SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa: 1 curr_seq: _GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa: 1 curr_seq: _GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa: 1 curr_seq: _GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa: 1 curr_seq: _GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa: 1 curr_seq: _GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa: 1 curr_seq: _GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa: 1 curr_seq: _GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa: 1 curr_seq: _GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa: 1 curr_seq: _GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/tPro-ACC-e5b14629/inputs/seq.fa: 1 curr_seq: _GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUACCGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCCACCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -315.707431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.707431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.707431 (E_RNA) where: Base-Base interactions energy: -15.731 where: short stacking energy: -15.731 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -315.707431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.707431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.707431 (E_RNA) where: Base-Base interactions energy: -15.731 where: short stacking energy: -15.731 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -315.707431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.707431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.707431 (E_RNA) where: Base-Base interactions energy: -15.731 where: short stacking energy: -15.731 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -315.707431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.707431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.707431 (E_RNA) where: Base-Base interactions energy: -15.731 where: short stacking energy: -15.731 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -315.707431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.707431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.707431 (E_RNA) where: Base-Base interactions energy: -15.731 where: short stacking energy: -15.731 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -315.707431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.707431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.707431 (E_RNA) where: Base-Base interactions energy: -15.731 where: short stacking energy: -15.731 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -315.707431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.707431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.707431 (E_RNA) where: Base-Base interactions energy: -15.731 where: short stacking energy: -15.731 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -315.707431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.707431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.707431 (E_RNA) where: Base-Base interactions energy: -15.731 where: short stacking energy: -15.731 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -315.707431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.707431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.707431 (E_RNA) where: Base-Base interactions energy: -15.731 where: short stacking energy: -15.731 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -315.707431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.707431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.707431 (E_RNA) where: Base-Base interactions energy: -15.731 where: short stacking energy: -15.731 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -454.617586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.617586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.617586 (E_RNA) where: Base-Base interactions energy: -209.577 where: short stacking energy: -209.577 Base-Backbone interact. energy: -0.121 local terms energy: -244.920133 where: bonds (distance) C4'-P energy: -50.609 bonds (distance) P-C4' energy: -52.916 flat angles C4'-P-C4' energy: -52.462 flat angles P-C4'-P energy: -32.972 tors. eta vs tors. theta energy: -55.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -420.746740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.746740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.746740 (E_RNA) where: Base-Base interactions energy: -197.065 where: short stacking energy: -195.725 Base-Backbone interact. energy: -0.323 local terms energy: -223.358273 where: bonds (distance) C4'-P energy: -51.516 bonds (distance) P-C4' energy: -45.024 flat angles C4'-P-C4' energy: -50.558 flat angles P-C4'-P energy: -35.873 tors. eta vs tors. theta energy: -40.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -399.056684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.056684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.056684 (E_RNA) where: Base-Base interactions energy: -179.986 where: short stacking energy: -177.391 Base-Backbone interact. energy: -0.170 local terms energy: -218.900313 where: bonds (distance) C4'-P energy: -44.302 bonds (distance) P-C4' energy: -49.105 flat angles C4'-P-C4' energy: -54.759 flat angles P-C4'-P energy: -29.924 tors. eta vs tors. theta energy: -40.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -355.362539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.362539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.362539 (E_RNA) where: Base-Base interactions energy: -152.315 where: short stacking energy: -130.697 Base-Backbone interact. energy: 1.474 local terms energy: -204.521600 where: bonds (distance) C4'-P energy: -49.507 bonds (distance) P-C4' energy: -52.716 flat angles C4'-P-C4' energy: -47.336 flat angles P-C4'-P energy: -31.858 tors. eta vs tors. theta energy: -23.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -362.199700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.199700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.199700 (E_RNA) where: Base-Base interactions energy: -171.540 where: short stacking energy: -147.768 Base-Backbone interact. energy: 0.562 local terms energy: -191.221906 where: bonds (distance) C4'-P energy: -47.826 bonds (distance) P-C4' energy: -36.088 flat angles C4'-P-C4' energy: -50.466 flat angles P-C4'-P energy: -29.138 tors. eta vs tors. theta energy: -27.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -316.127713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.127713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.127713 (E_RNA) where: Base-Base interactions energy: -21.238 where: short stacking energy: -21.238 Base-Backbone interact. energy: -0.000 local terms energy: -294.889259 where: bonds (distance) C4'-P energy: -74.116 bonds (distance) P-C4' energy: -67.250 flat angles C4'-P-C4' energy: -55.276 flat angles P-C4'-P energy: -63.880 tors. eta vs tors. theta energy: -34.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -316.433127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.433127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.433127 (E_RNA) where: Base-Base interactions energy: -20.598 where: short stacking energy: -20.598 Base-Backbone interact. energy: -0.000 local terms energy: -295.835194 where: bonds (distance) C4'-P energy: -74.348 bonds (distance) P-C4' energy: -67.511 flat angles C4'-P-C4' energy: -55.738 flat angles P-C4'-P energy: -64.107 tors. eta vs tors. theta energy: -34.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -315.280929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.280929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.280929 (E_RNA) where: Base-Base interactions energy: -16.464 where: short stacking energy: -16.464 Base-Backbone interact. energy: -0.000 local terms energy: -298.816827 where: bonds (distance) C4'-P energy: -74.580 bonds (distance) P-C4' energy: -69.769 flat angles C4'-P-C4' energy: -55.654 flat angles P-C4'-P energy: -64.511 tors. eta vs tors. theta energy: -34.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -315.259807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.259807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.259807 (E_RNA) where: Base-Base interactions energy: -16.463 where: short stacking energy: -16.463 Base-Backbone interact. energy: -0.000 local terms energy: -298.796245 where: bonds (distance) C4'-P energy: -74.580 bonds (distance) P-C4' energy: -69.769 flat angles C4'-P-C4' energy: -55.654 flat angles P-C4'-P energy: -64.511 tors. eta vs tors. theta energy: -34.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -315.280636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.280636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.280636 (E_RNA) where: Base-Base interactions energy: -16.256 where: short stacking energy: -16.256 Base-Backbone interact. energy: -0.000 local terms energy: -299.024679 where: bonds (distance) C4'-P energy: -74.580 bonds (distance) P-C4' energy: -69.773 flat angles C4'-P-C4' energy: -55.755 flat angles P-C4'-P energy: -64.511 tors. eta vs tors. theta energy: -34.406 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -484.778473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.778473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.778473 (E_RNA) where: Base-Base interactions energy: -245.891 where: short stacking energy: -212.603 Base-Backbone interact. energy: -0.247 local terms energy: -238.639591 where: bonds (distance) C4'-P energy: -44.873 bonds (distance) P-C4' energy: -49.009 flat angles C4'-P-C4' energy: -55.842 flat angles P-C4'-P energy: -31.819 tors. eta vs tors. theta energy: -57.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -452.390912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.390912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.390912 (E_RNA) where: Base-Base interactions energy: -213.130 where: short stacking energy: -177.361 Base-Backbone interact. energy: -0.197 local terms energy: -239.063831 where: bonds (distance) C4'-P energy: -56.321 bonds (distance) P-C4' energy: -53.121 flat angles C4'-P-C4' energy: -50.241 flat angles P-C4'-P energy: -36.563 tors. eta vs tors. theta energy: -42.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -415.963321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.963321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.963321 (E_RNA) where: Base-Base interactions energy: -212.768 where: short stacking energy: -149.626 Base-Backbone interact. energy: -0.500 local terms energy: -202.695743 where: bonds (distance) C4'-P energy: -54.143 bonds (distance) P-C4' energy: -46.389 flat angles C4'-P-C4' energy: -41.769 flat angles P-C4'-P energy: -36.659 tors. eta vs tors. theta energy: -23.737 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -404.749179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.749179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.749179 (E_RNA) where: Base-Base interactions energy: -203.785 where: short stacking energy: -161.312 Base-Backbone interact. energy: -0.876 local terms energy: -200.088295 where: bonds (distance) C4'-P energy: -50.571 bonds (distance) P-C4' energy: -35.440 flat angles C4'-P-C4' energy: -49.933 flat angles P-C4'-P energy: -31.526 tors. eta vs tors. theta energy: -32.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -388.094881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.094881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.094881 (E_RNA) where: Base-Base interactions energy: -216.170 where: short stacking energy: -118.584 Base-Backbone interact. energy: -1.542 local terms energy: -170.382496 where: bonds (distance) C4'-P energy: -41.055 bonds (distance) P-C4' energy: -47.714 flat angles C4'-P-C4' energy: -41.623 flat angles P-C4'-P energy: -28.712 tors. eta vs tors. theta energy: -11.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -370.794292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.794292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.794292 (E_RNA) where: Base-Base interactions energy: -196.987 where: short stacking energy: -104.307 Base-Backbone interact. energy: -0.716 local terms energy: -173.090897 where: bonds (distance) C4'-P energy: -41.780 bonds (distance) P-C4' energy: -46.748 flat angles C4'-P-C4' energy: -38.632 flat angles P-C4'-P energy: -30.516 tors. eta vs tors. theta energy: -15.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -313.984987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.984987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.984987 (E_RNA) where: Base-Base interactions energy: -138.640 where: short stacking energy: -109.554 Base-Backbone interact. energy: -1.566 local terms energy: -173.779310 where: bonds (distance) C4'-P energy: -47.490 bonds (distance) P-C4' energy: -50.415 flat angles C4'-P-C4' energy: -33.504 flat angles P-C4'-P energy: -28.491 tors. eta vs tors. theta energy: -13.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -281.807495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.807495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.807495 (E_RNA) where: Base-Base interactions energy: -146.364 where: short stacking energy: -78.999 Base-Backbone interact. energy: -0.552 local terms energy: -134.891188 where: bonds (distance) C4'-P energy: -41.184 bonds (distance) P-C4' energy: -41.681 flat angles C4'-P-C4' energy: -33.939 flat angles P-C4'-P energy: -16.498 tors. eta vs tors. theta energy: -1.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -306.463298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.463298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.463298 (E_RNA) where: Base-Base interactions energy: -148.980 where: short stacking energy: -103.586 Base-Backbone interact. energy: -0.969 local terms energy: -156.514483 where: bonds (distance) C4'-P energy: -38.511 bonds (distance) P-C4' energy: -43.920 flat angles C4'-P-C4' energy: -30.237 flat angles P-C4'-P energy: -29.393 tors. eta vs tors. theta energy: -14.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -221.210240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.210240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.210240 (E_RNA) where: Base-Base interactions energy: -81.823 where: short stacking energy: -78.129 Base-Backbone interact. energy: -2.813 local terms energy: -136.574203 where: bonds (distance) C4'-P energy: -50.938 bonds (distance) P-C4' energy: -27.291 flat angles C4'-P-C4' energy: -38.496 flat angles P-C4'-P energy: -28.551 tors. eta vs tors. theta energy: 8.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -526.834733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.834733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.834733 (E_RNA) where: Base-Base interactions energy: -277.744 where: short stacking energy: -212.878 Base-Backbone interact. energy: -0.588 local terms energy: -248.503119 where: bonds (distance) C4'-P energy: -50.820 bonds (distance) P-C4' energy: -53.202 flat angles C4'-P-C4' energy: -55.408 flat angles P-C4'-P energy: -39.313 tors. eta vs tors. theta energy: -49.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -534.865214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.865214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.865214 (E_RNA) where: Base-Base interactions energy: -324.491 where: short stacking energy: -175.850 Base-Backbone interact. energy: -1.322 local terms energy: -209.052205 where: bonds (distance) C4'-P energy: -44.186 bonds (distance) P-C4' energy: -54.326 flat angles C4'-P-C4' energy: -50.912 flat angles P-C4'-P energy: -19.748 tors. eta vs tors. theta energy: -39.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -460.392031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.392031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.392031 (E_RNA) where: Base-Base interactions energy: -232.645 where: short stacking energy: -167.586 Base-Backbone interact. energy: -0.488 local terms energy: -227.259574 where: bonds (distance) C4'-P energy: -52.152 bonds (distance) P-C4' energy: -44.310 flat angles C4'-P-C4' energy: -55.594 flat angles P-C4'-P energy: -34.290 tors. eta vs tors. theta energy: -40.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -471.202085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.202085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.202085 (E_RNA) where: Base-Base interactions energy: -242.891 where: short stacking energy: -187.857 Base-Backbone interact. energy: -0.155 local terms energy: -228.156119 where: bonds (distance) C4'-P energy: -49.418 bonds (distance) P-C4' energy: -48.315 flat angles C4'-P-C4' energy: -47.544 flat angles P-C4'-P energy: -31.559 tors. eta vs tors. theta energy: -51.321 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -463.769140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.769140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.769140 (E_RNA) where: Base-Base interactions energy: -265.545 where: short stacking energy: -147.059 Base-Backbone interact. energy: -3.814 local terms energy: -194.409878 where: bonds (distance) C4'-P energy: -38.168 bonds (distance) P-C4' energy: -48.910 flat angles C4'-P-C4' energy: -43.467 flat angles P-C4'-P energy: -26.782 tors. eta vs tors. theta energy: -37.084 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -411.932739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.932739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.932739 (E_RNA) where: Base-Base interactions energy: -213.931 where: short stacking energy: -134.604 Base-Backbone interact. energy: -1.016 local terms energy: -196.985591 where: bonds (distance) C4'-P energy: -47.060 bonds (distance) P-C4' energy: -49.947 flat angles C4'-P-C4' energy: -50.323 flat angles P-C4'-P energy: -20.109 tors. eta vs tors. theta energy: -29.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -290.024749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.024749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.024749 (E_RNA) where: Base-Base interactions energy: -120.020 where: short stacking energy: -86.556 Base-Backbone interact. energy: -0.239 local terms energy: -169.765620 where: bonds (distance) C4'-P energy: -48.018 bonds (distance) P-C4' energy: -39.996 flat angles C4'-P-C4' energy: -44.912 flat angles P-C4'-P energy: -30.942 tors. eta vs tors. theta energy: -5.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -338.612541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.612541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.612541 (E_RNA) where: Base-Base interactions energy: -163.890 where: short stacking energy: -98.356 Base-Backbone interact. energy: -0.785 local terms energy: -173.937575 where: bonds (distance) C4'-P energy: -44.662 bonds (distance) P-C4' energy: -45.910 flat angles C4'-P-C4' energy: -41.859 flat angles P-C4'-P energy: -28.061 tors. eta vs tors. theta energy: -13.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -351.936531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.936531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.936531 (E_RNA) where: Base-Base interactions energy: -190.443 where: short stacking energy: -124.356 Base-Backbone interact. energy: -0.564 local terms energy: -160.928875 where: bonds (distance) C4'-P energy: -45.493 bonds (distance) P-C4' energy: -42.305 flat angles C4'-P-C4' energy: -36.849 flat angles P-C4'-P energy: -18.656 tors. eta vs tors. theta energy: -17.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -231.986380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.986380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.986380 (E_RNA) where: Base-Base interactions energy: -73.370 where: short stacking energy: -64.000 Base-Backbone interact. energy: -0.581 local terms energy: -158.035486 where: bonds (distance) C4'-P energy: -47.072 bonds (distance) P-C4' energy: -52.561 flat angles C4'-P-C4' energy: -38.749 flat angles P-C4'-P energy: -20.243 tors. eta vs tors. theta energy: 0.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -546.743615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.743615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.743615 (E_RNA) where: Base-Base interactions energy: -292.064 where: short stacking energy: -217.826 Base-Backbone interact. energy: -1.392 local terms energy: -253.287321 where: bonds (distance) C4'-P energy: -49.267 bonds (distance) P-C4' energy: -53.340 flat angles C4'-P-C4' energy: -52.958 flat angles P-C4'-P energy: -35.872 tors. eta vs tors. theta energy: -61.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -535.048360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.048360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.048360 (E_RNA) where: Base-Base interactions energy: -319.067 where: short stacking energy: -182.502 Base-Backbone interact. energy: 1.073 local terms energy: -217.054958 where: bonds (distance) C4'-P energy: -55.696 bonds (distance) P-C4' energy: -48.419 flat angles C4'-P-C4' energy: -48.334 flat angles P-C4'-P energy: -32.652 tors. eta vs tors. theta energy: -31.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -470.611571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.611571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.611571 (E_RNA) where: Base-Base interactions energy: -253.868 where: short stacking energy: -177.966 Base-Backbone interact. energy: -2.401 local terms energy: -214.342197 where: bonds (distance) C4'-P energy: -47.723 bonds (distance) P-C4' energy: -49.784 flat angles C4'-P-C4' energy: -45.217 flat angles P-C4'-P energy: -31.237 tors. eta vs tors. theta energy: -40.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -557.182967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.182967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.182967 (E_RNA) where: Base-Base interactions energy: -324.718 where: short stacking energy: -173.588 Base-Backbone interact. energy: -1.051 local terms energy: -231.414739 where: bonds (distance) C4'-P energy: -50.748 bonds (distance) P-C4' energy: -50.961 flat angles C4'-P-C4' energy: -49.503 flat angles P-C4'-P energy: -33.410 tors. eta vs tors. theta energy: -46.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -536.792509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.792509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.792509 (E_RNA) where: Base-Base interactions energy: -336.612 where: short stacking energy: -182.167 Base-Backbone interact. energy: -0.178 local terms energy: -200.002703 where: bonds (distance) C4'-P energy: -50.160 bonds (distance) P-C4' energy: -45.304 flat angles C4'-P-C4' energy: -41.948 flat angles P-C4'-P energy: -25.196 tors. eta vs tors. theta energy: -37.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -414.238884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.238884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.238884 (E_RNA) where: Base-Base interactions energy: -247.036 where: short stacking energy: -133.452 Base-Backbone interact. energy: 1.637 local terms energy: -168.840067 where: bonds (distance) C4'-P energy: -41.096 bonds (distance) P-C4' energy: -40.488 flat angles C4'-P-C4' energy: -34.304 flat angles P-C4'-P energy: -34.514 tors. eta vs tors. theta energy: -18.439 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -278.929302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.929302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.929302 (E_RNA) where: Base-Base interactions energy: -110.201 where: short stacking energy: -91.520 Base-Backbone interact. energy: -0.417 local terms energy: -168.311777 where: bonds (distance) C4'-P energy: -40.256 bonds (distance) P-C4' energy: -41.880 flat angles C4'-P-C4' energy: -39.868 flat angles P-C4'-P energy: -30.499 tors. eta vs tors. theta energy: -15.809 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -319.538202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.538202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.538202 (E_RNA) where: Base-Base interactions energy: -169.194 where: short stacking energy: -107.472 Base-Backbone interact. energy: -0.009 local terms energy: -150.335739 where: bonds (distance) C4'-P energy: -40.680 bonds (distance) P-C4' energy: -36.288 flat angles C4'-P-C4' energy: -39.173 flat angles P-C4'-P energy: -26.231 tors. eta vs tors. theta energy: -7.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -312.565794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.565794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.565794 (E_RNA) where: Base-Base interactions energy: -168.722 where: short stacking energy: -92.497 Base-Backbone interact. energy: 3.648 local terms energy: -147.491245 where: bonds (distance) C4'-P energy: -36.392 bonds (distance) P-C4' energy: -34.349 flat angles C4'-P-C4' energy: -40.551 flat angles P-C4'-P energy: -27.568 tors. eta vs tors. theta energy: -8.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -271.064675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.064675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.064675 (E_RNA) where: Base-Base interactions energy: -126.424 where: short stacking energy: -75.400 Base-Backbone interact. energy: 1.752 local terms energy: -146.392500 where: bonds (distance) C4'-P energy: -32.115 bonds (distance) P-C4' energy: -44.386 flat angles C4'-P-C4' energy: -35.032 flat angles P-C4'-P energy: -26.694 tors. eta vs tors. theta energy: -8.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -560.277699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.277699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.277699 (E_RNA) where: Base-Base interactions energy: -341.835 where: short stacking energy: -211.867 Base-Backbone interact. energy: -0.936 local terms energy: -217.506045 where: bonds (distance) C4'-P energy: -46.753 bonds (distance) P-C4' energy: -46.768 flat angles C4'-P-C4' energy: -51.785 flat angles P-C4'-P energy: -34.992 tors. eta vs tors. theta energy: -37.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -527.824235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.824235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.824235 (E_RNA) where: Base-Base interactions energy: -296.173 where: short stacking energy: -182.046 Base-Backbone interact. energy: -0.714 local terms energy: -230.937679 where: bonds (distance) C4'-P energy: -49.675 bonds (distance) P-C4' energy: -53.108 flat angles C4'-P-C4' energy: -50.786 flat angles P-C4'-P energy: -30.852 tors. eta vs tors. theta energy: -46.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -576.429211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.429211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.429211 (E_RNA) where: Base-Base interactions energy: -354.364 where: short stacking energy: -187.639 Base-Backbone interact. energy: -1.083 local terms energy: -220.982767 where: bonds (distance) C4'-P energy: -45.263 bonds (distance) P-C4' energy: -46.342 flat angles C4'-P-C4' energy: -47.362 flat angles P-C4'-P energy: -37.017 tors. eta vs tors. theta energy: -44.