SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa: 1 curr_seq: _GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 43 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((...(((((((..(......)..))))))))).))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 16, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 15, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 14, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 13, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 12, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 11, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 10, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 3, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 43.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa: 1 curr_seq: _GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 43 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((...(((((((..(......)..))))))))).))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 16, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 15, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 14, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 13, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 12, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 11, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 10, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 3, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 43.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa: 1 curr_seq: _GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 43 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((...(((((((..(......)..))))))))).))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 16, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 15, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 14, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 13, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 12, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 11, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 10, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 3, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 43.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa: 1 curr_seq: _GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 43 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((...(((((((..(......)..))))))))).))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 16, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 15, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 14, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 13, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 12, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 11, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 10, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 3, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 43.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa: 1 curr_seq: _GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 43 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((...(((((((..(......)..))))))))).))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 16, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 15, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 14, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 13, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 12, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 11, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 10, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 3, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 43.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa: 1 curr_seq: _GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 43 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((...(((((((..(......)..))))))))).))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 16, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 15, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 14, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 13, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 12, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 11, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 10, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 3, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 43.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa: 1 curr_seq: _GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 43 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((...(((((((..(......)..))))))))).))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 16, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 15, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 14, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 13, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 12, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 11, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 10, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 3, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 43.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa: 1 curr_seq: _GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 43 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((...(((((((..(......)..))))))))).))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 16, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 15, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 14, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 13, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 12, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 11, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 10, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 3, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 43.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa: 1 curr_seq: _GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 43 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((...(((((((..(......)..))))))))).))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 16, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 15, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 14, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 13, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 12, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 11, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 10, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 3, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 43.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/nima-ed34d04a/inputs/seq.fa: 1 curr_seq: _GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GAGGUGCGUGCGGGCUGCAGCGCAGACCCCGGCCCGGCCCCUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 43 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((...(((((((..(......)..))))))))).))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 16, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 15, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 14, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 13, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 12, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 11, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 10, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 3, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 43.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: 373.672231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 373.672231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.293214 (E_RNA) where: Base-Base interactions energy: -9.578 where: short stacking energy: -9.578 Base-Backbone interact. energy: -0.000 local terms energy: -167.715585 where: bonds (distance) C4'-P energy: -41.778 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -31.572 flat angles P-C4'-P energy: -36.115 tors. eta vs tors. theta energy: -18.887 Dist. restrs. and SS energy: 550.965 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: 373.672231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 373.672231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.293214 (E_RNA) where: Base-Base interactions energy: -9.578 where: short stacking energy: -9.578 Base-Backbone interact. energy: -0.000 local terms energy: -167.715585 where: bonds (distance) C4'-P energy: -41.778 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -31.572 flat angles P-C4'-P energy: -36.115 tors. eta vs tors. theta energy: -18.887 Dist. restrs. and SS energy: 550.965 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: 373.672231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 373.672231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.293214 (E_RNA) where: Base-Base interactions energy: -9.578 where: short stacking energy: -9.578 Base-Backbone interact. energy: -0.000 local terms energy: -167.715585 where: bonds (distance) C4'-P energy: -41.778 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -31.572 flat angles P-C4'-P energy: -36.115 tors. eta vs tors. theta energy: -18.887 Dist. restrs. and SS energy: 550.965 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: 373.672231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 373.672231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.293214 (E_RNA) where: Base-Base interactions energy: -9.578 where: short stacking energy: -9.578 Base-Backbone interact. energy: -0.000 local terms energy: -167.715585 where: bonds (distance) C4'-P energy: -41.778 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -31.572 flat angles P-C4'-P energy: -36.115 tors. eta vs tors. theta energy: -18.887 Dist. restrs. and SS energy: 550.965 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: 373.672231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 373.672231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.293214 (E_RNA) where: Base-Base interactions energy: -9.578 where: short stacking energy: -9.578 Base-Backbone interact. energy: -0.000 local terms energy: -167.715585 where: bonds (distance) C4'-P energy: -41.778 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -31.572 flat angles P-C4'-P energy: -36.115 tors. eta vs tors. theta energy: -18.887 Dist. restrs. and SS energy: 550.965 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: 373.672231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 373.672231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.293214 (E_RNA) where: Base-Base interactions energy: -9.578 where: short stacking energy: -9.578 Base-Backbone interact. energy: -0.000 local terms energy: -167.715585 where: bonds (distance) C4'-P energy: -41.778 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -31.572 flat angles P-C4'-P energy: -36.115 tors. eta vs tors. theta energy: -18.887 Dist. restrs. and SS energy: 550.965 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: 373.672231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 373.672231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.293214 (E_RNA) where: Base-Base interactions energy: -9.578 where: short stacking energy: -9.578 Base-Backbone interact. energy: -0.000 local terms energy: -167.715585 where: bonds (distance) C4'-P energy: -41.778 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -31.572 flat angles P-C4'-P energy: -36.115 tors. eta vs tors. theta energy: -18.887 Dist. restrs. and SS energy: 550.965 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: 373.672231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 373.672231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.293214 (E_RNA) where: Base-Base interactions energy: -9.578 where: short stacking energy: -9.578 Base-Backbone interact. energy: -0.000 local terms energy: -167.715585 where: bonds (distance) C4'-P energy: -41.778 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -31.572 flat angles P-C4'-P energy: -36.115 tors. eta vs tors. theta energy: -18.887 Dist. restrs. and SS energy: 550.965 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: 373.672231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 373.672231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.293214 (E_RNA) where: Base-Base interactions energy: -9.578 where: short stacking energy: -9.578 Base-Backbone interact. energy: -0.000 local terms energy: -167.715585 where: bonds (distance) C4'-P energy: -41.778 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -31.572 flat angles P-C4'-P energy: -36.115 tors. eta vs tors. theta energy: -18.887 Dist. restrs. and SS energy: 550.965 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: 373.672231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 373.672231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.293214 (E_RNA) where: Base-Base interactions energy: -9.578 where: short stacking energy: -9.578 Base-Backbone interact. energy: -0.000 local terms energy: -167.715585 where: bonds (distance) C4'-P energy: -41.778 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -31.572 flat angles P-C4'-P energy: -36.115 tors. eta vs tors. theta energy: -18.887 Dist. restrs. and SS energy: 550.965 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -459.321873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.321873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.556583 (E_RNA) where: Base-Base interactions energy: -330.321 where: short stacking energy: -128.667 Base-Backbone interact. energy: -0.063 local terms energy: -129.172797 where: bonds (distance) C4'-P energy: -26.870 bonds (distance) P-C4' energy: -25.531 flat angles C4'-P-C4' energy: -29.488 flat angles P-C4'-P energy: -19.915 tors. eta vs tors. theta energy: -27.369 Dist. restrs. and SS energy: 0.235 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -365.173804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.173804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.380806 (E_RNA) where: Base-Base