance) C4'-P energy: -38.522 bonds (distance) P-C4' energy: -63.535 flat angles C4'-P-C4' energy: -47.053 flat angles P-C4'-P energy: -30.130 tors. eta vs tors. theta energy: -33.956 Dist. restrs. and SS energy: 1.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -1123.513967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1123.513967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1123.648793 (E_RNA) where: Base-Base interactions energy: -792.125 where: short stacking energy: -330.204 Base-Backbone interact. energy: 0.970 local terms energy: -332.493051 where: bonds (distance) C4'-P energy: -66.311 bonds (distance) P-C4' energy: -61.094 flat angles C4'-P-C4' energy: -65.649 flat angles P-C4'-P energy: -50.718 tors. eta vs tors. theta energy: -88.721 Dist. restrs. and SS energy: 0.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -1086.956490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.956490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1087.093678 (E_RNA) where: Base-Base interactions energy: -754.848 where: short stacking energy: -313.482 Base-Backbone interact. energy: -0.767 local terms energy: -331.478580 where: bonds (distance) C4'-P energy: -63.619 bonds (distance) P-C4' energy: -69.022 flat angles C4'-P-C4' energy: -67.242 flat angles P-C4'-P energy: -48.721 tors. eta vs tors. theta energy: -82.874 Dist. restrs. and SS energy: 0.137 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -1103.351005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1103.351005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1103.535992 (E_RNA) where: Base-Base interactions energy: -754.396 where: short stacking energy: -318.223 Base-Backbone interact. energy: -1.730 local terms energy: -347.409874 where: bonds (distance) C4'-P energy: -68.004 bonds (distance) P-C4' energy: -60.305 flat angles C4'-P-C4' energy: -75.369 flat angles P-C4'-P energy: -52.718 tors. eta vs tors. theta energy: -91.013 Dist. restrs. and SS energy: 0.185 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -1040.796312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.796312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1041.655344 (E_RNA) where: Base-Base interactions energy: -733.604 where: short stacking energy: -298.172 Base-Backbone interact. energy: -1.971 local terms energy: -306.080220 where: bonds (distance) C4'-P energy: -53.426 bonds (distance) P-C4' energy: -64.343 flat angles C4'-P-C4' energy: -61.623 flat angles P-C4'-P energy: -43.267 tors. eta vs tors. theta energy: -83.422 Dist. restrs. and SS energy: 0.859 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -1021.356386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.356386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.670791 (E_RNA) where: Base-Base interactions energy: -720.214 where: short stacking energy: -291.608 Base-Backbone interact. energy: -1.289 local terms energy: -300.167690 where: bonds (distance) C4'-P energy: -63.177 bonds (distance) P-C4' energy: -59.298 flat angles C4'-P-C4' energy: -61.616 flat angles P-C4'-P energy: -36.451 tors. eta vs tors. theta energy: -79.626 Dist. restrs. and SS energy: 0.314 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -914.571489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -914.571489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -914.985518 (E_RNA) where: Base-Base interactions energy: -627.996 where: short stacking energy: -269.426 Base-Backbone interact. energy: 0.637 local terms energy: -287.625672 where: bonds (distance) C4'-P energy: -60.871 bonds (distance) P-C4' energy: -63.569 flat angles C4'-P-C4' energy: -61.825 flat angles P-C4'-P energy: -34.337 tors. eta vs tors. theta energy: -67.023 Dist. restrs. and SS energy: 0.414 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -785.483778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.483778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.843092 (E_RNA) where: Base-Base interactions energy: -489.921 where: short stacking energy: -217.288 Base-Backbone interact. energy: 2.630 local terms energy: -298.551903 where: bonds (distance) C4'-P energy: -65.686 bonds (distance) P-C4' energy: -64.790 flat angles C4'-P-C4' energy: -66.957 flat angles P-C4'-P energy: -44.665 tors. eta vs tors. theta energy: -56.453 Dist. restrs. and SS energy: 0.359 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -757.285150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -757.285150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.038411 (E_RNA) where: Base-Base interactions energy: -511.206 where: short stacking energy: -215.607 Base-Backbone interact. energy: 4.222 local terms energy: -251.055349 where: bonds (distance) C4'-P energy: -50.193 bonds (distance) P-C4' energy: -53.001 flat angles C4'-P-C4' energy: -53.996 flat angles P-C4'-P energy: -38.470 tors. eta vs tors. theta energy: -55.396 Dist. restrs. and SS energy: 0.753 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -693.109145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.109145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.316673 (E_RNA) where: Base-Base interactions energy: -438.504 where: short stacking energy: -198.711 Base-Backbone interact. energy: -0.772 local terms energy: -255.039890 where: bonds (distance) C4'-P energy: -59.398 bonds (distance) P-C4' energy: -49.202 flat angles C4'-P-C4' energy: -57.275 flat angles P-C4'-P energy: -48.998 tors. eta vs tors. theta energy: -40.167 Dist. restrs. and SS energy: 1.208 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -687.438938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.438938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.931533 (E_RNA) where: Base-Base interactions energy: -436.647 where: short stacking energy: -181.331 Base-Backbone interact. energy: -3.381 local terms energy: -247.902867 where: bonds (distance) C4'-P energy: -54.411 bonds (distance) P-C4' energy: -57.048 flat angles C4'-P-C4' energy: -54.314 flat angles P-C4'-P energy: -44.213 tors. eta vs tors. theta energy: -37.918 Dist. restrs. and SS energy: 0.493 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -1091.048496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.048496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1091.555217 (E_RNA) where: Base-Base interactions energy: -778.701 where: short stacking energy: -315.599 Base-Backbone interact. energy: -2.411 local terms energy: -310.442783 where: bonds (distance) C4'-P energy: -58.719 bonds (distance) P-C4' energy: -53.968 flat angles C4'-P-C4' energy: -73.903 flat angles P-C4'-P energy: -46.131 tors. eta vs tors. theta energy: -77.722 Dist. restrs. and SS energy: 0.507 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -1130.461024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1130.461024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1131.179248 (E_RNA) where: Base-Base interactions energy: -801.747 where: short stacking energy: -324.036 Base-Backbone interact. energy: -1.767 local terms energy: -327.664985 where: bonds (distance) C4'-P energy: -68.431 bonds (distance) P-C4' energy: -59.617 flat angles C4'-P-C4' energy: -73.344 flat angles P-C4'-P energy: -41.701 tors. eta vs tors. theta energy: -84.572 Dist. restrs. and SS energy: 0.718 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -1079.721128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1079.721128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1079.854465 (E_RNA) where: Base-Base interactions energy: -746.583 where: short stacking energy: -315.279 Base-Backbone interact. energy: -3.197 local terms energy: -330.074966 where: bonds (distance) C4'-P energy: -62.554 bonds (distance) P-C4' energy: -63.481 flat angles C4'-P-C4' energy: -69.068 flat angles P-C4'-P energy: -47.588 tors. eta vs tors. theta energy: -87.384 Dist. restrs. and SS energy: 0.133 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -1037.342487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.342487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1037.670021 (E_RNA) where: Base-Base interactions energy: -725.331 where: short stacking energy: -299.906 Base-Backbone interact. energy: -1.763 local terms energy: -310.575715 where: bonds (distance) C4'-P energy: -59.248 bonds (distance) P-C4' energy: -68.966 flat angles C4'-P-C4' energy: -65.465 flat angles P-C4'-P energy: -40.101 tors. eta vs tors. theta energy: -76.797 Dist. restrs. and SS energy: 0.328 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -978.765587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.765587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.877833 (E_RNA) where: Base-Base interactions energy: -687.531 where: short stacking energy: -283.188 Base-Backbone interact. energy: -0.950 local terms energy: -290.396733 where: bonds (distance) C4'-P energy: -54.190 bonds (distance) P-C4' energy: -59.912 flat angles C4'-P-C4' energy: -61.114 flat angles P-C4'-P energy: -39.445 tors. eta vs tors. theta energy: -75.735 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -924.016782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -924.016782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.210854 (E_RNA) where: Base-Base interactions energy: -643.235 where: short stacking energy: -270.202 Base-Backbone interact. energy: -1.463 local terms energy: -279.513012 where: bonds (distance) C4'-P energy: -49.009 bonds (distance) P-C4' energy: -54.069 flat angles C4'-P-C4' energy: -59.406 flat angles P-C4'-P energy: -38.990 tors. eta vs tors. theta energy: -78.039 Dist. restrs. and SS energy: 0.194 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -784.436427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.436427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.995526 (E_RNA) where: Base-Base interactions energy: -522.681 where: short stacking energy: -238.862 Base-Backbone interact. energy: 1.740 local terms energy: -264.054927 where: bonds (distance) C4'-P energy: -62.455 bonds (distance) P-C4' energy: -58.679 flat angles C4'-P-C4' energy: -52.219 flat angles P-C4'-P energy: -37.506 tors. eta vs tors. theta energy: -53.197 Dist. restrs. and SS energy: 0.559 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -762.334653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.334653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.942377 (E_RNA) where: Base-Base interactions energy: -491.754 where: short stacking energy: -223.893 Base-Backbone interact. energy: -0.197 local terms energy: -270.991863 where: bonds (distance) C4'-P energy: -58.927 bonds (distance) P-C4' energy: -55.805 flat angles C4'-P-C4' energy: -57.743 flat angles P-C4'-P energy: -39.832 tors. eta vs tors. theta energy: -58.685 Dist. restrs. and SS energy: 0.608 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -695.386669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.386669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.083243 (E_RNA) where: Base-Base interactions energy: -454.603 where: short stacking energy: -205.798 Base-Backbone interact. energy: -2.839 local terms energy: -238.641188 where: bonds (distance) C4'-P energy: -54.441 bonds (distance) P-C4' energy: -59.272 flat angles C4'-P-C4' energy: -52.749 flat angles P-C4'-P energy: -34.274 tors. eta vs tors. theta energy: -37.905 Dist. restrs. and SS energy: 0.697 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -666.224979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.224979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.096785 (E_RNA) where: Base-Base interactions energy: -443.764 where: short stacking energy: -196.523 Base-Backbone interact. energy: -1.674 local terms energy: -221.658545 where: bonds (distance) C4'-P energy: -49.708 bonds (distance) P-C4' energy: -52.044 flat angles C4'-P-C4' energy: -54.998 flat angles P-C4'-P energy: -29.517 tors. eta vs tors. theta energy: -35.392 Dist. restrs. and SS energy: 0.872 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -1145.399093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1145.399093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1145.659631 (E_RNA) where: Base-Base interactions energy: -807.722 where: short stacking energy: -332.266 Base-Backbone interact. energy: -2.718 local terms energy: -335.220379 where: bonds (distance) C4'-P energy: -71.149 bonds (distance) P-C4' energy: -63.516 flat angles C4'-P-C4' energy: -74.573 flat angles P-C4'-P energy: -40.281 tors. eta vs tors. theta energy: -85.701 Dist. restrs. and SS energy: 0.261 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -1103.504318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1103.504318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1103.727527 (E_RNA) where: Base-Base interactions energy: -780.017 where: short stacking energy: -323.026 Base-Backbone interact. energy: -1.737 local terms energy: -321.973445 where: bonds (distance) C4'-P energy: -64.571 bonds (distance) P-C4' energy: -63.286 flat angles C4'-P-C4' energy: -69.987 flat angles P-C4'-P energy: -42.842 tors. eta vs tors. theta energy: -81.289 Dist. restrs. and SS energy: 0.223 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -1069.152469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.152469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1069.502839 (E_RNA) where: Base-Base interactions energy: -771.033 where: short stacking energy: -322.994 Base-Backbone interact. energy: 1.123 local terms energy: -299.592633 where: bonds (distance) C4'-P energy: -52.566 bonds (distance) P-C4' energy: -59.529 flat angles C4'-P-C4' energy: -69.051 flat angles P-C4'-P energy: -36.464 tors. eta vs tors. theta energy: -81.983 Dist. restrs. and SS energy: 0.350 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -1039.807373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.807373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.281192 (E_RNA) where: Base-Base interactions energy: -717.901 where: short stacking energy: -299.105 Base-Backbone interact. energy: 4.031 local terms energy: -326.410996 where: bonds (distance) C4'-P energy: -64.450 bonds (distance) P-C4' energy: -61.378 flat angles C4'-P-C4' energy: -65.564 flat angles P-C4'-P energy: -50.407 tors. eta vs tors. theta energy: -84.613 Dist. restrs. and SS energy: 0.474 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -987.715312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.715312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -987.939990 (E_RNA) where: Base-Base interactions energy: -681.087 where: short stacking energy: -289.011 Base-Backbone interact. energy: -0.249 local terms energy: -306.603716 where: bonds (distance) C4'-P energy: -58.960 bonds (distance) P-C4' energy: -68.254 flat angles C4'-P-C4' energy: -59.790 flat angles P-C4'-P energy: -33.113 tors. eta vs tors. theta energy: -86.487 Dist. restrs. and SS energy: 0.225 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -937.156791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.156791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -938.183526 (E_RNA) where: Base-Base interactions energy: -643.995 where: short stacking energy: -252.611 Base-Backbone interact. energy: -1.553 local terms energy: -292.635801 where: bonds (distance) C4'-P energy: -54.107 bonds (distance) P-C4' energy: -56.533 flat angles C4'-P-C4' energy: -68.499 flat angles P-C4'-P energy: -41.015 tors. eta vs tors. theta energy: -72.482 Dist. restrs. and SS energy: 1.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -824.331810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.331810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.613200 (E_RNA) where: Base-Base interactions energy: -539.528 where: short stacking energy: -246.324 Base-Backbone interact. energy: -0.454 local terms energy: -284.630979 where: bonds (distance) C4'-P energy: -53.556 bonds (distance) P-C4' energy: -64.959 flat angles C4'-P-C4' energy: -64.007 flat angles P-C4'-P energy: -35.918 tors. eta vs tors. theta energy: -66.192 Dist. restrs. and SS energy: 0.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -733.871331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -733.871331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.432503 (E_RNA) where: Base-Base interactions energy: -464.675 where: short stacking energy: -197.686 Base-Backbone interact. energy: -0.967 local terms energy: -268.790497 where: bonds (distance) C4'-P energy: -63.632 bonds (distance) P-C4' energy: -58.413 flat angles C4'-P-C4' energy: -65.095 flat angles P-C4'-P energy: -36.021 tors. eta vs tors. theta energy: -45.629 Dist. restrs. and SS energy: 0.561 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -686.037372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.037372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.298814 (E_RNA) where: Base-Base interactions energy: -447.345 where: short stacking energy: -193.577 Base-Backbone interact. energy: -1.031 local terms energy: -237.922619 where: bonds (distance) C4'-P energy: -58.318 bonds (distance) P-C4' energy: -55.741 flat angles C4'-P-C4' energy: -49.552 flat angles P-C4'-P energy: -34.020 tors. eta vs tors. theta energy: -40.292 Dist. restrs. and SS energy: 0.261 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -662.069587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.069587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.768751 (E_RNA) where: Base-Base interactions energy: -430.775 where: short stacking energy: -196.102 Base-Backbone interact. energy: -1.727 local terms energy: -230.266832 where: bonds (distance) C4'-P energy: -52.233 bonds (distance) P-C4' energy: -56.054 flat angles C4'-P-C4' energy: -49.006 flat angles P-C4'-P energy: -35.133 tors. eta vs tors. theta energy: -37.840 Dist. restrs. and SS energy: 0.699 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -1164.169625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1164.169625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1164.839460 (E_RNA) where: Base-Base interactions energy: -818.162 where: short stacking energy: -342.248 Base-Backbone interact. energy: 2.869 local terms energy: -349.547077 where: bonds (distance) C4'-P energy: -67.573 bonds (distance) P-C4' energy: -64.401 flat angles C4'-P-C4' energy: -77.100 flat angles P-C4'-P energy: -52.707 tors. eta vs tors. theta energy: -87.765 Dist. restrs. and SS energy: 0.670 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -1088.493216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1088.493216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1088.850943 (E_RNA) where: Base-Base interactions energy: -761.320 where: short stacking energy: -304.747 Base-Backbone interact. energy: -1.636 local terms energy: -325.895585 where: bonds (distance) C4'-P energy: -66.935 bonds (distance) P-C4' energy: -58.464 flat angles C4'-P-C4' energy: -72.823 flat angles P-C4'-P energy: -45.721 tors. eta vs tors. theta energy: -81.953 Dist. restrs. and SS energy: 0.358 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -1079.006358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1079.006358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1079.391758 (E_RNA) where: Base-Base interactions energy: -777.578 where: short stacking energy: -308.985 Base-Backbone interact. energy: 0.159 local terms energy: -301.973566 where: bonds (distance) C4'-P energy: -56.510 bonds (distance) P-C4' energy: -52.512 flat angles C4'-P-C4' energy: -70.297 flat angles P-C4'-P energy: -44.007 tors. eta vs tors. theta energy: -78.647 Dist. restrs. and SS energy: 0.385 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -1026.102614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.102614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1026.446643 (E_RNA) where: Base-Base interactions energy: -716.254 where: short stacking energy: -300.981 Base-Backbone interact. energy: 1.858 local terms energy: -312.049987 where: bonds (distance) C4'-P energy: -56.942 bonds (distance) P-C4' energy: -62.901 flat angles C4'-P-C4' energy: -62.417 flat angles P-C4'-P energy: -43.770 tors. eta vs tors. theta energy: -86.020 Dist. restrs. and SS energy: 0.344 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -1033.104607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1033.104607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1033.149733 (E_RNA) where: Base-Base interactions energy: -726.414 where: short stacking energy: -309.550 Base-Backbone interact. energy: -2.537 local terms energy: -304.198217 where: bonds (distance) C4'-P energy: -55.761 bonds (distance) P-C4' energy: -61.709 flat angles C4'-P-C4' energy: -53.382 flat angles P-C4'-P energy: -44.557 tors. eta vs tors. theta energy: -88.789 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -930.875391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -930.875391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.133758 (E_RNA) where: Base-Base interactions energy: -643.401 where: short stacking energy: -261.100 Base-Backbone interact. energy: 0.165 local terms energy: -287.897567 where: bonds (distance) C4'-P energy: -47.715 bonds (distance) P-C4' energy: -66.731 flat angles C4'-P-C4' energy: -67.869 flat angles P-C4'-P energy: -40.105 tors. eta vs tors. theta energy: -65.478 Dist. restrs. and SS energy: 0.258 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -837.816809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.816809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.349888 (E_RNA) where: Base-Base interactions energy: -557.885 where: short stacking energy: -252.333 Base-Backbone interact. energy: -1.384 local terms energy: -279.080765 where: bonds (distance) C4'-P energy: -59.020 bonds (distance) P-C4' energy: -47.071 flat angles C4'-P-C4' energy: -57.486 flat angles P-C4'-P energy: -47.965 tors. eta vs tors. theta energy: -67.539 Dist. restrs. and SS energy: 0.533 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -775.477729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.477729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.893073 (E_RNA) where: Base-Base interactions energy: -511.311 where: short stacking energy: -221.346 Base-Backbone interact. energy: 0.816 local terms energy: -265.398529 where: bonds (distance) C4'-P energy: -43.073 bonds (distance) P-C4' energy: -59.918 flat angles C4'-P-C4' energy: -61.347 flat angles P-C4'-P energy: -44.222 tors. eta vs tors. theta energy: -56.838 Dist. restrs. and SS energy: 0.415 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -706.947582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.947582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.446566 (E_RNA) where: Base-Base interactions energy: -456.160 where: short stacking energy: -199.125 Base-Backbone interact. energy: 0.856 local terms energy: -252.142209 where: bonds (distance) C4'-P energy: -58.417 bonds (distance) P-C4' energy: -61.451 flat angles C4'-P-C4' energy: -47.975 flat angles P-C4'-P energy: -35.619 tors. eta vs tors. theta energy: -48.680 Dist. restrs. and SS energy: 0.499 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -682.473629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.473629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.676079 (E_RNA) where: Base-Base interactions energy: -442.321 where: short stacking energy: -188.156 Base-Backbone interact. energy: 1.633 local terms energy: -241.988196 where: bonds (distance) C4'-P energy: -41.438 bonds (distance) P-C4' energy: -65.135 flat angles C4'-P-C4' energy: -53.637 flat angles P-C4'-P energy: -39.937 tors. eta vs tors. theta energy: -41.841 Dist. restrs. and SS energy: 0.202 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -1170.515774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1170.515774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1171.173664 (E_RNA) where: Base-Base interactions energy: -820.760 where: short stacking energy: -330.959 Base-Backbone interact. energy: -0.068 local terms energy: -350.345297 where: bonds (distance) C4'-P energy: -64.781 bonds (distance) P-C4' energy: -66.260 flat angles C4'-P-C4' energy: -73.299 flat angles P-C4'-P energy: -53.234 tors. eta vs tors. theta energy: -92.771 Dist. restrs. and SS energy: 0.658 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -1093.762144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1093.762144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1093.809003 (E_RNA) where: Base-Base interactions energy: -767.449 where: short stacking energy: -312.152 Base-Backbone interact. energy: -1.208 local terms energy: -325.151366 where: bonds (distance) C4'-P energy: -60.399 bonds (distance) P-C4' energy: -59.888 flat angles C4'-P-C4' energy: -73.994 flat angles P-C4'-P energy: -46.165 tors. eta vs tors. theta energy: -84.706 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -1075.279526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1075.279526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1076.055734 (E_RNA) where: Base-Base interactions energy: -759.524 where: short stacking energy: -276.887 Base-Backbone interact. energy: -1.095 local terms energy: -315.436737 where: bonds (distance) C4'-P energy: -61.122 bonds (distance) P-C4' energy: -68.222 flat angles C4'-P-C4' energy: -61.480 flat angles P-C4'-P energy: -48.094 tors. eta vs tors. theta energy: -76.519 Dist. restrs. and SS energy: 0.776 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -1052.826681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.826681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1053.237445 (E_RNA) where: Base-Base interactions energy: -728.866 where: short stacking energy: -310.740 Base-Backbone interact. energy: 0.160 local terms energy: -324.532310 where: bonds (distance) C4'-P energy: -61.545 bonds (distance) P-C4' energy: -51.953 flat angles C4'-P-C4' energy: -74.026 flat angles P-C4'-P energy: -47.748 tors. eta vs tors. theta energy: -89.261 Dist. restrs. and SS energy: 0.411 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -994.480590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.480590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -995.015470 (E_RNA) where: Base-Base interactions energy: -705.028 where: short stacking energy: -291.943 Base-Backbone interact. energy: -0.619 local terms energy: -289.368466 where: bonds (distance) C4'-P energy: -49.565 bonds (distance) P-C4' energy: -61.893 flat angles C4'-P-C4' energy: -66.350 flat angles P-C4'-P energy: -40.188 tors. eta vs tors. theta energy: -71.373 Dist. restrs. and SS energy: 0.535 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -919.868822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -919.868822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.986292 (E_RNA) where: Base-Base interactions energy: -632.045 where: short stacking energy: -274.112 Base-Backbone interact. energy: -0.617 local terms energy: -287.324775 where: bonds (distance) C4'-P energy: -54.695 bonds (distance) P-C4' energy: -59.335 flat angles C4'-P-C4' energy: -55.141 flat angles P-C4'-P energy: -42.872 tors. eta vs tors. theta energy: -75.282 Dist. restrs. and SS energy: 0.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -818.514748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.514748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -818.933138 (E_RNA) where: Base-Base interactions energy: -551.197 where: short stacking energy: -231.836 Base-Backbone interact. energy: 0.430 local terms energy: -268.166240 where: bonds (distance) C4'-P energy: -50.348 bonds (distance) P-C4' energy: -68.457 flat angles C4'-P-C4' energy: -55.720 flat angles P-C4'-P energy: -39.811 tors. eta vs tors. theta energy: -53.831 Dist. restrs. and SS energy: 0.418 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -719.628848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.628848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.874258 (E_RNA) where: Base-Base interactions energy: -487.920 where: short stacking energy: -218.788 Base-Backbone interact. energy: -1.535 local terms energy: -230.419957 where: bonds (distance) C4'-P energy: -56.366 bonds (distance) P-C4' energy: -43.836 flat angles C4'-P-C4' energy: -65.482 flat angles P-C4'-P energy: -20.400 tors. eta vs tors. theta energy: -44.337 Dist. restrs. and SS energy: 0.245 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -703.621883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.621883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.318999 (E_RNA) where: Base-Base interactions energy: -480.985 where: short stacking energy: -208.394 Base-Backbone interact. energy: -1.471 local terms energy: -221.862352 where: bonds (distance) C4'-P energy: -51.963 bonds (distance) P-C4' energy: -41.364 flat angles C4'-P-C4' energy: -49.167 flat angles P-C4'-P energy: -32.518 tors. eta vs tors. theta energy: -46.851 Dist. restrs. and SS energy: 0.697 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -684.689425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.689425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.376134 (E_RNA) where: Base-Base interactions energy: -454.742 where: short stacking energy: -194.627 Base-Backbone interact. energy: -0.425 local terms energy: -230.208900 where: bonds (distance) C4'-P energy: -49.392 bonds (distance) P-C4' energy: -51.354 flat angles C4'-P-C4' energy: -59.635 flat angles P-C4'-P energy: -26.570 tors. eta vs tors. theta energy: -43.257 Dist. restrs. and SS energy: 0.687 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -1145.972610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1145.972610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1146.305586 (E_RNA) where: Base-Base interactions energy: -812.662 where: short stacking energy: -335.961 Base-Backbone interact. energy: -0.977 local terms energy: -332.666510 where: bonds (distance) C4'-P energy: -58.404 bonds (distance) P-C4' energy: -67.821 flat angles C4'-P-C4' energy: -71.798 flat angles P-C4'-P energy: -47.359 tors. eta vs tors. theta energy: -87.285 Dist. restrs. and SS energy: 0.333 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -1106.188462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1106.188462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1106.542843 (E_RNA) where: Base-Base interactions energy: -769.911 where: short stacking energy: -323.685 Base-Backbone interact. energy: -0.953 local terms energy: -335.678423 where: bonds (distance) C4'-P energy: -61.327 bonds (distance) P-C4' energy: -69.151 flat angles C4'-P-C4' energy: -67.702 flat angles P-C4'-P energy: -47.565 tors. eta vs tors. theta energy: -89.933 Dist. restrs. and SS energy: 0.354 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -1079.264571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1079.264571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1079.565873 (E_RNA) where: Base-Base interactions energy: -757.361 where: short stacking energy: -298.941 Base-Backbone interact. energy: -1.675 local terms energy: -320.529058 where: bonds (distance) C4'-P energy: -64.935 bonds (distance) P-C4' energy: -67.876 flat angles C4'-P-C4' energy: -65.747 flat angles P-C4'-P energy: -43.010 tors. eta vs tors. theta energy: -78.960 Dist. restrs. and SS energy: 0.301 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -1027.310158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1027.310158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1028.172455 (E_RNA) where: Base-Base interactions energy: -706.770 where: short stacking energy: -315.677 Base-Backbone interact. energy: 0.408 local terms energy: -321.810196 where: bonds (distance) C4'-P energy: -59.250 bonds (distance) P-C4' energy: -64.473 flat angles C4'-P-C4' energy: -70.320 flat angles P-C4'-P energy: -39.542 tors. eta vs tors. theta energy: -88.226 Dist. restrs. and SS energy: 0.862 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -1005.769580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.769580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1006.068749 (E_RNA) where: Base-Base interactions energy: -712.120 where: short stacking energy: -294.190 Base-Backbone interact. energy: -2.896 local terms energy: -291.052282 where: bonds (distance) C4'-P energy: -58.618 bonds (distance) P-C4' energy: -49.280 flat angles C4'-P-C4' energy: -68.349 flat angles P-C4'-P energy: -43.025 tors. eta vs tors. theta energy: -71.781 Dist. restrs. and SS energy: 0.299 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -936.980606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -936.980606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.243441 (E_RNA) where: Base-Base interactions energy: -634.723 where: short stacking energy: -264.675 Base-Backbone interact. energy: 0.818 local terms energy: -303.338540 where: bonds (distance) C4'-P energy: -62.303 bonds (distance) P-C4' energy: -51.900 flat angles C4'-P-C4' energy: -60.943 flat angles P-C4'-P energy: -52.161 tors. eta vs tors. theta energy: -76.032 Dist. restrs. and SS energy: 0.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -847.196407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -847.196407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -847.862925 (E_RNA) where: Base-Base interactions energy: -567.418 where: short stacking energy: -254.318 Base-Backbone interact. energy: -0.517 local terms energy: -279.927907 where: bonds (distance) C4'-P energy: -65.316 bonds (distance) P-C4' energy: -55.028 flat angles C4'-P-C4' energy: -59.518 flat angles P-C4'-P energy: -33.831 tors. eta vs tors. theta energy: -66.234 Dist. restrs. and SS energy: 0.667 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -698.419357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.419357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.826362 (E_RNA) where: Base-Base interactions energy: -474.715 where: short stacking energy: -201.450 Base-Backbone interact. energy: -1.108 local terms energy: -223.003053 where: bonds (distance) C4'-P energy: -43.618 bonds (distance) P-C4' energy: -57.700 flat angles C4'-P-C4' energy: -42.900 flat angles P-C4'-P energy: -28.919 tors. eta vs tors. theta energy: -49.867 Dist. restrs. and SS energy: 0.407 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -698.511303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.511303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.240034 (E_RNA) where: Base-Base interactions energy: -465.944 where: short stacking energy: -199.608 Base-Backbone interact. energy: -0.421 local terms energy: -232.874276 where: bonds (distance) C4'-P energy: -48.154 bonds (distance) P-C4' energy: -39.691 flat angles C4'-P-C4' energy: -70.247 flat angles P-C4'-P energy: -37.115 tors. eta vs tors. theta energy: -37.668 Dist. restrs. and SS energy: 0.729 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -678.538874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.538874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.726701 (E_RNA) where: Base-Base interactions energy: -449.514 where: short stacking energy: -203.748 Base-Backbone interact. energy: -1.399 local terms energy: -227.813378 where: bonds (distance) C4'-P energy: -55.805 bonds (distance) P-C4' energy: -57.871 flat angles C4'-P-C4' energy: -50.232 flat angles P-C4'-P energy: -26.840 tors. eta vs tors. theta energy: -37.065 Dist. restrs. and SS energy: 0.188 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -1168.558201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1168.558201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1169.005126 (E_RNA) where: Base-Base interactions energy: -824.554 where: short stacking energy: -330.399 Base-Backbone interact. energy: -0.948 local terms energy: -343.503135 where: bonds (distance) C4'-P energy: -63.390 bonds (distance) P-C4' energy: -66.247 flat angles C4'-P-C4' energy: -72.706 flat angles P-C4'-P energy: -54.055 tors. eta vs tors. theta energy: -87.105 Dist. restrs. and SS energy: 0.447 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -1116.973902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1116.973902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1117.067150 (E_RNA) where: Base-Base interactions energy: -782.925 where: short stacking energy: -323.155 Base-Backbone interact. energy: -1.232 local terms energy: -332.910981 where: bonds (distance) C4'-P energy: -63.789 bonds (distance) P-C4' energy: -64.073 flat angles C4'-P-C4' energy: -75.018 flat angles P-C4'-P energy: -47.384 tors. eta vs tors. theta energy: -82.647 Dist. restrs. and SS energy: 0.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -1051.734821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.734821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1051.953360 (E_RNA) where: Base-Base interactions energy: -735.597 where: short stacking energy: -308.416 Base-Backbone interact. energy: 2.284 local terms energy: -318.640810 where: bonds (distance) C4'-P energy: -57.556 bonds (distance) P-C4' energy: -65.532 flat angles C4'-P-C4' energy: -64.915 flat angles P-C4'-P energy: -48.801 tors. eta vs tors. theta energy: -81.838 Dist. restrs. and SS energy: 0.219 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -1058.680691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.680691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.077002 (E_RNA) where: Base-Base interactions energy: -741.001 where: short stacking energy: -304.675 Base-Backbone interact. energy: -1.800 local terms energy: -316.276485 where: bonds (distance) C4'-P energy: -61.663 bonds (distance) P-C4' energy: -57.926 flat angles C4'-P-C4' energy: -69.353 flat angles P-C4'-P energy: -43.384 tors. eta vs tors. theta energy: -83.950 Dist. restrs. and SS energy: 0.396 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -989.788548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.788548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -990.302554 (E_RNA) where: Base-Base interactions energy: -702.930 where: short stacking energy: -284.210 Base-Backbone interact. energy: -1.239 local terms energy: -286.133571 where: bonds (distance) C4'-P energy: -47.297 bonds (distance) P-C4' energy: -54.048 flat angles C4'-P-C4' energy: -59.567 flat angles P-C4'-P energy: -36.945 tors. eta vs tors. theta energy: -88.277 Dist. restrs. and SS energy: 0.514 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -919.231833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -919.231833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.535979 (E_RNA) where: Base-Base interactions energy: -623.556 where: short stacking energy: -264.160 Base-Backbone interact. energy: 1.519 local terms energy: -297.499320 where: bonds (distance) C4'-P energy: -52.843 bonds (distance) P-C4' energy: -66.207 flat angles C4'-P-C4' energy: -60.491 flat angles P-C4'-P energy: -41.960 tors. eta vs tors. theta energy: -75.998 Dist. restrs. and SS energy: 0.304 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -839.672617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -839.672617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -840.008181 (E_RNA) where: Base-Base interactions energy: -569.587 where: short stacking energy: -243.453 Base-Backbone interact. energy: 0.101 local terms energy: -270.521579 where: bonds (distance) C4'-P energy: -59.378 bonds (distance) P-C4' energy: -50.545 flat angles C4'-P-C4' energy: -65.397 flat angles P-C4'-P energy: -33.515 tors. eta vs tors. theta energy: -61.686 Dist. restrs. and SS energy: 0.336 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -734.372611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.372611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.880592 (E_RNA) where: Base-Base interactions energy: -486.395 where: short stacking energy: -211.187 Base-Backbone interact. energy: 0.431 local terms energy: -248.916266 where: bonds (distance) C4'-P energy: -45.916 bonds (distance) P-C4' energy: -54.142 flat angles C4'-P-C4' energy: -68.573 flat angles P-C4'-P energy: -32.472 tors. eta vs tors. theta energy: -47.814 Dist. restrs. and SS energy: 0.508 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -738.766378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.766378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.375688 (E_RNA) where: Base-Base interactions energy: -487.193 where: short stacking energy: -223.506 Base-Backbone interact. energy: -0.600 local terms energy: -251.582937 where: bonds (distance) C4'-P energy: -41.399 bonds (distance) P-C4' energy: -63.311 flat angles C4'-P-C4' energy: -68.121 flat angles P-C4'-P energy: -21.929 tors. eta vs tors. theta energy: -56.823 Dist. restrs. and SS energy: 0.609 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -667.801876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.801876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.416415 (E_RNA) where: Base-Base interactions energy: -450.190 where: short stacking energy: -189.085 Base-Backbone interact. energy: -2.314 local terms energy: -215.912391 where: bonds (distance) C4'-P energy: -39.732 bonds (distance) P-C4' energy: -56.734 flat angles C4'-P-C4' energy: -51.497 flat angles P-C4'-P energy: -30.854 tors. eta vs tors. theta energy: -37.095 Dist. restrs. and SS energy: 0.615 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -1162.454397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1162.454397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1162.766192 (E_RNA) where: Base-Base interactions energy: -817.260 where: short stacking energy: -346.645 Base-Backbone interact. energy: -0.963 local terms energy: -344.543440 where: bonds (distance) C4'-P energy: -64.742 bonds (distance) P-C4' energy: -63.792 flat angles C4'-P-C4' energy: -73.730 flat angles P-C4'-P energy: -47.771 tors. eta vs tors. theta energy: -94.509 Dist. restrs. and SS energy: 0.312 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -1122.393534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1122.393534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1122.640075 (E_RNA) where: Base-Base interactions energy: -775.314 where: short stacking energy: -320.369 Base-Backbone interact. energy: 0.680 local terms energy: -348.005911 where: bonds (distance) C4'-P energy: -68.958 bonds (distance) P-C4' energy: -62.077 flat angles C4'-P-C4' energy: -80.797 flat angles P-C4'-P energy: -45.156 tors. eta vs tors. theta energy: -91.018 Dist. restrs. and SS energy: 0.247 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -1067.028780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.028780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1067.307588 (E_RNA) where: Base-Base interactions energy: -745.683 where: short stacking energy: -304.648 Base-Backbone interact. energy: 3.029 local terms energy: -324.653554 where: bonds (distance) C4'-P energy: -64.053 bonds (distance) P-C4' energy: -58.092 flat angles C4'-P-C4' energy: -70.733 flat angles P-C4'-P energy: -53.682 tors. eta vs tors. theta energy: -78.093 Dist. restrs. and SS energy: 0.