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -447.202236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.202236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.202236 (E_RNA) where: Base-Base interactions energy: -235.110 where: short stacking energy: -170.903 Base-Backbone interact. energy: -0.998 local terms energy: -211.093420 where: bonds (distance) C4'-P energy: -48.087 bonds (distance) P-C4' energy: -41.024 flat angles C4'-P-C4' energy: -47.576 flat angles P-C4'-P energy: -38.784 tors. eta vs tors. theta energy: -35.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -540.167227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.167227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.167227 (E_RNA) where: Base-Base interactions energy: -332.380 where: short stacking energy: -165.437 Base-Backbone interact. energy: -0.252 local terms energy: -207.534921 where: bonds (distance) C4'-P energy: -51.656 bonds (distance) P-C4' energy: -51.258 flat angles C4'-P-C4' energy: -42.446 flat angles P-C4'-P energy: -23.900 tors. eta vs tors. theta energy: -38.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -483.403407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.403407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.403407 (E_RNA) where: Base-Base interactions energy: -298.094 where: short stacking energy: -160.318 Base-Backbone interact. energy: -2.868 local terms energy: -182.441295 where: bonds (distance) C4'-P energy: -47.552 bonds (distance) P-C4' energy: -31.681 flat angles C4'-P-C4' energy: -44.472 flat angles P-C4'-P energy: -18.447 tors. eta vs tors. theta energy: -40.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -338.792938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.792938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.792938 (E_RNA) where: Base-Base interactions energy: -150.200 where: short stacking energy: -112.530 Base-Backbone interact. energy: -1.323 local terms energy: -187.270728 where: bonds (distance) C4'-P energy: -48.269 bonds (distance) P-C4' energy: -46.021 flat angles C4'-P-C4' energy: -43.700 flat angles P-C4'-P energy: -27.564 tors. eta vs tors. theta energy: -21.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -319.264891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.264891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.264891 (E_RNA) where: Base-Base interactions energy: -162.682 where: short stacking energy: -107.376 Base-Backbone interact. energy: -0.509 local terms energy: -156.073314 where: bonds (distance) C4'-P energy: -39.337 bonds (distance) P-C4' energy: -46.350 flat angles C4'-P-C4' energy: -41.857 flat angles P-C4'-P energy: -18.526 tors. eta vs tors. theta energy: -10.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -274.463975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.463975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.463975 (E_RNA) where: Base-Base interactions energy: -137.132 where: short stacking energy: -84.120 Base-Backbone interact. energy: 6.738 local terms energy: -144.070591 where: bonds (distance) C4'-P energy: -37.052 bonds (distance) P-C4' energy: -39.965 flat angles C4'-P-C4' energy: -38.172 flat angles P-C4'-P energy: -25.933 tors. eta vs tors. theta energy: -2.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -232.998170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.998170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.998170 (E_RNA) where: Base-Base interactions energy: -74.432 where: short stacking energy: -72.972 Base-Backbone interact. energy: -1.906 local terms energy: -156.660682 where: bonds (distance) C4'-P energy: -41.561 bonds (distance) P-C4' energy: -53.599 flat angles C4'-P-C4' energy: -35.541 flat angles P-C4'-P energy: -24.526 tors. eta vs tors. theta energy: -1.434 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -563.950244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.950244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.950244 (E_RNA) where: Base-Base interactions energy: -340.963 where: short stacking energy: -210.691 Base-Backbone interact. energy: 0.659 local terms energy: -223.646829 where: bonds (distance) C4'-P energy: -51.568 bonds (distance) P-C4' energy: -50.239 flat angles C4'-P-C4' energy: -56.849 flat angles P-C4'-P energy: -24.082 tors. eta vs tors. theta energy: -40.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -649.734369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.734369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.734369 (E_RNA) where: Base-Base interactions energy: -423.714 where: short stacking energy: -200.616 Base-Backbone interact. energy: -2.400 local terms energy: -223.620032 where: bonds (distance) C4'-P energy: -44.175 bonds (distance) P-C4' energy: -49.795 flat angles C4'-P-C4' energy: -48.884 flat angles P-C4'-P energy: -39.332 tors. eta vs tors. theta energy: -41.434 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -520.627500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.627500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.627500 (E_RNA) where: Base-Base interactions energy: -314.857 where: short stacking energy: -174.834 Base-Backbone interact. energy: -0.731 local terms energy: -205.039810 where: bonds (distance) C4'-P energy: -47.379 bonds (distance) P-C4' energy: -45.377 flat angles C4'-P-C4' energy: -51.936 flat angles P-C4'-P energy: -23.952 tors. eta vs tors. theta energy: -36.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -628.676971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.676971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.676971 (E_RNA) where: Base-Base interactions energy: -402.348 where: short stacking energy: -217.569 Base-Backbone interact. energy: -1.796 local terms energy: -224.533241 where: bonds (distance) C4'-P energy: -49.480 bonds (distance) P-C4' energy: -34.572 flat angles C4'-P-C4' energy: -53.406 flat angles P-C4'-P energy: -27.917 tors. eta vs tors. theta energy: -59.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -402.827062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.827062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.827062 (E_RNA) where: Base-Base interactions energy: -208.672 where: short stacking energy: -155.648 Base-Backbone interact. energy: -0.741 local terms energy: -193.413685 where: bonds (distance) C4'-P energy: -51.420 bonds (distance) P-C4' energy: -41.122 flat angles C4'-P-C4' energy: -41.226 flat angles P-C4'-P energy: -33.584 tors. eta vs tors. theta energy: -26.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -483.198355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.198355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.198355 (E_RNA) where: Base-Base interactions energy: -297.345 where: short stacking energy: -145.568 Base-Backbone interact. energy: -0.345 local terms energy: -185.508471 where: bonds (distance) C4'-P energy: -45.447 bonds (distance) P-C4' energy: -46.713 flat angles C4'-P-C4' energy: -39.514 flat angles P-C4'-P energy: -25.131 tors. eta vs tors. theta energy: -28.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -365.184736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.184736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.184736 (E_RNA) where: Base-Base interactions energy: -183.174 where: short stacking energy: -117.739 Base-Backbone interact. energy: 2.438 local terms energy: -184.448670 where: bonds (distance) C4'-P energy: -38.749 bonds (distance) P-C4' energy: -51.922 flat angles C4'-P-C4' energy: -52.127 flat angles P-C4'-P energy: -18.115 tors. eta vs tors. theta energy: -23.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -344.602604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.602604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.602604 (E_RNA) where: Base-Base interactions energy: -174.976 where: short stacking energy: -111.502 Base-Backbone interact. energy: -0.369 local terms energy: -169.258106 where: bonds (distance) C4'-P energy: -44.698 bonds (distance) P-C4' energy: -47.825 flat angles C4'-P-C4' energy: -42.498 flat angles P-C4'-P energy: -15.808 tors. eta vs tors. theta energy: -18.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -303.100263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.100263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.100263 (E_RNA) where: Base-Base interactions energy: -156.379 where: short stacking energy: -97.639 Base-Backbone interact. energy: -0.600 local terms energy: -146.121472 where: bonds (distance) C4'-P energy: -30.448 bonds (distance) P-C4' energy: -48.116 flat angles C4'-P-C4' energy: -33.217 flat angles P-C4'-P energy: -24.306 tors. eta vs tors. theta energy: -10.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -226.114711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.114711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.114711 (E_RNA) where: Base-Base interactions energy: -80.655 where: short stacking energy: -75.873 Base-Backbone interact. energy: 0.090 local terms energy: -145.549317 where: bonds (distance) C4'-P energy: -38.093 bonds (distance) P-C4' energy: -38.401 flat angles C4'-P-C4' energy: -45.921 flat angles P-C4'-P energy: -28.494 tors. eta vs tors. theta energy: 5.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -727.968036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.968036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.968036 (E_RNA) where: Base-Base interactions energy: -487.413 where: short stacking energy: -220.887 Base-Backbone interact. energy: -1.962 local terms energy: -238.593583 where: bonds (distance) C4'-P energy: -53.522 bonds (distance) P-C4' energy: -52.838 flat angles C4'-P-C4' energy: -54.706 flat angles P-C4'-P energy: -30.321 tors. eta vs tors. theta energy: -47.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -605.642384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.642384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.642384 (E_RNA) where: Base-Base interactions energy: -388.936 where: short stacking energy: -197.129 Base-Backbone interact. energy: -1.253 local terms energy: -215.453425 where: bonds (distance) C4'-P energy: -39.386 bonds (distance) P-C4' energy: -49.251 flat angles C4'-P-C4' energy: -49.470 flat angles P-C4'-P energy: -34.303 tors. eta vs tors. theta energy: -43.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -699.263816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.263816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.263816 (E_RNA) where: Base-Base interactions energy: -469.606 where: short stacking energy: -201.344 Base-Backbone interact. energy: -1.575 local terms energy: -228.082188 where: bonds (distance) C4'-P energy: -44.509 bonds (distance) P-C4' energy: -47.125 flat angles C4'-P-C4' energy: -57.381 flat angles P-C4'-P energy: -30.207 tors. eta vs tors. theta energy: -48.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -477.982596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.982596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.982596 (E_RNA) where: Base-Base interactions energy: -266.087 where: short stacking energy: -147.341 Base-Backbone interact. energy: -0.085 local terms energy: -211.810829 where: bonds (distance) C4'-P energy: -44.744 bonds (distance) P-C4' energy: -40.744 flat angles C4'-P-C4' energy: -50.219 flat angles P-C4'-P energy: -38.166 tors. eta vs tors. theta energy: -37.937 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -521.261291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.261291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.261291 (E_RNA) where: Base-Base interactions energy: -313.722 where: short stacking energy: -153.271 Base-Backbone interact. energy: 0.965 local terms energy: -208.503864 where: bonds (distance) C4'-P energy: -44.315 bonds (distance) P-C4' energy: -44.558 flat angles C4'-P-C4' energy: -58.566 flat angles P-C4'-P energy: -30.482 tors. eta vs tors. theta energy: -30.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -422.972289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.972289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.972289 (E_RNA) where: Base-Base interactions energy: -231.117 where: short stacking energy: -131.856 Base-Backbone interact. energy: -3.141 local terms energy: -188.714224 where: bonds (distance) C4'-P energy: -36.316 bonds (distance) P-C4' energy: -46.640 flat angles C4'-P-C4' energy: -44.039 flat angles P-C4'-P energy: -32.481 tors. eta vs tors. theta energy: -29.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -363.006225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.006225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.006225 (E_RNA) where: Base-Base interactions energy: -188.062 where: short stacking energy: -119.147 Base-Backbone interact. energy: -1.735 local terms energy: -173.209268 where: bonds (distance) C4'-P energy: -42.702 bonds (distance) P-C4' energy: -43.011 flat angles C4'-P-C4' energy: -45.265 flat angles P-C4'-P energy: -28.373 tors. eta vs tors. theta energy: -13.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -393.932977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.932977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.932977 (E_RNA) where: Base-Base interactions energy: -233.147 where: short stacking energy: -128.692 Base-Backbone interact. energy: -0.370 local terms energy: -160.416521 where: bonds (distance) C4'-P energy: -47.028 bonds (distance) P-C4' energy: -46.606 flat angles C4'-P-C4' energy: -26.487 flat angles P-C4'-P energy: -26.122 tors. eta vs tors. theta energy: -14.174 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -260.913662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.913662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.913662 (E_RNA) where: Base-Base interactions energy: -111.026 where: short stacking energy: -67.566 Base-Backbone interact. energy: 4.305 local terms energy: -154.192756 where: bonds (distance) C4'-P energy: -41.823 bonds (distance) P-C4' energy: -49.093 flat angles C4'-P-C4' energy: -35.399 flat angles P-C4'-P energy: -29.552 tors. eta vs tors. theta energy: 1.674 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -269.112327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.112327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.112327 (E_RNA) where: Base-Base interactions energy: -136.073 where: short stacking energy: -82.263 Base-Backbone interact. energy: 2.888 local terms energy: -135.926479 where: bonds (distance) C4'-P energy: -40.521 bonds (distance) P-C4' energy: -41.574 flat angles C4'-P-C4' energy: -37.553 flat angles P-C4'-P energy: -18.262 tors. eta vs tors. theta energy: 1.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -743.951634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -743.951634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.951634 (E_RNA) where: Base-Base interactions energy: -490.671 where: short stacking energy: -221.089 Base-Backbone interact. energy: -1.037 local terms energy: -252.243978 where: bonds (distance) C4'-P energy: -47.951 bonds (distance) P-C4' energy: -54.035 flat angles C4'-P-C4' energy: -59.741 flat angles P-C4'-P energy: -33.687 tors. eta vs tors. theta energy: -56.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -728.569593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.569593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.569593 (E_RNA) where: Base-Base interactions energy: -487.057 where: short stacking energy: -229.370 Base-Backbone interact. energy: 0.846 local terms energy: -242.358540 where: bonds (distance) C4'-P energy: -44.803 bonds (distance) P-C4' energy: -54.891 flat angles C4'-P-C4' energy: -47.278 flat angles P-C4'-P energy: -40.663 tors. eta vs tors. theta energy: -54.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -615.587857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.587857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.587857 (E_RNA) where: Base-Base interactions energy: -407.580 where: short stacking energy: -198.876 Base-Backbone interact. energy: -1.849 local terms energy: -206.158575 where: bonds (distance) C4'-P energy: -50.106 bonds (distance) P-C4' energy: -51.978 flat angles C4'-P-C4' energy: -47.432 flat angles P-C4'-P energy: -16.738 tors. eta vs tors. theta energy: -39.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -589.556182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.556182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.556182 (E_RNA) where: Base-Base interactions energy: -377.125 where: short stacking energy: -173.174 Base-Backbone interact. energy: -0.939 local terms energy: -211.491362 where: bonds (distance) C4'-P energy: -44.413 bonds (distance) P-C4' energy: -49.951 flat angles C4'-P-C4' energy: -41.907 flat angles P-C4'-P energy: -33.825 tors. eta vs tors. theta energy: -41.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -395.465284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.465284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.465284 (E_RNA) where: Base-Base interactions energy: -217.402 where: short stacking energy: -132.177 Base-Backbone interact. energy: -1.715 local terms energy: -176.348064 where: bonds (distance) C4'-P energy: -45.586 bonds (distance) P-C4' energy: -42.718 flat angles C4'-P-C4' energy: -44.336 flat angles P-C4'-P energy: -28.916 tors. eta vs tors. theta energy: -14.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -436.135947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.135947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.135947 (E_RNA) where: Base-Base interactions energy: -252.623 where: short stacking energy: -125.072 Base-Backbone interact. energy: -0.871 local terms energy: -182.641649 where: bonds (distance) C4'-P energy: -45.556 bonds (distance) P-C4' energy: -41.356 flat angles C4'-P-C4' energy: -47.343 flat angles P-C4'-P energy: -22.616 tors. eta vs tors. theta energy: -25.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -347.772567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.772567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.772567 (E_RNA) where: Base-Base interactions energy: -194.568 where: short stacking energy: -116.711 Base-Backbone interact. energy: 0.198 local terms energy: -153.402259 where: bonds (distance) C4'-P energy: -39.726 bonds (distance) P-C4' energy: -50.998 flat angles C4'-P-C4' energy: -33.518 flat angles P-C4'-P energy: -19.499 tors. eta vs tors. theta energy: -9.661 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -404.326961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.326961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.326961 (E_RNA) where: Base-Base interactions energy: -215.766 where: short stacking energy: -122.823 Base-Backbone interact. energy: -3.724 local terms energy: -184.837494 where: bonds (distance) C4'-P energy: -37.961 bonds (distance) P-C4' energy: -44.162 flat angles C4'-P-C4' energy: -47.332 flat angles P-C4'-P energy: -32.120 tors. eta vs tors. theta energy: -23.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -250.792660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.792660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.792660 (E_RNA) where: Base-Base interactions energy: -79.256 where: short stacking energy: -72.682 Base-Backbone interact. energy: -0.309 local terms energy: -171.227518 where: bonds (distance) C4'-P energy: -48.203 bonds (distance) P-C4' energy: -50.537 flat angles C4'-P-C4' energy: -43.645 flat angles P-C4'-P energy: -26.347 tors. eta vs tors. theta energy: -2.497 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -267.140600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.140600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.140600 (E_RNA) where: Base-Base interactions energy: -125.117 where: short stacking energy: -86.803 Base-Backbone interact. energy: -0.471 local terms energy: -141.552791 where: bonds (distance) C4'-P energy: -38.244 bonds (distance) P-C4' energy: -42.912 flat angles C4'-P-C4' energy: -34.444 flat angles P-C4'-P energy: -24.232 tors. eta vs tors. theta energy: -1.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -743.076758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -743.076758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.076758 (E_RNA) where: Base-Base interactions energy: -506.929 where: short stacking energy: -227.771 Base-Backbone interact. energy: -1.652 local terms energy: -234.496447 where: bonds (distance) C4'-P energy: -53.133 bonds (distance) P-C4' energy: -47.135 flat angles C4'-P-C4' energy: -56.882 flat angles P-C4'-P energy: -26.328 tors. eta vs tors. theta energy: -51.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -715.794827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.794827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.794827 (E_RNA) where: Base-Base interactions energy: -481.896 where: short stacking energy: -220.030 Base-Backbone interact. energy: -2.445 local terms energy: -231.453658 where: bonds (distance) C4'-P energy: -41.383 bonds (distance) P-C4' energy: -45.928 flat angles C4'-P-C4' energy: -49.762 flat angles P-C4'-P energy: -40.384 tors. eta vs tors. theta energy: -53.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -616.306651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -616.306651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.306651 (E_RNA) where: Base-Base interactions energy: -395.786 where: short stacking energy: -175.619 Base-Backbone interact. energy: -1.606 local terms energy: -218.914533 where: bonds (distance) C4'-P energy: -47.672 bonds (distance) P-C4' energy: -55.341 flat angles C4'-P-C4' energy: -45.704 flat angles P-C4'-P energy: -34.785 tors. eta vs tors. theta energy: -35.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -620.729496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -620.729496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.729496 (E_RNA) where: Base-Base interactions energy: -377.206 where: short stacking energy: -202.493 Base-Backbone interact. energy: -0.199 local terms energy: -243.324008 where: bonds (distance) C4'-P energy: -48.981 bonds (distance) P-C4' energy: -60.690 flat angles C4'-P-C4' energy: -53.691 flat angles P-C4'-P energy: -33.805 tors. eta vs tors. theta energy: -46.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -485.062171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.062171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.062171 (E_RNA) where: Base-Base interactions energy: -299.549 where: short stacking energy: -145.745 Base-Backbone interact. energy: 1.563 local terms energy: -187.076158 where: bonds (distance) C4'-P energy: -53.562 bonds (distance) P-C4' energy: -43.868 flat angles C4'-P-C4' energy: -38.877 flat angles P-C4'-P energy: -25.205 tors. eta vs tors. theta energy: -25.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -421.847525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.847525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.847525 (E_RNA) where: Base-Base interactions energy: -278.054 where: short stacking energy: -129.874 Base-Backbone interact. energy: 2.350 local terms energy: -146.143498 where: bonds (distance) C4'-P energy: -37.440 bonds (distance) P-C4' energy: -46.976 flat angles C4'-P-C4' energy: -25.965 flat angles P-C4'-P energy: -26.006 tors. eta vs tors. theta energy: -9.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -417.015456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.015456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.015456 (E_RNA) where: Base-Base interactions energy: -235.810 where: short stacking energy: -120.097 Base-Backbone interact. energy: -1.308 local terms energy: -179.897421 where: bonds (distance) C4'-P energy: -49.370 bonds (distance) P-C4' energy: -48.330 flat angles C4'-P-C4' energy: -36.898 flat angles P-C4'-P energy: -30.720 tors. eta vs tors. theta energy: -14.580 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -323.176611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.176611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.176611 (E_RNA) where: Base-Base interactions energy: -169.536 where: short stacking energy: -108.895 Base-Backbone interact. energy: -0.212 local terms energy: -153.429320 where: bonds (distance) C4'-P energy: -38.654 bonds (distance) P-C4' energy: -45.654 flat angles C4'-P-C4' energy: -35.323 flat angles P-C4'-P energy: -17.854 tors. eta vs tors. theta energy: -15.944 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -314.603267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.603267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.603267 (E_RNA) where: Base-Base interactions energy: -136.983 where: short stacking energy: -93.931 Base-Backbone interact. energy: -0.533 local terms energy: -177.087248 where: bonds (distance) C4'-P energy: -43.190 bonds (distance) P-C4' energy: -50.325 flat angles C4'-P-C4' energy: -47.516 flat angles P-C4'-P energy: -26.369 tors. eta vs tors. theta energy: -9.687 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -220.005217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.005217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.005217 (E_RNA) where: Base-Base interactions energy: -99.133 where: short stacking energy: -73.095 Base-Backbone interact. energy: 2.019 local terms energy: -122.891311 where: bonds (distance) C4'-P energy: -46.332 bonds (distance) P-C4' energy: -33.084 flat angles C4'-P-C4' energy: -38.802 flat angles P-C4'-P energy: -20.114 tors. eta vs tors. theta energy: 15.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -748.554007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.554007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.554007 (E_RNA) where: Base-Base interactions energy: -494.746 where: short stacking energy: -218.265 Base-Backbone interact. energy: -0.949 local terms energy: -252.858331 where: bonds (distance) C4'-P energy: -58.618 bonds (distance) P-C4' energy: -51.623 flat angles C4'-P-C4' energy: -46.979 flat angles P-C4'-P energy: -37.007 tors. eta vs tors. theta energy: -58.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -725.092576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.092576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.092576 (E_RNA) where: Base-Base interactions energy: -468.948 where: short stacking energy: -217.030 Base-Backbone interact. energy: -1.856 local terms energy: -254.288899 where: bonds (distance) C4'-P energy: -50.598 bonds (distance) P-C4' energy: -52.324 flat angles C4'-P-C4' energy: -58.557 flat angles P-C4'-P energy: -41.475 tors. eta vs tors. theta energy: -51.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -645.609549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.609549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.609549 (E_RNA) where: Base-Base interactions energy: -426.879 where: short stacking energy: -206.271 Base-Backbone interact. energy: -2.179 local terms energy: -216.551835 where: bonds (distance) C4'-P energy: -42.820 bonds (distance) P-C4' energy: -48.080 flat angles C4'-P-C4' energy: -53.627 flat angles P-C4'-P energy: -34.394 tors. eta vs tors. theta energy: -37.