interactions energy: -246.479 where: short stacking energy: -87.448 Base-Backbone interact. energy: -1.936 local terms energy: -120.965982 where: bonds (distance) C4'-P energy: -31.587 bonds (distance) P-C4' energy: -28.515 flat angles C4'-P-C4' energy: -22.503 flat angles P-C4'-P energy: -17.114 tors. eta vs tors. theta energy: -21.248 Dist. restrs. and SS energy: 4.207 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -417.341582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.341582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.490940 (E_RNA) where: Base-Base interactions energy: -287.847 where: short stacking energy: -123.058 Base-Backbone interact. energy: -0.316 local terms energy: -130.328217 where: bonds (distance) C4'-P energy: -26.245 bonds (distance) P-C4' energy: -27.717 flat angles C4'-P-C4' energy: -32.929 flat angles P-C4'-P energy: -14.622 tors. eta vs tors. theta energy: -28.815 Dist. restrs. and SS energy: 1.149 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -373.472706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.472706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.130555 (E_RNA) where: Base-Base interactions energy: -255.898 where: short stacking energy: -105.636 Base-Backbone interact. energy: -0.253 local terms energy: -123.979131 where: bonds (distance) C4'-P energy: -20.246 bonds (distance) P-C4' energy: -31.506 flat angles C4'-P-C4' energy: -30.718 flat angles P-C4'-P energy: -19.495 tors. eta vs tors. theta energy: -22.014 Dist. restrs. and SS energy: 6.658 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -338.987277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.987277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.034568 (E_RNA) where: Base-Base interactions energy: -228.870 where: short stacking energy: -118.658 Base-Backbone interact. energy: -0.827 local terms energy: -129.336944 where: bonds (distance) C4'-P energy: -29.590 bonds (distance) P-C4' energy: -28.872 flat angles C4'-P-C4' energy: -27.926 flat angles P-C4'-P energy: -15.481 tors. eta vs tors. theta energy: -27.469 Dist. restrs. and SS energy: 20.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -261.377848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.377848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.313884 (E_RNA) where: Base-Base interactions energy: -175.058 where: short stacking energy: -54.012 Base-Backbone interact. energy: 0.189 local terms energy: -97.444962 where: bonds (distance) C4'-P energy: -22.894 bonds (distance) P-C4' energy: -25.594 flat angles C4'-P-C4' energy: -24.145 flat angles P-C4'-P energy: -10.966 tors. eta vs tors. theta energy: -13.846 Dist. restrs. and SS energy: 10.936 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -293.785680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.785680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.565410 (E_RNA) where: Base-Base interactions energy: -219.408 where: short stacking energy: -80.495 Base-Backbone interact. energy: -0.511 local terms energy: -88.646915 where: bonds (distance) C4'-P energy: -16.011 bonds (distance) P-C4' energy: -16.327 flat angles C4'-P-C4' energy: -20.312 flat angles P-C4'-P energy: -16.325 tors. eta vs tors. theta energy: -19.672 Dist. restrs. and SS energy: 14.780 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -340.128874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.128874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.020527 (E_RNA) where: Base-Base interactions energy: -245.118 where: short stacking energy: -94.740 Base-Backbone interact. energy: -0.274 local terms energy: -101.628030 where: bonds (distance) C4'-P energy: -29.681 bonds (distance) P-C4' energy: -24.686 flat angles C4'-P-C4' energy: -23.152 flat angles P-C4'-P energy: -8.304 tors. eta vs tors. theta energy: -15.804 Dist. restrs. and SS energy: 6.892 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -326.913344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.913344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.382925 (E_RNA) where: Base-Base interactions energy: -234.076 where: short stacking energy: -83.311 Base-Backbone interact. energy: 0.023 local terms energy: -96.330389 where: bonds (distance) C4'-P energy: -21.331 bonds (distance) P-C4' energy: -23.918 flat angles C4'-P-C4' energy: -24.366 flat angles P-C4'-P energy: -16.219 tors. eta vs tors. theta energy: -10.496 Dist. restrs. and SS energy: 3.470 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -336.928760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.928760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.491319 (E_RNA) where: Base-Base interactions energy: -247.036 where: short stacking energy: -106.955 Base-Backbone interact. energy: -1.224 local terms energy: -93.230906 where: bonds (distance) C4'-P energy: -22.495 bonds (distance) P-C4' energy: -25.110 flat angles C4'-P-C4' energy: -20.950 flat angles P-C4'-P energy: -8.011 tors. eta vs tors. theta energy: -16.666 Dist. restrs. and SS energy: 4.563 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -481.024653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.024653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.976825 (E_RNA) where: Base-Base interactions energy: -344.703 where: short stacking energy: -152.406 Base-Backbone interact. energy: -0.347 local terms energy: -136.926784 where: bonds (distance) C4'-P energy: -28.275 bonds (distance) P-C4' energy: -27.678 flat angles C4'-P-C4' energy: -30.059 flat angles P-C4'-P energy: -18.177 tors. eta vs tors. theta energy: -32.737 Dist. restrs. and SS energy: 0.952 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -447.964964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.964964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.115887 (E_RNA) where: Base-Base interactions energy: -312.088 where: short stacking energy: -135.572 Base-Backbone interact. energy: -0.580 local terms energy: -137.447957 where: bonds (distance) C4'-P energy: -29.790 bonds (distance) P-C4' energy: -23.707 flat angles C4'-P-C4' energy: -31.999 flat angles P-C4'-P energy: -23.620 tors. eta vs tors. theta energy: -28.332 Dist. restrs. and SS energy: 2.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -438.526265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.526265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.782213 (E_RNA) where: Base-Base interactions energy: -304.375 where: short stacking energy: -134.891 Base-Backbone interact. energy: -0.447 local terms energy: -137.960985 where: bonds (distance) C4'-P energy: -23.543 bonds (distance) P-C4' energy: -30.710 flat angles C4'-P-C4' energy: -32.652 flat angles P-C4'-P energy: -17.912 tors. eta vs tors. theta energy: -33.143 Dist. restrs. and SS energy: 4.256 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -399.371728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.371728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.697617 (E_RNA) where: Base-Base interactions energy: -290.542 where: short stacking energy: -120.224 Base-Backbone interact. energy: -0.263 local terms energy: -129.893243 where: bonds (distance) C4'-P energy: -28.852 bonds (distance) P-C4' energy: -33.225 flat angles C4'-P-C4' energy: -24.501 flat angles P-C4'-P energy: -11.190 tors. eta vs tors. theta energy: -32.125 Dist. restrs. and SS energy: 21.326 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -407.055276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.055276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.773766 (E_RNA) where: Base-Base interactions energy: -288.222 where: short stacking energy: -114.191 Base-Backbone interact. energy: -0.503 local terms energy: -126.048607 where: bonds (distance) C4'-P energy: -22.390 bonds (distance) P-C4' energy: -30.005 flat angles C4'-P-C4' energy: -28.155 flat angles P-C4'-P energy: -17.372 tors. eta vs tors. theta energy: -28.127 Dist. restrs. and SS energy: 7.718 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -343.910070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.910070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.930337 (E_RNA) where: Base-Base interactions energy: -255.858 where: short stacking energy: -105.580 Base-Backbone interact. energy: -0.107 local terms energy: -97.965244 where: bonds (distance) C4'-P energy: -14.770 bonds (distance) P-C4' energy: -25.001 flat angles C4'-P-C4' energy: -23.109 flat angles P-C4'-P energy: -17.122 tors. eta vs tors. theta energy: -17.963 Dist. restrs. and SS energy: 10.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -257.046628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.046628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.246873 (E_RNA) where: Base-Base interactions energy: -172.580 where: short stacking energy: -81.985 Base-Backbone interact. energy: -0.667 local terms energy: -91.000815 where: bonds (distance) C4'-P energy: -17.163 bonds (distance) P-C4' energy: -14.851 flat angles C4'-P-C4' energy: -19.733 flat angles P-C4'-P energy: -20.130 tors. eta vs tors. theta energy: -19.124 Dist. restrs. and SS energy: 7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -408.130490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.130490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.421626 (E_RNA) where: Base-Base interactions energy: -297.161 where: short stacking energy: -123.300 Base-Backbone interact. energy: -0.981 local terms energy: -114.279573 where: bonds (distance) C4'-P energy: -25.955 bonds (distance) P-C4' energy: -19.504 flat angles C4'-P-C4' energy: -25.474 flat angles P-C4'-P energy: -20.054 tors. eta vs tors. theta energy: -23.293 Dist. restrs. and SS energy: 4.291 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -390.816394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.816394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.798771 (E_RNA) where: Base-Base interactions energy: -274.705 where: short stacking energy: -115.177 Base-Backbone interact. energy: -0.731 local terms energy: -118.363069 where: bonds (distance) C4'-P energy: -20.997 bonds (distance) P-C4' energy: -22.499 flat angles C4'-P-C4' energy: -26.455 flat angles P-C4'-P energy: -16.940 tors. eta vs tors. theta energy: -31.472 Dist. restrs. and SS energy: 2.982 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -364.527892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.527892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.867223 (E_RNA) where: Base-Base interactions energy: -274.810 where: short stacking energy: -117.389 Base-Backbone interact. energy: 1.104 local terms energy: -96.161653 where: bonds (distance) C4'-P energy: -18.102 bonds (distance) P-C4' energy: -16.109 flat angles C4'-P-C4' energy: -21.166 flat angles P-C4'-P energy: -14.198 tors. eta vs tors. theta energy: -26.587 Dist. restrs. and SS energy: 5.339 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -495.426768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.426768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.945216 (E_RNA) where: Base-Base interactions energy: -357.220 where: short stacking energy: -156.342 Base-Backbone interact. energy: -0.124 local terms energy: -138.600950 where: bonds (distance) C4'-P energy: -26.639 bonds (distance) P-C4' energy: -27.132 flat angles C4'-P-C4' energy: -31.954 flat angles P-C4'-P energy: -20.094 tors. eta vs tors. theta energy: -32.782 Dist. restrs. and SS energy: 0.518 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -459.995416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.995416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.294765 (E_RNA) where: Base-Base interactions energy: -320.675 where: short stacking energy: -142.976 Base-Backbone interact. energy: 2.426 local terms energy: -145.045482 where: bonds (distance) C4'-P energy: -25.020 bonds (distance) P-C4' energy: -32.668 flat angles C4'-P-C4' energy: -34.618 flat angles P-C4'-P energy: -21.374 tors. eta vs tors. theta energy: -31.366 Dist. restrs. and SS energy: 3.299 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -451.045155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.045155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.491964 (E_RNA) where: Base-Base interactions energy: -327.518 where: short stacking energy: -135.677 Base-Backbone interact. energy: -0.132 local terms energy: -129.842333 where: bonds (distance) C4'-P energy: -26.958 bonds (distance) P-C4' energy: -24.042 flat angles C4'-P-C4' energy: -22.327 flat angles P-C4'-P energy: -24.202 tors. eta vs tors. theta energy: -32.314 Dist. restrs. and SS energy: 6.447 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -377.091179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.091179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.597972 (E_RNA) where: Base-Base interactions energy: -260.655 where: short stacking energy: -116.084 Base-Backbone interact. energy: -0.429 local terms energy: -135.513833 where: bonds (distance) C4'-P energy: -19.220 bonds (distance) P-C4' energy: -31.035 flat angles C4'-P-C4' energy: -28.980 flat angles P-C4'-P energy: -25.034 tors. eta vs tors. theta energy: -31.246 Dist. restrs. and SS energy: 19.507 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -432.009864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.009864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.733350 (E_RNA) where: Base-Base interactions energy: -313.985 where: short stacking energy: -119.857 Base-Backbone interact. energy: -0.812 local terms energy: -125.937083 where: bonds (distance) C4'-P energy: -22.475 bonds (distance) P-C4' energy: -24.514 flat angles C4'-P-C4' energy: -22.961 flat angles P-C4'-P energy: -21.362 tors. eta vs tors. theta energy: -34.625 Dist. restrs. and SS energy: 8.723 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -362.372383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.372383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.356903 (E_RNA) where: Base-Base interactions energy: -240.602 where: short stacking energy: -110.086 Base-Backbone interact. energy: -0.824 local terms energy: -129.930921 where: bonds (distance) C4'-P energy: -23.133 bonds (distance) P-C4' energy: -29.927 flat angles C4'-P-C4' energy: -30.910 flat angles P-C4'-P energy: -20.809 tors. eta vs tors. theta energy: -25.151 Dist. restrs. and SS energy: 8.985 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -439.885577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.885577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.527303 (E_RNA) where: Base-Base interactions energy: -306.191 where: short stacking energy: -124.344 Base-Backbone interact. energy: -0.164 local terms energy: -134.172130 where: bonds (distance) C4'-P energy: -21.783 bonds (distance) P-C4' energy: -33.803 flat angles C4'-P-C4' energy: -29.951 flat angles P-C4'-P energy: -19.700 tors. eta vs tors. theta energy: -28.936 Dist. restrs. and SS energy: 0.642 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -311.601021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.601021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.427976 (E_RNA) where: Base-Base interactions energy: -210.572 where: short stacking energy: -75.130 Base-Backbone interact. energy: -0.497 local terms energy: -107.358875 where: bonds (distance) C4'-P energy: -18.859 bonds (distance) P-C4' energy: -26.063 flat angles C4'-P-C4' energy: -25.858 flat angles P-C4'-P energy: -16.195 tors. eta vs tors. theta energy: -20.384 Dist. restrs. and SS energy: 6.827 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -370.284505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.284505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.092254 (E_RNA) where: Base-Base interactions energy: -261.838 where: short stacking energy: -111.248 Base-Backbone interact. energy: -0.914 local terms energy: -109.340317 where: bonds (distance) C4'-P energy: -24.579 bonds (distance) P-C4' energy: -22.069 flat angles C4'-P-C4' energy: -26.604 flat angles P-C4'-P energy: -10.264 tors. eta vs tors. theta energy: -25.825 Dist. restrs. and SS energy: 1.808 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -394.713617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.713617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.887025 (E_RNA) where: Base-Base interactions energy: -279.767 where: short stacking energy: -115.341 Base-Backbone interact. energy: -0.109 local terms energy: -116.011105 where: bonds (distance) C4'-P energy: -16.457 bonds (distance) P-C4' energy: -32.701 flat angles C4'-P-C4' energy: -18.823 flat angles P-C4'-P energy: -21.736 tors. eta vs tors. theta energy: -26.293 Dist. restrs. and SS energy: 1.173 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -496.808099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.808099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.729273 (E_RNA) where: Base-Base interactions energy: -350.218 where: short stacking energy: -153.825 Base-Backbone interact. energy: -0.478 local terms energy: -148.033234 where: bonds (distance) C4'-P energy: -29.360 bonds (distance) P-C4' energy: -31.016 flat angles C4'-P-C4' energy: -27.433 flat angles P-C4'-P energy: -26.040 tors. eta vs tors. theta energy: -34.184 Dist. restrs. and SS energy: 1.921 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -482.153906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.153906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.336833 (E_RNA) where: Base-Base interactions energy: -346.527 where: short stacking energy: -152.726 Base-Backbone interact. energy: -0.143 local terms energy: -138.667094 where: bonds (distance) C4'-P energy: -32.962 bonds (distance) P-C4' energy: -23.256 flat angles C4'-P-C4' energy: -30.836 flat angles P-C4'-P energy: -19.338 tors. eta vs tors. theta energy: -32.275 Dist. restrs. and SS energy: 3.183 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -456.158649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.158649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.898593 (E_RNA) where: Base-Base interactions energy: -329.186 where: short stacking energy: -130.596 Base-Backbone interact. energy: -0.491 local terms energy: -128.222023 where: bonds (distance) C4'-P energy: -31.192 bonds (distance) P-C4' energy: -28.742 flat angles C4'-P-C4' energy: -27.844 flat angles P-C4'-P energy: -11.672 tors. eta vs tors. theta energy: -28.771 Dist. restrs. and SS energy: 1.740 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -439.765332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.765332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.489132 (E_RNA) where: Base-Base interactions energy: -313.792 where: short stacking energy: -109.533 Base-Backbone interact. energy: -0.531 local terms energy: -130.166620 where: bonds (distance) C4'-P energy: -26.905 bonds (distance) P-C4' energy: -32.539 flat angles C4'-P-C4' energy: -29.456 flat angles P-C4'-P energy: -12.635 tors. eta vs tors. theta energy: -28.631 Dist. restrs. and SS energy: 4.724 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -418.750195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.750195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.239214 (E_RNA) where: Base-Base interactions energy: -288.887 where: short stacking energy: -121.740 Base-Backbone interact. energy: -0.602 local terms energy: -139.749905 where: bonds (distance) C4'-P energy: -28.792 bonds (distance) P-C4' energy: -29.412 flat angles C4'-P-C4' energy: -30.196 flat angles P-C4'-P energy: -20.236 tors. eta vs tors. theta energy: -31.114 Dist. restrs. and SS energy: 10.489 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -491.775502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.775502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.900769 (E_RNA) where: Base-Base interactions energy: -353.297 where: short stacking energy: -151.646 Base-Backbone interact. energy: -0.166 local terms energy: -138.438679 where: bonds (distance) C4'-P energy: -24.397 bonds (distance) P-C4' energy: -29.486 flat angles C4'-P-C4' energy: -30.662 flat angles P-C4'-P energy: -14.438 tors. eta vs tors. theta energy: -39.456 Dist. restrs. and SS energy: 0.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -357.324129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.324129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.511035 (E_RNA) where: Base-Base interactions energy: -252.297 where: short stacking energy: -103.292 Base-Backbone interact. energy: -0.981 local terms energy: -110.233641 where: bonds (distance) C4'-P energy: -31.182 bonds (distance) P-C4' energy: -19.703 flat angles C4'-P-C4' energy: -24.552 flat angles P-C4'-P energy: -19.923 tors. eta vs tors. theta energy: -14.874 Dist. restrs. and SS energy: 6.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -386.195117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.195117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.940797 (E_RNA) where: Base-Base interactions energy: -293.555 where: short stacking energy: -123.201 Base-Backbone interact. energy: 2.466 local terms energy: -99.852259 where: bonds (distance) C4'-P energy: -24.201 bonds (distance) P-C4' energy: -16.676 flat angles C4'-P-C4' energy: -28.242 flat angles P-C4'-P energy: -6.041 tors. eta vs tors. theta energy: -24.692 Dist. restrs. and SS energy: 4.746 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -356.367752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.367752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.068235 (E_RNA) where: Base-Base interactions energy: -252.571 where: short stacking energy: -92.601 Base-Backbone interact. energy: -0.698 local terms energy: -115.799449 where: bonds (distance) C4'-P energy: -25.919 bonds (distance) P-C4' energy: -20.377 flat angles C4'-P-C4' energy: -26.525 flat angles P-C4'-P energy: -22.331 tors. eta vs tors. theta energy: -20.647 Dist. restrs. and SS energy: 12.700 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -409.638965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.638965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.083002 (E_RNA) where: Base-Base interactions energy: -286.559 where: short stacking energy: -128.257 Base-Backbone interact. energy: -0.594 local terms energy: -124.929679 where: bonds (distance) C4'-P energy: -20.112 bonds (distance) P-C4' energy: -28.629 flat angles C4'-P-C4' energy: -22.652 flat angles P-C4'-P energy: -19.533 tors. eta vs tors. theta energy: -34.003 Dist. restrs. and SS energy: 2.444 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -507.951488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.951488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.572455 (E_RNA) where: Base-Base interactions energy: -358.161 where: short stacking energy: -145.263 Base-Backbone interact. energy: -0.183 local terms energy: -151.228412 where: bonds (distance) C4'-P energy: -26.714 bonds (distance) P-C4' energy: -33.474 flat angles C4'-P-C4' energy: -32.629 flat angles P-C4'-P energy: -22.225 tors. eta vs tors. theta energy: -36.187 Dist. restrs. and SS energy: 1.621 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -509.743886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.743886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.724078 (E_RNA) where: Base-Base interactions energy: -357.437 where: short stacking energy: -151.172 Base-Backbone interact. energy: -0.017 local terms energy: -153.270675 where: bonds (distance) C4'-P energy: -29.798 bonds (distance) P-C4' energy: -33.175 flat angles C4'-P-C4' energy: -30.774 flat angles P-C4'-P energy: -23.855 tors. eta vs tors. theta energy: -35.669 Dist. restrs. and SS energy: 0.980 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -453.929078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.929078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.938598 (E_RNA) where: Base-Base interactions energy: -322.276 where: short stacking energy: -137.841 Base-Backbone interact. energy: -0.313 local terms energy: -132.349546 where: bonds (distance) C4'-P energy: -22.744 bonds (distance) P-C4' energy: -32.156 flat angles C4'-P-C4' energy: -31.766 flat angles P-C4'-P energy: -16.483 tors. eta vs tors. theta energy: -29.200 Dist. restrs. and SS energy: 1.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -439.087019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.087019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.874530 (E_RNA) where: Base-Base interactions energy: -315.861 where: short stacking energy: -121.361 Base-Backbone interact. energy: -0.875 local terms energy: -130.138777 where: bonds (distance) C4'-P energy: -28.028 bonds (distance) P-C4' energy: -22.956 flat angles C4'-P-C4' energy: -31.037 flat angles P-C4'-P energy: -18.486 tors. eta vs tors. theta energy: -29.631 Dist. restrs. and SS energy: 7.788 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -501.515317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.515317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.749613 (E_RNA) where: Base-Base interactions energy: -367.373 where: short stacking energy: -156.504 Base-Backbone interact. energy: -1.036 local terms energy: -133.340599 where: bonds (distance) C4'-P energy: -22.377 bonds (distance) P-C4' energy: -27.463 flat angles C4'-P-C4' energy: -28.044 flat angles P-C4'-P energy: -13.449 tors. eta vs tors. theta energy: -42.007 Dist. restrs. and SS energy: 0.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -458.892934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.892934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.629468 (E_RNA) where: Base-Base interactions energy: -334.651 where: short stacking energy: -136.638 Base-Backbone interact. energy: -0.386 local terms energy: -126.592617 where: bonds (distance) C4'-P energy: -22.650 bonds (distance) P-C4' energy: -27.359 flat angles C4'-P-C4' energy: -28.742 flat angles P-C4'-P energy: -14.001 tors. eta vs tors. theta energy: -33.841 Dist. restrs. and SS energy: 2.737 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -383.504055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.504055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.657006 (E_RNA) where: Base-Base interactions energy: -275.194 where: short stacking energy: -106.736 Base-Backbone interact. energy: 2.023 local terms energy: -117.486062 where: bonds (distance) C4'-P energy: -28.695 bonds (distance) P-C4' energy: -25.567 flat angles C4'-P-C4' energy: -21.076 flat angles P-C4'-P energy: -19.222 tors. eta vs tors. theta energy: -22.926 Dist. restrs. and SS energy: 7.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -357.357817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.357817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.951647 (E_RNA) where: Base-Base interactions energy: -254.895 where: short stacking energy: -97.044 Base-Backbone interact. energy: -0.554 local terms energy: -110.502743 where: bonds (distance) C4'-P energy: -26.468 bonds (distance) P-C4' energy: -26.586 flat angles C4'-P-C4' energy: -27.413 flat angles P-C4'-P energy: -13.551 tors. eta vs tors. theta energy: -16.485 Dist. restrs. and SS energy: 8.594 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -392.993836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.993836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.062914 (E_RNA) where: Base-Base interactions energy: -283.999 where: short stacking energy: -114.304 Base-Backbone interact. energy: -0.379 local terms energy: -109.685064 where: bonds (distance) C4'-P energy: -20.304 bonds (distance) P-C4' energy: -25.319 flat angles C4'-P-C4' energy: -23.452 flat angles P-C4'-P energy: -14.086 tors. eta vs tors. theta energy: -26.524 Dist. restrs. and SS energy: 1.