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -1082.992153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1082.992153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1083.168316 (E_RNA) where: Base-Base interactions energy: -769.970 where: short stacking energy: -311.023 Base-Backbone interact. energy: -0.817 local terms energy: -312.381386 where: bonds (distance) C4'-P energy: -54.524 bonds (distance) P-C4' energy: -53.254 flat angles C4'-P-C4' energy: -68.866 flat angles P-C4'-P energy: -48.435 tors. eta vs tors. theta energy: -87.303 Dist. restrs. and SS energy: 0.176 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -970.623880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -970.623880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -970.964702 (E_RNA) where: Base-Base interactions energy: -652.074 where: short stacking energy: -264.413 Base-Backbone interact. energy: -1.386 local terms energy: -317.504675 where: bonds (distance) C4'-P energy: -54.057 bonds (distance) P-C4' energy: -65.990 flat angles C4'-P-C4' energy: -59.530 flat angles P-C4'-P energy: -58.803 tors. eta vs tors. theta energy: -79.124 Dist. restrs. and SS energy: 0.341 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -903.652731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -903.652731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -903.897836 (E_RNA) where: Base-Base interactions energy: -629.245 where: short stacking energy: -254.425 Base-Backbone interact. energy: -0.197 local terms energy: -274.456506 where: bonds (distance) C4'-P energy: -51.683 bonds (distance) P-C4' energy: -50.996 flat angles C4'-P-C4' energy: -65.719 flat angles P-C4'-P energy: -38.418 tors. eta vs tors. theta energy: -67.641 Dist. restrs. and SS energy: 0.245 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -845.929541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.929541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -846.413446 (E_RNA) where: Base-Base interactions energy: -551.439 where: short stacking energy: -217.413 Base-Backbone interact. energy: -2.273 local terms energy: -292.701843 where: bonds (distance) C4'-P energy: -64.893 bonds (distance) P-C4' energy: -50.956 flat angles C4'-P-C4' energy: -66.314 flat angles P-C4'-P energy: -50.431 tors. eta vs tors. theta energy: -60.108 Dist. restrs. and SS energy: 0.484 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -716.513567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.513567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.640996 (E_RNA) where: Base-Base interactions energy: -470.431 where: short stacking energy: -212.166 Base-Backbone interact. energy: 2.140 local terms energy: -248.349897 where: bonds (distance) C4'-P energy: -58.642 bonds (distance) P-C4' energy: -61.145 flat angles C4'-P-C4' energy: -57.154 flat angles P-C4'-P energy: -29.726 tors. eta vs tors. theta energy: -41.683 Dist. restrs. and SS energy: 0.127 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -694.974178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.974178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.452884 (E_RNA) where: Base-Base interactions energy: -440.149 where: short stacking energy: -190.961 Base-Backbone interact. energy: 1.341 local terms energy: -256.644616 where: bonds (distance) C4'-P energy: -48.260 bonds (distance) P-C4' energy: -65.856 flat angles C4'-P-C4' energy: -57.313 flat angles P-C4'-P energy: -37.954 tors. eta vs tors. theta energy: -47.261 Dist. restrs. and SS energy: 0.479 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -664.726804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.726804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.716910 (E_RNA) where: Base-Base interactions energy: -436.981 where: short stacking energy: -182.146 Base-Backbone interact. energy: 1.698 local terms energy: -230.433368 where: bonds (distance) C4'-P energy: -43.815 bonds (distance) P-C4' energy: -59.196 flat angles C4'-P-C4' energy: -49.506 flat angles P-C4'-P energy: -36.263 tors. eta vs tors. theta energy: -41.653 Dist. restrs. and SS energy: 0.990 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -1173.247144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1173.247144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1173.646373 (E_RNA) where: Base-Base interactions energy: -827.217 where: short stacking energy: -341.845 Base-Backbone interact. energy: -3.035 local terms energy: -343.394304 where: bonds (distance) C4'-P energy: -62.103 bonds (distance) P-C4' energy: -68.970 flat angles C4'-P-C4' energy: -71.920 flat angles P-C4'-P energy: -50.084 tors. eta vs tors. theta energy: -90.316 Dist. restrs. and SS energy: 0.399 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -1138.157771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1138.157771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1138.287053 (E_RNA) where: Base-Base interactions energy: -803.709 where: short stacking energy: -337.310 Base-Backbone interact. energy: 0.490 local terms energy: -335.067588 where: bonds (distance) C4'-P energy: -70.498 bonds (distance) P-C4' energy: -57.029 flat angles C4'-P-C4' energy: -74.609 flat angles P-C4'-P energy: -46.723 tors. eta vs tors. theta energy: -86.208 Dist. restrs. and SS energy: 0.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -1078.617610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.617610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1079.180111 (E_RNA) where: Base-Base interactions energy: -742.625 where: short stacking energy: -314.211 Base-Backbone interact. energy: -0.904 local terms energy: -335.651266 where: bonds (distance) C4'-P energy: -62.930 bonds (distance) P-C4' energy: -64.850 flat angles C4'-P-C4' energy: -74.099 flat angles P-C4'-P energy: -43.511 tors. eta vs tors. theta energy: -90.261 Dist. restrs. and SS energy: 0.563 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -1075.937280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1075.937280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1075.970875 (E_RNA) where: Base-Base interactions energy: -750.444 where: short stacking energy: -298.513 Base-Backbone interact. energy: -2.076 local terms energy: -323.451303 where: bonds (distance) C4'-P energy: -64.214 bonds (distance) P-C4' energy: -60.755 flat angles C4'-P-C4' energy: -68.728 flat angles P-C4'-P energy: -46.414 tors. eta vs tors. theta energy: -83.340 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -974.568994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -974.568994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.273196 (E_RNA) where: Base-Base interactions energy: -669.537 where: short stacking energy: -281.966 Base-Backbone interact. energy: 0.748 local terms energy: -306.483853 where: bonds (distance) C4'-P energy: -62.002 bonds (distance) P-C4' energy: -61.369 flat angles C4'-P-C4' energy: -55.986 flat angles P-C4'-P energy: -45.385 tors. eta vs tors. theta energy: -81.741 Dist. restrs. and SS energy: 0.704 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -937.747020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.747020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -938.012900 (E_RNA) where: Base-Base interactions energy: -647.934 where: short stacking energy: -277.311 Base-Backbone interact. energy: -1.350 local terms energy: -288.728650 where: bonds (distance) C4'-P energy: -53.459 bonds (distance) P-C4' energy: -58.430 flat angles C4'-P-C4' energy: -65.814 flat angles P-C4'-P energy: -34.738 tors. eta vs tors. theta energy: -76.287 Dist. restrs. and SS energy: 0.266 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -846.509692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.509692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -846.674231 (E_RNA) where: Base-Base interactions energy: -587.828 where: short stacking energy: -232.874 Base-Backbone interact. energy: -1.150 local terms energy: -257.695840 where: bonds (distance) C4'-P energy: -53.553 bonds (distance) P-C4' energy: -52.316 flat angles C4'-P-C4' energy: -61.471 flat angles P-C4'-P energy: -37.797 tors. eta vs tors. theta energy: -52.560 Dist. restrs. and SS energy: 0.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -715.491415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.491415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.211699 (E_RNA) where: Base-Base interactions energy: -456.921 where: short stacking energy: -211.766 Base-Backbone interact. energy: 0.766 local terms energy: -260.056916 where: bonds (distance) C4'-P energy: -52.883 bonds (distance) P-C4' energy: -51.873 flat angles C4'-P-C4' energy: -64.138 flat angles P-C4'-P energy: -34.561 tors. eta vs tors. theta energy: -56.602 Dist. restrs. and SS energy: 0.720 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -728.688625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.688625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.123868 (E_RNA) where: Base-Base interactions energy: -488.279 where: short stacking energy: -190.934 Base-Backbone interact. energy: -0.512 local terms energy: -240.333131 where: bonds (distance) C4'-P energy: -52.787 bonds (distance) P-C4' energy: -54.796 flat angles C4'-P-C4' energy: -69.383 flat angles P-C4'-P energy: -29.081 tors. eta vs tors. theta energy: -34.286 Dist. restrs. and SS energy: 0.435 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -691.373387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.373387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.730891 (E_RNA) where: Base-Base interactions energy: -465.726 where: short stacking energy: -193.889 Base-Backbone interact. energy: -1.335 local terms energy: -224.669719 where: bonds (distance) C4'-P energy: -46.906 bonds (distance) P-C4' energy: -52.276 flat angles C4'-P-C4' energy: -55.255 flat angles P-C4'-P energy: -35.372 tors. eta vs tors. theta energy: -34.861 Dist. restrs. and SS energy: 0.358 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -1166.507814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1166.507814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1167.050390 (E_RNA) where: Base-Base interactions energy: -811.374 where: short stacking energy: -333.419 Base-Backbone interact. energy: 0.250 local terms energy: -355.926229 where: bonds (distance) C4'-P energy: -68.325 bonds (distance) P-C4' energy: -70.670 flat angles C4'-P-C4' energy: -78.066 flat angles P-C4'-P energy: -45.511 tors. eta vs tors. theta energy: -93.354 Dist. restrs. and SS energy: 0.543 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -1098.623991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1098.623991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1098.785520 (E_RNA) where: Base-Base interactions energy: -764.272 where: short stacking energy: -315.669 Base-Backbone interact. energy: 3.301 local terms energy: -337.815137 where: bonds (distance) C4'-P energy: -66.615 bonds (distance) P-C4' energy: -66.844 flat angles C4'-P-C4' energy: -75.525 flat angles P-C4'-P energy: -38.800 tors. eta vs tors. theta energy: -90.030 Dist. restrs. and SS energy: 0.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -1085.432149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.432149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1085.743391 (E_RNA) where: Base-Base interactions energy: -762.801 where: short stacking energy: -332.700 Base-Backbone interact. energy: -1.403 local terms energy: -321.539237 where: bonds (distance) C4'-P energy: -56.014 bonds (distance) P-C4' energy: -58.427 flat angles C4'-P-C4' energy: -74.699 flat angles P-C4'-P energy: -39.344 tors. eta vs tors. theta energy: -93.055 Dist. restrs. and SS energy: 0.311 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -1073.314295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.314295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.536825 (E_RNA) where: Base-Base interactions energy: -746.613 where: short stacking energy: -307.058 Base-Backbone interact. energy: 0.577 local terms energy: -327.500730 where: bonds (distance) C4'-P energy: -56.646 bonds (distance) P-C4' energy: -57.853 flat angles C4'-P-C4' energy: -69.129 flat angles P-C4'-P energy: -53.127 tors. eta vs tors. theta energy: -90.745 Dist. restrs. and SS energy: 0.223 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -1017.513692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1017.513692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1017.814420 (E_RNA) where: Base-Base interactions energy: -715.327 where: short stacking energy: -322.114 Base-Backbone interact. energy: -3.169 local terms energy: -299.318579 where: bonds (distance) C4'-P energy: -65.621 bonds (distance) P-C4' energy: -49.948 flat angles C4'-P-C4' energy: -64.169 flat angles P-C4'-P energy: -37.584 tors. eta vs tors. theta energy: -81.997 Dist. restrs. and SS energy: 0.301 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -884.396269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.396269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -884.760124 (E_RNA) where: Base-Base interactions energy: -613.883 where: short stacking energy: -248.028 Base-Backbone interact. energy: 0.487 local terms energy: -271.364164 where: bonds (distance) C4'-P energy: -54.749 bonds (distance) P-C4' energy: -61.869 flat angles C4'-P-C4' energy: -54.727 flat angles P-C4'-P energy: -42.402 tors. eta vs tors. theta energy: -57.618 Dist. restrs. and SS energy: 0.364 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -846.120882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.120882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -846.663507 (E_RNA) where: Base-Base interactions energy: -577.381 where: short stacking energy: -245.399 Base-Backbone interact. energy: -1.939 local terms energy: -267.343494 where: bonds (distance) C4'-P energy: -54.021 bonds (distance) P-C4' energy: -55.739 flat angles C4'-P-C4' energy: -65.671 flat angles P-C4'-P energy: -38.895 tors. eta vs tors. theta energy: -53.019 Dist. restrs. and SS energy: 0.543 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -747.172085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.172085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.478697 (E_RNA) where: Base-Base interactions energy: -490.583 where: short stacking energy: -228.737 Base-Backbone interact. energy: -0.179 local terms energy: -256.717453 where: bonds (distance) C4'-P energy: -44.587 bonds (distance) P-C4' energy: -59.345 flat angles C4'-P-C4' energy: -55.912 flat angles P-C4'-P energy: -40.026 tors. eta vs tors. theta energy: -56.847 Dist. restrs. and SS energy: 0.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -717.876260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.876260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.288064 (E_RNA) where: Base-Base interactions energy: -464.185 where: short stacking energy: -201.795 Base-Backbone interact. energy: -0.206 local terms energy: -253.896710 where: bonds (distance) C4'-P energy: -55.700 bonds (distance) P-C4' energy: -50.866 flat angles C4'-P-C4' energy: -68.893 flat angles P-C4'-P energy: -31.077 tors. eta vs tors. theta energy: -47.361 Dist. restrs. and SS energy: 0.412 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -677.632896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.632896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.495777 (E_RNA) where: Base-Base interactions energy: -436.525 where: short stacking energy: -184.418 Base-Backbone interact. energy: 0.466 local terms energy: -242.437012 where: bonds (distance) C4'-P energy: -50.323 bonds (distance) P-C4' energy: -47.529 flat angles C4'-P-C4' energy: -59.908 flat angles P-C4'-P energy: -40.324 tors. eta vs tors. theta energy: -44.353 Dist. restrs. and SS energy: 0.863 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -1129.220405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1129.220405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1129.720905 (E_RNA) where: Base-Base interactions energy: -800.633 where: short stacking energy: -325.587 Base-Backbone interact. energy: -0.523 local terms energy: -328.565568 where: bonds (distance) C4'-P energy: -60.833 bonds (distance) P-C4' energy: -60.791 flat angles C4'-P-C4' energy: -72.586 flat angles P-C4'-P energy: -46.808 tors. eta vs tors. theta energy: -87.547 Dist. restrs. and SS energy: 0.501 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -1154.897308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1154.897308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1155.417538 (E_RNA) where: Base-Base interactions energy: -820.277 where: short stacking energy: -341.254 Base-Backbone interact. energy: -1.111 local terms energy: -334.029566 where: bonds (distance) C4'-P energy: -64.507 bonds (distance) P-C4' energy: -54.860 flat angles C4'-P-C4' energy: -76.374 flat angles P-C4'-P energy: -44.382 tors. eta vs tors. theta energy: -93.907 Dist. restrs. and SS energy: 0.520 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -1107.238830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1107.238830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1107.702663 (E_RNA) where: Base-Base interactions energy: -777.728 where: short stacking energy: -329.085 Base-Backbone interact. energy: 0.029 local terms energy: -330.003503 where: bonds (distance) C4'-P energy: -58.950 bonds (distance) P-C4' energy: -58.539 flat angles C4'-P-C4' energy: -68.570 flat angles P-C4'-P energy: -45.860 tors. eta vs tors. theta energy: -98.085 Dist. restrs. and SS energy: 0.464 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -1066.521771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1066.521771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1066.713543 (E_RNA) where: Base-Base interactions energy: -741.199 where: short stacking energy: -296.660 Base-Backbone interact. energy: -0.887 local terms energy: -324.627675 where: bonds (distance) C4'-P energy: -64.619 bonds (distance) P-C4' energy: -71.695 flat angles C4'-P-C4' energy: -64.767 flat angles P-C4'-P energy: -39.766 tors. eta vs tors. theta energy: -83.780 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -985.364765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.364765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -985.822973 (E_RNA) where: Base-Base interactions energy: -683.084 where: short stacking energy: -284.331 Base-Backbone interact. energy: -0.781 local terms energy: -301.957476 where: bonds (distance) C4'-P energy: -53.728 bonds (distance) P-C4' energy: -61.172 flat angles C4'-P-C4' energy: -54.336 flat angles P-C4'-P energy: -54.217 tors. eta vs tors. theta energy: -78.505 Dist. restrs. and SS energy: 0.458 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -898.498333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.498333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -899.062386 (E_RNA) where: Base-Base interactions energy: -631.651 where: short stacking energy: -263.997 Base-Backbone interact. energy: 1.783 local terms energy: -269.194346 where: bonds (distance) C4'-P energy: -58.978 bonds (distance) P-C4' energy: -44.607 flat angles C4'-P-C4' energy: -55.633 flat angles P-C4'-P energy: -49.206 tors. eta vs tors. theta energy: -60.771 Dist. restrs. and SS energy: 0.564 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -801.071754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -801.071754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -801.264029 (E_RNA) where: Base-Base interactions energy: -545.135 where: short stacking energy: -238.477 Base-Backbone interact. energy: 2.576 local terms energy: -258.704824 where: bonds (distance) C4'-P energy: -52.855 bonds (distance) P-C4' energy: -56.504 flat angles C4'-P-C4' energy: -61.247 flat angles P-C4'-P energy: -28.151 tors. eta vs tors. theta energy: -59.949 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -735.143271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.143271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.494528 (E_RNA) where: Base-Base interactions energy: -468.364 where: short stacking energy: -217.640 Base-Backbone interact. energy: -3.211 local terms energy: -263.919980 where: bonds (distance) C4'-P energy: -57.647 bonds (distance) P-C4' energy: -52.805 flat angles C4'-P-C4' energy: -66.537 flat angles P-C4'-P energy: -38.114 tors. eta vs tors. theta energy: -48.817 Dist. restrs. and SS energy: 0.351 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -708.154372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.154372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.810634 (E_RNA) where: Base-Base interactions energy: -461.405 where: short stacking energy: -207.062 Base-Backbone interact. energy: -1.535 local terms energy: -245.870638 where: bonds (distance) C4'-P energy: -52.452 bonds (distance) P-C4' energy: -59.809 flat angles C4'-P-C4' energy: -60.758 flat angles P-C4'-P energy: -38.022 tors. eta vs tors. theta energy: -34.829 Dist. restrs. and SS energy: 0.656 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -672.937755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.937755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.803409 (E_RNA) where: Base-Base interactions energy: -436.171 where: short stacking energy: -187.596 Base-Backbone interact. energy: -0.317 local terms energy: -237.315305 where: bonds (distance) C4'-P energy: -55.556 bonds (distance) P-C4' energy: -53.409 flat angles C4'-P-C4' energy: -48.141 flat angles P-C4'-P energy: -40.471 tors. eta vs tors. theta energy: -39.739 Dist. restrs. and SS energy: 0.866 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -1142.225715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1142.225715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1142.833814 (E_RNA) where: Base-Base interactions energy: -799.008 where: short stacking energy: -339.507 Base-Backbone interact. energy: -0.185 local terms energy: -343.640215 where: bonds (distance) C4'-P energy: -62.311 bonds (distance) P-C4' energy: -62.275 flat angles C4'-P-C4' energy: -70.983 flat angles P-C4'-P energy: -50.545 tors. eta vs tors. theta energy: -97.525 Dist. restrs. and SS energy: 0.608 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -1146.166835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1146.166835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1147.052717 (E_RNA) where: Base-Base interactions energy: -809.900 where: short stacking energy: -338.913 Base-Backbone interact. energy: -3.259 local terms energy: -333.894224 where: bonds (distance) C4'-P energy: -57.518 bonds (distance) P-C4' energy: -66.515 flat angles C4'-P-C4' energy: -71.071 flat angles P-C4'-P energy: -46.927 tors. eta vs tors. theta energy: -91.864 Dist. restrs. and SS energy: 0.886 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -1086.354303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.354303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1086.640434 (E_RNA) where: Base-Base interactions energy: -762.586 where: short stacking energy: -319.807 Base-Backbone interact. energy: -2.049 local terms energy: -322.004856 where: bonds (distance) C4'-P energy: -46.161 bonds (distance) P-C4' energy: -69.610 flat angles C4'-P-C4' energy: -68.583 flat angles P-C4'-P energy: -47.138 tors. eta vs tors. theta energy: -90.514 Dist. restrs. and SS energy: 0.286 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -1035.059547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.059547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1035.267983 (E_RNA) where: Base-Base interactions energy: -720.909 where: short stacking energy: -287.495 Base-Backbone interact. energy: -2.254 local terms energy: -312.104628 where: bonds (distance) C4'-P energy: -60.060 bonds (distance) P-C4' energy: -57.186 flat angles C4'-P-C4' energy: -61.359 flat angles P-C4'-P energy: -56.459 tors. eta vs tors. theta energy: -77.040 Dist. restrs. and SS energy: 0.208 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -1014.787811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.787811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1014.945324 (E_RNA) where: Base-Base interactions energy: -709.084 where: short stacking energy: -287.260 Base-Backbone interact. energy: -1.268 local terms energy: -304.593200 where: bonds (distance) C4'-P energy: -65.121 bonds (distance) P-C4' energy: -60.561 flat angles C4'-P-C4' energy: -62.131 flat angles P-C4'-P energy: -38.434 tors. eta vs tors. theta energy: -78.346 Dist. restrs. and SS energy: 0.158 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -905.036222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -905.036222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.268104 (E_RNA) where: Base-Base interactions energy: -615.015 where: short stacking energy: -260.273 Base-Backbone interact. energy: 1.171 local terms energy: -291.423987 where: bonds (distance) C4'-P energy: -54.032 bonds (distance) P-C4' energy: -57.643 flat angles C4'-P-C4' energy: -69.267 flat angles P-C4'-P energy: -39.523 tors. eta vs tors. theta energy: -70.959 Dist. restrs. and SS energy: 0.232 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -766.092314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.092314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.280853 (E_RNA) where: Base-Base interactions energy: -502.574 where: short stacking energy: -219.792 Base-Backbone interact. energy: 0.688 local terms energy: -264.394312 where: bonds (distance) C4'-P energy: -49.646 bonds (distance) P-C4' energy: -51.068 flat angles C4'-P-C4' energy: -63.976 flat angles P-C4'-P energy: -46.936 tors. eta vs tors. theta energy: -52.769 Dist. restrs. and SS energy: 0.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -785.213430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.213430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.455804 (E_RNA) where: Base-Base interactions energy: -507.438 where: short stacking energy: -226.730 Base-Backbone interact. energy: -1.875 local terms energy: -276.142996 where: bonds (distance) C4'-P energy: -66.903 bonds (distance) P-C4' energy: -51.390 flat angles C4'-P-C4' energy: -59.745 flat angles P-C4'-P energy: -38.497 tors. eta vs tors. theta energy: -59.607 Dist. restrs. and SS energy: 0.242 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -722.563607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.563607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.675187 (E_RNA) where: Base-Base interactions energy: -499.226 where: short stacking energy: -224.259 Base-Backbone interact. energy: -0.559 local terms energy: -222.890746 where: bonds (distance) C4'-P energy: -55.360 bonds (distance) P-C4' energy: -43.097 flat angles C4'-P-C4' energy: -52.392 flat angles P-C4'-P energy: -22.291 tors. eta vs tors. theta energy: -49.751 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -720.906832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.906832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.257014 (E_RNA) where: Base-Base interactions energy: -473.480 where: short stacking energy: -204.983 Base-Backbone interact. energy: -1.169 local terms energy: -246.608144 where: bonds (distance) C4'-P energy: -58.351 bonds (distance) P-C4' energy: -49.329 flat angles C4'-P-C4' energy: -59.840 flat angles P-C4'-P energy: -32.069 tors. eta vs tors. theta energy: -47.020 Dist. restrs. and SS energy: 0.350 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -1156.609952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1156.609952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1157.218101 (E_RNA) where: Base-Base interactions energy: -811.464 where: short stacking energy: -347.297 Base-Backbone interact. energy: 0.398 local terms energy: -346.152638 where: bonds (distance) C4'-P energy: -65.294 bonds (distance) P-C4' energy: -69.138 flat angles C4'-P-C4' energy: -69.232 flat angles P-C4'-P energy: -48.224 tors. eta vs tors. theta energy: -94.264 Dist. restrs. and SS energy: 0.608 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -1134.048737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.048737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1134.514431 (E_RNA) where: Base-Base interactions energy: -814.185 where: short stacking energy: -320.973 Base-Backbone interact. energy: -1.184 local terms energy: -319.146081 where: bonds (distance) C4'-P energy: -65.564 bonds (distance) P-C4' energy: -49.999 flat angles C4'-P-C4' energy: -67.414 flat angles P-C4'-P energy: -50.709 tors. eta vs tors. theta energy: -85.459 Dist. restrs. and SS energy: 0.466 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -1083.175066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.175066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1083.441905 (E_RNA) where: Base-Base interactions energy: -748.264 where: short stacking energy: -304.372 Base-Backbone interact. energy: 0.485 local terms energy: -335.662704 where: bonds (distance) C4'-P energy: -67.308 bonds (distance) P-C4' energy: -65.176 flat angles C4'-P-C4' energy: -73.516 flat angles P-C4'-P energy: -47.625 tors. eta vs tors. theta energy: -82.038 Dist. restrs. and SS energy: 0.267 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -1038.601367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.601367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.732836 (E_RNA) where: Base-Base interactions energy: -711.161 where: short stacking energy: -284.130 Base-Backbone interact. energy: -1.386 local terms energy: -326.186235 where: bonds (distance) C4'-P energy: -64.078 bonds (distance) P-C4' energy: -63.954 flat angles C4'-P-C4' energy: -64.754 flat angles P-C4'-P energy: -52.732 tors. eta vs tors. theta energy: -80.667 Dist. restrs. and SS energy: 0.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -1032.647133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1032.647133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1032.868754 (E_RNA) where: Base-Base interactions energy: -712.486 where: short stacking energy: -278.853 Base-Backbone interact. energy: 2.184 local terms energy: -322.566630 where: bonds (distance) C4'-P energy: -63.488 bonds (distance) P-C4' energy: -59.359 flat angles C4'-P-C4' energy: -70.030 flat angles P-C4'-P energy: -52.384 tors. eta vs tors. theta energy: -77.306 Dist. restrs. and SS energy: 0.222 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -869.930391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.930391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -870.117765 (E_RNA) where: Base-Base interactions energy: -590.032 where: short stacking energy: -252.097 Base-Backbone interact. energy: -1.050 local terms energy: -279.036655 where: bonds (distance) C4'-P energy: -55.593 bonds (distance) P-C4' energy: -60.534 flat angles C4'-P-C4' energy: -70.112 flat angles P-C4'-P energy: -35.881 tors. eta vs tors. theta energy: -56.916 Dist. restrs. and SS energy: 0.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -784.059340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.059340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.661711 (E_RNA) where: Base-Base interactions energy: -520.232 where: short stacking energy: -224.663 Base-Backbone interact. energy: 0.235 local terms energy: -264.664402 where: bonds (distance) C4'-P energy: -59.023 bonds (distance) P-C4' energy: -54.633 flat angles C4'-P-C4' energy: -64.181 flat angles P-C4'-P energy: -43.498 tors. eta vs tors. theta energy: -43.329 Dist. restrs. and SS energy: 0.602 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -740.431042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.431042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.582215 (E_RNA) where: Base-Base interactions energy: -484.883 where: short stacking energy: -217.035 Base-Backbone interact. energy: -0.810 local terms energy: -254.889150 where: bonds (distance) C4'-P energy: -53.455 bonds (distance) P-C4' energy: -64.082 flat angles C4'-P-C4' energy: -58.343 flat angles P-C4'-P energy: -39.775 tors. eta vs tors. theta energy: -39.234 Dist. restrs. and SS energy: 0.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -725.182753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.182753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.818824 (E_RNA) where: Base-Base interactions energy: -475.293 where: short stacking energy: -203.209 Base-Backbone interact. energy: 4.074 local terms energy: -254.599919 where: bonds (distance) C4'-P energy: -52.821 bonds (distance) P-C4' energy: -60.036 flat angles C4'-P-C4' energy: -53.309 flat angles P-C4'-P energy: -39.125 tors. eta vs tors. theta energy: -49.309 Dist. restrs. and SS energy: 0.636 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -717.611924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.611924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.256918 (E_RNA) where: Base-Base interactions energy: -476.020 where: short stacking energy: -215.841 Base-Backbone interact. energy: -0.929 local terms energy: -241.307682 where: bonds (distance) C4'-P energy: -50.205 bonds (distance) P-C4' energy: -56.130 flat angles C4'-P-C4' energy: -63.108 flat angles P-C4'-P energy: -31.800 tors. eta vs tors. theta energy: -40.065 Dist. restrs. and SS energy: 0.645 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -1157.636600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1157.636600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1157.824120 (E_RNA) where: Base-Base interactions energy: -817.424 where: short stacking energy: -327.771 Base-Backbone interact. energy: -0.931 local terms energy: -339.469145 where: bonds (distance) C4'-P energy: -62.378 bonds (distance) P-C4' energy: -73.441 flat angles C4'-P-C4' energy: -72.302 flat angles P-C4'-P energy: -42.897 tors. eta vs tors. theta energy: -88.451 Dist. restrs. and SS energy: 0.188 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -1120.829533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1120.829533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1121.128501 (E_RNA) where: Base-Base interactions energy: -791.711 where: short stacking energy: -309.641 Base-Backbone interact. energy: -1.724 local terms energy: -327.693913 where: bonds (distance) C4'-P energy: -50.960 bonds (distance) P-C4' energy: -62.924 flat angles C4'-P-C4' energy: -76.707 flat angles P-C4'-P energy: -54.142 tors. eta vs tors. theta energy: -82.961 Dist. restrs. and SS energy: 0.299 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -1076.632173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.632173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1077.085034 (E_RNA) where: Base-Base interactions energy: -738.871 where: short stacking energy: -294.021 Base-Backbone interact. energy: -1.366 local terms energy: -336.847953 where: bonds (distance) C4'-P energy: -58.742 bonds (distance) P-C4' energy: -72.014 flat angles C4'-P-C4' energy: -70.433 flat angles P-C4'-P energy: -56.119 tors. eta vs tors. theta energy: -79.539 Dist. restrs. and SS energy: 0.453 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -1063.271153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.271153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1063.782608 (E_RNA) where: Base-Base interactions energy: -740.309 where: short stacking energy: -301.318 Base-Backbone interact. energy: 3.722 local terms energy: -327.195221 where: bonds (distance) C4'-P energy: -69.308 bonds (distance) P-C4' energy: -61.735 flat angles C4'-P-C4' energy: -68.059 flat angles P-C4'-P energy: -44.422 tors. eta vs tors. theta energy: -83.670 Dist. restrs. and SS energy: 0.511 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -1022.329967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1022.329967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1022.797756 (E_RNA) where: Base-Base interactions energy: -724.728 where: short stacking energy: -297.115 Base-Backbone interact. energy: 4.155 local terms energy: -302.225077 where: bonds (distance) C4'-P energy: -55.797 bonds (distance) P-C4' energy: -65.169 flat angles C4'-P-C4' energy: -59.642 flat angles P-C4'-P energy: -40.735 tors. eta vs tors. theta energy: -80.881 Dist. restrs. and SS energy: 0.468 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -871.331930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.331930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.021941 (E_RNA) where: Base-Base interactions energy: -585.854 where: short stacking energy: -261.789 Base-Backbone interact. energy: -2.717 local terms energy: -283.450504 where: bonds (distance) C4'-P energy: -52.927 bonds (distance) P-C4' energy: -61.976 flat angles C4'-P-C4' energy: -64.189 flat angles P-C4'-P energy: -34.349 tors. eta vs tors. theta energy: -70.009 Dist. restrs. and SS energy: 0.690 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -782.426715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.426715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.081554 (E_RNA) where: Base-Base interactions energy: -502.035 where: short stacking energy: -211.330 Base-Backbone interact. energy: -0.571 local terms energy: -280.475721 where: bonds (distance) C4'-P energy: -62.927 bonds (distance) P-C4' energy: -66.612 flat angles C4'-P-C4' energy: -65.209 flat angles P-C4'-P energy: -33.989 tors. eta vs tors. theta energy: -51.740 Dist. restrs. and SS energy: 0.655 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -773.257525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -773.257525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.179039 (E_RNA) where: Base-Base interactions energy: -516.360 where: short stacking energy: -238.512 Base-Backbone interact. energy: -0.268 local terms energy: -257.551241 where: bonds (distance) C4'-P energy: -44.569 bonds (distance) P-C4' energy: -54.978 flat angles C4'-P-C4' energy: -63.615 flat angles P-C4'-P energy: -43.451 tors. eta vs tors. theta energy: -50.938 Dist. restrs. and SS energy: 0.922 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -743.878343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -743.878343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.198118 (E_RNA) where: Base-Base interactions energy: -491.063 where: short stacking energy: -217.520 Base-Backbone interact. energy: -1.120 local terms energy: -252.015782 where: bonds (distance) C4'-P energy: -47.192 bonds (distance) P-C4' energy: -43.743 flat angles C4'-P-C4' energy: -58.508 flat angles P-C4'-P energy: -48.560 tors. eta vs tors. theta energy: -54.013 Dist. restrs. and SS energy: 0.320 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -724.695644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.695644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.642871 (E_RNA) where: Base-Base interactions energy: -471.621 where: short stacking energy: -217.936 Base-Backbone interact. energy: 1.697 local terms energy: -255.718427 where: bonds (distance) C4'-P energy: -59.240 bonds (distance) P-C4' energy: -48.453 flat angles C4'-P-C4' energy: -53.508 flat angles P-C4'-P energy: -46.249 tors. eta vs tors. theta energy: -48.269 Dist. restrs. and SS energy: 0.947 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -1169.731795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1169.731795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1170.322900 (E_RNA) where: Base-Base interactions energy: -825.877 where: short stacking energy: -327.728 Base-Backbone interact. energy: -2.493 local terms energy: -341.952640 where: bonds (distance) C4'-P energy: -68.267 bonds (distance) P-C4' energy: -66.656 flat angles C4'-P-C4' energy: -72.607 flat angles P-C4'-P energy: -48.583 tors. eta vs tors. theta energy: -85.841 Dist. restrs. and SS energy: 0.591 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -1127.447452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1127.447452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1127.778952 (E_RNA) where: Base-Base interactions energy: -802.162 where: short stacking energy: -314.043 Base-Backbone interact. energy: -1.782 local terms energy: -323.835219 where: bonds (distance) C4'-P energy: -65.465 bonds (distance) P-C4' energy: -71.119 flat angles C4'-P-C4' energy: -66.703 flat angles P-C4'-P energy: -42.101 tors. eta vs tors. theta energy: -78.447 Dist. restrs. and SS energy: 0.332 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -1103.733618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1103.733618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1103.978057 (E_RNA) where: Base-Base interactions energy: -770.392 where: short stacking energy: -320.422 Base-Backbone interact. energy: -0.524 local terms energy: -333.062352 where: bonds (distance) C4'-P energy: -65.680 bonds (distance) P-C4' energy: -45.740 flat angles C4'-P-C4' energy: -72.070 flat angles P-C4'-P energy: -53.565 tors. eta vs tors. theta energy: -96.007 Dist. restrs. and SS energy: 0.