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -631.759630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -631.759630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -631.759630 (E_RNA) where: Base-Base interactions energy: -424.078 where: short stacking energy: -209.239 Base-Backbone interact. energy: -1.726 local terms energy: -205.955013 where: bonds (distance) C4'-P energy: -41.244 bonds (distance) P-C4' energy: -39.820 flat angles C4'-P-C4' energy: -46.969 flat angles P-C4'-P energy: -30.276 tors. eta vs tors. theta energy: -47.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -495.252802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.252802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.252802 (E_RNA) where: Base-Base interactions energy: -303.217 where: short stacking energy: -162.463 Base-Backbone interact. energy: -0.150 local terms energy: -191.885772 where: bonds (distance) C4'-P energy: -49.040 bonds (distance) P-C4' energy: -45.532 flat angles C4'-P-C4' energy: -44.772 flat angles P-C4'-P energy: -17.667 tors. eta vs tors. theta energy: -34.875 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -448.612140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.612140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.612140 (E_RNA) where: Base-Base interactions energy: -265.021 where: short stacking energy: -144.324 Base-Backbone interact. energy: -0.786 local terms energy: -182.804954 where: bonds (distance) C4'-P energy: -35.580 bonds (distance) P-C4' energy: -35.701 flat angles C4'-P-C4' energy: -49.232 flat angles P-C4'-P energy: -31.557 tors. eta vs tors. theta energy: -30.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -453.548654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.548654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.548654 (E_RNA) where: Base-Base interactions energy: -294.336 where: short stacking energy: -127.786 Base-Backbone interact. energy: -1.420 local terms energy: -157.791854 where: bonds (distance) C4'-P energy: -38.754 bonds (distance) P-C4' energy: -50.403 flat angles C4'-P-C4' energy: -44.045 flat angles P-C4'-P energy: -13.090 tors. eta vs tors. theta energy: -11.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -354.666133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.666133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.666133 (E_RNA) where: Base-Base interactions energy: -175.057 where: short stacking energy: -100.224 Base-Backbone interact. energy: 0.162 local terms energy: -179.770749 where: bonds (distance) C4'-P energy: -37.961 bonds (distance) P-C4' energy: -46.501 flat angles C4'-P-C4' energy: -44.193 flat angles P-C4'-P energy: -32.155 tors. eta vs tors. theta energy: -18.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -337.367618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.367618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.367618 (E_RNA) where: Base-Base interactions energy: -202.000 where: short stacking energy: -97.577 Base-Backbone interact. energy: 0.841 local terms energy: -136.209032 where: bonds (distance) C4'-P energy: -42.171 bonds (distance) P-C4' energy: -34.954 flat angles C4'-P-C4' energy: -39.648 flat angles P-C4'-P energy: -17.456 tors. eta vs tors. theta energy: -1.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -277.846432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.846432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.846432 (E_RNA) where: Base-Base interactions energy: -137.478 where: short stacking energy: -84.154 Base-Backbone interact. energy: -1.363 local terms energy: -139.005310 where: bonds (distance) C4'-P energy: -44.785 bonds (distance) P-C4' energy: -42.789 flat angles C4'-P-C4' energy: -30.231 flat angles P-C4'-P energy: -28.009 tors. eta vs tors. theta energy: 6.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -752.745314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.745314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.745314 (E_RNA) where: Base-Base interactions energy: -504.971 where: short stacking energy: -240.381 Base-Backbone interact. energy: -0.367 local terms energy: -247.406430 where: bonds (distance) C4'-P energy: -49.153 bonds (distance) P-C4' energy: -47.728 flat angles C4'-P-C4' energy: -58.825 flat angles P-C4'-P energy: -34.250 tors. eta vs tors. theta energy: -57.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -727.000532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.000532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.000532 (E_RNA) where: Base-Base interactions energy: -496.601 where: short stacking energy: -221.220 Base-Backbone interact. energy: 0.907 local terms energy: -231.306550 where: bonds (distance) C4'-P energy: -49.435 bonds (distance) P-C4' energy: -45.425 flat angles C4'-P-C4' energy: -51.230 flat angles P-C4'-P energy: -31.429 tors. eta vs tors. theta energy: -53.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -672.368448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.368448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.368448 (E_RNA) where: Base-Base interactions energy: -437.537 where: short stacking energy: -205.428 Base-Backbone interact. energy: -1.137 local terms energy: -233.694811 where: bonds (distance) C4'-P energy: -39.700 bonds (distance) P-C4' energy: -48.878 flat angles C4'-P-C4' energy: -56.328 flat angles P-C4'-P energy: -37.487 tors. eta vs tors. theta energy: -51.301 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -604.466127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.466127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.466127 (E_RNA) where: Base-Base interactions energy: -390.091 where: short stacking energy: -183.392 Base-Backbone interact. energy: -0.663 local terms energy: -213.712672 where: bonds (distance) C4'-P energy: -48.829 bonds (distance) P-C4' energy: -47.902 flat angles C4'-P-C4' energy: -47.121 flat angles P-C4'-P energy: -32.554 tors. eta vs tors. theta energy: -37.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -499.812727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.812727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.812727 (E_RNA) where: Base-Base interactions energy: -304.040 where: short stacking energy: -148.957 Base-Backbone interact. energy: 0.679 local terms energy: -196.451040 where: bonds (distance) C4'-P energy: -39.586 bonds (distance) P-C4' energy: -51.665 flat angles C4'-P-C4' energy: -44.692 flat angles P-C4'-P energy: -31.258 tors. eta vs tors. theta energy: -29.250 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -467.535360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.535360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.535360 (E_RNA) where: Base-Base interactions energy: -254.393 where: short stacking energy: -175.431 Base-Backbone interact. energy: 0.059 local terms energy: -213.201177 where: bonds (distance) C4'-P energy: -47.627 bonds (distance) P-C4' energy: -50.446 flat angles C4'-P-C4' energy: -47.583 flat angles P-C4'-P energy: -22.921 tors. eta vs tors. theta energy: -44.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -504.080748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.080748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.080748 (E_RNA) where: Base-Base interactions energy: -304.489 where: short stacking energy: -144.278 Base-Backbone interact. energy: -0.625 local terms energy: -198.967025 where: bonds (distance) C4'-P energy: -36.469 bonds (distance) P-C4' energy: -49.019 flat angles C4'-P-C4' energy: -54.117 flat angles P-C4'-P energy: -29.475 tors. eta vs tors. theta energy: -29.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -314.829565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.829565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.829565 (E_RNA) where: Base-Base interactions energy: -166.018 where: short stacking energy: -121.316 Base-Backbone interact. energy: -0.868 local terms energy: -147.942667 where: bonds (distance) C4'-P energy: -39.446 bonds (distance) P-C4' energy: -41.443 flat angles C4'-P-C4' energy: -26.534 flat angles P-C4'-P energy: -25.740 tors. eta vs tors. theta energy: -14.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -363.119572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.119572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.119572 (E_RNA) where: Base-Base interactions energy: -199.785 where: short stacking energy: -98.129 Base-Backbone interact. energy: -1.720 local terms energy: -161.614776 where: bonds (distance) C4'-P energy: -37.950 bonds (distance) P-C4' energy: -45.300 flat angles C4'-P-C4' energy: -36.326 flat angles P-C4'-P energy: -27.330 tors. eta vs tors. theta energy: -14.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -245.006675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.006675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.006675 (E_RNA) where: Base-Base interactions energy: -108.983 where: short stacking energy: -71.147 Base-Backbone interact. energy: -0.603 local terms energy: -135.420082 where: bonds (distance) C4'-P energy: -35.767 bonds (distance) P-C4' energy: -43.249 flat angles C4'-P-C4' energy: -32.295 flat angles P-C4'-P energy: -25.674 tors. eta vs tors. theta energy: 1.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -766.374421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.374421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.374421 (E_RNA) where: Base-Base interactions energy: -523.836 where: short stacking energy: -227.840 Base-Backbone interact. energy: -0.533 local terms energy: -242.005327 where: bonds (distance) C4'-P energy: -48.790 bonds (distance) P-C4' energy: -49.011 flat angles C4'-P-C4' energy: -55.035 flat angles P-C4'-P energy: -34.665 tors. eta vs tors. theta energy: -54.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -737.507759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.507759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.507759 (E_RNA) where: Base-Base interactions energy: -502.648 where: short stacking energy: -216.600 Base-Backbone interact. energy: 1.609 local terms energy: -236.468269 where: bonds (distance) C4'-P energy: -41.710 bonds (distance) P-C4' energy: -48.289 flat angles C4'-P-C4' energy: -48.932 flat angles P-C4'-P energy: -38.548 tors. eta vs tors. theta energy: -58.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -720.148371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.148371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.148371 (E_RNA) where: Base-Base interactions energy: -483.167 where: short stacking energy: -220.355 Base-Backbone interact. energy: -1.084 local terms energy: -235.897182 where: bonds (distance) C4'-P energy: -41.880 bonds (distance) P-C4' energy: -58.254 flat angles C4'-P-C4' energy: -52.839 flat angles P-C4'-P energy: -30.316 tors. eta vs tors. theta energy: -52.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -597.308662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.308662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.308662 (E_RNA) where: Base-Base interactions energy: -384.293 where: short stacking energy: -188.237 Base-Backbone interact. energy: -1.079 local terms energy: -211.936291 where: bonds (distance) C4'-P energy: -47.743 bonds (distance) P-C4' energy: -45.437 flat angles C4'-P-C4' energy: -51.316 flat angles P-C4'-P energy: -27.152 tors. eta vs tors. theta energy: -40.288 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -637.984695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -637.984695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.984695 (E_RNA) where: Base-Base interactions energy: -413.308 where: short stacking energy: -184.655 Base-Backbone interact. energy: -2.540 local terms energy: -222.137260 where: bonds (distance) C4'-P energy: -45.470 bonds (distance) P-C4' energy: -48.938 flat angles C4'-P-C4' energy: -54.971 flat angles P-C4'-P energy: -31.265 tors. eta vs tors. theta energy: -41.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -525.557065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.557065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.557065 (E_RNA) where: Base-Base interactions energy: -318.496 where: short stacking energy: -154.736 Base-Backbone interact. energy: 4.574 local terms energy: -211.635421 where: bonds (distance) C4'-P energy: -46.277 bonds (distance) P-C4' energy: -53.845 flat angles C4'-P-C4' energy: -49.129 flat angles P-C4'-P energy: -29.928 tors. eta vs tors. theta energy: -32.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -436.128721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.128721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.128721 (E_RNA) where: Base-Base interactions energy: -235.629 where: short stacking energy: -154.857 Base-Backbone interact. energy: -0.426 local terms energy: -200.073909 where: bonds (distance) C4'-P energy: -45.586 bonds (distance) P-C4' energy: -46.997 flat angles C4'-P-C4' energy: -47.178 flat angles P-C4'-P energy: -28.010 tors. eta vs tors. theta energy: -32.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -385.888137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.888137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.888137 (E_RNA) where: Base-Base interactions energy: -208.495 where: short stacking energy: -104.256 Base-Backbone interact. energy: -0.664 local terms energy: -176.729756 where: bonds (distance) C4'-P energy: -51.254 bonds (distance) P-C4' energy: -37.979 flat angles C4'-P-C4' energy: -49.298 flat angles P-C4'-P energy: -19.964 tors. eta vs tors. theta energy: -18.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -290.963298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.963298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.963298 (E_RNA) where: Base-Base interactions energy: -128.956 where: short stacking energy: -86.573 Base-Backbone interact. energy: -1.431 local terms energy: -160.576678 where: bonds (distance) C4'-P energy: -41.096 bonds (distance) P-C4' energy: -41.142 flat angles C4'-P-C4' energy: -50.954 flat angles P-C4'-P energy: -21.675 tors. eta vs tors. theta energy: -5.710 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -254.125780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.125780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.125780 (E_RNA) where: Base-Base interactions energy: -96.057 where: short stacking energy: -85.477 Base-Backbone interact. energy: -0.372 local terms energy: -157.696659 where: bonds (distance) C4'-P energy: -38.542 bonds (distance) P-C4' energy: -52.512 flat angles C4'-P-C4' energy: -35.197 flat angles P-C4'-P energy: -20.535 tors. eta vs tors. theta energy: -10.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -757.291006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -757.291006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.291006 (E_RNA) where: Base-Base interactions energy: -501.908 where: short stacking energy: -227.053 Base-Backbone interact. energy: -0.589 local terms energy: -254.794162 where: bonds (distance) C4'-P energy: -53.253 bonds (distance) P-C4' energy: -46.656 flat angles C4'-P-C4' energy: -57.170 flat angles P-C4'-P energy: -39.852 tors. eta vs tors. theta energy: -57.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -748.506377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.506377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.506377 (E_RNA) where: Base-Base interactions energy: -498.624 where: short stacking energy: -235.458 Base-Backbone interact. energy: -1.406 local terms energy: -248.476250 where: bonds (distance) C4'-P energy: -48.618 bonds (distance) P-C4' energy: -50.976 flat angles C4'-P-C4' energy: -46.618 flat angles P-C4'-P energy: -41.491 tors. eta vs tors. theta energy: -60.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -717.695417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.695417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.695417 (E_RNA) where: Base-Base interactions energy: -475.384 where: short stacking energy: -216.412 Base-Backbone interact. energy: -1.584 local terms energy: -240.727366 where: bonds (distance) C4'-P energy: -52.035 bonds (distance) P-C4' energy: -51.414 flat angles C4'-P-C4' energy: -47.883 flat angles P-C4'-P energy: -31.382 tors. eta vs tors. theta energy: -58.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -572.855489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.855489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.855489 (E_RNA) where: Base-Base interactions energy: -373.853 where: short stacking energy: -166.392 Base-Backbone interact. energy: -0.817 local terms energy: -198.186004 where: bonds (distance) C4'-P energy: -42.231 bonds (distance) P-C4' energy: -54.664 flat angles C4'-P-C4' energy: -43.808 flat angles P-C4'-P energy: -24.760 tors. eta vs tors. theta energy: -32.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -659.869058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.869058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.869058 (E_RNA) where: Base-Base interactions energy: -429.378 where: short stacking energy: -178.834 Base-Backbone interact. energy: -2.466 local terms energy: -228.024717 where: bonds (distance) C4'-P energy: -45.084 bonds (distance) P-C4' energy: -46.023 flat angles C4'-P-C4' energy: -56.153 flat angles P-C4'-P energy: -31.760 tors. eta vs tors. theta energy: -49.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -552.875360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.875360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.875360 (E_RNA) where: Base-Base interactions energy: -361.540 where: short stacking energy: -178.036 Base-Backbone interact. energy: 0.805 local terms energy: -192.139998 where: bonds (distance) C4'-P energy: -31.126 bonds (distance) P-C4' energy: -42.563 flat angles C4'-P-C4' energy: -46.152 flat angles P-C4'-P energy: -30.146 tors. eta vs tors. theta energy: -42.152 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -420.802077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.802077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.802077 (E_RNA) where: Base-Base interactions energy: -242.782 where: short stacking energy: -150.169 Base-Backbone interact. energy: 0.414 local terms energy: -178.433971 where: bonds (distance) C4'-P energy: -32.307 bonds (distance) P-C4' energy: -45.506 flat angles C4'-P-C4' energy: -42.801 flat angles P-C4'-P energy: -21.184 tors. eta vs tors. theta energy: -36.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -372.263193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.263193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.263193 (E_RNA) where: Base-Base interactions energy: -226.191 where: short stacking energy: -138.627 Base-Backbone interact. energy: -1.686 local terms energy: -144.386068 where: bonds (distance) C4'-P energy: -32.055 bonds (distance) P-C4' energy: -43.603 flat angles C4'-P-C4' energy: -38.009 flat angles P-C4'-P energy: -15.590 tors. eta vs tors. theta energy: -15.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -308.097110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.097110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.097110 (E_RNA) where: Base-Base interactions energy: -171.318 where: short stacking energy: -97.879 Base-Backbone interact. energy: 1.579 local terms energy: -138.357975 where: bonds (distance) C4'-P energy: -44.705 bonds (distance) P-C4' energy: -45.625 flat angles C4'-P-C4' energy: -35.489 flat angles P-C4'-P energy: -14.418 tors. eta vs tors. theta energy: 1.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -226.494183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.494183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.494183 (E_RNA) where: Base-Base interactions energy: -77.475 where: short stacking energy: -75.117 Base-Backbone interact. energy: -1.031 local terms energy: -147.988510 where: bonds (distance) C4'-P energy: -37.916 bonds (distance) P-C4' energy: -44.437 flat angles C4'-P-C4' energy: -28.194 flat angles P-C4'-P energy: -30.621 tors. eta vs tors. theta energy: -6.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -782.090285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.090285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.090285 (E_RNA) where: Base-Base interactions energy: -519.472 where: short stacking energy: -234.239 Base-Backbone interact. energy: -2.252 local terms energy: -260.366520 where: bonds (distance) C4'-P energy: -48.900 bonds (distance) P-C4' energy: -56.155 flat angles C4'-P-C4' energy: -55.627 flat angles P-C4'-P energy: -42.803 tors. eta vs tors. theta energy: -56.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -719.116255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.116255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.116255 (E_RNA) where: Base-Base interactions energy: -481.984 where: short stacking energy: -246.142 Base-Backbone interact. energy: -0.624 local terms energy: -236.507721 where: bonds (distance) C4'-P energy: -42.514 bonds (distance) P-C4' energy: -46.193 flat angles C4'-P-C4' energy: -49.984 flat angles P-C4'-P energy: -37.112 tors. eta vs tors. theta energy: -60.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -732.398737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.398737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.398737 (E_RNA) where: Base-Base interactions energy: -488.769 where: short stacking energy: -222.138 Base-Backbone interact. energy: -0.776 local terms energy: -242.853797 where: bonds (distance) C4'-P energy: -46.103 bonds (distance) P-C4' energy: -49.426 flat angles C4'-P-C4' energy: -53.678 flat angles P-C4'-P energy: -32.469 tors. eta vs tors. theta energy: -61.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -726.642818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.642818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -726.642818 (E_RNA) where: Base-Base interactions energy: -495.023 where: short stacking energy: -233.513 Base-Backbone interact. energy: 2.524 local terms energy: -234.144341 where: bonds (distance) C4'-P energy: -41.855 bonds (distance) P-C4' energy: -46.655 flat angles C4'-P-C4' energy: -60.604 flat angles P-C4'-P energy: -22.851 tors. eta vs tors. theta energy: -62.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -541.002901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.002901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.002901 (E_RNA) where: Base-Base interactions energy: -349.936 where: short stacking energy: -169.058 Base-Backbone interact. energy: -3.052 local terms energy: -188.015120 where: bonds (distance) C4'-P energy: -34.946 bonds (distance) P-C4' energy: -46.447 flat angles C4'-P-C4' energy: -46.273 flat angles P-C4'-P energy: -28.586 tors. eta vs tors. theta energy: -31.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -516.665930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.665930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.665930 (E_RNA) where: Base-Base interactions energy: -328.924 where: short stacking energy: -162.723 Base-Backbone interact. energy: 4.161 local terms energy: -191.902937 where: bonds (distance) C4'-P energy: -39.337 bonds (distance) P-C4' energy: -41.988 flat angles C4'-P-C4' energy: -47.673 flat angles P-C4'-P energy: -31.821 tors. eta vs tors. theta energy: -31.085 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -413.484483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.484483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.484483 (E_RNA) where: Base-Base interactions energy: -230.012 where: short stacking energy: -142.094 Base-Backbone interact. energy: 0.023 local terms energy: -183.495453 where: bonds (distance) C4'-P energy: -37.493 bonds (distance) P-C4' energy: -43.442 flat angles C4'-P-C4' energy: -45.827 flat angles P-C4'-P energy: -30.736 tors. eta vs tors. theta energy: -25.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -378.176244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.176244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.176244 (E_RNA) where: Base-Base interactions energy: -206.010 where: short stacking energy: -122.375 Base-Backbone interact. energy: -0.461 local terms energy: -171.704864 where: bonds (distance) C4'-P energy: -46.748 bonds (distance) P-C4' energy: -41.140 flat angles C4'-P-C4' energy: -41.774 flat angles P-C4'-P energy: -21.171 tors. eta vs tors. theta energy: -20.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -357.266701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.266701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.266701 (E_RNA) where: Base-Base interactions energy: -190.790 where: short stacking energy: -115.592 Base-Backbone interact. energy: -0.364 local terms energy: -166.112838 where: bonds (distance) C4'-P energy: -32.986 bonds (distance) P-C4' energy: -49.113 flat angles C4'-P-C4' energy: -52.090 flat angles P-C4'-P energy: -22.126 tors. eta vs tors. theta energy: -9.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -229.865208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.865208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.865208 (E_RNA) where: Base-Base interactions energy: -92.607 where: short stacking energy: -87.256 Base-Backbone interact. energy: -1.680 local terms energy: -135.578862 where: bonds (distance) C4'-P energy: -46.132 bonds (distance) P-C4' energy: -44.056 flat angles C4'-P-C4' energy: -36.332 flat angles P-C4'-P energy: -14.025 tors. eta vs tors. theta energy: 4.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -779.498616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.498616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.498616 (E_RNA) where: Base-Base interactions energy: -535.014 where: short stacking energy: -233.863 Base-Backbone interact. energy: -2.313 local terms energy: -242.172274 where: bonds (distance) C4'-P energy: -44.046 bonds (distance) P-C4' energy: -45.355 flat angles C4'-P-C4' energy: -55.621 flat angles P-C4'-P energy: -37.123 tors. eta vs tors. theta energy: -60.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -735.346861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.346861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.346861 (E_RNA) where: Base-Base interactions energy: -506.543 where: short stacking energy: -214.860 Base-Backbone interact. energy: -2.479 local terms energy: -226.324540 where: bonds (distance) C4'-P energy: -38.005 bonds (distance) P-C4' energy: -50.531 flat angles C4'-P-C4' energy: -54.363 flat angles P-C4'-P energy: -36.198 tors. eta vs tors. theta energy: -47.227 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -739.847827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -739.847827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.847827 (E_RNA) where: Base-Base interactions energy: -507.935 where: short stacking energy: -206.431 Base-Backbone interact. energy: -0.754 local terms energy: -231.159237 where: bonds (distance) C4'-P energy: -55.442 bonds (distance) P-C4' energy: -48.265 flat angles C4'-P-C4' energy: -52.108 flat angles P-C4'-P energy: -25.847 tors. eta vs tors. theta energy: -49.