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -383.834989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.834989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.696862 (E_RNA) where: Base-Base interactions energy: -290.575 where: short stacking energy: -126.300 Base-Backbone interact. energy: -0.844 local terms energy: -95.277895 where: bonds (distance) C4'-P energy: -11.521 bonds (distance) P-C4' energy: -23.094 flat angles C4'-P-C4' energy: -20.651 flat angles P-C4'-P energy: -13.341 tors. eta vs tors. theta energy: -26.671 Dist. restrs. and SS energy: 2.862 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -516.675529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.675529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.636772 (E_RNA) where: Base-Base interactions energy: -372.306 where: short stacking energy: -156.745 Base-Backbone interact. energy: -1.729 local terms energy: -145.601145 where: bonds (distance) C4'-P energy: -24.982 bonds (distance) P-C4' energy: -31.765 flat angles C4'-P-C4' energy: -32.016 flat angles P-C4'-P energy: -21.015 tors. eta vs tors. theta energy: -35.823 Dist. restrs. and SS energy: 2.961 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -505.881292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.881292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.112555 (E_RNA) where: Base-Base interactions energy: -362.168 where: short stacking energy: -157.205 Base-Backbone interact. energy: -0.112 local terms energy: -143.832525 where: bonds (distance) C4'-P energy: -24.099 bonds (distance) P-C4' energy: -26.486 flat angles C4'-P-C4' energy: -34.865 flat angles P-C4'-P energy: -24.381 tors. eta vs tors. theta energy: -34.001 Dist. restrs. and SS energy: 0.231 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -455.642730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.642730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.312746 (E_RNA) where: Base-Base interactions energy: -326.450 where: short stacking energy: -123.610 Base-Backbone interact. energy: 1.196 local terms energy: -132.059485 where: bonds (distance) C4'-P energy: -28.517 bonds (distance) P-C4' energy: -31.540 flat angles C4'-P-C4' energy: -24.869 flat angles P-C4'-P energy: -25.421 tors. eta vs tors. theta energy: -21.713 Dist. restrs. and SS energy: 1.670 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -515.210520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.210520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.736882 (E_RNA) where: Base-Base interactions energy: -369.899 where: short stacking energy: -154.166 Base-Backbone interact. energy: -0.421 local terms energy: -145.417012 where: bonds (distance) C4'-P energy: -25.191 bonds (distance) P-C4' energy: -24.578 flat angles C4'-P-C4' energy: -32.134 flat angles P-C4'-P energy: -24.250 tors. eta vs tors. theta energy: -39.264 Dist. restrs. and SS energy: 0.526 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -438.230683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.230683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.927331 (E_RNA) where: Base-Base interactions energy: -319.254 where: short stacking energy: -137.020 Base-Backbone interact. energy: 0.023 local terms energy: -130.696123 where: bonds (distance) C4'-P energy: -31.419 bonds (distance) P-C4' energy: -20.775 flat angles C4'-P-C4' energy: -29.924 flat angles P-C4'-P energy: -19.295 tors. eta vs tors. theta energy: -29.283 Dist. restrs. and SS energy: 11.697 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -484.267048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.267048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.004670 (E_RNA) where: Base-Base interactions energy: -350.664 where: short stacking energy: -141.364 Base-Backbone interact. energy: -0.229 local terms energy: -134.111596 where: bonds (distance) C4'-P energy: -21.873 bonds (distance) P-C4' energy: -28.022 flat angles C4'-P-C4' energy: -31.843 flat angles P-C4'-P energy: -15.267 tors. eta vs tors. theta energy: -37.106 Dist. restrs. and SS energy: 0.738 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -392.700911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.700911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.423521 (E_RNA) where: Base-Base interactions energy: -274.873 where: short stacking energy: -114.995 Base-Backbone interact. energy: -0.422 local terms energy: -122.127875 where: bonds (distance) C4'-P energy: -26.245 bonds (distance) P-C4' energy: -27.537 flat angles C4'-P-C4' energy: -30.109 flat angles P-C4'-P energy: -16.921 tors. eta vs tors. theta energy: -21.316 Dist. restrs. and SS energy: 4.723 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -421.819565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.819565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.682724 (E_RNA) where: Base-Base interactions energy: -305.806 where: short stacking energy: -123.044 Base-Backbone interact. energy: -0.123 local terms energy: -122.753702 where: bonds (distance) C4'-P energy: -24.659 bonds (distance) P-C4' energy: -25.812 flat angles C4'-P-C4' energy: -27.001 flat angles P-C4'-P energy: -14.897 tors. eta vs tors. theta energy: -30.383 Dist. restrs. and SS energy: 6.863 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -379.958240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.958240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.856358 (E_RNA) where: Base-Base interactions energy: -270.315 where: short stacking energy: -103.608 Base-Backbone interact. energy: -0.109 local terms energy: -114.432825 where: bonds (distance) C4'-P energy: -27.120 bonds (distance) P-C4' energy: -28.229 flat angles C4'-P-C4' energy: -26.217 flat angles P-C4'-P energy: -18.904 tors. eta vs tors. theta energy: -13.964 Dist. restrs. and SS energy: 4.898 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -375.730661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.730661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.012029 (E_RNA) where: Base-Base interactions energy: -277.317 where: short stacking energy: -106.181 Base-Backbone interact. energy: -0.261 local terms energy: -100.433507 where: bonds (distance) C4'-P energy: -20.084 bonds (distance) P-C4' energy: -24.644 flat angles C4'-P-C4' energy: -19.826 flat angles P-C4'-P energy: -9.607 tors. eta vs tors. theta energy: -26.273 Dist. restrs. and SS energy: 2.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -510.175709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.175709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.546015 (E_RNA) where: Base-Base interactions energy: -368.191 where: short stacking energy: -148.535 Base-Backbone interact. energy: -0.097 local terms energy: -142.258352 where: bonds (distance) C4'-P energy: -29.762 bonds (distance) P-C4' energy: -26.225 flat angles C4'-P-C4' energy: -32.605 flat angles P-C4'-P energy: -19.588 tors. eta vs tors. theta energy: -34.078 Dist. restrs. and SS energy: 0.370 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -511.679127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.679127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.129795 (E_RNA) where: Base-Base interactions energy: -370.753 where: short stacking energy: -148.815 Base-Backbone interact. energy: -0.633 local terms energy: -140.743892 where: bonds (distance) C4'-P energy: -25.395 bonds (distance) P-C4' energy: -29.277 flat angles C4'-P-C4' energy: -27.613 flat angles P-C4'-P energy: -19.487 tors. eta vs tors. theta energy: -38.972 Dist. restrs. and SS energy: 0.451 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -529.885484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.885484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.283613 (E_RNA) where: Base-Base interactions energy: -380.913 where: short stacking energy: -153.186 Base-Backbone interact. energy: -0.639 local terms energy: -148.731744 where: bonds (distance) C4'-P energy: -31.144 bonds (distance) P-C4' energy: -31.605 flat angles C4'-P-C4' energy: -24.345 flat angles P-C4'-P energy: -23.031 tors. eta vs tors. theta energy: -38.606 Dist. restrs. and SS energy: 0.398 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -454.768881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.768881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.890454 (E_RNA) where: Base-Base interactions energy: -328.616 where: short stacking energy: -132.218 Base-Backbone interact. energy: -1.195 local terms energy: -126.079926 where: bonds (distance) C4'-P energy: -23.790 bonds (distance) P-C4' energy: -25.193 flat angles C4'-P-C4' energy: -32.263 flat angles P-C4'-P energy: -15.170 tors. eta vs tors. theta energy: -29.663 Dist. restrs. and SS energy: 1.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -499.973816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.973816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.207698 (E_RNA) where: Base-Base interactions energy: -361.569 where: short stacking energy: -137.275 Base-Backbone interact. energy: -1.017 local terms energy: -137.622169 where: bonds (distance) C4'-P energy: -22.527 bonds (distance) P-C4' energy: -29.437 flat angles C4'-P-C4' energy: -31.862 flat angles P-C4'-P energy: -22.352 tors. eta vs tors. theta energy: -31.445 Dist. restrs. and SS energy: 0.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -424.679373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.679373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.739952 (E_RNA) where: Base-Base interactions energy: -299.348 where: short stacking energy: -131.667 Base-Backbone interact. energy: -0.857 local terms energy: -129.535645 where: bonds (distance) C4'-P energy: -19.129 bonds (distance) P-C4' energy: -28.115 flat angles C4'-P-C4' energy: -29.293 flat angles P-C4'-P energy: -16.755 tors. eta vs tors. theta energy: -36.244 Dist. restrs. and SS energy: 5.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -433.986023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.986023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.302515 (E_RNA) where: Base-Base interactions energy: -306.558 where: short stacking energy: -126.350 Base-Backbone interact. energy: -0.026 local terms energy: -128.718625 where: bonds (distance) C4'-P energy: -25.426 bonds (distance) P-C4' energy: -22.440 flat angles C4'-P-C4' energy: -27.208 flat angles P-C4'-P energy: -22.252 tors. eta vs tors. theta energy: -31.393 Dist. restrs. and SS energy: 1.316 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -409.435385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.435385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.100010 (E_RNA) where: Base-Base interactions energy: -293.312 where: short stacking energy: -121.315 Base-Backbone interact. energy: -0.425 local terms energy: -123.362938 where: bonds (distance) C4'-P energy: -25.394 bonds (distance) P-C4' energy: -27.992 flat angles C4'-P-C4' energy: -25.644 flat angles P-C4'-P energy: -14.152 tors. eta vs tors. theta energy: -30.181 Dist. restrs. and SS energy: 7.665 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -388.623795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.623795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.138509 (E_RNA) where: Base-Base interactions energy: -278.004 where: short stacking energy: -109.631 Base-Backbone interact. energy: 0.743 local terms energy: -111.876794 where: bonds (distance) C4'-P energy: -20.686 bonds (distance) P-C4' energy: -22.548 flat angles C4'-P-C4' energy: -25.618 flat angles P-C4'-P energy: -16.779 tors. eta vs tors. theta energy: -26.245 Dist. restrs. and SS energy: 0.515 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -353.024234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.024234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.435251 (E_RNA) where: Base-Base interactions energy: -242.191 where: short stacking energy: -101.535 Base-Backbone interact. energy: -0.874 local terms energy: -120.370511 where: bonds (distance) C4'-P energy: -22.997 bonds (distance) P-C4' energy: -26.646 flat angles C4'-P-C4' energy: -30.968 flat angles P-C4'-P energy: -14.161 tors. eta vs tors. theta energy: -25.599 Dist. restrs. and SS energy: 10.411 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -517.306604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.306604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.603492 (E_RNA) where: Base-Base interactions energy: -370.633 where: short stacking energy: -148.924 Base-Backbone interact. energy: 0.074 local terms energy: -147.044075 where: bonds (distance) C4'-P energy: -24.662 bonds (distance) P-C4' energy: -25.572 flat angles C4'-P-C4' energy: -36.584 flat angles P-C4'-P energy: -25.561 tors. eta vs tors. theta energy: -34.665 Dist. restrs. and SS energy: 0.297 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -539.561778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.561778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.967049 (E_RNA) where: Base-Base interactions energy: -386.935 where: short stacking energy: -161.745 Base-Backbone interact. energy: -1.039 local terms energy: -151.993473 where: bonds (distance) C4'-P energy: -29.327 bonds (distance) P-C4' energy: -29.312 flat angles C4'-P-C4' energy: -32.570 flat angles P-C4'-P energy: -19.368 tors. eta vs tors. theta energy: -41.416 Dist. restrs. and SS energy: 0.405 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -507.885948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.885948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.504246 (E_RNA) where: Base-Base interactions energy: -371.479 where: short stacking energy: -147.242 Base-Backbone interact. energy: -0.770 local terms energy: -136.256132 where: bonds (distance) C4'-P energy: -24.540 bonds (distance) P-C4' energy: -26.014 flat angles C4'-P-C4' energy: -30.178 flat angles P-C4'-P energy: -21.184 tors. eta vs tors. theta energy: -34.340 Dist. restrs. and SS energy: 0.618 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -447.917146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.917146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.243617 (E_RNA) where: Base-Base interactions energy: -321.174 where: short stacking energy: -124.335 Base-Backbone interact. energy: 1.304 local terms energy: -130.374124 where: bonds (distance) C4'-P energy: -24.211 bonds (distance) P-C4' energy: -29.287 flat angles C4'-P-C4' energy: -26.794 flat angles P-C4'-P energy: -23.203 tors. eta vs tors. theta energy: -26.879 Dist. restrs. and SS energy: 2.326 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -484.576089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.576089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.002282 (E_RNA) where: Base-Base interactions energy: -349.919 where: short stacking energy: -144.063 Base-Backbone interact. energy: -0.161 local terms energy: -135.922317 where: bonds (distance) C4'-P energy: -24.551 bonds (distance) P-C4' energy: -28.296 flat angles C4'-P-C4' energy: -28.562 flat angles P-C4'-P energy: -21.358 tors. eta vs tors. theta energy: -33.155 Dist. restrs. and SS energy: 1.426 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -478.217789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.217789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.425921 (E_RNA) where: Base-Base interactions energy: -341.812 where: short stacking energy: -144.615 Base-Backbone interact. energy: 0.060 local terms energy: -140.674146 where: bonds (distance) C4'-P energy: -28.145 bonds (distance) P-C4' energy: -26.378 flat angles C4'-P-C4' energy: -27.136 flat angles P-C4'-P energy: -21.645 tors. eta vs tors. theta energy: -37.370 Dist. restrs. and SS energy: 4.208 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -447.830311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.830311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.728145 (E_RNA) where: Base-Base interactions energy: -313.902 where: short stacking energy: -132.177 Base-Backbone interact. energy: -1.158 local terms energy: -133.668082 where: bonds (distance) C4'-P energy: -26.437 bonds (distance) P-C4' energy: -27.597 flat angles C4'-P-C4' energy: -26.080 flat angles P-C4'-P energy: -14.533 tors. eta vs tors. theta energy: -39.022 Dist. restrs. and SS energy: 0.898 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -454.882690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.882690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.702038 (E_RNA) where: Base-Base interactions energy: -325.783 where: short stacking energy: -129.157 Base-Backbone interact. energy: -1.363 local terms energy: -131.556385 where: bonds (distance) C4'-P energy: -25.198 bonds (distance) P-C4' energy: -21.474 flat angles C4'-P-C4' energy: -30.054 flat angles P-C4'-P energy: -21.521 tors. eta vs tors. theta energy: -33.310 Dist. restrs. and SS energy: 3.819 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -402.644187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.644187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.041127 (E_RNA) where: Base-Base interactions energy: -289.046 where: short stacking energy: -106.469 Base-Backbone interact. energy: -0.542 local terms energy: -113.453672 where: bonds (distance) C4'-P energy: -26.320 bonds (distance) P-C4' energy: -21.402 flat angles C4'-P-C4' energy: -23.840 flat angles P-C4'-P energy: -15.102 tors. eta vs tors. theta energy: -26.789 Dist. restrs. and SS energy: 0.397 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -360.378958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.378958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.510411 (E_RNA) where: Base-Base interactions energy: -253.183 where: short stacking energy: -93.331 Base-Backbone interact. energy: -1.138 local terms energy: -111.189843 where: bonds (distance) C4'-P energy: -28.417 bonds (distance) P-C4' energy: -24.766 flat angles C4'-P-C4' energy: -22.095 flat angles P-C4'-P energy: -22.622 tors. eta vs tors. theta energy: -13.289 Dist. restrs. and SS energy: 5.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -544.570059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.570059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.828898 (E_RNA) where: Base-Base interactions energy: -387.935 where: short stacking energy: -158.538 Base-Backbone interact. energy: -0.143 local terms energy: -156.751222 where: bonds (distance) C4'-P energy: -29.032 bonds (distance) P-C4' energy: -29.942 flat angles C4'-P-C4' energy: -35.061 flat angles P-C4'-P energy: -25.224 tors. eta vs tors. theta energy: -37.492 Dist. restrs. and SS energy: 0.259 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -510.005194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.005194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.343059 (E_RNA) where: Base-Base interactions energy: -360.975 where: short stacking energy: -147.571 Base-Backbone interact. energy: -0.996 local terms energy: -148.371897 where: bonds (distance) C4'-P energy: -27.877 bonds (distance) P-C4' energy: -31.458 flat angles C4'-P-C4' energy: -29.480 flat angles P-C4'-P energy: -24.133 tors. eta vs tors. theta energy: -35.426 Dist. restrs. and SS energy: 0.338 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -513.978611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.978611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.229734 (E_RNA) where: Base-Base interactions energy: -366.429 where: short stacking energy: -141.208 Base-Backbone interact. energy: -1.259 local terms energy: -146.541636 where: bonds (distance) C4'-P energy: -24.585 bonds (distance) P-C4' energy: -31.949 flat angles C4'-P-C4' energy: -33.009 flat angles P-C4'-P energy: -22.190 tors. eta vs tors. theta energy: -34.808 Dist. restrs. and SS energy: 0.251 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -461.727321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.727321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.723495 (E_RNA) where: Base-Base interactions energy: -327.551 where: short stacking energy: -122.282 Base-Backbone interact. energy: 1.265 local terms energy: -136.437254 where: bonds (distance) C4'-P energy: -28.196 bonds (distance) P-C4' energy: -31.275 flat angles C4'-P-C4' energy: -26.639 flat angles P-C4'-P energy: -16.675 tors. eta vs tors. theta energy: -33.652 Dist. restrs. and SS energy: 0.996 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -500.061267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.061267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.634510 (E_RNA) where: Base-Base interactions energy: -350.384 where: short stacking energy: -145.430 Base-Backbone interact. energy: -0.683 local terms energy: -149.567103 where: bonds (distance) C4'-P energy: -29.507 bonds (distance) P-C4' energy: -30.783 flat angles C4'-P-C4' energy: -30.786 flat angles P-C4'-P energy: -21.260 tors. eta vs tors. theta energy: -37.232 Dist. restrs. and SS energy: 0.573 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -485.259778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.259778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.525716 (E_RNA) where: Base-Base interactions energy: -355.681 where: short stacking energy: -140.347 Base-Backbone interact. energy: -0.247 local terms energy: -129.598126 where: bonds (distance) C4'-P energy: -24.172 bonds (distance) P-C4' energy: -20.716 flat angles C4'-P-C4' energy: -30.063 flat angles P-C4'-P energy: -22.155 tors. eta vs tors. theta energy: -32.493 Dist. restrs. and SS energy: 0.266 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -438.392816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.392816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.056971 (E_RNA) where: Base-Base interactions energy: -302.561 where: short stacking energy: -124.866 Base-Backbone interact. energy: 0.305 local terms energy: -139.801081 where: bonds (distance) C4'-P energy: -26.936 bonds (distance) P-C4' energy: -25.939 flat angles C4'-P-C4' energy: -29.973 flat angles P-C4'-P energy: -19.375 tors. eta vs tors. theta energy: -37.579 Dist. restrs. and SS energy: 3.664 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -434.785284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.785284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.292751 (E_RNA) where: Base-Base interactions energy: -323.166 where: short stacking energy: -120.297 Base-Backbone interact. energy: -0.375 local terms energy: -111.751689 where: bonds (distance) C4'-P energy: -20.789 bonds (distance) P-C4' energy: -20.820 flat angles C4'-P-C4' energy: -22.879 flat angles P-C4'-P energy: -14.438 tors. eta vs tors. theta energy: -32.825 Dist. restrs. and SS energy: 0.507 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -447.394413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.394413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.541050 (E_RNA) where: Base-Base interactions energy: -313.947 where: short stacking energy: -127.269 Base-Backbone interact. energy: -0.323 local terms energy: -133.271844 where: bonds (distance) C4'-P energy: -23.636 bonds (distance) P-C4' energy: -28.024 flat angles C4'-P-C4' energy: -31.850 flat angles P-C4'-P energy: -19.725 tors. eta vs tors. theta energy: -30.037 Dist. restrs. and SS energy: 0.147 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -403.801856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.801856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.287825 (E_RNA) where: Base-Base interactions energy: -293.659 where: short stacking energy: -121.262 Base-Backbone interact. energy: -0.372 local terms energy: -113.256515 where: bonds (distance) C4'-P energy: -8.810 bonds (distance) P-C4' energy: -30.688 flat angles C4'-P-C4' energy: -28.287 flat angles P-C4'-P energy: -11.301 tors. eta vs tors. theta energy: -34.171 Dist. restrs. and SS energy: 3.486 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -547.109159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.109159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.457128 (E_RNA) where: Base-Base interactions energy: -388.549 where: short stacking energy: -158.476 Base-Backbone interact. energy: -0.212 local terms energy: -158.696221 where: bonds (distance) C4'-P energy: -28.638 bonds (distance) P-C4' energy: -29.230 flat angles C4'-P-C4' energy: -32.427 flat angles P-C4'-P energy: -26.142 tors. eta vs tors. theta energy: -42.259 Dist. restrs. and SS energy: 0.348 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -516.554335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.554335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.088051 (E_RNA) where: Base-Base interactions energy: -361.206 where: short stacking energy: -145.155 Base-Backbone interact. energy: -1.317 local terms energy: -154.565723 where: bonds (distance) C4'-P energy: -32.410 bonds (distance) P-C4' energy: -33.341 flat angles C4'-P-C4' energy: -35.262 flat angles P-C4'-P energy: -19.779 tors. eta vs tors. theta energy: -33.774 Dist. restrs. and SS energy: 0.534 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -495.484639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.484639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.838971 (E_RNA) where: Base-Base interactions energy: -354.533 where: short stacking energy: -150.276 Base-Backbone interact. energy: -1.005 local terms energy: -140.300927 where: bonds (distance) C4'-P energy: -25.213 bonds (distance) P-C4' energy: -28.105 flat angles C4'-P-C4' energy: -31.393 flat angles P-C4'-P energy: -17.029 tors. eta vs tors. theta energy: -38.560 Dist. restrs. and SS energy: 0.354 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -510.400848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.400848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.611609 (E_RNA) where: Base-Base interactions energy: -362.071 where: short stacking energy: -150.193 Base-Backbone interact. energy: -0.396 local terms energy: -148.144009 where: bonds (distance) C4'-P energy: -25.678 bonds (distance) P-C4' energy: -29.673 flat angles C4'-P-C4' energy: -31.511 flat angles P-C4'-P energy: -21.472 tors. eta vs tors. theta energy: -39.811 Dist. restrs. and SS energy: 0.211 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -492.451683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.451683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.930343 (E_RNA) where: Base-Base interactions energy: -343.325 where: short stacking energy: -145.303 Base-Backbone interact. energy: 0.406 local terms energy: -150.011714 where: bonds (distance) C4'-P energy: -25.871 bonds (distance) P-C4' energy: -28.173 flat angles C4'-P-C4' energy: -36.721 flat angles P-C4'-P energy: -21.006 tors. eta vs tors. theta energy: -38.240 Dist. restrs. and SS energy: 0.479 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -510.165880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.165880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.311139 (E_RNA) where: Base-Base interactions energy: -361.286 where: short stacking energy: -134.064 Base-Backbone interact. energy: -0.553 local terms energy: -148.471444 where: bonds (distance) C4'-P energy: -31.032 bonds (distance) P-C4' energy: -26.092 flat angles C4'-P-C4' energy: -31.370 flat angles P-C4'-P energy: -18.553 tors. eta vs tors. theta energy: -41.425 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -429.978284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.978284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.260458 (E_RNA) where: Base-Base interactions energy: -310.394 where: short stacking energy: -124.221 Base-Backbone interact. energy: -0.620 local terms energy: -120.246041 where: bonds (distance) C4'-P energy: -27.751 bonds (distance) P-C4' energy: -26.423 flat angles C4'-P-C4' energy: -25.749 flat angles P-C4'-P energy: -14.472 tors. eta vs tors. theta energy: -25.852 Dist. restrs. and SS energy: 1.282 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -459.856972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.856972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.833764 (E_RNA) where: Base-Base interactions energy: -319.568 where: short stacking energy: -137.385 Base-Backbone interact. energy: -0.085 local terms energy: -141.180999 where: bonds (distance) C4'-P energy: -28.236 bonds (distance) P-C4' energy: -27.533 flat angles C4'-P-C4' energy: -32.402 flat angles P-C4'-P energy: -13.557 tors. eta vs tors. theta energy: -39.452 Dist. restrs. and SS energy: 0.977 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -426.336815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.336815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.074116 (E_RNA) where: Base-Base interactions energy: -319.734 where: short stacking energy: -135.505 Base-Backbone interact. energy: 2.546 local terms energy: -109.886784 where: bonds (distance) C4'-P energy: -21.319 bonds (distance) P-C4' energy: -19.406 flat angles C4'-P-C4' energy: -27.513 flat angles P-C4'-P energy: -7.547 tors. eta vs tors. theta energy: -34.103 Dist. restrs. and SS energy: 0.737 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -386.259367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.259367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.477831 (E_RNA) where: Base-Base interactions energy: -283.484 where: short stacking energy: -108.916 Base-Backbone interact. energy: 2.298 local terms energy: -115.291942 where: bonds (distance) C4'-P energy: -19.241 bonds (distance) P-C4' energy: -29.008 flat angles C4'-P-C4' energy: -21.208 flat angles P-C4'-P energy: -17.316 tors. eta vs tors. theta energy: -28.518 Dist. restrs. and SS energy: 10.