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -1054.970515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1054.970515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1055.139236 (E_RNA) where: Base-Base interactions energy: -746.721 where: short stacking energy: -295.171 Base-Backbone interact. energy: -0.556 local terms energy: -307.862158 where: bonds (distance) C4'-P energy: -65.481 bonds (distance) P-C4' energy: -50.477 flat angles C4'-P-C4' energy: -67.582 flat angles P-C4'-P energy: -48.015 tors. eta vs tors. theta energy: -76.307 Dist. restrs. and SS energy: 0.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -978.826913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.826913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -979.138133 (E_RNA) where: Base-Base interactions energy: -678.618 where: short stacking energy: -290.176 Base-Backbone interact. energy: -0.310 local terms energy: -300.209869 where: bonds (distance) C4'-P energy: -58.240 bonds (distance) P-C4' energy: -64.500 flat angles C4'-P-C4' energy: -64.733 flat angles P-C4'-P energy: -35.823 tors. eta vs tors. theta energy: -76.914 Dist. restrs. and SS energy: 0.311 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -889.013519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.013519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -890.231769 (E_RNA) where: Base-Base interactions energy: -594.944 where: short stacking energy: -257.891 Base-Backbone interact. energy: 0.371 local terms energy: -295.658767 where: bonds (distance) C4'-P energy: -61.390 bonds (distance) P-C4' energy: -56.956 flat angles C4'-P-C4' energy: -61.655 flat angles P-C4'-P energy: -46.047 tors. eta vs tors. theta energy: -69.611 Dist. restrs. and SS energy: 1.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -783.932652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.932652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.352407 (E_RNA) where: Base-Base interactions energy: -531.295 where: short stacking energy: -213.477 Base-Backbone interact. energy: -2.152 local terms energy: -250.905058 where: bonds (distance) C4'-P energy: -47.281 bonds (distance) P-C4' energy: -55.609 flat angles C4'-P-C4' energy: -52.763 flat angles P-C4'-P energy: -45.525 tors. eta vs tors. theta energy: -49.727 Dist. restrs. and SS energy: 0.420 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -725.401802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.401802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.936196 (E_RNA) where: Base-Base interactions energy: -478.778 where: short stacking energy: -217.579 Base-Backbone interact. energy: -0.484 local terms energy: -246.673840 where: bonds (distance) C4'-P energy: -55.761 bonds (distance) P-C4' energy: -50.852 flat angles C4'-P-C4' energy: -50.943 flat angles P-C4'-P energy: -42.397 tors. eta vs tors. theta energy: -46.721 Dist. restrs. and SS energy: 0.534 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -730.421401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.421401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.629622 (E_RNA) where: Base-Base interactions energy: -492.295 where: short stacking energy: -177.439 Base-Backbone interact. energy: 1.764 local terms energy: -240.098235 where: bonds (distance) C4'-P energy: -47.000 bonds (distance) P-C4' energy: -51.390 flat angles C4'-P-C4' energy: -58.772 flat angles P-C4'-P energy: -40.544 tors. eta vs tors. theta energy: -42.392 Dist. restrs. and SS energy: 0.208 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -657.955015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.955015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.809694 (E_RNA) where: Base-Base interactions energy: -434.850 where: short stacking energy: -173.497 Base-Backbone interact. energy: -2.440 local terms energy: -221.519881 where: bonds (distance) C4'-P energy: -43.770 bonds (distance) P-C4' energy: -56.292 flat angles C4'-P-C4' energy: -56.822 flat angles P-C4'-P energy: -36.619 tors. eta vs tors. theta energy: -28.017 Dist. restrs. and SS energy: 0.855 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -1171.219814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1171.219814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1171.348413 (E_RNA) where: Base-Base interactions energy: -839.626 where: short stacking energy: -323.540 Base-Backbone interact. energy: -0.971 local terms energy: -330.751558 where: bonds (distance) C4'-P energy: -54.940 bonds (distance) P-C4' energy: -66.179 flat angles C4'-P-C4' energy: -74.089 flat angles P-C4'-P energy: -50.540 tors. eta vs tors. theta energy: -85.005 Dist. restrs. and SS energy: 0.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -1136.118163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1136.118163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1136.376554 (E_RNA) where: Base-Base interactions energy: -807.120 where: short stacking energy: -335.460 Base-Backbone interact. energy: 5.762 local terms energy: -335.017962 where: bonds (distance) C4'-P energy: -61.044 bonds (distance) P-C4' energy: -66.124 flat angles C4'-P-C4' energy: -75.761 flat angles P-C4'-P energy: -36.428 tors. eta vs tors. theta energy: -95.662 Dist. restrs. and SS energy: 0.258 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -1106.250906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1106.250906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1106.578627 (E_RNA) where: Base-Base interactions energy: -760.659 where: short stacking energy: -321.211 Base-Backbone interact. energy: -1.042 local terms energy: -344.877658 where: bonds (distance) C4'-P energy: -60.896 bonds (distance) P-C4' energy: -68.849 flat angles C4'-P-C4' energy: -73.139 flat angles P-C4'-P energy: -51.953 tors. eta vs tors. theta energy: -90.041 Dist. restrs. and SS energy: 0.328 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -1044.999270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1044.999270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1045.385315 (E_RNA) where: Base-Base interactions energy: -711.564 where: short stacking energy: -291.456 Base-Backbone interact. energy: -3.228 local terms energy: -330.593230 where: bonds (distance) C4'-P energy: -64.399 bonds (distance) P-C4' energy: -63.854 flat angles C4'-P-C4' energy: -70.545 flat angles P-C4'-P energy: -48.357 tors. eta vs tors. theta energy: -83.439 Dist. restrs. and SS energy: 0.386 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -995.988566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -995.988566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -996.672340 (E_RNA) where: Base-Base interactions energy: -702.088 where: short stacking energy: -294.698 Base-Backbone interact. energy: -3.032 local terms energy: -291.552214 where: bonds (distance) C4'-P energy: -45.862 bonds (distance) P-C4' energy: -58.193 flat angles C4'-P-C4' energy: -68.294 flat angles P-C4'-P energy: -39.685 tors. eta vs tors. theta energy: -79.519 Dist. restrs. and SS energy: 0.684 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -853.194783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.194783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.711071 (E_RNA) where: Base-Base interactions energy: -581.778 where: short stacking energy: -249.622 Base-Backbone interact. energy: -0.947 local terms energy: -270.985504 where: bonds (distance) C4'-P energy: -60.636 bonds (distance) P-C4' energy: -50.153 flat angles C4'-P-C4' energy: -59.879 flat angles P-C4'-P energy: -33.665 tors. eta vs tors. theta energy: -66.652 Dist. restrs. and SS energy: 0.516 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -860.670033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.670033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -861.646661 (E_RNA) where: Base-Base interactions energy: -580.143 where: short stacking energy: -251.615 Base-Backbone interact. energy: -2.764 local terms energy: -278.739836 where: bonds (distance) C4'-P energy: -60.510 bonds (distance) P-C4' energy: -50.677 flat angles C4'-P-C4' energy: -61.473 flat angles P-C4'-P energy: -44.207 tors. eta vs tors. theta energy: -61.872 Dist. restrs. and SS energy: 0.977 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -753.748846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.748846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.004616 (E_RNA) where: Base-Base interactions energy: -501.145 where: short stacking energy: -230.470 Base-Backbone interact. energy: -2.745 local terms energy: -250.113941 where: bonds (distance) C4'-P energy: -59.998 bonds (distance) P-C4' energy: -53.219 flat angles C4'-P-C4' energy: -59.781 flat angles P-C4'-P energy: -37.745 tors. eta vs tors. theta energy: -39.371 Dist. restrs. and SS energy: 0.256 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -731.150062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.150062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.378891 (E_RNA) where: Base-Base interactions energy: -496.454 where: short stacking energy: -231.590 Base-Backbone interact. energy: 3.653 local terms energy: -242.577600 where: bonds (distance) C4'-P energy: -51.997 bonds (distance) P-C4' energy: -58.469 flat angles C4'-P-C4' energy: -47.091 flat angles P-C4'-P energy: -35.787 tors. eta vs tors. theta energy: -49.234 Dist. restrs. and SS energy: 4.229 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -637.220756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -637.220756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.853597 (E_RNA) where: Base-Base interactions energy: -406.934 where: short stacking energy: -173.212 Base-Backbone interact. energy: 0.875 local terms energy: -231.794316 where: bonds (distance) C4'-P energy: -42.439 bonds (distance) P-C4' energy: -53.021 flat angles C4'-P-C4' energy: -61.003 flat angles P-C4'-P energy: -33.767 tors. eta vs tors. theta energy: -41.564 Dist. restrs. and SS energy: 0.633 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -1187.841784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1187.841784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1188.135599 (E_RNA) where: Base-Base interactions energy: -842.416 where: short stacking energy: -338.897 Base-Backbone interact. energy: 1.472 local terms energy: -347.191428 where: bonds (distance) C4'-P energy: -61.003 bonds (distance) P-C4' energy: -66.105 flat angles C4'-P-C4' energy: -78.906 flat angles P-C4'-P energy: -47.564 tors. eta vs tors. theta energy: -93.614 Dist. restrs. and SS energy: 0.294 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -1118.061612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1118.061612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1118.400488 (E_RNA) where: Base-Base interactions energy: -785.773 where: short stacking energy: -316.968 Base-Backbone interact. energy: -1.736 local terms energy: -330.890933 where: bonds (distance) C4'-P energy: -62.128 bonds (distance) P-C4' energy: -67.499 flat angles C4'-P-C4' energy: -71.978 flat angles P-C4'-P energy: -47.809 tors. eta vs tors. theta energy: -81.478 Dist. restrs. and SS energy: 0.339 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -1109.940705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1109.940705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1110.111921 (E_RNA) where: Base-Base interactions energy: -779.366 where: short stacking energy: -317.945 Base-Backbone interact. energy: 4.060 local terms energy: -334.805798 where: bonds (distance) C4'-P energy: -63.584 bonds (distance) P-C4' energy: -75.154 flat angles C4'-P-C4' energy: -59.319 flat angles P-C4'-P energy: -44.166 tors. eta vs tors. theta energy: -92.582 Dist. restrs. and SS energy: 0.171 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -1011.020418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.020418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.336256 (E_RNA) where: Base-Base interactions energy: -715.208 where: short stacking energy: -303.774 Base-Backbone interact. energy: 1.204 local terms energy: -297.332496 where: bonds (distance) C4'-P energy: -55.083 bonds (distance) P-C4' energy: -48.267 flat angles C4'-P-C4' energy: -67.687 flat angles P-C4'-P energy: -46.799 tors. eta vs tors. theta energy: -79.498 Dist. restrs. and SS energy: 0.316 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -991.982203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -991.982203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -992.418229 (E_RNA) where: Base-Base interactions energy: -686.879 where: short stacking energy: -288.722 Base-Backbone interact. energy: -1.736 local terms energy: -303.803953 where: bonds (distance) C4'-P energy: -57.414 bonds (distance) P-C4' energy: -57.737 flat angles C4'-P-C4' energy: -65.853 flat angles P-C4'-P energy: -45.306 tors. eta vs tors. theta energy: -77.493 Dist. restrs. and SS energy: 0.436 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -910.770113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -910.770113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.033559 (E_RNA) where: Base-Base interactions energy: -597.748 where: short stacking energy: -255.717 Base-Backbone interact. energy: -3.016 local terms energy: -310.269366 where: bonds (distance) C4'-P energy: -61.555 bonds (distance) P-C4' energy: -70.261 flat angles C4'-P-C4' energy: -64.151 flat angles P-C4'-P energy: -43.039 tors. eta vs tors. theta energy: -71.263 Dist. restrs. and SS energy: 0.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -854.423873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -854.423873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -854.819524 (E_RNA) where: Base-Base interactions energy: -583.581 where: short stacking energy: -254.862 Base-Backbone interact. energy: 0.141 local terms energy: -271.378906 where: bonds (distance) C4'-P energy: -54.635 bonds (distance) P-C4' energy: -62.086 flat angles C4'-P-C4' energy: -70.120 flat angles P-C4'-P energy: -33.598 tors. eta vs tors. theta energy: -50.940 Dist. restrs. and SS energy: 0.396 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -757.689311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -757.689311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.028305 (E_RNA) where: Base-Base interactions energy: -510.146 where: short stacking energy: -213.408 Base-Backbone interact. energy: -0.739 local terms energy: -247.143595 where: bonds (distance) C4'-P energy: -54.678 bonds (distance) P-C4' energy: -56.253 flat angles C4'-P-C4' energy: -54.361 flat angles P-C4'-P energy: -39.837 tors. eta vs tors. theta energy: -42.014 Dist. restrs. and SS energy: 0.339 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -719.750629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.750629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.204833 (E_RNA) where: Base-Base interactions energy: -479.031 where: short stacking energy: -218.986 Base-Backbone interact. energy: 1.132 local terms energy: -242.305907 where: bonds (distance) C4'-P energy: -56.004 bonds (distance) P-C4' energy: -36.215 flat angles C4'-P-C4' energy: -66.646 flat angles P-C4'-P energy: -29.353 tors. eta vs tors. theta energy: -54.088 Dist. restrs. and SS energy: 0.454 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -666.636819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.636819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.435182 (E_RNA) where: Base-Base interactions energy: -443.377 where: short stacking energy: -189.257 Base-Backbone interact. energy: 0.061 local terms energy: -224.118756 where: bonds (distance) C4'-P energy: -58.239 bonds (distance) P-C4' energy: -56.226 flat angles C4'-P-C4' energy: -51.732 flat angles P-C4'-P energy: -21.785 tors. eta vs tors. theta energy: -36.137 Dist. restrs. and SS energy: 0.798 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -1174.785441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1174.785441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1174.907602 (E_RNA) where: Base-Base interactions energy: -834.599 where: short stacking energy: -340.116 Base-Backbone interact. energy: -1.038 local terms energy: -339.270644 where: bonds (distance) C4'-P energy: -57.039 bonds (distance) P-C4' energy: -68.768 flat angles C4'-P-C4' energy: -78.227 flat angles P-C4'-P energy: -46.026 tors. eta vs tors. theta energy: -89.211 Dist. restrs. and SS energy: 0.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -1112.530220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1112.530220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1112.709574 (E_RNA) where: Base-Base interactions energy: -790.736 where: short stacking energy: -300.894 Base-Backbone interact. energy: -2.257 local terms energy: -319.716493 where: bonds (distance) C4'-P energy: -60.552 bonds (distance) P-C4' energy: -65.184 flat angles C4'-P-C4' energy: -71.870 flat angles P-C4'-P energy: -49.189 tors. eta vs tors. theta energy: -72.922 Dist. restrs. and SS energy: 0.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -1101.530539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1101.530539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1101.767164 (E_RNA) where: Base-Base interactions energy: -761.610 where: short stacking energy: -319.601 Base-Backbone interact. energy: -0.010 local terms energy: -340.146609 where: bonds (distance) C4'-P energy: -63.149 bonds (distance) P-C4' energy: -52.275 flat angles C4'-P-C4' energy: -76.935 flat angles P-C4'-P energy: -53.077 tors. eta vs tors. theta energy: -94.710 Dist. restrs. and SS energy: 0.237 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -1040.151190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.151190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.487679 (E_RNA) where: Base-Base interactions energy: -716.817 where: short stacking energy: -285.820 Base-Backbone interact. energy: -0.934 local terms energy: -322.736709 where: bonds (distance) C4'-P energy: -56.569 bonds (distance) P-C4' energy: -67.480 flat angles C4'-P-C4' energy: -70.547 flat angles P-C4'-P energy: -43.240 tors. eta vs tors. theta energy: -84.900 Dist. restrs. and SS energy: 0.336 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -1020.482601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.482601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.116882 (E_RNA) where: Base-Base interactions energy: -708.123 where: short stacking energy: -282.719 Base-Backbone interact. energy: -0.971 local terms energy: -312.022720 where: bonds (distance) C4'-P energy: -58.127 bonds (distance) P-C4' energy: -64.295 flat angles C4'-P-C4' energy: -64.980 flat angles P-C4'-P energy: -47.108 tors. eta vs tors. theta energy: -77.513 Dist. restrs. and SS energy: 0.634 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -867.724117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -867.724117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -868.481895 (E_RNA) where: Base-Base interactions energy: -591.109 where: short stacking energy: -257.381 Base-Backbone interact. energy: 0.309 local terms energy: -277.681701 where: bonds (distance) C4'-P energy: -48.994 bonds (distance) P-C4' energy: -55.668 flat angles C4'-P-C4' energy: -67.920 flat angles P-C4'-P energy: -43.009 tors. eta vs tors. theta energy: -62.090 Dist. restrs. and SS energy: 0.758 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -784.503835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.503835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.156015 (E_RNA) where: Base-Base interactions energy: -532.235 where: short stacking energy: -223.667 Base-Backbone interact. energy: 1.245 local terms energy: -254.166178 where: bonds (distance) C4'-P energy: -41.245 bonds (distance) P-C4' energy: -60.859 flat angles C4'-P-C4' energy: -66.887 flat angles P-C4'-P energy: -34.441 tors. eta vs tors. theta energy: -50.734 Dist. restrs. and SS energy: 0.652 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -755.175392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.175392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.525242 (E_RNA) where: Base-Base interactions energy: -505.609 where: short stacking energy: -209.300 Base-Backbone interact. energy: -1.093 local terms energy: -248.823510 where: bonds (distance) C4'-P energy: -47.612 bonds (distance) P-C4' energy: -59.824 flat angles C4'-P-C4' energy: -55.624 flat angles P-C4'-P energy: -34.531 tors. eta vs tors. theta energy: -51.233 Dist. restrs. and SS energy: 0.350 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -701.736922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.736922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.102662 (E_RNA) where: Base-Base interactions energy: -466.345 where: short stacking energy: -200.654 Base-Backbone interact. energy: -1.722 local terms energy: -234.035532 where: bonds (distance) C4'-P energy: -59.566 bonds (distance) P-C4' energy: -50.154 flat angles C4'-P-C4' energy: -56.077 flat angles P-C4'-P energy: -35.463 tors. eta vs tors. theta energy: -32.776 Dist. restrs. and SS energy: 0.366 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -718.829856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.829856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.926323 (E_RNA) where: Base-Base interactions energy: -469.068 where: short stacking energy: -207.248 Base-Backbone interact. energy: -1.439 local terms energy: -249.419519 where: bonds (distance) C4'-P energy: -37.351 bonds (distance) P-C4' energy: -66.871 flat angles C4'-P-C4' energy: -54.088 flat angles P-C4'-P energy: -46.768 tors. eta vs tors. theta energy: -44.343 Dist. restrs. and SS energy: 1.