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -665.153515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.153515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.153515 (E_RNA) where: Base-Base interactions energy: -436.503 where: short stacking energy: -190.546 Base-Backbone interact. energy: -0.323 local terms energy: -228.327299 where: bonds (distance) C4'-P energy: -44.190 bonds (distance) P-C4' energy: -38.781 flat angles C4'-P-C4' energy: -50.416 flat angles P-C4'-P energy: -34.822 tors. eta vs tors. theta energy: -60.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -560.801102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.801102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.801102 (E_RNA) where: Base-Base interactions energy: -374.584 where: short stacking energy: -170.708 Base-Backbone interact. energy: 0.685 local terms energy: -186.902307 where: bonds (distance) C4'-P energy: -36.503 bonds (distance) P-C4' energy: -45.078 flat angles C4'-P-C4' energy: -49.322 flat angles P-C4'-P energy: -27.710 tors. eta vs tors. theta energy: -28.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -540.856413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.856413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.856413 (E_RNA) where: Base-Base interactions energy: -335.121 where: short stacking energy: -173.631 Base-Backbone interact. energy: -0.523 local terms energy: -205.212858 where: bonds (distance) C4'-P energy: -47.113 bonds (distance) P-C4' energy: -45.991 flat angles C4'-P-C4' energy: -48.353 flat angles P-C4'-P energy: -25.768 tors. eta vs tors. theta energy: -37.988 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -426.538204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.538204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.538204 (E_RNA) where: Base-Base interactions energy: -230.435 where: short stacking energy: -121.204 Base-Backbone interact. energy: -1.178 local terms energy: -194.924737 where: bonds (distance) C4'-P energy: -42.185 bonds (distance) P-C4' energy: -46.795 flat angles C4'-P-C4' energy: -47.042 flat angles P-C4'-P energy: -31.190 tors. eta vs tors. theta energy: -27.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -396.326088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.326088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.326088 (E_RNA) where: Base-Base interactions energy: -218.534 where: short stacking energy: -122.199 Base-Backbone interact. energy: -0.256 local terms energy: -177.536563 where: bonds (distance) C4'-P energy: -49.634 bonds (distance) P-C4' energy: -34.784 flat angles C4'-P-C4' energy: -41.752 flat angles P-C4'-P energy: -27.614 tors. eta vs tors. theta energy: -23.753 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -272.893171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.893171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.893171 (E_RNA) where: Base-Base interactions energy: -97.400 where: short stacking energy: -95.103 Base-Backbone interact. energy: -0.464 local terms energy: -175.029485 where: bonds (distance) C4'-P energy: -40.186 bonds (distance) P-C4' energy: -46.274 flat angles C4'-P-C4' energy: -41.665 flat angles P-C4'-P energy: -33.919 tors. eta vs tors. theta energy: -12.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -312.806580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.806580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.806580 (E_RNA) where: Base-Base interactions energy: -163.816 where: short stacking energy: -111.450 Base-Backbone interact. energy: 5.174 local terms energy: -154.165063 where: bonds (distance) C4'-P energy: -36.872 bonds (distance) P-C4' energy: -43.408 flat angles C4'-P-C4' energy: -30.854 flat angles P-C4'-P energy: -25.552 tors. eta vs tors. theta energy: -17.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -788.687681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -788.687681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.687681 (E_RNA) where: Base-Base interactions energy: -538.608 where: short stacking energy: -225.764 Base-Backbone interact. energy: 0.697 local terms energy: -250.776024 where: bonds (distance) C4'-P energy: -50.768 bonds (distance) P-C4' energy: -55.423 flat angles C4'-P-C4' energy: -51.403 flat angles P-C4'-P energy: -36.987 tors. eta vs tors. theta energy: -56.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -776.493787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.493787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.493787 (E_RNA) where: Base-Base interactions energy: -540.422 where: short stacking energy: -237.778 Base-Backbone interact. energy: -0.978 local terms energy: -235.093328 where: bonds (distance) C4'-P energy: -35.493 bonds (distance) P-C4' energy: -49.437 flat angles C4'-P-C4' energy: -54.448 flat angles P-C4'-P energy: -32.096 tors. eta vs tors. theta energy: -63.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -720.285933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.285933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.285933 (E_RNA) where: Base-Base interactions energy: -495.460 where: short stacking energy: -206.868 Base-Backbone interact. energy: -2.014 local terms energy: -222.811308 where: bonds (distance) C4'-P energy: -45.106 bonds (distance) P-C4' energy: -44.713 flat angles C4'-P-C4' energy: -48.444 flat angles P-C4'-P energy: -42.114 tors. eta vs tors. theta energy: -42.435 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -671.069927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.069927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.069927 (E_RNA) where: Base-Base interactions energy: -443.657 where: short stacking energy: -204.078 Base-Backbone interact. energy: 2.202 local terms energy: -229.614643 where: bonds (distance) C4'-P energy: -44.574 bonds (distance) P-C4' energy: -47.356 flat angles C4'-P-C4' energy: -44.870 flat angles P-C4'-P energy: -41.011 tors. eta vs tors. theta energy: -51.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -572.232634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.232634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.232634 (E_RNA) where: Base-Base interactions energy: -373.992 where: short stacking energy: -192.230 Base-Backbone interact. energy: -0.620 local terms energy: -197.620572 where: bonds (distance) C4'-P energy: -30.098 bonds (distance) P-C4' energy: -45.746 flat angles C4'-P-C4' energy: -47.029 flat angles P-C4'-P energy: -31.460 tors. eta vs tors. theta energy: -43.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -526.331509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.331509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.331509 (E_RNA) where: Base-Base interactions energy: -350.250 where: short stacking energy: -152.202 Base-Backbone interact. energy: -1.662 local terms energy: -174.419126 where: bonds (distance) C4'-P energy: -45.236 bonds (distance) P-C4' energy: -46.950 flat angles C4'-P-C4' energy: -43.116 flat angles P-C4'-P energy: -22.295 tors. eta vs tors. theta energy: -16.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -462.245370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.245370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.245370 (E_RNA) where: Base-Base interactions energy: -279.855 where: short stacking energy: -154.636 Base-Backbone interact. energy: -1.035 local terms energy: -181.356098 where: bonds (distance) C4'-P energy: -41.554 bonds (distance) P-C4' energy: -47.217 flat angles C4'-P-C4' energy: -40.288 flat angles P-C4'-P energy: -22.877 tors. eta vs tors. theta energy: -29.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -376.761589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.761589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.761589 (E_RNA) where: Base-Base interactions energy: -197.631 where: short stacking energy: -108.176 Base-Backbone interact. energy: -0.624 local terms energy: -178.506704 where: bonds (distance) C4'-P energy: -44.981 bonds (distance) P-C4' energy: -48.073 flat angles C4'-P-C4' energy: -44.535 flat angles P-C4'-P energy: -31.834 tors. eta vs tors. theta energy: -9.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -228.667689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.667689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.667689 (E_RNA) where: Base-Base interactions energy: -86.330 where: short stacking energy: -74.457 Base-Backbone interact. energy: 0.601 local terms energy: -142.939044 where: bonds (distance) C4'-P energy: -42.162 bonds (distance) P-C4' energy: -45.273 flat angles C4'-P-C4' energy: -39.751 flat angles P-C4'-P energy: -25.527 tors. eta vs tors. theta energy: 9.775 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -265.665101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.665101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.665101 (E_RNA) where: Base-Base interactions energy: -103.204 where: short stacking energy: -81.987 Base-Backbone interact. energy: -0.983 local terms energy: -161.478203 where: bonds (distance) C4'-P energy: -37.851 bonds (distance) P-C4' energy: -42.201 flat angles C4'-P-C4' energy: -42.159 flat angles P-C4'-P energy: -26.269 tors. eta vs tors. theta energy: -13.000 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -801.308102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -801.308102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -801.308102 (E_RNA) where: Base-Base interactions energy: -536.672 where: short stacking energy: -246.135 Base-Backbone interact. energy: -0.329 local terms energy: -264.306898 where: bonds (distance) C4'-P energy: -52.370 bonds (distance) P-C4' energy: -51.553 flat angles C4'-P-C4' energy: -59.757 flat angles P-C4'-P energy: -35.591 tors. eta vs tors. theta energy: -65.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -776.623624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.623624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.623624 (E_RNA) where: Base-Base interactions energy: -520.686 where: short stacking energy: -217.684 Base-Backbone interact. energy: 0.593 local terms energy: -256.530971 where: bonds (distance) C4'-P energy: -55.801 bonds (distance) P-C4' energy: -51.998 flat angles C4'-P-C4' energy: -52.238 flat angles P-C4'-P energy: -37.620 tors. eta vs tors. theta energy: -58.874 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -749.992138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -749.992138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.992138 (E_RNA) where: Base-Base interactions energy: -512.709 where: short stacking energy: -241.461 Base-Backbone interact. energy: -1.330 local terms energy: -235.952341 where: bonds (distance) C4'-P energy: -42.610 bonds (distance) P-C4' energy: -55.633 flat angles C4'-P-C4' energy: -51.912 flat angles P-C4'-P energy: -19.332 tors. eta vs tors. theta energy: -66.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -677.145921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.145921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.145921 (E_RNA) where: Base-Base interactions energy: -442.348 where: short stacking energy: -220.772 Base-Backbone interact. energy: -1.387 local terms energy: -233.411493 where: bonds (distance) C4'-P energy: -51.268 bonds (distance) P-C4' energy: -41.232 flat angles C4'-P-C4' energy: -51.471 flat angles P-C4'-P energy: -31.211 tors. eta vs tors. theta energy: -58.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -554.009218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.009218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.009218 (E_RNA) where: Base-Base interactions energy: -358.975 where: short stacking energy: -163.887 Base-Backbone interact. energy: 0.810 local terms energy: -195.845006 where: bonds (distance) C4'-P energy: -39.382 bonds (distance) P-C4' energy: -49.484 flat angles C4'-P-C4' energy: -42.238 flat angles P-C4'-P energy: -34.966 tors. eta vs tors. theta energy: -29.775 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -561.191981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.191981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.191981 (E_RNA) where: Base-Base interactions energy: -375.257 where: short stacking energy: -174.857 Base-Backbone interact. energy: 0.504 local terms energy: -186.438552 where: bonds (distance) C4'-P energy: -37.046 bonds (distance) P-C4' energy: -40.841 flat angles C4'-P-C4' energy: -53.867 flat angles P-C4'-P energy: -25.747 tors. eta vs tors. theta energy: -28.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -495.678578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.678578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.678578 (E_RNA) where: Base-Base interactions energy: -290.746 where: short stacking energy: -144.785 Base-Backbone interact. energy: 1.108 local terms energy: -206.040109 where: bonds (distance) C4'-P energy: -46.884 bonds (distance) P-C4' energy: -48.993 flat angles C4'-P-C4' energy: -43.064 flat angles P-C4'-P energy: -34.404 tors. eta vs tors. theta energy: -32.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -351.455293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.455293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.455293 (E_RNA) where: Base-Base interactions energy: -190.657 where: short stacking energy: -114.732 Base-Backbone interact. energy: -1.604 local terms energy: -159.194480 where: bonds (distance) C4'-P energy: -38.487 bonds (distance) P-C4' energy: -46.484 flat angles C4'-P-C4' energy: -44.354 flat angles P-C4'-P energy: -18.772 tors. eta vs tors. theta energy: -11.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -249.002937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.002937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.002937 (E_RNA) where: Base-Base interactions energy: -99.811 where: short stacking energy: -83.252 Base-Backbone interact. energy: -0.371 local terms energy: -148.821262 where: bonds (distance) C4'-P energy: -45.624 bonds (distance) P-C4' energy: -41.142 flat angles C4'-P-C4' energy: -39.510 flat angles P-C4'-P energy: -21.874 tors. eta vs tors. theta energy: -0.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -239.299341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.299341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.299341 (E_RNA) where: Base-Base interactions energy: -105.199 where: short stacking energy: -74.713 Base-Backbone interact. energy: -0.838 local terms energy: -133.261426 where: bonds (distance) C4'-P energy: -33.654 bonds (distance) P-C4' energy: -42.124 flat angles C4'-P-C4' energy: -27.193 flat angles P-C4'-P energy: -23.467 tors. eta vs tors. theta energy: -6.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -760.690430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -760.690430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.690430 (E_RNA) where: Base-Base interactions energy: -531.966 where: short stacking energy: -216.599 Base-Backbone interact. energy: 1.091 local terms energy: -229.815333 where: bonds (distance) C4'-P energy: -46.917 bonds (distance) P-C4' energy: -38.743 flat angles C4'-P-C4' energy: -54.402 flat angles P-C4'-P energy: -39.734 tors. eta vs tors. theta energy: -50.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -758.263526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.263526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.263526 (E_RNA) where: Base-Base interactions energy: -517.267 where: short stacking energy: -218.465 Base-Backbone interact. energy: 0.030 local terms energy: -241.025964 where: bonds (distance) C4'-P energy: -53.476 bonds (distance) P-C4' energy: -44.745 flat angles C4'-P-C4' energy: -56.352 flat angles P-C4'-P energy: -34.412 tors. eta vs tors. theta energy: -52.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -759.539810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.539810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.539810 (E_RNA) where: Base-Base interactions energy: -516.048 where: short stacking energy: -225.161 Base-Backbone interact. energy: -1.122 local terms energy: -242.369611 where: bonds (distance) C4'-P energy: -46.874 bonds (distance) P-C4' energy: -50.482 flat angles C4'-P-C4' energy: -47.154 flat angles P-C4'-P energy: -31.760 tors. eta vs tors. theta energy: -66.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -708.333930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.333930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.333930 (E_RNA) where: Base-Base interactions energy: -466.962 where: short stacking energy: -213.941 Base-Backbone interact. energy: -1.205 local terms energy: -240.166227 where: bonds (distance) C4'-P energy: -50.746 bonds (distance) P-C4' energy: -51.418 flat angles C4'-P-C4' energy: -54.823 flat angles P-C4'-P energy: -32.766 tors. eta vs tors. theta energy: -50.414 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -554.882774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.882774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.882774 (E_RNA) where: Base-Base interactions energy: -361.690 where: short stacking energy: -183.381 Base-Backbone interact. energy: 0.635 local terms energy: -193.827480 where: bonds (distance) C4'-P energy: -43.221 bonds (distance) P-C4' energy: -42.085 flat angles C4'-P-C4' energy: -56.006 flat angles P-C4'-P energy: -28.024 tors. eta vs tors. theta energy: -24.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -550.563317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.563317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.563317 (E_RNA) where: Base-Base interactions energy: -359.514 where: short stacking energy: -165.954 Base-Backbone interact. energy: -1.037 local terms energy: -190.012270 where: bonds (distance) C4'-P energy: -34.170 bonds (distance) P-C4' energy: -48.870 flat angles C4'-P-C4' energy: -57.434 flat angles P-C4'-P energy: -31.444 tors. eta vs tors. theta energy: -18.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -521.131931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.131931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.131931 (E_RNA) where: Base-Base interactions energy: -318.714 where: short stacking energy: -171.945 Base-Backbone interact. energy: -0.765 local terms energy: -201.652941 where: bonds (distance) C4'-P energy: -38.576 bonds (distance) P-C4' energy: -53.319 flat angles C4'-P-C4' energy: -42.510 flat angles P-C4'-P energy: -30.247 tors. eta vs tors. theta energy: -37.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -398.248410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.248410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.248410 (E_RNA) where: Base-Base interactions energy: -221.627 where: short stacking energy: -125.689 Base-Backbone interact. energy: 2.968 local terms energy: -179.589106 where: bonds (distance) C4'-P energy: -31.461 bonds (distance) P-C4' energy: -42.421 flat angles C4'-P-C4' energy: -51.600 flat angles P-C4'-P energy: -34.266 tors. eta vs tors. theta energy: -19.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -250.670804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.670804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.670804 (E_RNA) where: Base-Base interactions energy: -112.675 where: short stacking energy: -77.557 Base-Backbone interact. energy: -1.587 local terms energy: -136.408648 where: bonds (distance) C4'-P energy: -31.604 bonds (distance) P-C4' energy: -46.105 flat angles C4'-P-C4' energy: -41.939 flat angles P-C4'-P energy: -19.616 tors. eta vs tors. theta energy: 2.854 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -215.699679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.699679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.699679 (E_RNA) where: Base-Base interactions energy: -77.699 where: short stacking energy: -65.346 Base-Backbone interact. energy: 2.232 local terms energy: -140.231961 where: bonds (distance) C4'-P energy: -39.475 bonds (distance) P-C4' energy: -41.160 flat angles C4'-P-C4' energy: -32.637 flat angles P-C4'-P energy: -26.281 tors. eta vs tors. theta energy: -0.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -784.571156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.571156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.571156 (E_RNA) where: Base-Base interactions energy: -527.476 where: short stacking energy: -232.506 Base-Backbone interact. energy: 0.141 local terms energy: -257.236198 where: bonds (distance) C4'-P energy: -52.556 bonds (distance) P-C4' energy: -57.400 flat angles C4'-P-C4' energy: -59.665 flat angles P-C4'-P energy: -29.179 tors. eta vs tors. theta energy: -58.436 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -769.890227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.890227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.890227 (E_RNA) where: Base-Base interactions energy: -532.332 where: short stacking energy: -223.065 Base-Backbone interact. energy: 0.345 local terms energy: -237.902855 where: bonds (distance) C4'-P energy: -44.445 bonds (distance) P-C4' energy: -47.188 flat angles C4'-P-C4' energy: -55.052 flat angles P-C4'-P energy: -32.489 tors. eta vs tors. theta energy: -58.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -789.887296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.887296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.887296 (E_RNA) where: Base-Base interactions energy: -538.943 where: short stacking energy: -225.980 Base-Backbone interact. energy: -1.944 local terms energy: -249.000385 where: bonds (distance) C4'-P energy: -42.889 bonds (distance) P-C4' energy: -46.271 flat angles C4'-P-C4' energy: -56.225 flat angles P-C4'-P energy: -41.620 tors. eta vs tors. theta energy: -61.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -682.702685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.702685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.702685 (E_RNA) where: Base-Base interactions energy: -464.396 where: short stacking energy: -202.385 Base-Backbone interact. energy: -0.025 local terms energy: -218.281991 where: bonds (distance) C4'-P energy: -35.497 bonds (distance) P-C4' energy: -48.536 flat angles C4'-P-C4' energy: -48.346 flat angles P-C4'-P energy: -39.701 tors. eta vs tors. theta energy: -46.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -585.473958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.473958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.473958 (E_RNA) where: Base-Base interactions energy: -376.269 where: short stacking energy: -167.904 Base-Backbone interact. energy: -0.854 local terms energy: -208.351608 where: bonds (distance) C4'-P energy: -45.497 bonds (distance) P-C4' energy: -52.003 flat angles C4'-P-C4' energy: -51.914 flat angles P-C4'-P energy: -28.259 tors. eta vs tors. theta energy: -30.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -541.487745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.487745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.487745 (E_RNA) where: Base-Base interactions energy: -345.830 where: short stacking energy: -160.878 Base-Backbone interact. energy: -1.804 local terms energy: -193.853121 where: bonds (distance) C4'-P energy: -48.764 bonds (distance) P-C4' energy: -43.596 flat angles C4'-P-C4' energy: -48.070 flat angles P-C4'-P energy: -23.224 tors. eta vs tors. theta energy: -30.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -498.150835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.150835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.150835 (E_RNA) where: Base-Base interactions energy: -314.146 where: short stacking energy: -158.356 Base-Backbone interact. energy: 0.150 local terms energy: -184.155002 where: bonds (distance) C4'-P energy: -36.462 bonds (distance) P-C4' energy: -47.760 flat angles C4'-P-C4' energy: -43.963 flat angles P-C4'-P energy: -20.953 tors. eta vs tors. theta energy: -35.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -386.566615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.566615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.566615 (E_RNA) where: Base-Base interactions energy: -221.794 where: short stacking energy: -117.440 Base-Backbone interact. energy: 0.950 local terms energy: -165.722494 where: bonds (distance) C4'-P energy: -32.394 bonds (distance) P-C4' energy: -46.221 flat angles C4'-P-C4' energy: -39.319 flat angles P-C4'-P energy: -24.623 tors. eta vs tors. theta energy: -23.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -250.142031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.142031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.142031 (E_RNA) where: Base-Base interactions energy: -91.489 where: short stacking energy: -85.914 Base-Backbone interact. energy: 2.333 local terms energy: -160.986031 where: bonds (distance) C4'-P energy: -37.397 bonds (distance) P-C4' energy: -49.617 flat angles C4'-P-C4' energy: -41.332 flat angles P-C4'-P energy: -24.110 tors. eta vs tors. theta energy: -8.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -218.142791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.142791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.142791 (E_RNA) where: Base-Base interactions energy: -71.365 where: short stacking energy: -53.519 Base-Backbone interact. energy: -0.058 local terms energy: -146.720317 where: bonds (distance) C4'-P energy: -43.692 bonds (distance) P-C4' energy: -52.579 flat angles C4'-P-C4' energy: -42.820 flat angles P-C4'-P energy: -14.756 tors. eta vs tors. theta energy: 7.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -772.506106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.506106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.506106 (E_RNA) where: Base-Base interactions energy: -532.393 where: short stacking energy: -235.596 Base-Backbone interact. energy: -0.086 local terms energy: -240.026755 where: bonds (distance) C4'-P energy: -43.391 bonds (distance) P-C4' energy: -44.718 flat angles C4'-P-C4' energy: -52.480 flat angles P-C4'-P energy: -42.242 tors. eta vs tors. theta energy: -57.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -783.823658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.823658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.823658 (E_RNA) where: Base-Base interactions energy: -535.828 where: short stacking energy: -223.241 Base-Backbone interact. energy: -1.078 local terms energy: -246.917014 where: bonds (distance) C4'-P energy: -46.413 bonds (distance) P-C4' energy: -55.147 flat angles C4'-P-C4' energy: -55.523 flat angles P-C4'-P energy: -33.117 tors. eta vs tors. theta energy: -56.