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -557.381446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.381446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.481738 (E_RNA) where: Base-Base interactions energy: -387.347 where: short stacking energy: -154.403 Base-Backbone interact. energy: -0.432 local terms energy: -169.703276 where: bonds (distance) C4'-P energy: -31.206 bonds (distance) P-C4' energy: -33.406 flat angles C4'-P-C4' energy: -35.716 flat angles P-C4'-P energy: -23.237 tors. eta vs tors. theta energy: -46.138 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -515.786502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.786502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.050341 (E_RNA) where: Base-Base interactions energy: -375.390 where: short stacking energy: -146.186 Base-Backbone interact. energy: 0.323 local terms energy: -140.983848 where: bonds (distance) C4'-P energy: -25.116 bonds (distance) P-C4' energy: -25.375 flat angles C4'-P-C4' energy: -31.426 flat angles P-C4'-P energy: -23.197 tors. eta vs tors. theta energy: -35.870 Dist. restrs. and SS energy: 0.264 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -513.091744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.091744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.323429 (E_RNA) where: Base-Base interactions energy: -362.704 where: short stacking energy: -153.022 Base-Backbone interact. energy: -0.341 local terms energy: -150.278606 where: bonds (distance) C4'-P energy: -24.586 bonds (distance) P-C4' energy: -28.728 flat angles C4'-P-C4' energy: -33.246 flat angles P-C4'-P energy: -23.780 tors. eta vs tors. theta energy: -39.937 Dist. restrs. and SS energy: 0.232 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -511.185200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.185200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.721937 (E_RNA) where: Base-Base interactions energy: -366.720 where: short stacking energy: -161.989 Base-Backbone interact. energy: -0.596 local terms energy: -144.406000 where: bonds (distance) C4'-P energy: -26.992 bonds (distance) P-C4' energy: -21.584 flat angles C4'-P-C4' energy: -33.251 flat angles P-C4'-P energy: -22.782 tors. eta vs tors. theta energy: -39.796 Dist. restrs. and SS energy: 0.537 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -519.427206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.427206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.847727 (E_RNA) where: Base-Base interactions energy: -375.886 where: short stacking energy: -146.020 Base-Backbone interact. energy: -0.252 local terms energy: -143.709713 where: bonds (distance) C4'-P energy: -23.991 bonds (distance) P-C4' energy: -25.853 flat angles C4'-P-C4' energy: -30.859 flat angles P-C4'-P energy: -23.224 tors. eta vs tors. theta energy: -39.783 Dist. restrs. and SS energy: 0.421 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -483.304718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.304718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.738979 (E_RNA) where: Base-Base interactions energy: -348.362 where: short stacking energy: -157.385 Base-Backbone interact. energy: 1.755 local terms energy: -137.131867 where: bonds (distance) C4'-P energy: -27.356 bonds (distance) P-C4' energy: -24.975 flat angles C4'-P-C4' energy: -29.684 flat angles P-C4'-P energy: -13.448 tors. eta vs tors. theta energy: -41.668 Dist. restrs. and SS energy: 0.434 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -449.138198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.138198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.583114 (E_RNA) where: Base-Base interactions energy: -305.070 where: short stacking energy: -123.832 Base-Backbone interact. energy: -0.118 local terms energy: -144.395526 where: bonds (distance) C4'-P energy: -28.311 bonds (distance) P-C4' energy: -24.915 flat angles C4'-P-C4' energy: -28.569 flat angles P-C4'-P energy: -23.782 tors. eta vs tors. theta energy: -38.819 Dist. restrs. and SS energy: 0.445 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -409.511784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.511784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.020076 (E_RNA) where: Base-Base interactions energy: -299.091 where: short stacking energy: -128.008 Base-Backbone interact. energy: -1.672 local terms energy: -112.256762 where: bonds (distance) C4'-P energy: -15.717 bonds (distance) P-C4' energy: -21.417 flat angles C4'-P-C4' energy: -25.395 flat angles P-C4'-P energy: -17.173 tors. eta vs tors. theta energy: -32.554 Dist. restrs. and SS energy: 3.508 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -436.790599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.790599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.917086 (E_RNA) where: Base-Base interactions energy: -312.260 where: short stacking energy: -122.908 Base-Backbone interact. energy: -0.281 local terms energy: -125.376244 where: bonds (distance) C4'-P energy: -25.067 bonds (distance) P-C4' energy: -26.130 flat angles C4'-P-C4' energy: -27.883 flat angles P-C4'-P energy: -17.723 tors. eta vs tors. theta energy: -28.573 Dist. restrs. and SS energy: 1.126 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -402.329483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.329483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.244727 (E_RNA) where: Base-Base interactions energy: -277.928 where: short stacking energy: -117.118 Base-Backbone interact. energy: -0.571 local terms energy: -127.745656 where: bonds (distance) C4'-P energy: -24.760 bonds (distance) P-C4' energy: -21.205 flat angles C4'-P-C4' energy: -31.756 flat angles P-C4'-P energy: -19.318 tors. eta vs tors. theta energy: -30.707 Dist. restrs. and SS energy: 3.915 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -547.121699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.121699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.460900 (E_RNA) where: Base-Base interactions energy: -398.230 where: short stacking energy: -168.949 Base-Backbone interact. energy: -0.185 local terms energy: -149.045881 where: bonds (distance) C4'-P energy: -25.729 bonds (distance) P-C4' energy: -27.439 flat angles C4'-P-C4' energy: -32.178 flat angles P-C4'-P energy: -22.960 tors. eta vs tors. theta energy: -40.740 Dist. restrs. and SS energy: 0.339 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -541.421634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.421634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.775558 (E_RNA) where: Base-Base interactions energy: -386.676 where: short stacking energy: -155.928 Base-Backbone interact. energy: -0.484 local terms energy: -154.615875 where: bonds (distance) C4'-P energy: -28.643 bonds (distance) P-C4' energy: -31.232 flat angles C4'-P-C4' energy: -29.618 flat angles P-C4'-P energy: -24.631 tors. eta vs tors. theta energy: -40.492 Dist. restrs. and SS energy: 0.354 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -505.026736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.026736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.842527 (E_RNA) where: Base-Base interactions energy: -360.243 where: short stacking energy: -141.206 Base-Backbone interact. energy: -1.576 local terms energy: -144.023723 where: bonds (distance) C4'-P energy: -25.803 bonds (distance) P-C4' energy: -26.065 flat angles C4'-P-C4' energy: -36.279 flat angles P-C4'-P energy: -19.640 tors. eta vs tors. theta energy: -36.237 Dist. restrs. and SS energy: 0.816 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -510.325323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.325323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.628494 (E_RNA) where: Base-Base interactions energy: -358.827 where: short stacking energy: -149.095 Base-Backbone interact. energy: -0.179 local terms energy: -151.623063 where: bonds (distance) C4'-P energy: -25.428 bonds (distance) P-C4' energy: -28.825 flat angles C4'-P-C4' energy: -31.596 flat angles P-C4'-P energy: -25.805 tors. eta vs tors. theta energy: -39.968 Dist. restrs. and SS energy: 0.303 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -488.496056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.496056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.817503 (E_RNA) where: Base-Base interactions energy: -341.676 where: short stacking energy: -149.145 Base-Backbone interact. energy: -0.253 local terms energy: -149.887979 where: bonds (distance) C4'-P energy: -33.692 bonds (distance) P-C4' energy: -26.535 flat angles C4'-P-C4' energy: -28.264 flat angles P-C4'-P energy: -24.579 tors. eta vs tors. theta energy: -36.818 Dist. restrs. and SS energy: 3.321 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -481.339328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.339328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.721437 (E_RNA) where: Base-Base interactions energy: -361.037 where: short stacking energy: -147.110 Base-Backbone interact. energy: -0.312 local terms energy: -120.372364 where: bonds (distance) C4'-P energy: -20.653 bonds (distance) P-C4' energy: -26.095 flat angles C4'-P-C4' energy: -25.093 flat angles P-C4'-P energy: -13.071 tors. eta vs tors. theta energy: -35.460 Dist. restrs. and SS energy: 0.382 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -479.797146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.797146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.158841 (E_RNA) where: Base-Base interactions energy: -342.726 where: short stacking energy: -147.716 Base-Backbone interact. energy: 0.324 local terms energy: -137.757066 where: bonds (distance) C4'-P energy: -22.151 bonds (distance) P-C4' energy: -21.595 flat angles C4'-P-C4' energy: -26.291 flat angles P-C4'-P energy: -25.019 tors. eta vs tors. theta energy: -42.700 Dist. restrs. and SS energy: 0.362 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -474.502654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.502654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.811138 (E_RNA) where: Base-Base interactions energy: -350.865 where: short stacking energy: -140.649 Base-Backbone interact. energy: -0.875 local terms energy: -124.071472 where: bonds (distance) C4'-P energy: -22.037 bonds (distance) P-C4' energy: -21.119 flat angles C4'-P-C4' energy: -30.192 flat angles P-C4'-P energy: -14.988 tors. eta vs tors. theta energy: -35.736 Dist. restrs. and SS energy: 1.308 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -415.162543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.162543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.114275 (E_RNA) where: Base-Base interactions energy: -277.264 where: short stacking energy: -125.074 Base-Backbone interact. energy: -0.140 local terms energy: -140.710245 where: bonds (distance) C4'-P energy: -28.593 bonds (distance) P-C4' energy: -30.864 flat angles C4'-P-C4' energy: -23.759 flat angles P-C4'-P energy: -24.127 tors. eta vs tors. theta energy: -33.368 Dist. restrs. and SS energy: 2.952 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -392.257861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.257861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.344776 (E_RNA) where: Base-Base interactions energy: -275.856 where: short stacking energy: -122.754 Base-Backbone interact. energy: -0.396 local terms energy: -120.092990 where: bonds (distance) C4'-P energy: -21.844 bonds (distance) P-C4' energy: -23.351 flat angles C4'-P-C4' energy: -25.451 flat angles P-C4'-P energy: -17.538 tors. eta vs tors. theta energy: -31.910 Dist. restrs. and SS energy: 4.