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -1179.267917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1179.267917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1179.584685 (E_RNA) where: Base-Base interactions energy: -831.878 where: short stacking energy: -345.817 Base-Backbone interact. energy: -1.500 local terms energy: -346.206583 where: bonds (distance) C4'-P energy: -68.144 bonds (distance) P-C4' energy: -66.432 flat angles C4'-P-C4' energy: -71.280 flat angles P-C4'-P energy: -49.033 tors. eta vs tors. theta energy: -91.318 Dist. restrs. and SS energy: 0.317 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -1117.379003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1117.379003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1117.827304 (E_RNA) where: Base-Base interactions energy: -778.578 where: short stacking energy: -309.426 Base-Backbone interact. energy: -1.538 local terms energy: -337.711711 where: bonds (distance) C4'-P energy: -65.382 bonds (distance) P-C4' energy: -70.013 flat angles C4'-P-C4' energy: -72.084 flat angles P-C4'-P energy: -47.550 tors. eta vs tors. theta energy: -82.683 Dist. restrs. and SS energy: 0.448 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -1094.103721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1094.103721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1094.460869 (E_RNA) where: Base-Base interactions energy: -777.031 where: short stacking energy: -309.301 Base-Backbone interact. energy: -1.873 local terms energy: -315.556757 where: bonds (distance) C4'-P energy: -64.695 bonds (distance) P-C4' energy: -62.815 flat angles C4'-P-C4' energy: -57.238 flat angles P-C4'-P energy: -45.214 tors. eta vs tors. theta energy: -85.595 Dist. restrs. and SS energy: 0.357 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -1001.241139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.241139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1001.607434 (E_RNA) where: Base-Base interactions energy: -673.408 where: short stacking energy: -285.890 Base-Backbone interact. energy: -1.395 local terms energy: -326.804025 where: bonds (distance) C4'-P energy: -66.231 bonds (distance) P-C4' energy: -66.028 flat angles C4'-P-C4' energy: -65.850 flat angles P-C4'-P energy: -45.058 tors. eta vs tors. theta energy: -83.637 Dist. restrs. and SS energy: 0.366 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -1011.364262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.364262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.491855 (E_RNA) where: Base-Base interactions energy: -690.757 where: short stacking energy: -279.799 Base-Backbone interact. energy: -1.681 local terms energy: -319.053981 where: bonds (distance) C4'-P energy: -63.665 bonds (distance) P-C4' energy: -64.999 flat angles C4'-P-C4' energy: -62.039 flat angles P-C4'-P energy: -49.508 tors. eta vs tors. theta energy: -78.842 Dist. restrs. and SS energy: 0.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -896.384608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.384608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -896.680321 (E_RNA) where: Base-Base interactions energy: -601.243 where: short stacking energy: -255.142 Base-Backbone interact. energy: -1.133 local terms energy: -294.304527 where: bonds (distance) C4'-P energy: -64.052 bonds (distance) P-C4' energy: -62.083 flat angles C4'-P-C4' energy: -54.259 flat angles P-C4'-P energy: -49.066 tors. eta vs tors. theta energy: -64.845 Dist. restrs. and SS energy: 0.296 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -778.352796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.352796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.876994 (E_RNA) where: Base-Base interactions energy: -501.167 where: short stacking energy: -239.281 Base-Backbone interact. energy: -1.552 local terms energy: -276.158301 where: bonds (distance) C4'-P energy: -57.951 bonds (distance) P-C4' energy: -65.265 flat angles C4'-P-C4' energy: -61.222 flat angles P-C4'-P energy: -37.989 tors. eta vs tors. theta energy: -53.731 Dist. restrs. and SS energy: 0.524 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -786.942221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.942221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.178499 (E_RNA) where: Base-Base interactions energy: -547.709 where: short stacking energy: -235.416 Base-Backbone interact. energy: -1.956 local terms energy: -237.512640 where: bonds (distance) C4'-P energy: -53.820 bonds (distance) P-C4' energy: -65.801 flat angles C4'-P-C4' energy: -45.694 flat angles P-C4'-P energy: -20.927 tors. eta vs tors. theta energy: -51.270 Dist. restrs. and SS energy: 0.236 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -741.972552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -741.972552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -742.528059 (E_RNA) where: Base-Base interactions energy: -489.049 where: short stacking energy: -202.407 Base-Backbone interact. energy: -1.396 local terms energy: -252.083147 where: bonds (distance) C4'-P energy: -48.403 bonds (distance) P-C4' energy: -47.519 flat angles C4'-P-C4' energy: -64.518 flat angles P-C4'-P energy: -41.123 tors. eta vs tors. theta energy: -50.520 Dist. restrs. and SS energy: 0.556 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -705.516049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.516049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.026894 (E_RNA) where: Base-Base interactions energy: -469.477 where: short stacking energy: -208.711 Base-Backbone interact. energy: 0.396 local terms energy: -236.945894 where: bonds (distance) C4'-P energy: -53.462 bonds (distance) P-C4' energy: -44.936 flat angles C4'-P-C4' energy: -47.747 flat angles P-C4'-P energy: -37.798 tors. eta vs tors. theta energy: -53.002 Dist. restrs. and SS energy: 0.511 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -1142.110721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1142.110721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1142.239426 (E_RNA) where: Base-Base interactions energy: -821.863 where: short stacking energy: -337.734 Base-Backbone interact. energy: -1.861 local terms energy: -318.515104 where: bonds (distance) C4'-P energy: -61.309 bonds (distance) P-C4' energy: -59.855 flat angles C4'-P-C4' energy: -67.619 flat angles P-C4'-P energy: -43.163 tors. eta vs tors. theta energy: -86.570 Dist. restrs. and SS energy: 0.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -1145.362078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1145.362078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1145.650418 (E_RNA) where: Base-Base interactions energy: -814.066 where: short stacking energy: -324.277 Base-Backbone interact. energy: -1.383 local terms energy: -330.201177 where: bonds (distance) C4'-P energy: -48.582 bonds (distance) P-C4' energy: -65.650 flat angles C4'-P-C4' energy: -76.801 flat angles P-C4'-P energy: -47.927 tors. eta vs tors. theta energy: -91.242 Dist. restrs. and SS energy: 0.288 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -1096.326944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.326944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1096.614062 (E_RNA) where: Base-Base interactions energy: -761.174 where: short stacking energy: -322.542 Base-Backbone interact. energy: -0.884 local terms energy: -334.556802 where: bonds (distance) C4'-P energy: -62.103 bonds (distance) P-C4' energy: -62.902 flat angles C4'-P-C4' energy: -74.469 flat angles P-C4'-P energy: -41.507 tors. eta vs tors. theta energy: -93.576 Dist. restrs. and SS energy: 0.287 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -1031.626113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.626113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1032.807632 (E_RNA) where: Base-Base interactions energy: -718.534 where: short stacking energy: -292.023 Base-Backbone interact. energy: -0.323 local terms energy: -313.951335 where: bonds (distance) C4'-P energy: -64.082 bonds (distance) P-C4' energy: -61.335 flat angles C4'-P-C4' energy: -67.497 flat angles P-C4'-P energy: -42.644 tors. eta vs tors. theta energy: -78.393 Dist. restrs. and SS energy: 1.182 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -1016.563638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.563638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1016.773931 (E_RNA) where: Base-Base interactions energy: -706.852 where: short stacking energy: -293.157 Base-Backbone interact. energy: -0.649 local terms energy: -309.272913 where: bonds (distance) C4'-P energy: -64.960 bonds (distance) P-C4' energy: -56.912 flat angles C4'-P-C4' energy: -66.355 flat angles P-C4'-P energy: -36.106 tors. eta vs tors. theta energy: -84.940 Dist. restrs. and SS energy: 0.210 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -820.147028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.147028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.511804 (E_RNA) where: Base-Base interactions energy: -533.633 where: short stacking energy: -244.588 Base-Backbone interact. energy: -1.946 local terms energy: -284.932345 where: bonds (distance) C4'-P energy: -46.961 bonds (distance) P-C4' energy: -60.567 flat angles C4'-P-C4' energy: -64.095 flat angles P-C4'-P energy: -47.940 tors. eta vs tors. theta energy: -65.370 Dist. restrs. and SS energy: 0.365 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -882.835962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -882.835962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -883.499527 (E_RNA) where: Base-Base interactions energy: -595.495 where: short stacking energy: -243.970 Base-Backbone interact. energy: -0.521 local terms energy: -287.483457 where: bonds (distance) C4'-P energy: -55.748 bonds (distance) P-C4' energy: -52.916 flat angles C4'-P-C4' energy: -65.979 flat angles P-C4'-P energy: -52.805 tors. eta vs tors. theta energy: -60.035 Dist. restrs. and SS energy: 0.664 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -807.924175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -807.924175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -808.472673 (E_RNA) where: Base-Base interactions energy: -546.031 where: short stacking energy: -225.410 Base-Backbone interact. energy: -1.681 local terms energy: -260.760956 where: bonds (distance) C4'-P energy: -62.202 bonds (distance) P-C4' energy: -59.952 flat angles C4'-P-C4' energy: -54.595 flat angles P-C4'-P energy: -29.648 tors. eta vs tors. theta energy: -54.364 Dist. restrs. and SS energy: 0.548 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -728.460760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.460760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.375453 (E_RNA) where: Base-Base interactions energy: -485.042 where: short stacking energy: -208.988 Base-Backbone interact. energy: -1.554 local terms energy: -242.779538 where: bonds (distance) C4'-P energy: -52.451 bonds (distance) P-C4' energy: -52.360 flat angles C4'-P-C4' energy: -60.911 flat angles P-C4'-P energy: -29.484 tors. eta vs tors. theta energy: -47.575 Dist. restrs. and SS energy: 0.915 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -690.374326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.374326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.718694 (E_RNA) where: Base-Base interactions energy: -479.172 where: short stacking energy: -212.323 Base-Backbone interact. energy: -0.533 local terms energy: -211.013932 where: bonds (distance) C4'-P energy: -48.191 bonds (distance) P-C4' energy: -47.845 flat angles C4'-P-C4' energy: -51.154 flat angles P-C4'-P energy: -18.774 tors. eta vs tors. theta energy: -45.051 Dist. restrs. and SS energy: 0.344 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -1160.031747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1160.031747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1160.559475 (E_RNA) where: Base-Base interactions energy: -808.585 where: short stacking energy: -335.408 Base-Backbone interact. energy: -1.291 local terms energy: -350.683605 where: bonds (distance) C4'-P energy: -58.650 bonds (distance) P-C4' energy: -68.583 flat angles C4'-P-C4' energy: -78.253 flat angles P-C4'-P energy: -49.346 tors. eta vs tors. theta energy: -95.852 Dist. restrs. and SS energy: 0.528 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -1128.710225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1128.710225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1128.879552 (E_RNA) where: Base-Base interactions energy: -789.179 where: short stacking energy: -318.727 Base-Backbone interact. energy: -3.645 local terms energy: -336.055378 where: bonds (distance) C4'-P energy: -67.559 bonds (distance) P-C4' energy: -58.108 flat angles C4'-P-C4' energy: -77.443 flat angles P-C4'-P energy: -52.186 tors. eta vs tors. theta energy: -80.759 Dist. restrs. and SS energy: 0.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -1076.961874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.961874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1077.242325 (E_RNA) where: Base-Base interactions energy: -755.331 where: short stacking energy: -309.625 Base-Backbone interact. energy: 1.887 local terms energy: -323.798669 where: bonds (distance) C4'-P energy: -52.504 bonds (distance) P-C4' energy: -61.590 flat angles C4'-P-C4' energy: -73.496 flat angles P-C4'-P energy: -41.561 tors. eta vs tors. theta energy: -94.648 Dist. restrs. and SS energy: 0.280 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -1089.068382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.068382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1090.656725 (E_RNA) where: Base-Base interactions energy: -775.359 where: short stacking energy: -312.704 Base-Backbone interact. energy: -0.130 local terms energy: -315.167626 where: bonds (distance) C4'-P energy: -58.817 bonds (distance) P-C4' energy: -58.902 flat angles C4'-P-C4' energy: -67.708 flat angles P-C4'-P energy: -48.812 tors. eta vs tors. theta energy: -80.930 Dist. restrs. and SS energy: 1.588 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -991.402520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -991.402520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -991.533244 (E_RNA) where: Base-Base interactions energy: -690.462 where: short stacking energy: -276.084 Base-Backbone interact. energy: -2.272 local terms energy: -298.799340 where: bonds (distance) C4'-P energy: -58.606 bonds (distance) P-C4' energy: -51.836 flat angles C4'-P-C4' energy: -63.223 flat angles P-C4'-P energy: -44.774 tors. eta vs tors. theta energy: -80.361 Dist. restrs. and SS energy: 0.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -797.938920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.938920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -798.166788 (E_RNA) where: Base-Base interactions energy: -537.158 where: short stacking energy: -246.071 Base-Backbone interact. energy: -1.363 local terms energy: -259.645316 where: bonds (distance) C4'-P energy: -58.453 bonds (distance) P-C4' energy: -51.913 flat angles C4'-P-C4' energy: -56.181 flat angles P-C4'-P energy: -38.073 tors. eta vs tors. theta energy: -55.026 Dist. restrs. and SS energy: 0.228 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -807.766165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -807.766165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -808.044385 (E_RNA) where: Base-Base interactions energy: -535.702 where: short stacking energy: -244.476 Base-Backbone interact. energy: 2.067 local terms energy: -274.408874 where: bonds (distance) C4'-P energy: -67.547 bonds (distance) P-C4' energy: -51.978 flat angles C4'-P-C4' energy: -59.018 flat angles P-C4'-P energy: -36.039 tors. eta vs tors. theta energy: -59.827 Dist. restrs. and SS energy: 0.278 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -834.239235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.239235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -835.068789 (E_RNA) where: Base-Base interactions energy: -560.505 where: short stacking energy: -225.510 Base-Backbone interact. energy: -0.382 local terms energy: -274.182192 where: bonds (distance) C4'-P energy: -43.469 bonds (distance) P-C4' energy: -57.843 flat angles C4'-P-C4' energy: -64.769 flat angles P-C4'-P energy: -37.592 tors. eta vs tors. theta energy: -70.510 Dist. restrs. and SS energy: 0.830 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -704.519564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.519564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.150406 (E_RNA) where: Base-Base interactions energy: -453.303 where: short stacking energy: -193.215 Base-Backbone interact. energy: 0.909 local terms energy: -252.755810 where: bonds (distance) C4'-P energy: -56.916 bonds (distance) P-C4' energy: -51.186 flat angles C4'-P-C4' energy: -61.768 flat angles P-C4'-P energy: -41.914 tors. eta vs tors. theta energy: -40.971 Dist. restrs. and SS energy: 0.631 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -676.774961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.774961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.037863 (E_RNA) where: Base-Base interactions energy: -434.475 where: short stacking energy: -174.004 Base-Backbone interact. energy: -0.790 local terms energy: -241.772769 where: bonds (distance) C4'-P energy: -63.912 bonds (distance) P-C4' energy: -52.454 flat angles C4'-P-C4' energy: -45.610 flat angles P-C4'-P energy: -44.526 tors. eta vs tors. theta energy: -35.272 Dist. restrs. and SS energy: 0.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -1168.430170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1168.430170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1168.625211 (E_RNA) where: Base-Base interactions energy: -834.369 where: short stacking energy: -344.872 Base-Backbone interact. energy: -2.164 local terms energy: -332.092276 where: bonds (distance) C4'-P energy: -59.574 bonds (distance) P-C4' energy: -57.145 flat angles C4'-P-C4' energy: -69.893 flat angles P-C4'-P energy: -53.150 tors. eta vs tors. theta energy: -92.331 Dist. restrs. and SS energy: 0.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -1139.340003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1139.340003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1139.568952 (E_RNA) where: Base-Base interactions energy: -805.916 where: short stacking energy: -333.709 Base-Backbone interact. energy: 4.740 local terms energy: -338.392510 where: bonds (distance) C4'-P energy: -59.005 bonds (distance) P-C4' energy: -68.106 flat angles C4'-P-C4' energy: -69.640 flat angles P-C4'-P energy: -49.711 tors. eta vs tors. theta energy: -91.931 Dist. restrs. and SS energy: 0.229 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -1105.522294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1105.522294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1105.642439 (E_RNA) where: Base-Base interactions energy: -759.713 where: short stacking energy: -323.106 Base-Backbone interact. energy: -2.667 local terms energy: -343.262697 where: bonds (distance) C4'-P energy: -68.685 bonds (distance) P-C4' energy: -63.750 flat angles C4'-P-C4' energy: -71.214 flat angles P-C4'-P energy: -48.181 tors. eta vs tors. theta energy: -91.433 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -1083.298270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.298270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1083.877890 (E_RNA) where: Base-Base interactions energy: -760.097 where: short stacking energy: -304.647 Base-Backbone interact. energy: -2.291 local terms energy: -321.489691 where: bonds (distance) C4'-P energy: -56.034 bonds (distance) P-C4' energy: -58.708 flat angles C4'-P-C4' energy: -73.724 flat angles P-C4'-P energy: -49.829 tors. eta vs tors. theta energy: -83.195 Dist. restrs. and SS energy: 0.580 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -959.136504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.136504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -959.417507 (E_RNA) where: Base-Base interactions energy: -666.474 where: short stacking energy: -288.895 Base-Backbone interact. energy: -2.888 local terms energy: -290.055630 where: bonds (distance) C4'-P energy: -62.350 bonds (distance) P-C4' energy: -55.626 flat angles C4'-P-C4' energy: -68.898 flat angles P-C4'-P energy: -25.674 tors. eta vs tors. theta energy: -77.507 Dist. restrs. and SS energy: 0.