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -785.358553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.358553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.358553 (E_RNA) where: Base-Base interactions energy: -538.248 where: short stacking energy: -244.529 Base-Backbone interact. energy: -0.929 local terms energy: -246.181151 where: bonds (distance) C4'-P energy: -40.184 bonds (distance) P-C4' energy: -52.602 flat angles C4'-P-C4' energy: -47.414 flat angles P-C4'-P energy: -36.725 tors. eta vs tors. theta energy: -69.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -702.136890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.136890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.136890 (E_RNA) where: Base-Base interactions energy: -464.927 where: short stacking energy: -208.737 Base-Backbone interact. energy: -1.103 local terms energy: -236.107383 where: bonds (distance) C4'-P energy: -40.885 bonds (distance) P-C4' energy: -52.179 flat angles C4'-P-C4' energy: -50.037 flat angles P-C4'-P energy: -35.886 tors. eta vs tors. theta energy: -57.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -574.993050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.993050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.993050 (E_RNA) where: Base-Base interactions energy: -373.254 where: short stacking energy: -189.195 Base-Backbone interact. energy: 1.149 local terms energy: -202.888410 where: bonds (distance) C4'-P energy: -37.085 bonds (distance) P-C4' energy: -49.673 flat angles C4'-P-C4' energy: -39.229 flat angles P-C4'-P energy: -36.209 tors. eta vs tors. theta energy: -40.691 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -522.408979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.408979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.408979 (E_RNA) where: Base-Base interactions energy: -316.826 where: short stacking energy: -144.864 Base-Backbone interact. energy: 0.223 local terms energy: -205.805759 where: bonds (distance) C4'-P energy: -44.517 bonds (distance) P-C4' energy: -42.419 flat angles C4'-P-C4' energy: -51.690 flat angles P-C4'-P energy: -33.127 tors. eta vs tors. theta energy: -34.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -427.631075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.631075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.631075 (E_RNA) where: Base-Base interactions energy: -245.569 where: short stacking energy: -143.031 Base-Backbone interact. energy: -1.653 local terms energy: -180.408731 where: bonds (distance) C4'-P energy: -35.817 bonds (distance) P-C4' energy: -40.144 flat angles C4'-P-C4' energy: -40.556 flat angles P-C4'-P energy: -32.147 tors. eta vs tors. theta energy: -31.745 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -403.276833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.276833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.276833 (E_RNA) where: Base-Base interactions energy: -229.944 where: short stacking energy: -130.244 Base-Backbone interact. energy: -0.823 local terms energy: -172.509873 where: bonds (distance) C4'-P energy: -36.892 bonds (distance) P-C4' energy: -46.558 flat angles C4'-P-C4' energy: -42.082 flat angles P-C4'-P energy: -26.214 tors. eta vs tors. theta energy: -20.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -249.050870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.050870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.050870 (E_RNA) where: Base-Base interactions energy: -105.374 where: short stacking energy: -64.432 Base-Backbone interact. energy: 0.376 local terms energy: -144.052417 where: bonds (distance) C4'-P energy: -40.640 bonds (distance) P-C4' energy: -46.614 flat angles C4'-P-C4' energy: -39.064 flat angles P-C4'-P energy: -19.845 tors. eta vs tors. theta energy: 2.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -220.243567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.243567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.243567 (E_RNA) where: Base-Base interactions energy: -73.923 where: short stacking energy: -57.172 Base-Backbone interact. energy: -0.866 local terms energy: -145.454138 where: bonds (distance) C4'-P energy: -42.393 bonds (distance) P-C4' energy: -46.587 flat angles C4'-P-C4' energy: -30.227 flat angles P-C4'-P energy: -26.302 tors. eta vs tors. theta energy: 0.056 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -784.893252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.893252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.893252 (E_RNA) where: Base-Base interactions energy: -524.161 where: short stacking energy: -231.553 Base-Backbone interact. energy: -3.360 local terms energy: -257.372508 where: bonds (distance) C4'-P energy: -47.100 bonds (distance) P-C4' energy: -54.376 flat angles C4'-P-C4' energy: -58.901 flat angles P-C4'-P energy: -39.901 tors. eta vs tors. theta energy: -57.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -775.964615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.964615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.964615 (E_RNA) where: Base-Base interactions energy: -526.456 where: short stacking energy: -210.842 Base-Backbone interact. energy: 0.663 local terms energy: -250.171581 where: bonds (distance) C4'-P energy: -46.182 bonds (distance) P-C4' energy: -52.801 flat angles C4'-P-C4' energy: -58.381 flat angles P-C4'-P energy: -38.244 tors. eta vs tors. theta energy: -54.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -801.286773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -801.286773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -801.286773 (E_RNA) where: Base-Base interactions energy: -526.757 where: short stacking energy: -244.306 Base-Backbone interact. energy: -0.956 local terms energy: -273.574222 where: bonds (distance) C4'-P energy: -56.034 bonds (distance) P-C4' energy: -54.172 flat angles C4'-P-C4' energy: -53.561 flat angles P-C4'-P energy: -38.008 tors. eta vs tors. theta energy: -71.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -699.432502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.432502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.432502 (E_RNA) where: Base-Base interactions energy: -464.520 where: short stacking energy: -210.187 Base-Backbone interact. energy: -0.862 local terms energy: -234.050900 where: bonds (distance) C4'-P energy: -43.439 bonds (distance) P-C4' energy: -42.227 flat angles C4'-P-C4' energy: -52.583 flat angles P-C4'-P energy: -37.416 tors. eta vs tors. theta energy: -58.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -579.252372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.252372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.252372 (E_RNA) where: Base-Base interactions energy: -364.826 where: short stacking energy: -153.211 Base-Backbone interact. energy: -1.214 local terms energy: -213.212987 where: bonds (distance) C4'-P energy: -45.344 bonds (distance) P-C4' energy: -51.077 flat angles C4'-P-C4' energy: -53.504 flat angles P-C4'-P energy: -27.325 tors. eta vs tors. theta energy: -35.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -543.440102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.440102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.440102 (E_RNA) where: Base-Base interactions energy: -359.818 where: short stacking energy: -177.788 Base-Backbone interact. energy: 0.764 local terms energy: -184.385619 where: bonds (distance) C4'-P energy: -37.482 bonds (distance) P-C4' energy: -45.140 flat angles C4'-P-C4' energy: -39.651 flat angles P-C4'-P energy: -31.249 tors. eta vs tors. theta energy: -30.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -482.176300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.176300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.176300 (E_RNA) where: Base-Base interactions energy: -300.604 where: short stacking energy: -144.229 Base-Backbone interact. energy: 0.710 local terms energy: -182.282223 where: bonds (distance) C4'-P energy: -43.874 bonds (distance) P-C4' energy: -44.715 flat angles C4'-P-C4' energy: -39.295 flat angles P-C4'-P energy: -31.989 tors. eta vs tors. theta energy: -22.409 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -411.549435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.549435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.549435 (E_RNA) where: Base-Base interactions energy: -234.453 where: short stacking energy: -117.521 Base-Backbone interact. energy: -0.817 local terms energy: -176.279745 where: bonds (distance) C4'-P energy: -50.765 bonds (distance) P-C4' energy: -44.897 flat angles C4'-P-C4' energy: -32.980 flat angles P-C4'-P energy: -28.018 tors. eta vs tors. theta energy: -19.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -261.874525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.874525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.874525 (E_RNA) where: Base-Base interactions energy: -123.337 where: short stacking energy: -101.757 Base-Backbone interact. energy: 1.674 local terms energy: -140.211942 where: bonds (distance) C4'-P energy: -36.420 bonds (distance) P-C4' energy: -35.147 flat angles C4'-P-C4' energy: -33.823 flat angles P-C4'-P energy: -25.050 tors. eta vs tors. theta energy: -9.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -236.072191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.072191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.072191 (E_RNA) where: Base-Base interactions energy: -91.034 where: short stacking energy: -51.707 Base-Backbone interact. energy: -0.703 local terms energy: -144.335341 where: bonds (distance) C4'-P energy: -32.670 bonds (distance) P-C4' energy: -55.711 flat angles C4'-P-C4' energy: -41.202 flat angles P-C4'-P energy: -13.722 tors. eta vs tors. theta energy: -1.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -785.535305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.535305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.535305 (E_RNA) where: Base-Base interactions energy: -545.385 where: short stacking energy: -236.717 Base-Backbone interact. energy: -1.401 local terms energy: -238.748727 where: bonds (distance) C4'-P energy: -46.861 bonds (distance) P-C4' energy: -41.978 flat angles C4'-P-C4' energy: -56.486 flat angles P-C4'-P energy: -35.927 tors. eta vs tors. theta energy: -57.497 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -810.006735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.006735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -810.006735 (E_RNA) where: Base-Base interactions energy: -541.621 where: short stacking energy: -246.492 Base-Backbone interact. energy: -0.665 local terms energy: -267.720082 where: bonds (distance) C4'-P energy: -46.593 bonds (distance) P-C4' energy: -51.861 flat angles C4'-P-C4' energy: -56.653 flat angles P-C4'-P energy: -41.130 tors. eta vs tors. theta energy: -71.483 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -755.844905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.844905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.844905 (E_RNA) where: Base-Base interactions energy: -518.178 where: short stacking energy: -214.361 Base-Backbone interact. energy: -0.896 local terms energy: -236.771185 where: bonds (distance) C4'-P energy: -48.391 bonds (distance) P-C4' energy: -49.617 flat angles C4'-P-C4' energy: -55.556 flat angles P-C4'-P energy: -35.896 tors. eta vs tors. theta energy: -47.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -707.018224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.018224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.018224 (E_RNA) where: Base-Base interactions energy: -480.314 where: short stacking energy: -211.522 Base-Backbone interact. energy: -1.343 local terms energy: -225.361601 where: bonds (distance) C4'-P energy: -39.174 bonds (distance) P-C4' energy: -45.406 flat angles C4'-P-C4' energy: -49.222 flat angles P-C4'-P energy: -32.196 tors. eta vs tors. theta energy: -59.364 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -596.138028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.138028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.138028 (E_RNA) where: Base-Base interactions energy: -396.821 where: short stacking energy: -174.108 Base-Backbone interact. energy: 0.450 local terms energy: -199.767078 where: bonds (distance) C4'-P energy: -38.347 bonds (distance) P-C4' energy: -45.258 flat angles C4'-P-C4' energy: -47.554 flat angles P-C4'-P energy: -33.309 tors. eta vs tors. theta energy: -35.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -522.120629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.120629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.120629 (E_RNA) where: Base-Base interactions energy: -321.942 where: short stacking energy: -164.691 Base-Backbone interact. energy: -0.041 local terms energy: -200.138028 where: bonds (distance) C4'-P energy: -47.388 bonds (distance) P-C4' energy: -42.869 flat angles C4'-P-C4' energy: -44.696 flat angles P-C4'-P energy: -26.757 tors. eta vs tors. theta energy: -38.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -461.804997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.804997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.804997 (E_RNA) where: Base-Base interactions energy: -273.105 where: short stacking energy: -132.093 Base-Backbone interact. energy: -1.909 local terms energy: -186.791086 where: bonds (distance) C4'-P energy: -35.280 bonds (distance) P-C4' energy: -50.939 flat angles C4'-P-C4' energy: -39.652 flat angles P-C4'-P energy: -31.120 tors. eta vs tors. theta energy: -29.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -386.226805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.226805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.226805 (E_RNA) where: Base-Base interactions energy: -205.115 where: short stacking energy: -123.789 Base-Backbone interact. energy: -1.710 local terms energy: -179.402628 where: bonds (distance) C4'-P energy: -44.569 bonds (distance) P-C4' energy: -47.229 flat angles C4'-P-C4' energy: -40.212 flat angles P-C4'-P energy: -24.143 tors. eta vs tors. theta energy: -23.250 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -275.680656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.680656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.680656 (E_RNA) where: Base-Base interactions energy: -140.040 where: short stacking energy: -85.698 Base-Backbone interact. energy: 0.164 local terms energy: -135.804657 where: bonds (distance) C4'-P energy: -36.583 bonds (distance) P-C4' energy: -44.746 flat angles C4'-P-C4' energy: -22.165 flat angles P-C4'-P energy: -32.102 tors. eta vs tors. theta energy: -0.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -229.000317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.000317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.000317 (E_RNA) where: Base-Base interactions energy: -70.759 where: short stacking energy: -58.408 Base-Backbone interact. energy: -1.457 local terms energy: -156.784579 where: bonds (distance) C4'-P energy: -41.037 bonds (distance) P-C4' energy: -49.142 flat angles C4'-P-C4' energy: -45.508 flat angles P-C4'-P energy: -23.251 tors. eta vs tors. theta energy: 2.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -825.259273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -825.259273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -825.259273 (E_RNA) where: Base-Base interactions energy: -554.179 where: short stacking energy: -249.319 Base-Backbone interact. energy: -0.606 local terms energy: -270.473512 where: bonds (distance) C4'-P energy: -51.697 bonds (distance) P-C4' energy: -51.164 flat angles C4'-P-C4' energy: -54.120 flat angles P-C4'-P energy: -39.947 tors. eta vs tors. theta energy: -73.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -777.405515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.405515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.405515 (E_RNA) where: Base-Base interactions energy: -529.529 where: short stacking energy: -214.217 Base-Backbone interact. energy: -2.148 local terms energy: -245.728708 where: bonds (distance) C4'-P energy: -46.694 bonds (distance) P-C4' energy: -53.342 flat angles C4'-P-C4' energy: -47.818 flat angles P-C4'-P energy: -42.186 tors. eta vs tors. theta energy: -55.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -770.129138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.129138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.129138 (E_RNA) where: Base-Base interactions energy: -518.372 where: short stacking energy: -234.351 Base-Backbone interact. energy: -0.831 local terms energy: -250.926124 where: bonds (distance) C4'-P energy: -55.267 bonds (distance) P-C4' energy: -46.946 flat angles C4'-P-C4' energy: -47.775 flat angles P-C4'-P energy: -32.074 tors. eta vs tors. theta energy: -68.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -718.974883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.974883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.974883 (E_RNA) where: Base-Base interactions energy: -478.678 where: short stacking energy: -199.229 Base-Backbone interact. energy: -0.350 local terms energy: -239.946831 where: bonds (distance) C4'-P energy: -41.655 bonds (distance) P-C4' energy: -50.064 flat angles C4'-P-C4' energy: -51.696 flat angles P-C4'-P energy: -39.569 tors. eta vs tors. theta energy: -56.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -634.061905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -634.061905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -634.061905 (E_RNA) where: Base-Base interactions energy: -411.957 where: short stacking energy: -183.558 Base-Backbone interact. energy: 2.339 local terms energy: -224.443844 where: bonds (distance) C4'-P energy: -46.021 bonds (distance) P-C4' energy: -53.222 flat angles C4'-P-C4' energy: -53.439 flat angles P-C4'-P energy: -25.395 tors. eta vs tors. theta energy: -46.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -549.328124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.328124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.328124 (E_RNA) where: Base-Base interactions energy: -331.965 where: short stacking energy: -181.649 Base-Backbone interact. energy: 0.489 local terms energy: -217.851707 where: bonds (distance) C4'-P energy: -45.934 bonds (distance) P-C4' energy: -50.553 flat angles C4'-P-C4' energy: -48.097 flat angles P-C4'-P energy: -32.767 tors. eta vs tors. theta energy: -40.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -449.815555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.815555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.815555 (E_RNA) where: Base-Base interactions energy: -251.314 where: short stacking energy: -137.888 Base-Backbone interact. energy: -1.197 local terms energy: -197.304662 where: bonds (distance) C4'-P energy: -51.750 bonds (distance) P-C4' energy: -47.329 flat angles C4'-P-C4' energy: -42.645 flat angles P-C4'-P energy: -20.923 tors. eta vs tors. theta energy: -34.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -469.709060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.709060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.709060 (E_RNA) where: Base-Base interactions energy: -287.188 where: short stacking energy: -144.790 Base-Backbone interact. energy: -0.184 local terms energy: -182.337693 where: bonds (distance) C4'-P energy: -43.428 bonds (distance) P-C4' energy: -48.059 flat angles C4'-P-C4' energy: -39.761 flat angles P-C4'-P energy: -29.510 tors. eta vs tors. theta energy: -21.580 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -273.489656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.489656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.489656 (E_RNA) where: Base-Base interactions energy: -132.418 where: short stacking energy: -95.935 Base-Backbone interact. energy: -0.781 local terms energy: -140.290437 where: bonds (distance) C4'-P energy: -36.539 bonds (distance) P-C4' energy: -41.250 flat angles C4'-P-C4' energy: -34.136 flat angles P-C4'-P energy: -20.902 tors. eta vs tors. theta energy: -7.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -264.281232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.281232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.281232 (E_RNA) where: Base-Base interactions energy: -132.631 where: short stacking energy: -70.644 Base-Backbone interact. energy: 0.112 local terms energy: -131.761832 where: bonds (distance) C4'-P energy: -37.703 bonds (distance) P-C4' energy: -33.019 flat angles C4'-P-C4' energy: -44.790 flat angles P-C4'-P energy: -22.102 tors. eta vs tors. theta energy: 5.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -841.426186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.426186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.426186 (E_RNA) where: Base-Base interactions energy: -579.154 where: short stacking energy: -259.952 Base-Backbone interact. energy: -2.234 local terms energy: -260.038159 where: bonds (distance) C4'-P energy: -52.246 bonds (distance) P-C4' energy: -50.602 flat angles C4'-P-C4' energy: -55.646 flat angles P-C4'-P energy: -31.230 tors. eta vs tors. theta energy: -70.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -784.996450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.996450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.996450 (E_RNA) where: Base-Base interactions energy: -542.299 where: short stacking energy: -217.974 Base-Backbone interact. energy: -0.999 local terms energy: -241.698789 where: bonds (distance) C4'-P energy: -51.014 bonds (distance) P-C4' energy: -46.643 flat angles C4'-P-C4' energy: -49.233 flat angles P-C4'-P energy: -32.423 tors. eta vs tors. theta energy: -62.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -755.445730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.445730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.445730 (E_RNA) where: Base-Base interactions energy: -504.131 where: short stacking energy: -239.888 Base-Backbone interact. energy: -0.681 local terms energy: -250.633887 where: bonds (distance) C4'-P energy: -51.348 bonds (distance) P-C4' energy: -45.856 flat angles C4'-P-C4' energy: -46.992 flat angles P-C4'-P energy: -35.455 tors. eta vs tors. theta energy: -70.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -728.990645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.990645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.990645 (E_RNA) where: Base-Base interactions energy: -516.566 where: short stacking energy: -204.609 Base-Backbone interact. energy: 0.655 local terms energy: -213.079301 where: bonds (distance) C4'-P energy: -39.360 bonds (distance) P-C4' energy: -43.485 flat angles C4'-P-C4' energy: -50.517 flat angles P-C4'-P energy: -28.529 tors. eta vs tors. theta energy: -51.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -632.609606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -632.609606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.609606 (E_RNA) where: Base-Base interactions energy: -433.445 where: short stacking energy: -186.177 Base-Backbone interact. energy: 0.478 local terms energy: -199.642669 where: bonds (distance) C4'-P energy: -38.858 bonds (distance) P-C4' energy: -41.526 flat angles C4'-P-C4' energy: -48.961 flat angles P-C4'-P energy: -32.705 tors. eta vs tors. theta energy: -37.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -538.990720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.990720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.990720 (E_RNA) where: Base-Base interactions energy: -346.108 where: short stacking energy: -161.850 Base-Backbone interact. energy: -1.112 local terms energy: -191.770986 where: bonds (distance) C4'-P energy: -41.980 bonds (distance) P-C4' energy: -44.741 flat angles C4'-P-C4' energy: -41.453 flat angles P-C4'-P energy: -28.273 tors. eta vs tors. theta energy: -35.324 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -440.965004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.965004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.965004 (E_RNA) where: Base-Base interactions energy: -245.780 where: short stacking energy: -147.002 Base-Backbone interact. energy: -1.914 local terms energy: -193.271383 where: bonds (distance) C4'-P energy: -45.829 bonds (distance) P-C4' energy: -42.084 flat angles C4'-P-C4' energy: -49.417 flat angles P-C4'-P energy: -17.602 tors. eta vs tors. theta energy: -38.341 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -412.200976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.200976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.200976 (E_RNA) where: Base-Base interactions energy: -238.263 where: short stacking energy: -117.901 Base-Backbone interact. energy: 1.478 local terms energy: -175.415877 where: bonds (distance) C4'-P energy: -34.158 bonds (distance) P-C4' energy: -43.366 flat angles C4'-P-C4' energy: -45.065 flat angles P-C4'-P energy: -25.403 tors. eta vs tors. theta energy: -27.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -263.360256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.360256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.360256 (E_RNA) where: Base-Base interactions energy: -119.061 where: short stacking energy: -74.581 Base-Backbone interact. energy: -0.242 local terms energy: -144.057130 where: bonds (distance) C4'-P energy: -35.724 bonds (distance) P-C4' energy: -44.975 flat angles C4'-P-C4' energy: -37.406 flat angles P-C4'-P energy: -27.286 tors. eta vs tors. theta energy: 1.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -240.303877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.303877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.303877 (E_RNA) where: Base-Base interactions energy: -107.094 where: short stacking energy: -83.443 Base-Backbone interact. energy: 1.635 local terms energy: -134.844271 where: bonds (distance) C4'-P energy: -49.292 bonds (distance) P-C4' energy: -44.853 flat angles C4'-P-C4' energy: -29.228 flat angles P-C4'-P energy: -12.869 tors. eta vs tors. theta energy: 1.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -814.359200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.359200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.359200 (E_RNA) where: Base-Base interactions energy: -553.435 where: short stacking energy: -237.829 Base-Backbone interact. energy: -1.614 local terms energy: -259.309971 where: bonds (distance) C4'-P energy: -49.304 bonds (distance) P-C4' energy: -51.351 flat angles C4'-P-C4' energy: -53.640 flat angles P-C4'-P energy: -38.104 tors. eta vs tors. theta energy: -66.