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -545.334611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.334611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.471188 (E_RNA) where: Base-Base interactions energy: -386.820 where: short stacking energy: -153.147 Base-Backbone interact. energy: -0.428 local terms energy: -158.222487 where: bonds (distance) C4'-P energy: -30.414 bonds (distance) P-C4' energy: -31.082 flat angles C4'-P-C4' energy: -33.089 flat angles P-C4'-P energy: -24.910 tors. eta vs tors. theta energy: -38.728 Dist. restrs. and SS energy: 0.137 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -535.033195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.033195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.184462 (E_RNA) where: Base-Base interactions energy: -372.178 where: short stacking energy: -152.010 Base-Backbone interact. energy: -0.708 local terms energy: -162.298646 where: bonds (distance) C4'-P energy: -28.800 bonds (distance) P-C4' energy: -32.879 flat angles C4'-P-C4' energy: -33.895 flat angles P-C4'-P energy: -28.980 tors. eta vs tors. theta energy: -37.743 Dist. restrs. and SS energy: 0.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -525.334613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.334613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.440423 (E_RNA) where: Base-Base interactions energy: -374.897 where: short stacking energy: -154.060 Base-Backbone interact. energy: -0.242 local terms energy: -150.301443 where: bonds (distance) C4'-P energy: -26.357 bonds (distance) P-C4' energy: -28.130 flat angles C4'-P-C4' energy: -32.732 flat angles P-C4'-P energy: -26.554 tors. eta vs tors. theta energy: -36.528 Dist. restrs. and SS energy: 0.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -506.804516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.804516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.368586 (E_RNA) where: Base-Base interactions energy: -359.552 where: short stacking energy: -143.587 Base-Backbone interact. energy: -0.905 local terms energy: -146.911668 where: bonds (distance) C4'-P energy: -28.674 bonds (distance) P-C4' energy: -28.164 flat angles C4'-P-C4' energy: -34.639 flat angles P-C4'-P energy: -22.174 tors. eta vs tors. theta energy: -33.262 Dist. restrs. and SS energy: 0.564 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -484.152429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.152429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.562052 (E_RNA) where: Base-Base interactions energy: -355.116 where: short stacking energy: -144.078 Base-Backbone interact. energy: -0.963 local terms energy: -128.482432 where: bonds (distance) C4'-P energy: -25.626 bonds (distance) P-C4' energy: -19.218 flat angles C4'-P-C4' energy: -28.773 flat angles P-C4'-P energy: -22.957 tors. eta vs tors. theta energy: -31.910 Dist. restrs. and SS energy: 0.410 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -494.714793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.714793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.888938 (E_RNA) where: Base-Base interactions energy: -360.144 where: short stacking energy: -154.796 Base-Backbone interact. energy: -0.203 local terms energy: -134.541819 where: bonds (distance) C4'-P energy: -24.990 bonds (distance) P-C4' energy: -19.307 flat angles C4'-P-C4' energy: -31.103 flat angles P-C4'-P energy: -21.523 tors. eta vs tors. theta energy: -37.618 Dist. restrs. and SS energy: 0.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -492.385466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.385466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.548692 (E_RNA) where: Base-Base interactions energy: -350.099 where: short stacking energy: -142.164 Base-Backbone interact. energy: -0.526 local terms energy: -141.923030 where: bonds (distance) C4'-P energy: -25.205 bonds (distance) P-C4' energy: -32.290 flat angles C4'-P-C4' energy: -27.834 flat angles P-C4'-P energy: -17.732 tors. eta vs tors. theta energy: -38.862 Dist. restrs. and SS energy: 0.163 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -479.472985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.472985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.569885 (E_RNA) where: Base-Base interactions energy: -337.199 where: short stacking energy: -134.143 Base-Backbone interact. energy: -0.126 local terms energy: -142.245409 where: bonds (distance) C4'-P energy: -25.258 bonds (distance) P-C4' energy: -26.106 flat angles C4'-P-C4' energy: -32.764 flat angles P-C4'-P energy: -22.136 tors. eta vs tors. theta energy: -35.981 Dist. restrs. and SS energy: 0.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -436.565573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.565573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.499772 (E_RNA) where: Base-Base interactions energy: -318.971 where: short stacking energy: -130.026 Base-Backbone interact. energy: -0.265 local terms energy: -119.263823 where: bonds (distance) C4'-P energy: -24.107 bonds (distance) P-C4' energy: -22.856 flat angles C4'-P-C4' energy: -24.796 flat angles P-C4'-P energy: -15.773 tors. eta vs tors. theta energy: -31.732 Dist. restrs. and SS energy: 1.934 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -390.076960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.076960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.077711 (E_RNA) where: Base-Base interactions energy: -283.894 where: short stacking energy: -120.087 Base-Backbone interact. energy: -1.515 local terms energy: -111.669177 where: bonds (distance) C4'-P energy: -21.733 bonds (distance) P-C4' energy: -27.259 flat angles C4'-P-C4' energy: -23.918 flat angles P-C4'-P energy: -11.438 tors. eta vs tors. theta energy: -27.320 Dist. restrs. and SS energy: 7.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -542.661952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.661952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.061570 (E_RNA) where: Base-Base interactions energy: -398.564 where: short stacking energy: -158.307 Base-Backbone interact. energy: -0.854 local terms energy: -143.642665 where: bonds (distance) C4'-P energy: -25.704 bonds (distance) P-C4' energy: -27.928 flat angles C4'-P-C4' energy: -30.015 flat angles P-C4'-P energy: -21.889 tors. eta vs tors. theta energy: -38.106 Dist. restrs. and SS energy: 0.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -531.380676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.380676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.858895 (E_RNA) where: Base-Base interactions energy: -375.771 where: short stacking energy: -156.623 Base-Backbone interact. energy: -1.434 local terms energy: -154.653087 where: bonds (distance) C4'-P energy: -28.709 bonds (distance) P-C4' energy: -31.074 flat angles C4'-P-C4' energy: -33.637 flat angles P-C4'-P energy: -21.237 tors. eta vs tors. theta energy: -39.996 Dist. restrs. and SS energy: 0.478 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -542.827506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.827506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.996723 (E_RNA) where: Base-Base interactions energy: -398.707 where: short stacking energy: -157.530 Base-Backbone interact. energy: -0.416 local terms energy: -143.873316 where: bonds (distance) C4'-P energy: -26.710 bonds (distance) P-C4' energy: -20.439 flat angles C4'-P-C4' energy: -32.595 flat angles P-C4'-P energy: -23.738 tors. eta vs tors. theta energy: -40.391 Dist. restrs. and SS energy: 0.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -515.891848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.891848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.109839 (E_RNA) where: Base-Base interactions energy: -365.717 where: short stacking energy: -141.818 Base-Backbone interact. energy: -1.838 local terms energy: -148.555676 where: bonds (distance) C4'-P energy: -26.507 bonds (distance) P-C4' energy: -27.583 flat angles C4'-P-C4' energy: -32.921 flat angles P-C4'-P energy: -23.766 tors. eta vs tors. theta energy: -37.778 Dist. restrs. and SS energy: 0.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -484.319416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.319416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.537859 (E_RNA) where: Base-Base interactions energy: -348.401 where: short stacking energy: -153.788 Base-Backbone interact. energy: -0.632 local terms energy: -135.504509 where: bonds (distance) C4'-P energy: -25.821 bonds (distance) P-C4' energy: -21.835 flat angles C4'-P-C4' energy: -27.234 flat angles P-C4'-P energy: -23.911 tors. eta vs tors. theta energy: -36.704 Dist. restrs. and SS energy: 0.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -505.762090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.762090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.925275 (E_RNA) where: Base-Base interactions energy: -365.280 where: short stacking energy: -142.528 Base-Backbone interact. energy: -1.284 local terms energy: -139.361312 where: bonds (distance) C4'-P energy: -27.122 bonds (distance) P-C4' energy: -23.541 flat angles C4'-P-C4' energy: -33.255 flat angles P-C4'-P energy: -20.715 tors. eta vs tors. theta energy: -34.729 Dist. restrs. and SS energy: 0.163 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -488.726367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.726367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.812627 (E_RNA) where: Base-Base interactions energy: -343.510 where: short stacking energy: -152.032 Base-Backbone interact. energy: -0.003 local terms energy: -145.300027 where: bonds (distance) C4'-P energy: -29.201 bonds (distance) P-C4' energy: -30.596 flat angles C4'-P-C4' energy: -27.941 flat angles P-C4'-P energy: -17.705 tors. eta vs tors. theta energy: -39.856 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -465.866163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.866163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.242914 (E_RNA) where: Base-Base interactions energy: -330.900 where: short stacking energy: -136.991 Base-Backbone interact. energy: -0.302 local terms energy: -135.040593 where: bonds (distance) C4'-P energy: -27.144 bonds (distance) P-C4' energy: -20.774 flat angles C4'-P-C4' energy: -27.879 flat angles P-C4'-P energy: -20.447 tors. eta vs tors. theta energy: -38.796 Dist. restrs. and SS energy: 0.377 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -465.889438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.889438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.179615 (E_RNA) where: Base-Base interactions energy: -336.035 where: short stacking energy: -143.909 Base-Backbone interact. energy: -0.324 local terms energy: -129.820452 where: bonds (distance) C4'-P energy: -26.940 bonds (distance) P-C4' energy: -23.737 flat angles C4'-P-C4' energy: -29.634 flat angles P-C4'-P energy: -12.747 tors. eta vs tors. theta energy: -36.762 Dist. restrs. and SS energy: 0.290 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -374.031572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.031572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.601697 (E_RNA) where: Base-Base interactions energy: -269.440 where: short stacking energy: -106.675 Base-Backbone interact. energy: -0.805 local terms energy: -109.356960 where: bonds (distance) C4'-P energy: -22.082 bonds (distance) P-C4' energy: -21.359 flat angles C4'-P-C4' energy: -26.214 flat angles P-C4'-P energy: -15.297 tors. eta vs tors. theta energy: -24.404 Dist. restrs. and SS energy: 5.570 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -551.008788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.008788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.327640 (E_RNA) where: Base-Base interactions energy: -395.259 where: short stacking energy: -155.699 Base-Backbone interact. energy: -0.278 local terms energy: -155.791064 where: bonds (distance) C4'-P energy: -26.471 bonds (distance) P-C4' energy: -32.687 flat angles C4'-P-C4' energy: -31.221 flat angles P-C4'-P energy: -23.478 tors. eta vs tors. theta energy: -41.934 Dist. restrs. and SS energy: 0.319 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -530.156545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.156545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.400128 (E_RNA) where: Base-Base interactions energy: -386.298 where: short stacking energy: -155.165 Base-Backbone interact. energy: -0.087 local terms energy: -144.015471 where: bonds (distance) C4'-P energy: -24.540 bonds (distance) P-C4' energy: -30.913 flat angles C4'-P-C4' energy: -27.311 flat angles P-C4'-P energy: -20.687 tors. eta vs tors. theta energy: -40.564 Dist. restrs. and SS energy: 0.