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -851.558897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -851.558897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -851.804766 (E_RNA) where: Base-Base interactions energy: -591.868 where: short stacking energy: -240.040 Base-Backbone interact. energy: -2.329 local terms energy: -257.608221 where: bonds (distance) C4'-P energy: -49.855 bonds (distance) P-C4' energy: -48.122 flat angles C4'-P-C4' energy: -50.985 flat angles P-C4'-P energy: -49.406 tors. eta vs tors. theta energy: -59.240 Dist. restrs. and SS energy: 0.246 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -764.075991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -764.075991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -764.402446 (E_RNA) where: Base-Base interactions energy: -498.034 where: short stacking energy: -225.632 Base-Backbone interact. energy: -1.004 local terms energy: -265.364688 where: bonds (distance) C4'-P energy: -54.214 bonds (distance) P-C4' energy: -47.728 flat angles C4'-P-C4' energy: -66.346 flat angles P-C4'-P energy: -39.582 tors. eta vs tors. theta energy: -57.495 Dist. restrs. and SS energy: 0.326 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -799.584510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.584510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.464614 (E_RNA) where: Base-Base interactions energy: -541.825 where: short stacking energy: -236.045 Base-Backbone interact. energy: -0.456 local terms energy: -258.184535 where: bonds (distance) C4'-P energy: -48.635 bonds (distance) P-C4' energy: -51.353 flat angles C4'-P-C4' energy: -60.860 flat angles P-C4'-P energy: -40.463 tors. eta vs tors. theta energy: -56.873 Dist. restrs. and SS energy: 0.880 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -693.581510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.581510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.900389 (E_RNA) where: Base-Base interactions energy: -462.022 where: short stacking energy: -206.900 Base-Backbone interact. energy: -0.920 local terms energy: -230.958343 where: bonds (distance) C4'-P energy: -53.818 bonds (distance) P-C4' energy: -60.575 flat angles C4'-P-C4' energy: -41.292 flat angles P-C4'-P energy: -28.633 tors. eta vs tors. theta energy: -46.640 Dist. restrs. and SS energy: 0.319 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -690.209974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.209974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.531386 (E_RNA) where: Base-Base interactions energy: -460.607 where: short stacking energy: -179.918 Base-Backbone interact. energy: -1.025 local terms energy: -228.899506 where: bonds (distance) C4'-P energy: -58.683 bonds (distance) P-C4' energy: -52.869 flat angles C4'-P-C4' energy: -47.869 flat angles P-C4'-P energy: -39.382 tors. eta vs tors. theta energy: -30.097 Dist. restrs. and SS energy: 0.321 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -1158.077782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1158.077782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1158.203519 (E_RNA) where: Base-Base interactions energy: -798.041 where: short stacking energy: -327.495 Base-Backbone interact. energy: -3.170 local terms energy: -356.991857 where: bonds (distance) C4'-P energy: -67.603 bonds (distance) P-C4' energy: -74.515 flat angles C4'-P-C4' energy: -73.634 flat angles P-C4'-P energy: -48.600 tors. eta vs tors. theta energy: -92.640 Dist. restrs. and SS energy: 0.126 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -1122.381731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1122.381731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1122.674101 (E_RNA) where: Base-Base interactions energy: -785.091 where: short stacking energy: -324.818 Base-Backbone interact. energy: 3.822 local terms energy: -341.405477 where: bonds (distance) C4'-P energy: -63.629 bonds (distance) P-C4' energy: -65.427 flat angles C4'-P-C4' energy: -66.347 flat angles P-C4'-P energy: -55.565 tors. eta vs tors. theta energy: -90.438 Dist. restrs. and SS energy: 0.292 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -1112.574055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1112.574055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1112.761082 (E_RNA) where: Base-Base interactions energy: -771.718 where: short stacking energy: -306.240 Base-Backbone interact. energy: -0.601 local terms energy: -340.441375 where: bonds (distance) C4'-P energy: -59.987 bonds (distance) P-C4' energy: -70.176 flat angles C4'-P-C4' energy: -76.619 flat angles P-C4'-P energy: -47.950 tors. eta vs tors. theta energy: -85.709 Dist. restrs. and SS energy: 0.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -1079.044592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1079.044592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1080.588933 (E_RNA) where: Base-Base interactions energy: -775.374 where: short stacking energy: -311.523 Base-Backbone interact. energy: -2.227 local terms energy: -302.988066 where: bonds (distance) C4'-P energy: -59.590 bonds (distance) P-C4' energy: -59.303 flat angles C4'-P-C4' energy: -65.947 flat angles P-C4'-P energy: -35.182 tors. eta vs tors. theta energy: -82.966 Dist. restrs. and SS energy: 1.544 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -991.427819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -991.427819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -991.720356 (E_RNA) where: Base-Base interactions energy: -685.251 where: short stacking energy: -297.136 Base-Backbone interact. energy: -1.537 local terms energy: -304.931657 where: bonds (distance) C4'-P energy: -52.254 bonds (distance) P-C4' energy: -53.190 flat angles C4'-P-C4' energy: -67.901 flat angles P-C4'-P energy: -47.337 tors. eta vs tors. theta energy: -84.250 Dist. restrs. and SS energy: 0.293 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -858.769529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.769529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.292371 (E_RNA) where: Base-Base interactions energy: -564.211 where: short stacking energy: -234.215 Base-Backbone interact. energy: -2.061 local terms energy: -293.020436 where: bonds (distance) C4'-P energy: -65.437 bonds (distance) P-C4' energy: -62.483 flat angles C4'-P-C4' energy: -65.824 flat angles P-C4'-P energy: -41.382 tors. eta vs tors. theta energy: -57.896 Dist. restrs. and SS energy: 0.523 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -852.846798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -852.846798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.687113 (E_RNA) where: Base-Base interactions energy: -577.460 where: short stacking energy: -258.154 Base-Backbone interact. energy: -0.984 local terms energy: -275.243950 where: bonds (distance) C4'-P energy: -55.518 bonds (distance) P-C4' energy: -52.127 flat angles C4'-P-C4' energy: -61.795 flat angles P-C4'-P energy: -47.489 tors. eta vs tors. theta energy: -58.315 Dist. restrs. and SS energy: 0.840 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -756.224082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.224082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.614403 (E_RNA) where: Base-Base interactions energy: -489.257 where: short stacking energy: -228.257 Base-Backbone interact. energy: -0.998 local terms energy: -266.359672 where: bonds (distance) C4'-P energy: -58.131 bonds (distance) P-C4' energy: -56.893 flat angles C4'-P-C4' energy: -64.643 flat angles P-C4'-P energy: -33.118 tors. eta vs tors. theta energy: -53.574 Dist. restrs. and SS energy: 0.390 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -711.782028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.782028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.558253 (E_RNA) where: Base-Base interactions energy: -477.200 where: short stacking energy: -202.813 Base-Backbone interact. energy: -1.255 local terms energy: -234.103040 where: bonds (distance) C4'-P energy: -63.340 bonds (distance) P-C4' energy: -50.394 flat angles C4'-P-C4' energy: -48.391 flat angles P-C4'-P energy: -33.166 tors. eta vs tors. theta energy: -38.812 Dist. restrs. and SS energy: 0.776 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -669.248974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.248974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.789434 (E_RNA) where: Base-Base interactions energy: -451.642 where: short stacking energy: -191.468 Base-Backbone interact. energy: 1.468 local terms energy: -219.615358 where: bonds (distance) C4'-P energy: -55.042 bonds (distance) P-C4' energy: -54.246 flat angles C4'-P-C4' energy: -46.001 flat angles P-C4'-P energy: -31.701 tors. eta vs tors. theta energy: -32.626 Dist. restrs. and SS energy: 0.540 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -1158.845309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1158.845309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1159.083495 (E_RNA) where: Base-Base interactions energy: -812.884 where: short stacking energy: -337.944 Base-Backbone interact. energy: -1.616 local terms energy: -344.582758 where: bonds (distance) C4'-P energy: -63.886 bonds (distance) P-C4' energy: -63.915 flat angles C4'-P-C4' energy: -76.890 flat angles P-C4'-P energy: -44.775 tors. eta vs tors. theta energy: -95.117 Dist. restrs. and SS energy: 0.238 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -1134.337128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.337128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1134.536114 (E_RNA) where: Base-Base interactions energy: -803.743 where: short stacking energy: -318.019 Base-Backbone interact. energy: -1.289 local terms energy: -329.504640 where: bonds (distance) C4'-P energy: -61.397 bonds (distance) P-C4' energy: -64.626 flat angles C4'-P-C4' energy: -68.375 flat angles P-C4'-P energy: -50.717 tors. eta vs tors. theta energy: -84.391 Dist. restrs. and SS energy: 0.199 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -1097.324465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1097.324465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1097.324465 (E_RNA) where: Base-Base interactions energy: -771.646 where: short stacking energy: -322.712 Base-Backbone interact. energy: -0.740 local terms energy: -324.939336 where: bonds (distance) C4'-P energy: -57.307 bonds (distance) P-C4' energy: -60.769 flat angles C4'-P-C4' energy: -70.557 flat angles P-C4'-P energy: -44.540 tors. eta vs tors. theta energy: -91.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -1069.094829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.094829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1070.818235 (E_RNA) where: Base-Base interactions energy: -765.133 where: short stacking energy: -296.922 Base-Backbone interact. energy: -1.194 local terms energy: -304.490971 where: bonds (distance) C4'-P energy: -49.836 bonds (distance) P-C4' energy: -58.061 flat angles C4'-P-C4' energy: -71.500 flat angles P-C4'-P energy: -42.887 tors. eta vs tors. theta energy: -82.207 Dist. restrs. and SS energy: 1.723 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -1003.951912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1003.951912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1004.428446 (E_RNA) where: Base-Base interactions energy: -695.615 where: short stacking energy: -320.695 Base-Backbone interact. energy: -1.157 local terms energy: -307.656196 where: bonds (distance) C4'-P energy: -48.696 bonds (distance) P-C4' energy: -53.322 flat angles C4'-P-C4' energy: -70.097 flat angles P-C4'-P energy: -37.571 tors. eta vs tors. theta energy: -97.970 Dist. restrs. and SS energy: 0.477 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -839.760987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -839.760987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -840.582116 (E_RNA) where: Base-Base interactions energy: -571.186 where: short stacking energy: -229.102 Base-Backbone interact. energy: -1.954 local terms energy: -267.442769 where: bonds (distance) C4'-P energy: -54.327 bonds (distance) P-C4' energy: -54.698 flat angles C4'-P-C4' energy: -56.105 flat angles P-C4'-P energy: -37.704 tors. eta vs tors. theta energy: -64.608 Dist. restrs. and SS energy: 0.821 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -864.143807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -864.143807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -864.536850 (E_RNA) where: Base-Base interactions energy: -578.155 where: short stacking energy: -241.885 Base-Backbone interact. energy: -1.265 local terms energy: -285.117007 where: bonds (distance) C4'-P energy: -54.018 bonds (distance) P-C4' energy: -56.028 flat angles C4'-P-C4' energy: -61.724 flat angles P-C4'-P energy: -47.739 tors. eta vs tors. theta energy: -65.608 Dist. restrs. and SS energy: 0.393 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -765.431158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.431158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.002000 (E_RNA) where: Base-Base interactions energy: -503.605 where: short stacking energy: -215.712 Base-Backbone interact. energy: 2.010 local terms energy: -264.407418 where: bonds (distance) C4'-P energy: -56.612 bonds (distance) P-C4' energy: -56.135 flat angles C4'-P-C4' energy: -61.015 flat angles P-C4'-P energy: -51.032 tors. eta vs tors. theta energy: -39.613 Dist. restrs. and SS energy: 0.571 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -698.521614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.521614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.119465 (E_RNA) where: Base-Base interactions energy: -459.479 where: short stacking energy: -184.197 Base-Backbone interact. energy: -0.208 local terms energy: -239.432513 where: bonds (distance) C4'-P energy: -53.387 bonds (distance) P-C4' energy: -59.392 flat angles C4'-P-C4' energy: -51.864 flat angles P-C4'-P energy: -35.861 tors. eta vs tors. theta energy: -38.929 Dist. restrs. and SS energy: 0.598 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -653.777361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.777361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.240568 (E_RNA) where: Base-Base interactions energy: -432.118 where: short stacking energy: -181.166 Base-Backbone interact. energy: -0.623 local terms energy: -221.499813 where: bonds (distance) C4'-P energy: -48.021 bonds (distance) P-C4' energy: -59.160 flat angles C4'-P-C4' energy: -40.118 flat angles P-C4'-P energy: -38.725 tors. eta vs tors. theta energy: -35.475 Dist. restrs. and SS energy: 0.463 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -1181.482299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1181.482299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1181.806563 (E_RNA) where: Base-Base interactions energy: -845.284 where: short stacking energy: -343.827 Base-Backbone interact. energy: -1.898 local terms energy: -334.624590 where: bonds (distance) C4'-P energy: -66.131 bonds (distance) P-C4' energy: -51.274 flat angles C4'-P-C4' energy: -71.364 flat angles P-C4'-P energy: -51.319 tors. eta vs tors. theta energy: -94.537 Dist. restrs. and SS energy: 0.324 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -1140.885875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1140.885875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1141.049803 (E_RNA) where: Base-Base interactions energy: -804.285 where: short stacking energy: -336.146 Base-Backbone interact. energy: -1.486 local terms energy: -335.279376 where: bonds (distance) C4'-P energy: -58.134 bonds (distance) P-C4' energy: -66.937 flat angles C4'-P-C4' energy: -71.271 flat angles P-C4'-P energy: -52.241 tors. eta vs tors. theta energy: -86.697 Dist. restrs. and SS energy: 0.164 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -1086.072095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.072095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1086.334499 (E_RNA) where: Base-Base interactions energy: -769.800 where: short stacking energy: -311.395 Base-Backbone interact. energy: 0.986 local terms energy: -317.521023 where: bonds (distance) C4'-P energy: -65.903 bonds (distance) P-C4' energy: -51.028 flat angles C4'-P-C4' energy: -72.971 flat angles P-C4'-P energy: -43.794 tors. eta vs tors. theta energy: -83.824 Dist. restrs. and SS energy: 0.262 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -1086.597411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.597411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1086.866790 (E_RNA) where: Base-Base interactions energy: -752.552 where: short stacking energy: -321.950 Base-Backbone interact. energy: -1.146 local terms energy: -333.168969 where: bonds (distance) C4'-P energy: -61.228 bonds (distance) P-C4' energy: -67.776 flat angles C4'-P-C4' energy: -68.078 flat angles P-C4'-P energy: -46.950 tors. eta vs tors. theta energy: -89.138 Dist. restrs. and SS energy: 0.269 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -999.665742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.665742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.050291 (E_RNA) where: Base-Base interactions energy: -681.701 where: short stacking energy: -306.677 Base-Backbone interact. energy: -2.147 local terms energy: -316.202223 where: bonds (distance) C4'-P energy: -67.958 bonds (distance) P-C4' energy: -54.683 flat angles C4'-P-C4' energy: -64.901 flat angles P-C4'-P energy: -43.268 tors. eta vs tors. theta energy: -85.393 Dist. restrs. and SS energy: 0.385 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -867.075857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -867.075857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.507363 (E_RNA) where: Base-Base interactions energy: -587.490 where: short stacking energy: -248.945 Base-Backbone interact. energy: 0.090 local terms energy: -280.107409 where: bonds (distance) C4'-P energy: -55.540 bonds (distance) P-C4' energy: -55.424 flat angles C4'-P-C4' energy: -65.305 flat angles P-C4'-P energy: -45.762 tors. eta vs tors. theta energy: -58.075 Dist. restrs. and SS energy: 0.432 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -842.409630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -842.409630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -842.626702 (E_RNA) where: Base-Base interactions energy: -576.455 where: short stacking energy: -222.380 Base-Backbone interact. energy: -0.161 local terms energy: -266.010598 where: bonds (distance) C4'-P energy: -45.460 bonds (distance) P-C4' energy: -61.628 flat angles C4'-P-C4' energy: -64.816 flat angles P-C4'-P energy: -40.553 tors. eta vs tors. theta energy: -53.553 Dist. restrs. and SS energy: 0.217 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -764.229755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -764.229755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -764.740302 (E_RNA) where: Base-Base interactions energy: -495.641 where: short stacking energy: -218.468 Base-Backbone interact. energy: -1.725 local terms energy: -267.374448 where: bonds (distance) C4'-P energy: -55.910 bonds (distance) P-C4' energy: -60.925 flat angles C4'-P-C4' energy: -54.718 flat angles P-C4'-P energy: -41.049 tors. eta vs tors. theta energy: -54.772 Dist. restrs. and SS energy: 0.511 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -702.094943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.094943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.980720 (E_RNA) where: Base-Base interactions energy: -481.473 where: short stacking energy: -202.196 Base-Backbone interact. energy: -1.190 local terms energy: -220.318154 where: bonds (distance) C4'-P energy: -44.890 bonds (distance) P-C4' energy: -49.520 flat angles C4'-P-C4' energy: -52.386 flat angles P-C4'-P energy: -34.715 tors. eta vs tors. theta energy: -38.806 Dist. restrs. and SS energy: 0.886 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -676.792175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.792175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.463934 (E_RNA) where: Base-Base interactions energy: -428.748 where: short stacking energy: -184.941 Base-Backbone interact. energy: 2.905 local terms energy: -251.621660 where: bonds (distance) C4'-P energy: -54.176 bonds (distance) P-C4' energy: -57.869 flat angles C4'-P-C4' energy: -49.365 flat angles P-C4'-P energy: -47.085 tors. eta vs tors. theta energy: -43.127 Dist. restrs. and SS energy: 0.672 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -1165.368019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1165.368019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1165.507556 (E_RNA) where: Base-Base interactions energy: -836.942 where: short stacking energy: -318.497 Base-Backbone interact. energy: -2.111 local terms energy: -326.454769 where: bonds (distance) C4'-P energy: -68.614 bonds (distance) P-C4' energy: -60.775 flat angles C4'-P-C4' energy: -75.425 flat angles P-C4'-P energy: -35.472 tors. eta vs tors. theta energy: -86.169 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -1157.210503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1157.210503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1157.671619 (E_RNA) where: Base-Base interactions energy: -818.332 where: short stacking energy: -339.884 Base-Backbone interact. energy: -3.564 local terms energy: -335.776061 where: bonds (distance) C4'-P energy: -61.100 bonds (distance) P-C4' energy: -58.311 flat angles C4'-P-C4' energy: -78.439 flat angles P-C4'-P energy: -49.608 tors. eta vs tors. theta energy: -88.318 Dist. restrs. and SS energy: 0.461 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -1087.261975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.261975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1087.836270 (E_RNA) where: Base-Base interactions energy: -763.088 where: short stacking energy: -307.619 Base-Backbone interact. energy: -2.789 local terms energy: -321.959191 where: bonds (distance) C4'-P energy: -66.122 bonds (distance) P-C4' energy: -68.999 flat angles C4'-P-C4' energy: -60.563 flat angles P-C4'-P energy: -45.152 tors. eta vs tors. theta energy: -81.123 Dist. restrs. and SS energy: 0.574 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -1070.485706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1070.485706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1070.763113 (E_RNA) where: Base-Base interactions energy: -757.189 where: short stacking energy: -311.614 Base-Backbone interact. energy: -0.916 local terms energy: -312.658306 where: bonds (distance) C4'-P energy: -59.506 bonds (distance) P-C4' energy: -54.744 flat angles C4'-P-C4' energy: -69.495 flat angles P-C4'-P energy: -39.576 tors. eta vs tors. theta energy: -89.338 Dist. restrs. and SS energy: 0.277 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -961.534384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -961.534384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.072563 (E_RNA) where: Base-Base interactions energy: -679.624 where: short stacking energy: -285.913 Base-Backbone interact. energy: -2.129 local terms energy: -280.320270 where: bonds (distance) C4'-P energy: -52.300 bonds (distance) P-C4' energy: -51.361 flat angles C4'-P-C4' energy: -61.208 flat angles P-C4'-P energy: -39.466 tors. eta vs tors. theta energy: -75.984 Dist. restrs. and SS energy: 0.538 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -877.623732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.623732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -877.970563 (E_RNA) where: Base-Base interactions energy: -603.112 where: short stacking energy: -257.887 Base-Backbone interact. energy: -3.174 local terms energy: -271.684528 where: bonds (distance) C4'-P energy: -48.847 bonds (distance) P-C4' energy: -57.707 flat angles C4'-P-C4' energy: -61.905 flat angles P-C4'-P energy: -41.600 tors. eta vs tors. theta energy: -61.626 Dist. restrs. and SS energy: 0.347 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -848.196474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.196474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.012330 (E_RNA) where: Base-Base interactions energy: -576.021 where: short stacking energy: -242.297 Base-Backbone interact. energy: 2.529 local terms energy: -275.521018 where: bonds (distance) C4'-P energy: -51.123 bonds (distance) P-C4' energy: -58.047 flat angles C4'-P-C4' energy: -58.065 flat angles P-C4'-P energy: -47.574 tors. eta vs tors. theta energy: -60.712 Dist. restrs. and SS energy: 0.816 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -750.929858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.929858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.398326 (E_RNA) where: Base-Base interactions energy: -494.922 where: short stacking energy: -217.682 Base-Backbone interact. energy: 0.510 local terms energy: -256.986675 where: bonds (distance) C4'-P energy: -54.209 bonds (distance) P-C4' energy: -54.083 flat angles C4'-P-C4' energy: -53.259 flat angles P-C4'-P energy: -42.695 tors. eta vs tors. theta energy: -52.740 Dist. restrs. and SS energy: 0.468 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -701.685115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.685115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.005253 (E_RNA) where: Base-Base interactions energy: -445.113 where: short stacking energy: -199.388 Base-Backbone interact. energy: -2.845 local terms energy: -254.046656 where: bonds (distance) C4'-P energy: -61.785 bonds (distance) P-C4' energy: -49.486 flat angles C4'-P-C4' energy: -64.959 flat angles P-C4'-P energy: -40.721 tors. eta vs tors. theta energy: -37.096 Dist. restrs. and SS energy: 0.320 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -663.702932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.702932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.257442 (E_RNA) where: Base-Base interactions energy: -434.220 where: short stacking energy: -170.892 Base-Backbone interact. energy: -1.226 local terms energy: -228.811353 where: bonds (distance) C4'-P energy: -60.372 bonds (distance) P-C4' energy: -62.366 flat angles C4'-P-C4' energy: -50.233 flat angles P-C4'-P energy: -26.000 tors. eta vs tors. theta energy: -29.841 Dist. restrs. and SS energy: 0.555 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -1163.112210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1163.112210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1163.361609 (E_RNA) where: Base-Base interactions energy: -823.318 where: short stacking energy: -335.357 Base-Backbone interact. energy: -2.236 local terms energy: -337.807420 where: bonds (distance) C4'-P energy: -71.340 bonds (distance) P-C4' energy: -64.533 flat angles C4'-P-C4' energy: -69.450 flat angles P-C4'-P energy: -52.429 tors. eta vs tors. theta energy: -80.056 Dist. restrs. and SS energy: 0.249 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -1136.767862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1136.767862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1137.074966 (E_RNA) where: Base-Base interactions energy: -808.964 where: short stacking energy: -354.185 Base-Backbone interact. energy: -0.351 local terms energy: -327.759289 where: bonds (distance) C4'-P energy: -62.801 bonds (distance) P-C4' energy: -57.227 flat angles C4'-P-C4' energy: -71.511 flat angles P-C4'-P energy: -39.228 tors. eta vs tors. theta energy: -96.992 Dist. restrs. and SS energy: 0.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -1100.996867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1100.996867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1101.242054 (E_RNA) where: Base-Base interactions energy: -768.770 where: short stacking energy: -325.723 Base-Backbone interact. energy: -0.124 local terms energy: -332.348499 where: bonds (distance) C4'-P energy: -60.933 bonds (distance) P-C4' energy: -66.079 flat angles C4'-P-C4' energy: -67.962 flat angles P-C4'-P energy: -46.794 tors. eta vs tors. theta energy: -90.581 Dist. restrs. and SS energy: 0.245 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -1057.102573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.102573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1057.990398 (E_RNA) where: Base-Base interactions energy: -739.843 where: short stacking energy: -299.410 Base-Backbone interact. energy: -0.450 local terms energy: -317.696995 where: bonds (distance) C4'-P energy: -64.914 bonds (distance) P-C4' energy: -46.203 flat angles C4'-P-C4' energy: -62.660 flat angles P-C4'-P energy: -59.286 tors. eta vs tors. theta energy: -84.634 Dist. restrs. and SS energy: 0.888 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -949.220713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -949.220713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.705198 (E_RNA) where: Base-Base interactions energy: -652.425 where: short stacking energy: -268.880 Base-Backbone interact. energy: 1.474 local terms energy: -298.754459 where: bonds (distance) C4'-P energy: -52.237 bonds (distance) P-C4' energy: -67.028 flat angles C4'-P-C4' energy: -56.339 flat angles P-C4'-P energy: -48.236 tors. eta vs tors. theta energy: -74.915 Dist. restrs. and SS energy: 0.484 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -907.127892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.127892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.585712 (E_RNA) where: Base-Base interactions energy: -598.245 where: short stacking energy: -264.583 Base-Backbone interact. energy: 0.036 local terms energy: -309.376280 where: bonds (distance) C4'-P energy: -62.820 bonds (distance) P-C4' energy: -56.281 flat angles C4'-P-C4' energy: -73.024 flat angles P-C4'-P energy: -48.436 tors. eta vs tors. theta energy: -68.816 Dist. restrs. and SS energy: 0.458 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -846.395828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.395828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -847.097112 (E_RNA) where: Base-Base interactions energy: -582.541 where: short stacking energy: -251.439 Base-Backbone interact. energy: -1.157 local terms energy: -263.398773 where: bonds (distance) C4'-P energy: -52.224 bonds (distance) P-C4' energy: -54.674 flat angles C4'-P-C4' energy: -59.290 flat angles P-C4'-P energy: -41.428 tors. eta vs tors. theta energy: -55.784 Dist. restrs. and SS energy: 0.701 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -738.943995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.943995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.275678 (E_RNA) where: Base-Base interactions energy: -489.039 where: short stacking energy: -217.420 Base-Backbone interact. energy: -1.640 local terms energy: -249.596335 where: bonds (distance) C4'-P energy: -48.877 bonds (distance) P-C4' energy: -53.618 flat angles C4'-P-C4' energy: -65.075 flat angles P-C4'-P energy: -42.178 tors. eta vs tors. theta energy: -39.849 Dist. restrs. and SS energy: 1.332 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -722.111313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.111313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.655040 (E_RNA) where: Base-Base interactions energy: -467.590 where: short stacking energy: -211.702 Base-Backbone interact. energy: -3.167 local terms energy: -252.897367 where: bonds (distance) C4'-P energy: -64.200 bonds (distance) P-C4' energy: -50.702 flat angles C4'-P-C4' energy: -57.126 flat angles P-C4'-P energy: -38.567 tors. eta vs tors. theta energy: -42.303 Dist. restrs. and SS energy: 1.544 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -666.721442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.721442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.149627 (E_RNA) where: Base-Base interactions energy: -427.906 where: short stacking energy: -177.198 Base-Backbone interact. energy: -0.984 local terms energy: -238.259718 where: bonds (distance) C4'-P energy: -60.708 bonds (distance) P-C4' energy: -51.526 flat angles C4'-P-C4' energy: -56.963 flat angles P-C4'-P energy: -26.589 tors. eta vs tors. theta energy: -42.474 Dist. restrs. and SS energy: 0.428 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -1168.889306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1168.889306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1169.445826 (E_RNA) where: Base-Base interactions energy: -812.270 where: short stacking energy: -332.929 Base-Backbone interact. energy: -1.417 local terms energy: -355.758925 where: bonds (distance) C4'-P energy: -71.935 bonds (distance) P-C4' energy: -66.340 flat angles C4'-P-C4' energy: -80.295 flat angles P-C4'-P energy: -46.455 tors. eta vs tors. theta energy: -90.734 Dist. restrs. and SS energy: 0.557 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -1140.682109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1140.682109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1140.992697 (E_RNA) where: Base-Base interactions energy: -790.922 where: short stacking energy: -324.730 Base-Backbone interact. energy: 0.219 local terms energy: -350.289047 where: bonds (distance) C4'-P energy: -68.587 bonds (distance) P-C4' energy: -64.308 flat angles C4'-P-C4' energy: -72.904 flat angles P-C4'-P energy: -49.302 tors. eta vs tors. theta energy: -95.187 Dist. restrs. and SS energy: 0.311 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -1109.984885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1109.984885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1110.257155 (E_RNA) where: Base-Base interactions energy: -777.915 where: short stacking energy: -315.703 Base-Backbone interact. energy: -3.339 local terms energy: -329.003621 where: bonds (distance) C4'-P energy: -61.264 bonds (distance) P-C4' energy: -59.149 flat angles C4'-P-C4' energy: -68.680 flat angles P-C4'-P energy: -50.805 tors. eta vs tors. theta energy: -89.105 Dist. restrs. and SS energy: 0.272 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -1051.397950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.397950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1051.815616 (E_RNA) where: Base-Base interactions energy: -747.806 where: short stacking energy: -324.512 Base-Backbone interact. energy: -1.258 local terms energy: -302.752161 where: bonds (distance) C4'-P energy: -60.697 bonds (distance) P-C4' energy: -58.280 flat angles C4'-P-C4' energy: -61.348 flat angles P-C4'-P energy: -45.529 tors. eta vs tors. theta energy: -76.898 Dist. restrs. and SS energy: 0.418 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -975.766644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.766644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -976.062627 (E_RNA) where: Base-Base interactions energy: -675.286 where: short stacking energy: -284.100 Base-Backbone interact. energy: -0.792 local terms energy: -299.984707 where: bonds (distance) C4'-P energy: -58.551 bonds (distance) P-C4' energy: -58.687 flat angles C4'-P-C4' energy: -62.296 flat angles P-C4'-P energy: -43.171 tors. eta vs tors. theta energy: -77.279 Dist. restrs. and SS energy: 0.296 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -907.494170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.494170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.688976 (E_RNA) where: Base-Base interactions energy: -611.169 where: short stacking energy: -262.988 Base-Backbone interact. energy: -1.962 local terms energy: -294.557885 where: bonds (distance) C4'-P energy: -54.356 bonds (distance) P-C4' energy: -56.982 flat angles C4'-P-C4' energy: -68.465 flat angles P-C4'-P energy: -38.452 tors. eta vs tors. theta energy: -76.303 Dist. restrs. and SS energy: 0.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -871.664187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.664187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.882222 (E_RNA) where: Base-Base interactions energy: -563.588 where: short stacking energy: -259.914 Base-Backbone interact. energy: 1.283 local terms energy: -309.577409 where: bonds (distance) C4'-P energy: -62.733 bonds (distance) P-C4' energy: -66.651 flat angles C4'-P-C4' energy: -69.721 flat angles P-C4'-P energy: -44.806 tors. eta vs tors. theta energy: -65.666 Dist. restrs. and SS energy: 0.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -729.754099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.754099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.266733 (E_RNA) where: Base-Base interactions energy: -482.438 where: short stacking energy: -212.433 Base-Backbone interact. energy: 4.008 local terms energy: -251.836820 where: bonds (distance) C4'-P energy: -40.455 bonds (distance) P-C4' energy: -59.017 flat angles C4'-P-C4' energy: -57.285 flat angles P-C4'-P energy: -41.918 tors. eta vs tors. theta energy: -53.161 Dist. restrs. and SS energy: 0.513 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -729.622855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.622855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.152662 (E_RNA) where: Base-Base interactions energy: -478.034 where: short stacking energy: -218.974 Base-Backbone interact. energy: -1.556 local terms energy: -250.562433 where: bonds (distance) C4'-P energy: -42.206 bonds (distance) P-C4' energy: -61.473 flat angles C4'-P-C4' energy: -55.727 flat angles P-C4'-P energy: -38.228 tors. eta vs tors. theta energy: -52.928 Dist. restrs. and SS energy: 0.530 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -664.276862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.276862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.447796 (E_RNA) where: Base-Base interactions energy: -427.931 where: short stacking energy: -187.812 Base-Backbone interact. energy: 2.306 local terms energy: -239.822419 where: bonds (distance) C4'-P energy: -58.009 bonds (distance) P-C4' energy: -52.582 flat angles C4'-P-C4' energy: -58.337 flat angles P-C4'-P energy: -32.438 tors. eta vs tors. theta energy: -38.456 Dist. restrs. and SS energy: 1.171 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 4 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 10939180 moves confirmed later: 12153677 all moves confirmed: 23092857 percent of confirmed moves: 14.433036 current total energy: -1073.756327 recalc. total energy: -1073.756327 replica 8 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 12434228 moves confirmed later: 14238771 all moves confirmed: 26672999 percent of confirmed moves: 16.670624 current total energy: -1076.764968 recalc. total energy: -1076.764968 replica 10 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 11942821 moves confirmed later: 13545977 all moves confirmed: 25488798 percent of confirmed moves: 15.930499 current total energy: -1025.893614 recalc. total energy: -1025.893614 replica 3 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 10240143 moves confirmed later: 11238187 all moves confirmed: 21478330 percent of confirmed moves: 13.423956 current total energy: -988.368623 recalc. total energy: -988.368623 replica 2 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 11205549 moves confirmed later: 12523507 all moves confirmed: 23729056 percent of confirmed moves: 14.830660 current total energy: -886.137149 recalc. total energy: -886.137149 replica 5 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 11464474 moves confirmed later: 12868722 all moves confirmed: 24333196 percent of confirmed moves: 15.208248 current total energy: -789.177644 recalc. total energy: -789.177644 replica 6 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 16290241 moves confirmed later: 19369196 all moves confirmed: 35659437 percent of confirmed moves: 22.287148 current total energy: -755.431092 recalc. total energy: -755.431092 replica 9 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 13980847 moves confirmed later: 16272830 all moves confirmed: 30253677 percent of confirmed moves: 18.908548 current total energy: -611.395207 recalc. total energy: -611.395207 replica 1 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 16480044 moves confirmed later: 19565300 all moves confirmed: 36045344 percent of confirmed moves: 22.528340 current total energy: -636.478047 recalc. total energy: -636.478047 replica 7 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 16401973 moves confirmed later: 19578100 all moves confirmed: 35980073 percent of confirmed moves: 22.487546 current total energy: -575.446251 recalc. total energy: -575.446251 out arg RESULTS//1/test-55316fe3_01 Time of doing 1600000 iterations: 3905.887 seconds