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -796.812370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -796.812370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -796.812370 (E_RNA) where: Base-Base interactions energy: -559.158 where: short stacking energy: -222.001 Base-Backbone interact. energy: -0.901 local terms energy: -236.753695 where: bonds (distance) C4'-P energy: -45.608 bonds (distance) P-C4' energy: -52.033 flat angles C4'-P-C4' energy: -54.141 flat angles P-C4'-P energy: -29.687 tors. eta vs tors. theta energy: -55.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -755.166205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.166205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.166205 (E_RNA) where: Base-Base interactions energy: -510.822 where: short stacking energy: -227.686 Base-Backbone interact. energy: -1.445 local terms energy: -242.899384 where: bonds (distance) C4'-P energy: -44.252 bonds (distance) P-C4' energy: -54.431 flat angles C4'-P-C4' energy: -54.126 flat angles P-C4'-P energy: -30.791 tors. eta vs tors. theta energy: -59.299 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -736.573798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.573798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.573798 (E_RNA) where: Base-Base interactions energy: -501.262 where: short stacking energy: -209.623 Base-Backbone interact. energy: -1.597 local terms energy: -233.715555 where: bonds (distance) C4'-P energy: -46.269 bonds (distance) P-C4' energy: -41.356 flat angles C4'-P-C4' energy: -53.914 flat angles P-C4'-P energy: -39.285 tors. eta vs tors. theta energy: -52.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -655.396488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.396488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.396488 (E_RNA) where: Base-Base interactions energy: -437.890 where: short stacking energy: -177.618 Base-Backbone interact. energy: -0.706 local terms energy: -216.800907 where: bonds (distance) C4'-P energy: -42.676 bonds (distance) P-C4' energy: -51.834 flat angles C4'-P-C4' energy: -48.185 flat angles P-C4'-P energy: -32.862 tors. eta vs tors. theta energy: -41.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -576.868884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.868884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.868884 (E_RNA) where: Base-Base interactions energy: -368.020 where: short stacking energy: -166.062 Base-Backbone interact. energy: -2.065 local terms energy: -206.784062 where: bonds (distance) C4'-P energy: -43.122 bonds (distance) P-C4' energy: -47.306 flat angles C4'-P-C4' energy: -42.752 flat angles P-C4'-P energy: -32.516 tors. eta vs tors. theta energy: -41.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -523.464509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.464509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.464509 (E_RNA) where: Base-Base interactions energy: -329.305 where: short stacking energy: -160.699 Base-Backbone interact. energy: 0.390 local terms energy: -194.549469 where: bonds (distance) C4'-P energy: -38.654 bonds (distance) P-C4' energy: -46.690 flat angles C4'-P-C4' energy: -48.994 flat angles P-C4'-P energy: -29.597 tors. eta vs tors. theta energy: -30.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -408.243841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.243841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.243841 (E_RNA) where: Base-Base interactions energy: -237.629 where: short stacking energy: -138.089 Base-Backbone interact. energy: -1.330 local terms energy: -169.284481 where: bonds (distance) C4'-P energy: -33.659 bonds (distance) P-C4' energy: -46.996 flat angles C4'-P-C4' energy: -40.379 flat angles P-C4'-P energy: -15.958 tors. eta vs tors. theta energy: -32.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -247.975450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.975450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.975450 (E_RNA) where: Base-Base interactions energy: -103.765 where: short stacking energy: -78.950 Base-Backbone interact. energy: -0.014 local terms energy: -144.196589 where: bonds (distance) C4'-P energy: -36.968 bonds (distance) P-C4' energy: -41.517 flat angles C4'-P-C4' energy: -47.546 flat angles P-C4'-P energy: -27.712 tors. eta vs tors. theta energy: 9.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -255.183931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.183931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.183931 (E_RNA) where: Base-Base interactions energy: -116.387 where: short stacking energy: -84.942 Base-Backbone interact. energy: 2.583 local terms energy: -141.379695 where: bonds (distance) C4'-P energy: -39.474 bonds (distance) P-C4' energy: -45.630 flat angles C4'-P-C4' energy: -36.306 flat angles P-C4'-P energy: -17.577 tors. eta vs tors. theta energy: -2.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -828.934571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -828.934571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -828.934571 (E_RNA) where: Base-Base interactions energy: -559.065 where: short stacking energy: -237.127 Base-Backbone interact. energy: -0.355 local terms energy: -269.514100 where: bonds (distance) C4'-P energy: -50.231 bonds (distance) P-C4' energy: -57.579 flat angles C4'-P-C4' energy: -52.228 flat angles P-C4'-P energy: -44.027 tors. eta vs tors. theta energy: -65.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -778.054035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.054035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.054035 (E_RNA) where: Base-Base interactions energy: -522.372 where: short stacking energy: -234.812 Base-Backbone interact. energy: -0.048 local terms energy: -255.634266 where: bonds (distance) C4'-P energy: -46.673 bonds (distance) P-C4' energy: -51.703 flat angles C4'-P-C4' energy: -57.090 flat angles P-C4'-P energy: -40.438 tors. eta vs tors. theta energy: -59.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -763.990275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.990275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.990275 (E_RNA) where: Base-Base interactions energy: -505.330 where: short stacking energy: -222.300 Base-Backbone interact. energy: 0.564 local terms energy: -259.225031 where: bonds (distance) C4'-P energy: -47.923 bonds (distance) P-C4' energy: -56.900 flat angles C4'-P-C4' energy: -57.041 flat angles P-C4'-P energy: -35.323 tors. eta vs tors. theta energy: -62.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -734.758955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.758955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.758955 (E_RNA) where: Base-Base interactions energy: -510.002 where: short stacking energy: -200.913 Base-Backbone interact. energy: -0.278 local terms energy: -224.479352 where: bonds (distance) C4'-P energy: -46.696 bonds (distance) P-C4' energy: -45.533 flat angles C4'-P-C4' energy: -55.955 flat angles P-C4'-P energy: -25.330 tors. eta vs tors. theta energy: -50.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -644.259347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.259347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.259347 (E_RNA) where: Base-Base interactions energy: -432.500 where: short stacking energy: -171.054 Base-Backbone interact. energy: -0.584 local terms energy: -211.175315 where: bonds (distance) C4'-P energy: -51.020 bonds (distance) P-C4' energy: -43.191 flat angles C4'-P-C4' energy: -48.658 flat angles P-C4'-P energy: -26.682 tors. eta vs tors. theta energy: -41.624 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -533.672498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.672498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.672498 (E_RNA) where: Base-Base interactions energy: -351.224 where: short stacking energy: -145.555 Base-Backbone interact. energy: -1.307 local terms energy: -181.141206 where: bonds (distance) C4'-P energy: -43.791 bonds (distance) P-C4' energy: -49.481 flat angles C4'-P-C4' energy: -34.282 flat angles P-C4'-P energy: -19.716 tors. eta vs tors. theta energy: -33.871 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -560.746878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.746878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.746878 (E_RNA) where: Base-Base interactions energy: -383.161 where: short stacking energy: -181.105 Base-Backbone interact. energy: -0.317 local terms energy: -177.268338 where: bonds (distance) C4'-P energy: -38.395 bonds (distance) P-C4' energy: -28.384 flat angles C4'-P-C4' energy: -43.851 flat angles P-C4'-P energy: -35.470 tors. eta vs tors. theta energy: -31.169 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -397.740310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.740310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.740310 (E_RNA) where: Base-Base interactions energy: -232.323 where: short stacking energy: -121.416 Base-Backbone interact. energy: 1.060 local terms energy: -166.477542 where: bonds (distance) C4'-P energy: -37.164 bonds (distance) P-C4' energy: -46.027 flat angles C4'-P-C4' energy: -36.931 flat angles P-C4'-P energy: -25.512 tors. eta vs tors. theta energy: -20.843 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -249.586007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.586007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.586007 (E_RNA) where: Base-Base interactions energy: -87.726 where: short stacking energy: -87.965 Base-Backbone interact. energy: -0.290 local terms energy: -161.570198 where: bonds (distance) C4'-P energy: -51.475 bonds (distance) P-C4' energy: -47.854 flat angles C4'-P-C4' energy: -38.334 flat angles P-C4'-P energy: -8.645 tors. eta vs tors. theta energy: -15.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -242.491957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.491957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.491957 (E_RNA) where: Base-Base interactions energy: -120.125 where: short stacking energy: -65.937 Base-Backbone interact. energy: -1.559 local terms energy: -120.808219 where: bonds (distance) C4'-P energy: -30.444 bonds (distance) P-C4' energy: -36.846 flat angles C4'-P-C4' energy: -26.838 flat angles P-C4'-P energy: -24.190 tors. eta vs tors. theta energy: -2.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -824.685877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.685877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.685877 (E_RNA) where: Base-Base interactions energy: -578.971 where: short stacking energy: -241.938 Base-Backbone interact. energy: -0.684 local terms energy: -245.030626 where: bonds (distance) C4'-P energy: -41.653 bonds (distance) P-C4' energy: -50.363 flat angles C4'-P-C4' energy: -50.699 flat angles P-C4'-P energy: -36.556 tors. eta vs tors. theta energy: -65.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -783.049351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.049351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.049351 (E_RNA) where: Base-Base interactions energy: -535.309 where: short stacking energy: -224.400 Base-Backbone interact. energy: -0.673 local terms energy: -247.067631 where: bonds (distance) C4'-P energy: -39.751 bonds (distance) P-C4' energy: -55.889 flat angles C4'-P-C4' energy: -51.042 flat angles P-C4'-P energy: -36.583 tors. eta vs tors. theta energy: -63.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -738.955047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.955047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.955047 (E_RNA) where: Base-Base interactions energy: -496.779 where: short stacking energy: -234.903 Base-Backbone interact. energy: -0.068 local terms energy: -242.107965 where: bonds (distance) C4'-P energy: -37.344 bonds (distance) P-C4' energy: -48.023 flat angles C4'-P-C4' energy: -53.013 flat angles P-C4'-P energy: -35.657 tors. eta vs tors. theta energy: -68.071 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -735.689599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.689599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.689599 (E_RNA) where: Base-Base interactions energy: -506.107 where: short stacking energy: -213.966 Base-Backbone interact. energy: -0.349 local terms energy: -229.233011 where: bonds (distance) C4'-P energy: -48.062 bonds (distance) P-C4' energy: -53.580 flat angles C4'-P-C4' energy: -45.429 flat angles P-C4'-P energy: -29.649 tors. eta vs tors. theta energy: -52.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -653.289436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.289436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.289436 (E_RNA) where: Base-Base interactions energy: -437.898 where: short stacking energy: -180.919 Base-Backbone interact. energy: -0.568 local terms energy: -214.822887 where: bonds (distance) C4'-P energy: -56.370 bonds (distance) P-C4' energy: -49.173 flat angles C4'-P-C4' energy: -49.667 flat angles P-C4'-P energy: -19.963 tors. eta vs tors. theta energy: -39.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -512.112546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.112546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.112546 (E_RNA) where: Base-Base interactions energy: -328.042 where: short stacking energy: -138.897 Base-Backbone interact. energy: -0.710 local terms energy: -183.360220 where: bonds (distance) C4'-P energy: -43.479 bonds (distance) P-C4' energy: -52.358 flat angles C4'-P-C4' energy: -33.581 flat angles P-C4'-P energy: -32.113 tors. eta vs tors. theta energy: -21.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -572.405032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.405032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.405032 (E_RNA) where: Base-Base interactions energy: -381.402 where: short stacking energy: -183.903 Base-Backbone interact. energy: -0.983 local terms energy: -190.020789 where: bonds (distance) C4'-P energy: -34.160 bonds (distance) P-C4' energy: -46.078 flat angles C4'-P-C4' energy: -43.460 flat angles P-C4'-P energy: -21.939 tors. eta vs tors. theta energy: -44.384 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -447.524057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.524057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.524057 (E_RNA) where: Base-Base interactions energy: -251.538 where: short stacking energy: -128.162 Base-Backbone interact. energy: -2.551 local terms energy: -193.434741 where: bonds (distance) C4'-P energy: -35.504 bonds (distance) P-C4' energy: -52.167 flat angles C4'-P-C4' energy: -47.385 flat angles P-C4'-P energy: -33.779 tors. eta vs tors. theta energy: -24.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -364.973406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.973406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.973406 (E_RNA) where: Base-Base interactions energy: -200.225 where: short stacking energy: -90.681 Base-Backbone interact. energy: -1.491 local terms energy: -163.257421 where: bonds (distance) C4'-P energy: -50.862 bonds (distance) P-C4' energy: -49.622 flat angles C4'-P-C4' energy: -41.140 flat angles P-C4'-P energy: -17.343 tors. eta vs tors. theta energy: -4.290 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -208.310174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.310174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.310174 (E_RNA) where: Base-Base interactions energy: -67.341 where: short stacking energy: -49.048 Base-Backbone interact. energy: -0.977 local terms energy: -139.992157 where: bonds (distance) C4'-P energy: -44.455 bonds (distance) P-C4' energy: -46.928 flat angles C4'-P-C4' energy: -40.151 flat angles P-C4'-P energy: -22.577 tors. eta vs tors. theta energy: 14.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -825.777046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -825.777046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -825.777046 (E_RNA) where: Base-Base interactions energy: -565.286 where: short stacking energy: -259.065 Base-Backbone interact. energy: -1.676 local terms energy: -258.815030 where: bonds (distance) C4'-P energy: -45.832 bonds (distance) P-C4' energy: -51.504 flat angles C4'-P-C4' energy: -58.924 flat angles P-C4'-P energy: -34.333 tors. eta vs tors. theta energy: -68.223 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -769.702806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.702806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.702806 (E_RNA) where: Base-Base interactions energy: -519.745 where: short stacking energy: -238.525 Base-Backbone interact. energy: 0.050 local terms energy: -250.008777 where: bonds (distance) C4'-P energy: -47.935 bonds (distance) P-C4' energy: -51.638 flat angles C4'-P-C4' energy: -50.046 flat angles P-C4'-P energy: -38.150 tors. eta vs tors. theta energy: -62.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -731.776155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.776155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.776155 (E_RNA) where: Base-Base interactions energy: -468.154 where: short stacking energy: -223.026 Base-Backbone interact. energy: -0.691 local terms energy: -262.931196 where: bonds (distance) C4'-P energy: -48.373 bonds (distance) P-C4' energy: -53.489 flat angles C4'-P-C4' energy: -53.862 flat angles P-C4'-P energy: -39.102 tors. eta vs tors. theta energy: -68.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -741.156996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -741.156996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.156996 (E_RNA) where: Base-Base interactions energy: -503.632 where: short stacking energy: -211.645 Base-Backbone interact. energy: -0.938 local terms energy: -236.587294 where: bonds (distance) C4'-P energy: -45.593 bonds (distance) P-C4' energy: -47.002 flat angles C4'-P-C4' energy: -54.508 flat angles P-C4'-P energy: -37.923 tors. eta vs tors. theta energy: -51.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -660.570802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.570802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -660.570802 (E_RNA) where: Base-Base interactions energy: -447.622 where: short stacking energy: -198.903 Base-Backbone interact. energy: -1.309 local terms energy: -211.639979 where: bonds (distance) C4'-P energy: -40.198 bonds (distance) P-C4' energy: -49.295 flat angles C4'-P-C4' energy: -43.965 flat angles P-C4'-P energy: -31.537 tors. eta vs tors. theta energy: -46.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -590.088611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.088611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.088611 (E_RNA) where: Base-Base interactions energy: -384.739 where: short stacking energy: -193.748 Base-Backbone interact. energy: -0.252 local terms energy: -205.097818 where: bonds (distance) C4'-P energy: -44.814 bonds (distance) P-C4' energy: -38.177 flat angles C4'-P-C4' energy: -52.496 flat angles P-C4'-P energy: -21.335 tors. eta vs tors. theta energy: -48.276 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -515.046775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.046775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.046775 (E_RNA) where: Base-Base interactions energy: -328.597 where: short stacking energy: -154.596 Base-Backbone interact. energy: -1.746 local terms energy: -184.704293 where: bonds (distance) C4'-P energy: -40.064 bonds (distance) P-C4' energy: -50.685 flat angles C4'-P-C4' energy: -36.978 flat angles P-C4'-P energy: -27.553 tors. eta vs tors. theta energy: -29.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -467.023665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.023665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.023665 (E_RNA) where: Base-Base interactions energy: -283.582 where: short stacking energy: -147.437 Base-Backbone interact. energy: -0.521 local terms energy: -182.920931 where: bonds (distance) C4'-P energy: -45.041 bonds (distance) P-C4' energy: -40.593 flat angles C4'-P-C4' energy: -40.802 flat angles P-C4'-P energy: -21.873 tors. eta vs tors. theta energy: -34.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -393.421178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.421178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.421178 (E_RNA) where: Base-Base interactions energy: -220.085 where: short stacking energy: -117.131 Base-Backbone interact. energy: -1.633 local terms energy: -171.703752 where: bonds (distance) C4'-P energy: -44.372 bonds (distance) P-C4' energy: -43.073 flat angles C4'-P-C4' energy: -40.196 flat angles P-C4'-P energy: -20.753 tors. eta vs tors. theta energy: -23.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -224.168468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.168468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.168468 (E_RNA) where: Base-Base interactions energy: -95.246 where: short stacking energy: -66.349 Base-Backbone interact. energy: -1.744 local terms energy: -127.178414 where: bonds (distance) C4'-P energy: -31.433 bonds (distance) P-C4' energy: -43.203 flat angles C4'-P-C4' energy: -43.850 flat angles P-C4'-P energy: -21.337 tors. eta vs tors. theta energy: 12.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -819.029958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.029958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.029958 (E_RNA) where: Base-Base interactions energy: -551.037 where: short stacking energy: -244.607 Base-Backbone interact. energy: -0.402 local terms energy: -267.590513 where: bonds (distance) C4'-P energy: -45.807 bonds (distance) P-C4' energy: -52.672 flat angles C4'-P-C4' energy: -56.399 flat angles P-C4'-P energy: -45.352 tors. eta vs tors. theta energy: -67.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -784.038793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.038793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.038793 (E_RNA) where: Base-Base interactions energy: -536.113 where: short stacking energy: -237.633 Base-Backbone interact. energy: -0.459 local terms energy: -247.466978 where: bonds (distance) C4'-P energy: -46.510 bonds (distance) P-C4' energy: -48.145 flat angles C4'-P-C4' energy: -48.510 flat angles P-C4'-P energy: -42.025 tors. eta vs tors. theta energy: -62.276 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -745.194311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.194311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.194311 (E_RNA) where: Base-Base interactions energy: -496.444 where: short stacking energy: -223.932 Base-Backbone interact. energy: 0.072 local terms energy: -248.822050 where: bonds (distance) C4'-P energy: -42.033 bonds (distance) P-C4' energy: -55.606 flat angles C4'-P-C4' energy: -52.022 flat angles P-C4'-P energy: -34.180 tors. eta vs tors. theta energy: -64.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -744.936146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.936146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.936146 (E_RNA) where: Base-Base interactions energy: -505.872 where: short stacking energy: -220.036 Base-Backbone interact. energy: -1.089 local terms energy: -237.975704 where: bonds (distance) C4'-P energy: -47.498 bonds (distance) P-C4' energy: -47.085 flat angles C4'-P-C4' energy: -54.329 flat angles P-C4'-P energy: -34.578 tors. eta vs tors. theta energy: -54.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -649.959100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.959100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.959100 (E_RNA) where: Base-Base interactions energy: -427.269 where: short stacking energy: -188.648 Base-Backbone interact. energy: -1.683 local terms energy: -221.006601 where: bonds (distance) C4'-P energy: -45.019 bonds (distance) P-C4' energy: -47.112 flat angles C4'-P-C4' energy: -52.682 flat angles P-C4'-P energy: -31.716 tors. eta vs tors. theta energy: -44.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -600.573241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.573241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.573241 (E_RNA) where: Base-Base interactions energy: -400.299 where: short stacking energy: -204.119 Base-Backbone interact. energy: -1.758 local terms energy: -198.516430 where: bonds (distance) C4'-P energy: -42.327 bonds (distance) P-C4' energy: -46.460 flat angles C4'-P-C4' energy: -35.259 flat angles P-C4'-P energy: -27.714 tors. eta vs tors. theta energy: -46.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -511.321279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.321279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.321279 (E_RNA) where: Base-Base interactions energy: -325.780 where: short stacking energy: -147.520 Base-Backbone interact. energy: 0.439 local terms energy: -185.980342 where: bonds (distance) C4'-P energy: -40.736 bonds (distance) P-C4' energy: -35.943 flat angles C4'-P-C4' energy: -50.202 flat angles P-C4'-P energy: -34.330 tors. eta vs tors. theta energy: -24.769 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -543.821822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.821822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.821822 (E_RNA) where: Base-Base interactions energy: -337.335 where: short stacking energy: -143.608 Base-Backbone interact. energy: -0.033 local terms energy: -206.454468 where: bonds (distance) C4'-P energy: -48.236 bonds (distance) P-C4' energy: -44.184 flat angles C4'-P-C4' energy: -52.347 flat angles P-C4'-P energy: -25.421 tors. eta vs tors. theta energy: -36.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -382.593377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.593377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.593377 (E_RNA) where: Base-Base interactions energy: -226.051 where: short stacking energy: -115.029 Base-Backbone interact. energy: -0.097 local terms energy: -156.445317 where: bonds (distance) C4'-P energy: -28.793 bonds (distance) P-C4' energy: -48.305 flat angles C4'-P-C4' energy: -39.106 flat angles P-C4'-P energy: -26.137 tors. eta vs tors. theta energy: -14.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -226.171283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.171283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.171283 (E_RNA) where: Base-Base interactions energy: -96.229 where: short stacking energy: -75.377 Base-Backbone interact. energy: 1.053 local terms energy: -130.995845 where: bonds (distance) C4'-P energy: -41.925 bonds (distance) P-C4' energy: -40.253 flat angles C4'-P-C4' energy: -34.386 flat angles P-C4'-P energy: -22.177 tors. eta vs tors. theta energy: 7.745 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -824.219413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.219413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.219413 (E_RNA) where: Base-Base interactions energy: -579.150 where: short stacking energy: -260.080 Base-Backbone interact. energy: -1.655 local terms energy: -243.414821 where: bonds (distance) C4'-P energy: -45.891 bonds (distance) P-C4' energy: -54.385 flat angles C4'-P-C4' energy: -52.249 flat angles P-C4'-P energy: -21.815 tors. eta vs tors. theta energy: -69.