SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/sedhu-d83226db/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/sedhu-d83226db/inputs/seq.fa: 1 curr_seq: _UGAUCGCCAUCUUCGACGAGGACGGCGGCGGCACCGUGGACUUCCAGGAGUUCGUGGGCGGCCUGAGCGCCUUCAGCAGCAGGGGCGGCAGGGAGGAGAAGCUGAGGUUCGCCUUCAAGGUGUACGACAUGGACAGGGACGGCUACAUCAGCAACGGCGAGCUGUACCUGGUGCUGAAGAUGAUGGUGGGCAACAACCUGAAGGACACCCAGCUGCAGCAGAUCGUGGACAAGACCAUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UGAUCGCCAUCUUCGACGAGGACGGCGGCGGCACCGUGGACUUCCAGGAGUUCGUGGGCGGCCUGAGCGCCUUCAGCAGCAGGGGCGGCAGGGAGGAGAAGCUGAGGUUCGCCUUCAAGGUGUACGACAUGGACAGGGACGGCUACAUCAGCAACGGCGAGCUGUACCUGGUGCUGAAGAUGAUGGUGGGCAACAACCUGAAGGACACCCAGCUGCAGCAGAUCGUGGACAAGACCAUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 239 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1200 n_atoms_counter: 1200 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _....((((.(((((...))))).))))(((((...(((..((((.(((.(((((.((....)))))))..((((((((.((((.(((((...........(((((.((..(((.((...((.((.....)).))...)).))).)).)))))........_ chain: 2: _))))).)))).)))))))).((.((.....)).)).)))))))..)))...)))))........((((......))))._ nucl1: 13, chain1: 0, <---> nucl2: 17, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 17 nucl1: 12, chain1: 0, <---> nucl2: 18, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 18 nucl1: 11, chain1: 0, <---> nucl2: 19, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 19 nucl1: 10, chain1: 0, <---> nucl2: 20, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 20 nucl1: 9, chain1: 0, <---> nucl2: 21, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 21 nucl1: 7, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 6, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 5, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 4, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 56, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 55, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 55, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 53, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 52, chain1: 0, <---> nucl2: 64, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 64 nucl1: 51, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 65 nucl1: 50, chain1: 0, <---> nucl2: 66, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 50, chainIndex_2: 0, nuclIndex_2: 66 nucl1: 49, chain1: 0, <---> nucl2: 67, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 49, chainIndex_2: 0, nuclIndex_2: 67 nucl1: 123, chain1: 0, <---> nucl2: 129, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 129 nucl1: 122, chain1: 0, <---> nucl2: 130, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 130 nucl1: 120, chain1: 0, <---> nucl2: 132, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 120, chainIndex_2: 0, nuclIndex_2: 132 nucl1: 119, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 119, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 115, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 115, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 114, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 114, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 112, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 112, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 111, chain1: 0, <---> nucl2: 141, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 111, chainIndex_2: 0, nuclIndex_2: 141 nucl1: 110, chain1: 0, <---> nucl2: 142, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 110, chainIndex_2: 0, nuclIndex_2: 142 nucl1: 107, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 107, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 106, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 106, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 104, chain1: 0, <---> nucl2: 147, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 104, chainIndex_2: 0, nuclIndex_2: 147 nucl1: 103, chain1: 0, <---> nucl2: 148, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 103, chainIndex_2: 0, nuclIndex_2: 148 nucl1: 102, chain1: 0, <---> nucl2: 149, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 102, chainIndex_2: 0, nuclIndex_2: 149 nucl1: 101, chain1: 0, <---> nucl2: 150, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 150 nucl1: 100, chain1: 0, <---> nucl2: 151, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 151 nucl1: 88, chain1: 0, <---> nucl2: 0, chain2: 1 ERROR: chainIndex_1: 0, chainIndex_2: 1 ERROR: number of chains specified in secondary strc. restraints file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/sedhu-d83226db/inputs/hard_ss.ss is greater than actual number of chains which is: 1 out arg RESULTS//1/sedhu-d83226db_01