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -811.425167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -811.425167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -811.425167 (E_RNA) where: Base-Base interactions energy: -542.751 where: short stacking energy: -247.046 Base-Backbone interact. energy: -1.837 local terms energy: -266.836615 where: bonds (distance) C4'-P energy: -50.483 bonds (distance) P-C4' energy: -58.740 flat angles C4'-P-C4' energy: -53.821 flat angles P-C4'-P energy: -41.155 tors. eta vs tors. theta energy: -62.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -736.230616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.230616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.230616 (E_RNA) where: Base-Base interactions energy: -490.813 where: short stacking energy: -224.474 Base-Backbone interact. energy: -0.164 local terms energy: -245.253784 where: bonds (distance) C4'-P energy: -39.024 bonds (distance) P-C4' energy: -46.968 flat angles C4'-P-C4' energy: -54.754 flat angles P-C4'-P energy: -45.110 tors. eta vs tors. theta energy: -59.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -745.146014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.146014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.146014 (E_RNA) where: Base-Base interactions energy: -514.899 where: short stacking energy: -222.157 Base-Backbone interact. energy: -0.919 local terms energy: -229.327561 where: bonds (distance) C4'-P energy: -37.119 bonds (distance) P-C4' energy: -43.596 flat angles C4'-P-C4' energy: -55.467 flat angles P-C4'-P energy: -34.860 tors. eta vs tors. theta energy: -58.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -676.440731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.440731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.440731 (E_RNA) where: Base-Base interactions energy: -487.526 where: short stacking energy: -189.024 Base-Backbone interact. energy: 0.440 local terms energy: -189.354922 where: bonds (distance) C4'-P energy: -40.197 bonds (distance) P-C4' energy: -46.127 flat angles C4'-P-C4' energy: -37.978 flat angles P-C4'-P energy: -26.959 tors. eta vs tors. theta energy: -38.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -583.967139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.967139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.967139 (E_RNA) where: Base-Base interactions energy: -378.259 where: short stacking energy: -183.868 Base-Backbone interact. energy: -0.074 local terms energy: -205.633659 where: bonds (distance) C4'-P energy: -39.958 bonds (distance) P-C4' energy: -44.521 flat angles C4'-P-C4' energy: -44.547 flat angles P-C4'-P energy: -27.898 tors. eta vs tors. theta energy: -48.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -539.286487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.286487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.286487 (E_RNA) where: Base-Base interactions energy: -352.755 where: short stacking energy: -153.178 Base-Backbone interact. energy: 0.133 local terms energy: -186.664868 where: bonds (distance) C4'-P energy: -42.264 bonds (distance) P-C4' energy: -51.254 flat angles C4'-P-C4' energy: -42.019 flat angles P-C4'-P energy: -24.994 tors. eta vs tors. theta energy: -26.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -540.241950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.241950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.241950 (E_RNA) where: Base-Base interactions energy: -338.711 where: short stacking energy: -167.082 Base-Backbone interact. energy: -1.156 local terms energy: -200.374219 where: bonds (distance) C4'-P energy: -41.356 bonds (distance) P-C4' energy: -38.113 flat angles C4'-P-C4' energy: -47.389 flat angles P-C4'-P energy: -30.280 tors. eta vs tors. theta energy: -43.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -343.305287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.305287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.305287 (E_RNA) where: Base-Base interactions energy: -187.395 where: short stacking energy: -106.744 Base-Backbone interact. energy: -0.823 local terms energy: -155.087186 where: bonds (distance) C4'-P energy: -42.843 bonds (distance) P-C4' energy: -41.388 flat angles C4'-P-C4' energy: -30.785 flat angles P-C4'-P energy: -21.410 tors. eta vs tors. theta energy: -18.661 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -251.684298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.684298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.684298 (E_RNA) where: Base-Base interactions energy: -131.494 where: short stacking energy: -76.474 Base-Backbone interact. energy: -0.904 local terms energy: -119.285936 where: bonds (distance) C4'-P energy: -32.161 bonds (distance) P-C4' energy: -37.486 flat angles C4'-P-C4' energy: -33.211 flat angles P-C4'-P energy: -19.469 tors. eta vs tors. theta energy: 3.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -832.753204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.753204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.753204 (E_RNA) where: Base-Base interactions energy: -577.933 where: short stacking energy: -262.170 Base-Backbone interact. energy: 1.015 local terms energy: -255.834562 where: bonds (distance) C4'-P energy: -45.992 bonds (distance) P-C4' energy: -53.582 flat angles C4'-P-C4' energy: -60.433 flat angles P-C4'-P energy: -25.668 tors. eta vs tors. theta energy: -70.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -815.077507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.077507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.077507 (E_RNA) where: Base-Base interactions energy: -553.146 where: short stacking energy: -241.316 Base-Backbone interact. energy: -1.173 local terms energy: -260.758911 where: bonds (distance) C4'-P energy: -58.573 bonds (distance) P-C4' energy: -53.958 flat angles C4'-P-C4' energy: -46.129 flat angles P-C4'-P energy: -32.134 tors. eta vs tors. theta energy: -69.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -756.023050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.023050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.023050 (E_RNA) where: Base-Base interactions energy: -518.798 where: short stacking energy: -225.543 Base-Backbone interact. energy: -0.193 local terms energy: -237.032044 where: bonds (distance) C4'-P energy: -50.798 bonds (distance) P-C4' energy: -48.458 flat angles C4'-P-C4' energy: -51.382 flat angles P-C4'-P energy: -17.978 tors. eta vs tors. theta energy: -68.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -737.990232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.990232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.990232 (E_RNA) where: Base-Base interactions energy: -521.556 where: short stacking energy: -200.354 Base-Backbone interact. energy: -1.592 local terms energy: -214.842381 where: bonds (distance) C4'-P energy: -41.979 bonds (distance) P-C4' energy: -45.728 flat angles C4'-P-C4' energy: -46.528 flat angles P-C4'-P energy: -31.954 tors. eta vs tors. theta energy: -48.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -692.466582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.466582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.466582 (E_RNA) where: Base-Base interactions energy: -477.358 where: short stacking energy: -189.621 Base-Backbone interact. energy: 2.775 local terms energy: -217.883153 where: bonds (distance) C4'-P energy: -37.215 bonds (distance) P-C4' energy: -46.422 flat angles C4'-P-C4' energy: -45.817 flat angles P-C4'-P energy: -36.708 tors. eta vs tors. theta energy: -51.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -587.250482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.250482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.250482 (E_RNA) where: Base-Base interactions energy: -372.749 where: short stacking energy: -198.490 Base-Backbone interact. energy: 1.424 local terms energy: -215.924603 where: bonds (distance) C4'-P energy: -43.449 bonds (distance) P-C4' energy: -52.605 flat angles C4'-P-C4' energy: -48.951 flat angles P-C4'-P energy: -28.459 tors. eta vs tors. theta energy: -42.461 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -541.033096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.033096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.033096 (E_RNA) where: Base-Base interactions energy: -362.194 where: short stacking energy: -166.869 Base-Backbone interact. energy: -0.504 local terms energy: -178.334971 where: bonds (distance) C4'-P energy: -48.808 bonds (distance) P-C4' energy: -34.002 flat angles C4'-P-C4' energy: -40.014 flat angles P-C4'-P energy: -19.875 tors. eta vs tors. theta energy: -35.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -502.413650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.413650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.413650 (E_RNA) where: Base-Base interactions energy: -308.531 where: short stacking energy: -151.735 Base-Backbone interact. energy: -0.602 local terms energy: -193.280470 where: bonds (distance) C4'-P energy: -39.513 bonds (distance) P-C4' energy: -51.366 flat angles C4'-P-C4' energy: -49.529 flat angles P-C4'-P energy: -17.156 tors. eta vs tors. theta energy: -35.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -340.995627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.995627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.995627 (E_RNA) where: Base-Base interactions energy: -177.404 where: short stacking energy: -103.066 Base-Backbone interact. energy: 0.324 local terms energy: -163.915482 where: bonds (distance) C4'-P energy: -40.412 bonds (distance) P-C4' energy: -43.791 flat angles C4'-P-C4' energy: -43.396 flat angles P-C4'-P energy: -16.944 tors. eta vs tors. theta energy: -19.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -258.861528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.861528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.861528 (E_RNA) where: Base-Base interactions energy: -111.058 where: short stacking energy: -66.682 Base-Backbone interact. energy: -0.307 local terms energy: -147.496602 where: bonds (distance) C4'-P energy: -41.876 bonds (distance) P-C4' energy: -44.661 flat angles C4'-P-C4' energy: -35.747 flat angles P-C4'-P energy: -20.832 tors. eta vs tors. theta energy: -4.380 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -827.284417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.284417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -827.284417 (E_RNA) where: Base-Base interactions energy: -566.456 where: short stacking energy: -257.271 Base-Backbone interact. energy: -2.139 local terms energy: -258.689354 where: bonds (distance) C4'-P energy: -50.741 bonds (distance) P-C4' energy: -50.654 flat angles C4'-P-C4' energy: -56.360 flat angles P-C4'-P energy: -32.898 tors. eta vs tors. theta energy: -68.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -820.624728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.624728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.624728 (E_RNA) where: Base-Base interactions energy: -544.593 where: short stacking energy: -247.639 Base-Backbone interact. energy: -1.193 local terms energy: -274.839296 where: bonds (distance) C4'-P energy: -51.717 bonds (distance) P-C4' energy: -48.619 flat angles C4'-P-C4' energy: -55.217 flat angles P-C4'-P energy: -45.165 tors. eta vs tors. theta energy: -74.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -748.709159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.709159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.709159 (E_RNA) where: Base-Base interactions energy: -508.385 where: short stacking energy: -218.713 Base-Backbone interact. energy: 0.762 local terms energy: -241.086546 where: bonds (distance) C4'-P energy: -50.441 bonds (distance) P-C4' energy: -47.147 flat angles C4'-P-C4' energy: -50.389 flat angles P-C4'-P energy: -26.471 tors. eta vs tors. theta energy: -66.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -735.882296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.882296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.882296 (E_RNA) where: Base-Base interactions energy: -510.065 where: short stacking energy: -195.704 Base-Backbone interact. energy: -0.546 local terms energy: -225.272141 where: bonds (distance) C4'-P energy: -47.844 bonds (distance) P-C4' energy: -49.375 flat angles C4'-P-C4' energy: -51.519 flat angles P-C4'-P energy: -25.128 tors. eta vs tors. theta energy: -51.406 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -681.295942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.295942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.295942 (E_RNA) where: Base-Base interactions energy: -477.132 where: short stacking energy: -194.510 Base-Backbone interact. energy: 1.246 local terms energy: -205.409817 where: bonds (distance) C4'-P energy: -42.130 bonds (distance) P-C4' energy: -44.914 flat angles C4'-P-C4' energy: -46.527 flat angles P-C4'-P energy: -30.003 tors. eta vs tors. theta energy: -41.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -585.445883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.445883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.445883 (E_RNA) where: Base-Base interactions energy: -377.976 where: short stacking energy: -171.920 Base-Backbone interact. energy: -0.207 local terms energy: -207.262884 where: bonds (distance) C4'-P energy: -42.681 bonds (distance) P-C4' energy: -53.814 flat angles C4'-P-C4' energy: -39.717 flat angles P-C4'-P energy: -34.976 tors. eta vs tors. theta energy: -36.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -557.306352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.306352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.306352 (E_RNA) where: Base-Base interactions energy: -371.394 where: short stacking energy: -175.935 Base-Backbone interact. energy: -0.941 local terms energy: -184.972072 where: bonds (distance) C4'-P energy: -40.374 bonds (distance) P-C4' energy: -46.366 flat angles C4'-P-C4' energy: -38.112 flat angles P-C4'-P energy: -23.059 tors. eta vs tors. theta energy: -37.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -538.373974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.373974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.373974 (E_RNA) where: Base-Base interactions energy: -335.148 where: short stacking energy: -156.282 Base-Backbone interact. energy: -1.987 local terms energy: -201.239080 where: bonds (distance) C4'-P energy: -35.068 bonds (distance) P-C4' energy: -52.348 flat angles C4'-P-C4' energy: -51.782 flat angles P-C4'-P energy: -29.112 tors. eta vs tors. theta energy: -32.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -290.375488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.375488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.375488 (E_RNA) where: Base-Base interactions energy: -138.741 where: short stacking energy: -89.246 Base-Backbone interact. energy: -1.154 local terms energy: -150.480275 where: bonds (distance) C4'-P energy: -44.130 bonds (distance) P-C4' energy: -47.853 flat angles C4'-P-C4' energy: -45.054 flat angles P-C4'-P energy: -14.110 tors. eta vs tors. theta energy: 0.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -214.369605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.369605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.369605 (E_RNA) where: Base-Base interactions energy: -83.278 where: short stacking energy: -63.773 Base-Backbone interact. energy: -1.291 local terms energy: -129.800934 where: bonds (distance) C4'-P energy: -27.881 bonds (distance) P-C4' energy: -52.611 flat angles C4'-P-C4' energy: -40.577 flat angles P-C4'-P energy: -18.603 tors. eta vs tors. theta energy: 9.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -834.471481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.471481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.471481 (E_RNA) where: Base-Base interactions energy: -564.982 where: short stacking energy: -250.792 Base-Backbone interact. energy: -1.717 local terms energy: -267.772227 where: bonds (distance) C4'-P energy: -49.923 bonds (distance) P-C4' energy: -47.363 flat angles C4'-P-C4' energy: -57.485 flat angles P-C4'-P energy: -39.803 tors. eta vs tors. theta energy: -73.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -820.579877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.579877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.579877 (E_RNA) where: Base-Base interactions energy: -569.134 where: short stacking energy: -250.626 Base-Backbone interact. energy: 0.269 local terms energy: -251.715446 where: bonds (distance) C4'-P energy: -49.424 bonds (distance) P-C4' energy: -45.415 flat angles C4'-P-C4' energy: -50.355 flat angles P-C4'-P energy: -39.666 tors. eta vs tors. theta energy: -66.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -775.810855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.810855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.810855 (E_RNA) where: Base-Base interactions energy: -530.526 where: short stacking energy: -220.050 Base-Backbone interact. energy: 0.406 local terms energy: -245.690963 where: bonds (distance) C4'-P energy: -52.118 bonds (distance) P-C4' energy: -47.927 flat angles C4'-P-C4' energy: -59.851 flat angles P-C4'-P energy: -33.236 tors. eta vs tors. theta energy: -52.560 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -719.583372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.583372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.583372 (E_RNA) where: Base-Base interactions energy: -476.694 where: short stacking energy: -210.099 Base-Backbone interact. energy: -0.549 local terms energy: -242.340323 where: bonds (distance) C4'-P energy: -49.260 bonds (distance) P-C4' energy: -41.308 flat angles C4'-P-C4' energy: -59.549 flat angles P-C4'-P energy: -29.964 tors. eta vs tors. theta energy: -62.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -680.673710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.673710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.673710 (E_RNA) where: Base-Base interactions energy: -461.469 where: short stacking energy: -195.981 Base-Backbone interact. energy: -1.229 local terms energy: -217.975552 where: bonds (distance) C4'-P energy: -48.317 bonds (distance) P-C4' energy: -40.865 flat angles C4'-P-C4' energy: -47.913 flat angles P-C4'-P energy: -40.213 tors. eta vs tors. theta energy: -40.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -554.795171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.795171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.795171 (E_RNA) where: Base-Base interactions energy: -364.934 where: short stacking energy: -165.424 Base-Backbone interact. energy: -2.657 local terms energy: -187.204905 where: bonds (distance) C4'-P energy: -28.655 bonds (distance) P-C4' energy: -41.074 flat angles C4'-P-C4' energy: -45.194 flat angles P-C4'-P energy: -30.196 tors. eta vs tors. theta energy: -42.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -528.168028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.168028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.168028 (E_RNA) where: Base-Base interactions energy: -335.071 where: short stacking energy: -157.895 Base-Backbone interact. energy: 2.388 local terms energy: -195.485379 where: bonds (distance) C4'-P energy: -36.552 bonds (distance) P-C4' energy: -44.682 flat angles C4'-P-C4' energy: -47.370 flat angles P-C4'-P energy: -30.615 tors. eta vs tors. theta energy: -36.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -523.659335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.659335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.659335 (E_RNA) where: Base-Base interactions energy: -347.304 where: short stacking energy: -161.548 Base-Backbone interact. energy: -0.001 local terms energy: -176.354667 where: bonds (distance) C4'-P energy: -37.977 bonds (distance) P-C4' energy: -47.536 flat angles C4'-P-C4' energy: -39.684 flat angles P-C4'-P energy: -17.830 tors. eta vs tors. theta energy: -33.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -269.797270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.797270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.797270 (E_RNA) where: Base-Base interactions energy: -101.941 where: short stacking energy: -76.266 Base-Backbone interact. energy: -0.923 local terms energy: -166.932985 where: bonds (distance) C4'-P energy: -44.921 bonds (distance) P-C4' energy: -49.020 flat angles C4'-P-C4' energy: -37.148 flat angles P-C4'-P energy: -26.660 tors. eta vs tors. theta energy: -9.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -226.112927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.112927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.112927 (E_RNA) where: Base-Base interactions energy: -89.424 where: short stacking energy: -66.653 Base-Backbone interact. energy: 1.634 local terms energy: -138.322210 where: bonds (distance) C4'-P energy: -39.465 bonds (distance) P-C4' energy: -37.289 flat angles C4'-P-C4' energy: -29.596 flat angles P-C4'-P energy: -29.278 tors. eta vs tors. theta energy: -2.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -848.478456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.478456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -848.478456 (E_RNA) where: Base-Base interactions energy: -586.666 where: short stacking energy: -259.006 Base-Backbone interact. energy: -1.648 local terms energy: -260.164524 where: bonds (distance) C4'-P energy: -44.967 bonds (distance) P-C4' energy: -55.498 flat angles C4'-P-C4' energy: -46.487 flat angles P-C4'-P energy: -42.095 tors. eta vs tors. theta energy: -71.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -782.134084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.134084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.134084 (E_RNA) where: Base-Base interactions energy: -536.096 where: short stacking energy: -219.634 Base-Backbone interact. energy: -0.169 local terms energy: -245.868850 where: bonds (distance) C4'-P energy: -43.972 bonds (distance) P-C4' energy: -52.593 flat angles C4'-P-C4' energy: -56.461 flat angles P-C4'-P energy: -33.764 tors. eta vs tors. theta energy: -59.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -790.544501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -790.544501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.544501 (E_RNA) where: Base-Base interactions energy: -552.616 where: short stacking energy: -227.276 Base-Backbone interact. energy: -1.704 local terms energy: -236.224913 where: bonds (distance) C4'-P energy: -35.191 bonds (distance) P-C4' energy: -49.695 flat angles C4'-P-C4' energy: -54.469 flat angles P-C4'-P energy: -39.250 tors. eta vs tors. theta energy: -57.620 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -720.103603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.103603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.103603 (E_RNA) where: Base-Base interactions energy: -484.507 where: short stacking energy: -222.550 Base-Backbone interact. energy: -2.241 local terms energy: -233.355230 where: bonds (distance) C4'-P energy: -44.028 bonds (distance) P-C4' energy: -45.815 flat angles C4'-P-C4' energy: -59.807 flat angles P-C4'-P energy: -26.984 tors. eta vs tors. theta energy: -56.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -677.491822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.491822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.491822 (E_RNA) where: Base-Base interactions energy: -457.328 where: short stacking energy: -189.100 Base-Backbone interact. energy: -0.831 local terms energy: -219.333122 where: bonds (distance) C4'-P energy: -44.100 bonds (distance) P-C4' energy: -42.228 flat angles C4'-P-C4' energy: -50.132 flat angles P-C4'-P energy: -38.245 tors. eta vs tors. theta energy: -44.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -544.134174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.134174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.134174 (E_RNA) where: Base-Base interactions energy: -364.703 where: short stacking energy: -184.200 Base-Backbone interact. energy: 1.327 local terms energy: -180.758580 where: bonds (distance) C4'-P energy: -44.975 bonds (distance) P-C4' energy: -38.996 flat angles C4'-P-C4' energy: -27.441 flat angles P-C4'-P energy: -24.313 tors. eta vs tors. theta energy: -45.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -507.919467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.919467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.919467 (E_RNA) where: Base-Base interactions energy: -341.969 where: short stacking energy: -166.635 Base-Backbone interact. energy: 1.374 local terms energy: -167.324243 where: bonds (distance) C4'-P energy: -40.679 bonds (distance) P-C4' energy: -41.537 flat angles C4'-P-C4' energy: -33.809 flat angles P-C4'-P energy: -22.520 tors. eta vs tors. theta energy: -28.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -543.721589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.721589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.721589 (E_RNA) where: Base-Base interactions energy: -369.555 where: short stacking energy: -169.947 Base-Backbone interact. energy: 0.234 local terms energy: -174.400826 where: bonds (distance) C4'-P energy: -35.536 bonds (distance) P-C4' energy: -39.340 flat angles C4'-P-C4' energy: -43.268 flat angles P-C4'-P energy: -22.220 tors. eta vs tors. theta energy: -34.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -269.804926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.804926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.804926 (E_RNA) where: Base-Base interactions energy: -109.713 where: short stacking energy: -92.977 Base-Backbone interact. energy: 0.273 local terms energy: -160.364503 where: bonds (distance) C4'-P energy: -41.389 bonds (distance) P-C4' energy: -43.358 flat angles C4'-P-C4' energy: -38.834 flat angles P-C4'-P energy: -26.869 tors. eta vs tors. theta energy: -9.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -218.535552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.535552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.535552 (E_RNA) where: Base-Base interactions energy: -92.979 where: short stacking energy: -89.555 Base-Backbone interact. energy: 3.008 local terms energy: -128.564355 where: bonds (distance) C4'-P energy: -38.779 bonds (distance) P-C4' energy: -35.766 flat angles C4'-P-C4' energy: -32.209 flat angles P-C4'-P energy: -20.102 tors. eta vs tors. theta energy: -1.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -848.119308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.119308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -848.119308 (E_RNA) where: Base-Base interactions energy: -585.090 where: short stacking energy: -262.302 Base-Backbone interact. energy: -0.756 local terms energy: -262.273288 where: bonds (distance) C4'-P energy: -42.704 bonds (distance) P-C4' energy: -53.181 flat angles C4'-P-C4' energy: -54.960 flat angles P-C4'-P energy: -42.025 tors. eta vs tors. theta energy: -69.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -783.492761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.492761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.492761 (E_RNA) where: Base-Base interactions energy: -542.535 where: short stacking energy: -214.064 Base-Backbone interact. energy: -0.959 local terms energy: -239.998921 where: bonds (distance) C4'-P energy: -45.913 bonds (distance) P-C4' energy: -50.231 flat angles C4'-P-C4' energy: -56.374 flat angles P-C4'-P energy: -33.109 tors. eta vs tors. theta energy: -54.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -799.293020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.293020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.293020 (E_RNA) where: Base-Base interactions energy: -555.445 where: short stacking energy: -232.532 Base-Backbone interact. energy: -1.902 local terms energy: -241.946719 where: bonds (distance) C4'-P energy: -44.972 bonds (distance) P-C4' energy: -47.822 flat angles C4'-P-C4' energy: -56.861 flat angles P-C4'-P energy: -33.066 tors. eta vs tors. theta energy: -59.226 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -743.840641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -743.840641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.840641 (E_RNA) where: Base-Base interactions energy: -487.600 where: short stacking energy: -224.739 Base-Backbone interact. energy: -0.327 local terms energy: -255.912738 where: bonds (distance) C4'-P energy: -48.477 bonds (distance) P-C4' energy: -53.911 flat angles C4'-P-C4' energy: -54.528 flat angles P-C4'-P energy: -36.454 tors. eta vs tors. theta energy: -62.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -676.822481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.822481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.822481 (E_RNA) where: Base-Base interactions energy: -458.653 where: short stacking energy: -187.056 Base-Backbone interact. energy: -1.159 local terms energy: -217.010269 where: bonds (distance) C4'-P energy: -47.503 bonds (distance) P-C4' energy: -52.010 flat angles C4'-P-C4' energy: -47.642 flat angles P-C4'-P energy: -27.578 tors. eta vs tors. theta energy: -42.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -591.333252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.333252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.333252 (E_RNA) where: Base-Base interactions energy: -377.222 where: short stacking energy: -188.447 Base-Backbone interact. energy: -0.773 local terms energy: -213.338371 where: bonds (distance) C4'-P energy: -38.018 bonds (distance) P-C4' energy: -48.853 flat angles C4'-P-C4' energy: -53.205 flat angles P-C4'-P energy: -33.277 tors. eta vs tors. theta energy: -39.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -565.537903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.537903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.537903 (E_RNA) where: Base-Base interactions energy: -374.472 where: short stacking energy: -161.853 Base-Backbone interact. energy: -2.229 local terms energy: -188.837070 where: bonds (distance) C4'-P energy: -47.116 bonds (distance) P-C4' energy: -43.851 flat angles C4'-P-C4' energy: -45.061 flat angles P-C4'-P energy: -22.546 tors. eta vs tors. theta energy: -30.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -443.564901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.564901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.564901 (E_RNA) where: Base-Base interactions energy: -280.294 where: short stacking energy: -150.906 Base-Backbone interact. energy: 2.271 local terms energy: -165.542819 where: bonds (distance) C4'-P energy: -38.807 bonds (distance) P-C4' energy: -46.118 flat angles C4'-P-C4' energy: -30.446 flat angles P-C4'-P energy: -23.855 tors. eta vs tors. theta energy: -26.318 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -238.862359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.862359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.862359 (E_RNA) where: Base-Base interactions energy: -72.939 where: short stacking energy: -72.389 Base-Backbone interact. energy: -0.335 local terms energy: -165.588118 where: bonds (distance) C4'-P energy: -38.587 bonds (distance) P-C4' energy: -48.127 flat angles C4'-P-C4' energy: -41.362 flat angles P-C4'-P energy: -30.454 tors. eta vs tors. theta energy: -7.058 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -230.803052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.803052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.803052 (E_RNA) where: Base-Base interactions energy: -108.988 where: short stacking energy: -68.132 Base-Backbone interact. energy: -2.154 local terms energy: -119.660964 where: bonds (distance) C4'-P energy: -43.154 bonds (distance) P-C4' energy: -29.109 flat angles C4'-P-C4' energy: -29.156 flat angles P-C4'-P energy: -26.812 tors. eta vs tors. theta energy: 8.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -838.197554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.197554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.197554 (E_RNA) where: Base-Base interactions energy: -581.043 where: short stacking energy: -258.576 Base-Backbone interact. energy: -1.160 local terms energy: -255.994949 where: bonds (distance) C4'-P energy: -48.374 bonds (distance) P-C4' energy: -47.690 flat angles C4'-P-C4' energy: -52.591 flat angles P-C4'-P energy: -41.714 tors. eta vs tors. theta energy: -65.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -834.066968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.066968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.066968 (E_RNA) where: Base-Base interactions energy: -575.776 where: short stacking energy: -249.195 Base-Backbone interact. energy: -2.009 local terms energy: -256.281240 where: bonds (distance) C4'-P energy: -45.018 bonds (distance) P-C4' energy: -55.691 flat angles C4'-P-C4' energy: -59.231 flat angles P-C4'-P energy: -34.676 tors. eta vs tors. theta energy: -61.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -771.901335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.901335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.901335 (E_RNA) where: Base-Base interactions energy: -535.761 where: short stacking energy: -227.626 Base-Backbone interact. energy: -1.100 local terms energy: -235.039649 where: bonds (distance) C4'-P energy: -42.656 bonds (distance) P-C4' energy: -43.895 flat angles C4'-P-C4' energy: -57.211 flat angles P-C4'-P energy: -36.469 tors. eta vs tors. theta energy: -54.809 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -729.591014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.591014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.591014 (E_RNA) where: Base-Base interactions energy: -498.694 where: short stacking energy: -213.642 Base-Backbone interact. energy: -0.759 local terms energy: -230.137331 where: bonds (distance) C4'-P energy: -42.352 bonds (distance) P-C4' energy: -50.073 flat angles C4'-P-C4' energy: -48.373 flat angles P-C4'-P energy: -29.078 tors. eta vs tors. theta energy: -60.261 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -680.570884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.570884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.570884 (E_RNA) where: Base-Base interactions energy: -462.421 where: short stacking energy: -195.217 Base-Backbone interact. energy: -1.185 local terms energy: -216.965231 where: bonds (distance) C4'-P energy: -48.552 bonds (distance) P-C4' energy: -45.483 flat angles C4'-P-C4' energy: -46.888 flat angles P-C4'-P energy: -31.425 tors. eta vs tors. theta energy: -44.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -603.630332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.630332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.630332 (E_RNA) where: Base-Base interactions energy: -393.387 where: short stacking energy: -189.754 Base-Backbone interact. energy: 0.014 local terms energy: -210.256817 where: bonds (distance) C4'-P energy: -50.499 bonds (distance) P-C4' energy: -47.904 flat angles C4'-P-C4' energy: -41.250 flat angles P-C4'-P energy: -23.364 tors. eta vs tors. theta energy: -47.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -528.291136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.291136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.291136 (E_RNA) where: Base-Base interactions energy: -341.273 where: short stacking energy: -145.654 Base-Backbone interact. energy: -1.642 local terms energy: -185.376061 where: bonds (distance) C4'-P energy: -42.114 bonds (distance) P-C4' energy: -43.821 flat angles C4'-P-C4' energy: -38.957 flat angles P-C4'-P energy: -36.468 tors. eta vs tors. theta energy: -24.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -471.555433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.555433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.555433 (E_RNA) where: Base-Base interactions energy: -287.536 where: short stacking energy: -143.509 Base-Backbone interact. energy: -0.867 local terms energy: -183.151738 where: bonds (distance) C4'-P energy: -42.221 bonds (distance) P-C4' energy: -37.606 flat angles C4'-P-C4' energy: -42.590 flat angles P-C4'-P energy: -26.101 tors. eta vs tors. theta energy: -34.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -242.565744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.565744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.565744 (E_RNA) where: Base-Base interactions energy: -95.384 where: short stacking energy: -76.506 Base-Backbone interact. energy: 1.038 local terms energy: -148.219632 where: bonds (distance) C4'-P energy: -44.721 bonds (distance) P-C4' energy: -53.118 flat angles C4'-P-C4' energy: -28.720 flat angles P-C4'-P energy: -16.918 tors. eta vs tors. theta energy: -4.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -250.462642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.462642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.462642 (E_RNA) where: Base-Base interactions energy: -99.758 where: short stacking energy: -81.109 Base-Backbone interact. energy: -0.691 local terms energy: -150.014380 where: bonds (distance) C4'-P energy: -46.396 bonds (distance) P-C4' energy: -39.343 flat angles C4'-P-C4' energy: -39.741 flat angles P-C4'-P energy: -14.164 tors. eta vs tors. theta energy: -10.370 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -855.249689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.249689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.249689 (E_RNA) where: Base-Base interactions energy: -586.553 where: short stacking energy: -259.545 Base-Backbone interact. energy: -1.622 local terms energy: -267.074767 where: bonds (distance) C4'-P energy: -51.014 bonds (distance) P-C4' energy: -54.888 flat angles C4'-P-C4' energy: -58.384 flat angles P-C4'-P energy: -31.911 tors. eta vs tors. theta energy: -70.877 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -821.294560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -821.294560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -821.294560 (E_RNA) where: Base-Base interactions energy: -557.194 where: short stacking energy: -246.653 Base-Backbone interact. energy: -1.495 local terms energy: -262.605970 where: bonds (distance) C4'-P energy: -44.943 bonds (distance) P-C4' energy: -51.311 flat angles C4'-P-C4' energy: -58.965 flat angles P-C4'-P energy: -41.419 tors. eta vs tors. theta energy: -65.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -811.087796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -811.087796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -811.087796 (E_RNA) where: Base-Base interactions energy: -553.952 where: short stacking energy: -243.030 Base-Backbone interact. energy: -0.484 local terms energy: -256.651821 where: bonds (distance) C4'-P energy: -44.095 bonds (distance) P-C4' energy: -51.507 flat angles C4'-P-C4' energy: -54.646 flat angles P-C4'-P energy: -42.429 tors. eta vs tors. theta energy: -63.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -731.983939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.983939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.983939 (E_RNA) where: Base-Base interactions energy: -482.203 where: short stacking energy: -228.027 Base-Backbone interact. energy: -0.857 local terms energy: -248.924059 where: bonds (distance) C4'-P energy: -48.198 bonds (distance) P-C4' energy: -50.872 flat angles C4'-P-C4' energy: -59.022 flat angles P-C4'-P energy: -24.866 tors. eta vs tors. theta energy: -65.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -684.436600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.436600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.436600 (E_RNA) where: Base-Base interactions energy: -479.779 where: short stacking energy: -207.120 Base-Backbone interact. energy: -0.882 local terms energy: -203.776143 where: bonds (distance) C4'-P energy: -27.702 bonds (distance) P-C4' energy: -49.550 flat angles C4'-P-C4' energy: -48.604 flat angles P-C4'-P energy: -29.626 tors. eta vs tors. theta energy: -48.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -592.558057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.558057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.558057 (E_RNA) where: Base-Base interactions energy: -376.378 where: short stacking energy: -188.460 Base-Backbone interact. energy: -0.178 local terms energy: -216.001944 where: bonds (distance) C4'-P energy: -39.678 bonds (distance) P-C4' energy: -50.186 flat angles C4'-P-C4' energy: -49.368 flat angles P-C4'-P energy: -27.313 tors. eta vs tors. theta energy: -49.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -511.057126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.057126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.057126 (E_RNA) where: Base-Base interactions energy: -317.035 where: short stacking energy: -172.091 Base-Backbone interact. energy: 0.564 local terms energy: -194.586047 where: bonds (distance) C4'-P energy: -42.054 bonds (distance) P-C4' energy: -45.473 flat angles C4'-P-C4' energy: -52.458 flat angles P-C4'-P energy: -19.766 tors. eta vs tors. theta energy: -34.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -495.814655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.814655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.814655 (E_RNA) where: Base-Base interactions energy: -312.529 where: short stacking energy: -156.534 Base-Backbone interact. energy: -1.026 local terms energy: -182.259184 where: bonds (distance) C4'-P energy: -37.547 bonds (distance) P-C4' energy: -54.639 flat angles C4'-P-C4' energy: -33.522 flat angles P-C4'-P energy: -26.084 tors. eta vs tors. theta energy: -30.467 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -238.159458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.159458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.159458 (E_RNA) where: Base-Base interactions energy: -92.146 where: short stacking energy: -79.118 Base-Backbone interact. energy: 0.045 local terms energy: -146.059350 where: bonds (distance) C4'-P energy: -43.718 bonds (distance) P-C4' energy: -41.821 flat angles C4'-P-C4' energy: -35.912 flat angles P-C4'-P energy: -21.728 tors. eta vs tors. theta energy: -2.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -229.024139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.024139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.024139 (E_RNA) where: Base-Base interactions energy: -83.786 where: short stacking energy: -73.358 Base-Backbone interact. energy: -0.698 local terms energy: -144.539862 where: bonds (distance) C4'-P energy: -33.526 bonds (distance) P-C4' energy: -45.920 flat angles C4'-P-C4' energy: -26.572 flat angles P-C4'-P energy: -32.010 tors. eta vs tors. theta energy: -6.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -849.962019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.962019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.962019 (E_RNA) where: Base-Base interactions energy: -583.798 where: short stacking energy: -260.875 Base-Backbone interact. energy: -1.014 local terms energy: -265.149627 where: bonds (distance) C4'-P energy: -47.569 bonds (distance) P-C4' energy: -49.531 flat angles C4'-P-C4' energy: -54.869 flat angles P-C4'-P energy: -41.293 tors. eta vs tors. theta energy: -71.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -823.133243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -823.133243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.133243 (E_RNA) where: Base-Base interactions energy: -553.253 where: short stacking energy: -252.619 Base-Backbone interact. energy: -2.711 local terms energy: -267.169090 where: bonds (distance) C4'-P energy: -49.839 bonds (distance) P-C4' energy: -46.742 flat angles C4'-P-C4' energy: -56.137 flat angles P-C4'-P energy: -41.267 tors. eta vs tors. theta energy: -73.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -795.259418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.259418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -795.259418 (E_RNA) where: Base-Base interactions energy: -550.451 where: short stacking energy: -236.832 Base-Backbone interact. energy: -0.603 local terms energy: -244.205519 where: bonds (distance) C4'-P energy: -46.126 bonds (distance) P-C4' energy: -48.526 flat angles C4'-P-C4' energy: -47.260 flat angles P-C4'-P energy: -39.297 tors. eta vs tors. theta energy: -62.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -710.711811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -710.711811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.711811 (E_RNA) where: Base-Base interactions energy: -475.403 where: short stacking energy: -207.584 Base-Backbone interact. energy: -1.269 local terms energy: -234.039409 where: bonds (distance) C4'-P energy: -42.288 bonds (distance) P-C4' energy: -47.366 flat angles C4'-P-C4' energy: -49.935 flat angles P-C4'-P energy: -34.154 tors. eta vs tors. theta energy: -60.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -708.107258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.107258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.107258 (E_RNA) where: Base-Base interactions energy: -492.621 where: short stacking energy: -199.043 Base-Backbone interact. energy: 1.223 local terms energy: -216.709102 where: bonds (distance) C4'-P energy: -41.015 bonds (distance) P-C4' energy: -41.353 flat angles C4'-P-C4' energy: -53.546 flat angles P-C4'-P energy: -35.953 tors. eta vs tors. theta energy: -44.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -603.906718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.906718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.906718 (E_RNA) where: Base-Base interactions energy: -387.427 where: short stacking energy: -189.672 Base-Backbone interact. energy: -0.783 local terms energy: -215.697536 where: bonds (distance) C4'-P energy: -36.756 bonds (distance) P-C4' energy: -52.755 flat angles C4'-P-C4' energy: -45.364 flat angles P-C4'-P energy: -27.923 tors. eta vs tors. theta energy: -52.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -514.666537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.666537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.666537 (E_RNA) where: Base-Base interactions energy: -335.942 where: short stacking energy: -152.245 Base-Backbone interact. energy: -1.521 local terms energy: -177.203264 where: bonds (distance) C4'-P energy: -44.347 bonds (distance) P-C4' energy: -38.232 flat angles C4'-P-C4' energy: -34.924 flat angles P-C4'-P energy: -29.880 tors. eta vs tors. theta energy: -29.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -509.310007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.310007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.310007 (E_RNA) where: Base-Base interactions energy: -332.633 where: short stacking energy: -150.414 Base-Backbone interact. energy: -2.337 local terms energy: -174.339754 where: bonds (distance) C4'-P energy: -38.916 bonds (distance) P-C4' energy: -43.238 flat angles C4'-P-C4' energy: -35.369 flat angles P-C4'-P energy: -31.198 tors. eta vs tors. theta energy: -25.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -237.944203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.944203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.944203 (E_RNA) where: Base-Base interactions energy: -86.666 where: short stacking energy: -81.022 Base-Backbone interact. energy: 2.873 local terms energy: -154.151637 where: bonds (distance) C4'-P energy: -31.741 bonds (distance) P-C4' energy: -47.186 flat angles C4'-P-C4' energy: -40.689 flat angles P-C4'-P energy: -21.962 tors. eta vs tors. theta energy: -12.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -229.015221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.015221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.015221 (E_RNA) where: Base-Base interactions energy: -82.442 where: short stacking energy: -67.123 Base-Backbone interact. energy: 0.095 local terms energy: -146.668085 where: bonds (distance) C4'-P energy: -47.392 bonds (distance) P-C4' energy: -45.602 flat angles C4'-P-C4' energy: -26.663 flat angles P-C4'-P energy: -32.518 tors. eta vs tors. theta energy: 5.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -840.999620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.999620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -840.999620 (E_RNA) where: Base-Base interactions energy: -585.804 where: short stacking energy: -255.242 Base-Backbone interact. energy: -0.197 local terms energy: -254.998437 where: bonds (distance) C4'-P energy: -48.191 bonds (distance) P-C4' energy: -50.935 flat angles C4'-P-C4' energy: -52.283 flat angles P-C4'-P energy: -40.116 tors. eta vs tors. theta energy: -63.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -833.513624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.513624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.513624 (E_RNA) where: Base-Base interactions energy: -580.304 where: short stacking energy: -253.552 Base-Backbone interact. energy: -1.112 local terms energy: -252.098219 where: bonds (distance) C4'-P energy: -44.278 bonds (distance) P-C4' energy: -47.952 flat angles C4'-P-C4' energy: -53.666 flat angles P-C4'-P energy: -37.981 tors. eta vs tors. theta energy: -68.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -792.350850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -792.350850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -792.350850 (E_RNA) where: Base-Base interactions energy: -553.385 where: short stacking energy: -251.978 Base-Backbone interact. energy: -0.820 local terms energy: -238.145845 where: bonds (distance) C4'-P energy: -45.980 bonds (distance) P-C4' energy: -36.798 flat angles C4'-P-C4' energy: -54.487 flat angles P-C4'-P energy: -34.201 tors. eta vs tors. theta energy: -66.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -724.542116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.542116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.542116 (E_RNA) where: Base-Base interactions energy: -492.150 where: short stacking energy: -201.712 Base-Backbone interact. energy: -0.718 local terms energy: -231.673657 where: bonds (distance) C4'-P energy: -46.119 bonds (distance) P-C4' energy: -44.054 flat angles C4'-P-C4' energy: -55.639 flat angles P-C4'-P energy: -27.363 tors. eta vs tors. theta energy: -58.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -719.540339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.540339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.540339 (E_RNA) where: Base-Base interactions energy: -514.419 where: short stacking energy: -209.586 Base-Backbone interact. energy: -2.562 local terms energy: -202.559427 where: bonds (distance) C4'-P energy: -41.312 bonds (distance) P-C4' energy: -44.702 flat angles C4'-P-C4' energy: -39.571 flat angles P-C4'-P energy: -31.570 tors. eta vs tors. theta energy: -45.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -566.105419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.105419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.105419 (E_RNA) where: Base-Base interactions energy: -358.499 where: short stacking energy: -186.540 Base-Backbone interact. energy: 0.334 local terms energy: -207.940309 where: bonds (distance) C4'-P energy: -38.198 bonds (distance) P-C4' energy: -55.050 flat angles C4'-P-C4' energy: -47.038 flat angles P-C4'-P energy: -32.265 tors. eta vs tors. theta energy: -35.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -516.527272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.527272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.527272 (E_RNA) where: Base-Base interactions energy: -321.321 where: short stacking energy: -147.026 Base-Backbone interact. energy: -1.553 local terms energy: -193.653279 where: bonds (distance) C4'-P energy: -41.512 bonds (distance) P-C4' energy: -45.166 flat angles C4'-P-C4' energy: -44.477 flat angles P-C4'-P energy: -34.979 tors. eta vs tors. theta energy: -27.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -478.997848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.997848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.997848 (E_RNA) where: Base-Base interactions energy: -296.049 where: short stacking energy: -147.405 Base-Backbone interact. energy: -0.018 local terms energy: -182.930705 where: bonds (distance) C4'-P energy: -35.597 bonds (distance) P-C4' energy: -49.551 flat angles C4'-P-C4' energy: -50.383 flat angles P-C4'-P energy: -25.096 tors. eta vs tors. theta energy: -22.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -268.964269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.964269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.964269 (E_RNA) where: Base-Base interactions energy: -109.159 where: short stacking energy: -76.129 Base-Backbone interact. energy: -1.816 local terms energy: -157.989500 where: bonds (distance) C4'-P energy: -45.307 bonds (distance) P-C4' energy: -48.208 flat angles C4'-P-C4' energy: -31.120 flat angles P-C4'-P energy: -32.107 tors. eta vs tors. theta energy: -1.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -229.507723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.507723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.507723 (E_RNA) where: Base-Base interactions energy: -70.024 where: short stacking energy: -69.711 Base-Backbone interact. energy: 0.122 local terms energy: -159.605352 where: bonds (distance) C4'-P energy: -46.205 bonds (distance) P-C4' energy: -41.923 flat angles C4'-P-C4' energy: -32.710 flat angles P-C4'-P energy: -28.192 tors. eta vs tors. theta energy: -10.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)