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -552.039695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.039695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.070531 (E_RNA) where: Base-Base interactions energy: -402.000 where: short stacking energy: -169.804 Base-Backbone interact. energy: -0.166 local terms energy: -149.904858 where: bonds (distance) C4'-P energy: -28.349 bonds (distance) P-C4' energy: -24.270 flat angles C4'-P-C4' energy: -29.758 flat angles P-C4'-P energy: -25.519 tors. eta vs tors. theta energy: -42.008 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -506.861184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.861184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.102785 (E_RNA) where: Base-Base interactions energy: -371.195 where: short stacking energy: -146.500 Base-Backbone interact. energy: 0.842 local terms energy: -136.750049 where: bonds (distance) C4'-P energy: -24.057 bonds (distance) P-C4' energy: -30.975 flat angles C4'-P-C4' energy: -28.952 flat angles P-C4'-P energy: -20.158 tors. eta vs tors. theta energy: -32.608 Dist. restrs. and SS energy: 0.242 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -510.558202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.558202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.825575 (E_RNA) where: Base-Base interactions energy: -366.511 where: short stacking energy: -159.754 Base-Backbone interact. energy: -1.343 local terms energy: -142.971475 where: bonds (distance) C4'-P energy: -26.013 bonds (distance) P-C4' energy: -27.497 flat angles C4'-P-C4' energy: -24.852 flat angles P-C4'-P energy: -23.008 tors. eta vs tors. theta energy: -41.602 Dist. restrs. and SS energy: 0.267 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -480.196655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.196655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.517345 (E_RNA) where: Base-Base interactions energy: -335.138 where: short stacking energy: -145.061 Base-Backbone interact. energy: -0.986 local terms energy: -144.393796 where: bonds (distance) C4'-P energy: -22.102 bonds (distance) P-C4' energy: -27.655 flat angles C4'-P-C4' energy: -27.908 flat angles P-C4'-P energy: -23.600 tors. eta vs tors. theta energy: -43.128 Dist. restrs. and SS energy: 0.321 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -502.591323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.591323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.180068 (E_RNA) where: Base-Base interactions energy: -360.369 where: short stacking energy: -147.801 Base-Backbone interact. energy: -0.725 local terms energy: -142.086585 where: bonds (distance) C4'-P energy: -28.306 bonds (distance) P-C4' energy: -21.062 flat angles C4'-P-C4' energy: -33.654 flat angles P-C4'-P energy: -19.908 tors. eta vs tors. theta energy: -39.158 Dist. restrs. and SS energy: 0.589 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -459.231450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.231450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.840249 (E_RNA) where: Base-Base interactions energy: -329.758 where: short stacking energy: -137.311 Base-Backbone interact. energy: -0.681 local terms energy: -130.401427 where: bonds (distance) C4'-P energy: -24.789 bonds (distance) P-C4' energy: -21.989 flat angles C4'-P-C4' energy: -28.681 flat angles P-C4'-P energy: -18.696 tors. eta vs tors. theta energy: -36.246 Dist. restrs. and SS energy: 1.609 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -474.578398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.578398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.102476 (E_RNA) where: Base-Base interactions energy: -337.543 where: short stacking energy: -146.412 Base-Backbone interact. energy: -0.118 local terms energy: -137.440860 where: bonds (distance) C4'-P energy: -22.873 bonds (distance) P-C4' energy: -30.192 flat angles C4'-P-C4' energy: -25.482 flat angles P-C4'-P energy: -17.090 tors. eta vs tors. theta energy: -41.804 Dist. restrs. and SS energy: 0.524 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -391.052155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.052155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.943459 (E_RNA) where: Base-Base interactions energy: -272.315 where: short stacking energy: -117.148 Base-Backbone interact. energy: 1.737 local terms energy: -127.365496 where: bonds (distance) C4'-P energy: -25.990 bonds (distance) P-C4' energy: -28.671 flat angles C4'-P-C4' energy: -28.963 flat angles P-C4'-P energy: -17.693 tors. eta vs tors. theta energy: -26.048 Dist. restrs. and SS energy: 6.891 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -548.201059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.201059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.283629 (E_RNA) where: Base-Base interactions energy: -393.521 where: short stacking energy: -154.016 Base-Backbone interact. energy: -0.422 local terms energy: -154.341093 where: bonds (distance) C4'-P energy: -28.755 bonds (distance) P-C4' energy: -35.505 flat angles C4'-P-C4' energy: -30.146 flat angles P-C4'-P energy: -21.427 tors. eta vs tors. theta energy: -38.508 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -547.859449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.859449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.923715 (E_RNA) where: Base-Base interactions energy: -398.179 where: short stacking energy: -160.019 Base-Backbone interact. energy: -0.724 local terms energy: -149.020003 where: bonds (distance) C4'-P energy: -24.397 bonds (distance) P-C4' energy: -31.636 flat angles C4'-P-C4' energy: -31.747 flat angles P-C4'-P energy: -17.617 tors. eta vs tors. theta energy: -43.623 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -534.887419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.887419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.070175 (E_RNA) where: Base-Base interactions energy: -392.123 where: short stacking energy: -152.481 Base-Backbone interact. energy: -0.728 local terms energy: -142.219286 where: bonds (distance) C4'-P energy: -24.850 bonds (distance) P-C4' energy: -28.009 flat angles C4'-P-C4' energy: -27.864 flat angles P-C4'-P energy: -22.112 tors. eta vs tors. theta energy: -39.384 Dist. restrs. and SS energy: 0.183 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -522.509831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.509831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.608037 (E_RNA) where: Base-Base interactions energy: -382.462 where: short stacking energy: -161.008 Base-Backbone interact. energy: -0.875 local terms energy: -139.270641 where: bonds (distance) C4'-P energy: -24.735 bonds (distance) P-C4' energy: -21.490 flat angles C4'-P-C4' energy: -27.819 flat angles P-C4'-P energy: -21.416 tors. eta vs tors. theta energy: -43.811 Dist. restrs. and SS energy: 0.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -498.812774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.812774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.363920 (E_RNA) where: Base-Base interactions energy: -358.113 where: short stacking energy: -142.817 Base-Backbone interact. energy: -0.577 local terms energy: -140.673687 where: bonds (distance) C4'-P energy: -26.638 bonds (distance) P-C4' energy: -27.887 flat angles C4'-P-C4' energy: -29.213 flat angles P-C4'-P energy: -20.147 tors. eta vs tors. theta energy: -36.788 Dist. restrs. and SS energy: 0.551 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -508.994699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.994699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.037059 (E_RNA) where: Base-Base interactions energy: -379.627 where: short stacking energy: -154.833 Base-Backbone interact. energy: -0.718 local terms energy: -128.692736 where: bonds (distance) C4'-P energy: -24.378 bonds (distance) P-C4' energy: -21.061 flat angles C4'-P-C4' energy: -27.617 flat angles P-C4'-P energy: -20.172 tors. eta vs tors. theta energy: -35.465 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -478.581976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.581976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.757323 (E_RNA) where: Base-Base interactions energy: -359.869 where: short stacking energy: -151.739 Base-Backbone interact. energy: -0.156 local terms energy: -118.732968 where: bonds (distance) C4'-P energy: -12.591 bonds (distance) P-C4' energy: -20.868 flat angles C4'-P-C4' energy: -29.111 flat angles P-C4'-P energy: -13.640 tors. eta vs tors. theta energy: -42.523 Dist. restrs. and SS energy: 0.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -440.725637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.725637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.319839 (E_RNA) where: Base-Base interactions energy: -320.452 where: short stacking energy: -130.657 Base-Backbone interact. energy: -0.367 local terms energy: -121.500702 where: bonds (distance) C4'-P energy: -18.155 bonds (distance) P-C4' energy: -15.793 flat angles C4'-P-C4' energy: -28.738 flat angles P-C4'-P energy: -21.073 tors. eta vs tors. theta energy: -37.742 Dist. restrs. and SS energy: 1.594 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -473.457194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.457194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.746303 (E_RNA) where: Base-Base interactions energy: -346.651 where: short stacking energy: -139.348 Base-Backbone interact. energy: 0.200 local terms energy: -127.295470 where: bonds (distance) C4'-P energy: -29.227 bonds (distance) P-C4' energy: -20.928 flat angles C4'-P-C4' energy: -27.313 flat angles P-C4'-P energy: -17.186 tors. eta vs tors. theta energy: -32.640 Dist. restrs. and SS energy: 0.289 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -392.221225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.221225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.677285 (E_RNA) where: Base-Base interactions energy: -276.524 where: short stacking energy: -114.172 Base-Backbone interact. energy: -0.507 local terms energy: -120.645886 where: bonds (distance) C4'-P energy: -27.525 bonds (distance) P-C4' energy: -20.101 flat angles C4'-P-C4' energy: -30.446 flat angles P-C4'-P energy: -17.428 tors. eta vs tors. theta energy: -25.145 Dist. restrs. and SS energy: 5.456 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -551.145684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.145684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.298469 (E_RNA) where: Base-Base interactions energy: -394.145 where: short stacking energy: -160.971 Base-Backbone interact. energy: -0.260 local terms energy: -156.893409 where: bonds (distance) C4'-P energy: -22.481 bonds (distance) P-C4' energy: -30.210 flat angles C4'-P-C4' energy: -34.799 flat angles P-C4'-P energy: -24.788 tors. eta vs tors. theta energy: -44.616 Dist. restrs. and SS energy: 0.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -541.944668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.944668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.277581 (E_RNA) where: Base-Base interactions energy: -387.111 where: short stacking energy: -156.320 Base-Backbone interact. energy: -0.323 local terms energy: -154.843627 where: bonds (distance) C4'-P energy: -29.952 bonds (distance) P-C4' energy: -32.462 flat angles C4'-P-C4' energy: -29.615 flat angles P-C4'-P energy: -22.038 tors. eta vs tors. theta energy: -40.777 Dist. restrs. and SS energy: 0.333 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -522.016479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.016479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.148028 (E_RNA) where: Base-Base interactions energy: -364.091 where: short stacking energy: -154.769 Base-Backbone interact. energy: -0.423 local terms energy: -157.633573 where: bonds (distance) C4'-P energy: -30.447 bonds (distance) P-C4' energy: -28.274 flat angles C4'-P-C4' energy: -33.094 flat angles P-C4'-P energy: -21.498 tors. eta vs tors. theta energy: -44.321 Dist. restrs. and SS energy: 0.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -541.310062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.310062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.576483 (E_RNA) where: Base-Base interactions energy: -386.703 where: short stacking energy: -155.529 Base-Backbone interact. energy: -0.454 local terms energy: -154.419786 where: bonds (distance) C4'-P energy: -29.643 bonds (distance) P-C4' energy: -30.945 flat angles C4'-P-C4' energy: -33.128 flat angles P-C4'-P energy: -19.984 tors. eta vs tors. theta energy: -40.720 Dist. restrs. and SS energy: 0.266 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -532.261488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.261488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.323377 (E_RNA) where: Base-Base interactions energy: -377.583 where: short stacking energy: -149.926 Base-Backbone interact. energy: -0.116 local terms energy: -154.624380 where: bonds (distance) C4'-P energy: -25.604 bonds (distance) P-C4' energy: -32.836 flat angles C4'-P-C4' energy: -35.531 flat angles P-C4'-P energy: -20.966 tors. eta vs tors. theta energy: -39.687 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -467.799512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.799512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.242722 (E_RNA) where: Base-Base interactions energy: -341.604 where: short stacking energy: -143.385 Base-Backbone interact. energy: 2.714 local terms energy: -129.353285 where: bonds (distance) C4'-P energy: -20.085 bonds (distance) P-C4' energy: -26.026 flat angles C4'-P-C4' energy: -33.397 flat angles P-C4'-P energy: -17.325 tors. eta vs tors. theta energy: -32.521 Dist. restrs. and SS energy: 0.443 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -477.050343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.050343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.336831 (E_RNA) where: Base-Base interactions energy: -342.193 where: short stacking energy: -149.733 Base-Backbone interact. energy: -0.340 local terms energy: -134.803552 where: bonds (distance) C4'-P energy: -23.380 bonds (distance) P-C4' energy: -24.763 flat angles C4'-P-C4' energy: -34.986 flat angles P-C4'-P energy: -20.016 tors. eta vs tors. theta energy: -31.659 Dist. restrs. and SS energy: 0.286 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -458.332530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.332530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.881102 (E_RNA) where: Base-Base interactions energy: -325.730 where: short stacking energy: -133.321 Base-Backbone interact. energy: -0.056 local terms energy: -133.095057 where: bonds (distance) C4'-P energy: -21.682 bonds (distance) P-C4' energy: -29.374 flat angles C4'-P-C4' energy: -25.015 flat angles P-C4'-P energy: -18.316 tors. eta vs tors. theta energy: -38.708 Dist. restrs. and SS energy: 0.549 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -417.284075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.284075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.252261 (E_RNA) where: Base-Base interactions energy: -291.438 where: short stacking energy: -129.382 Base-Backbone interact. energy: -0.885 local terms energy: -127.929859 where: bonds (distance) C4'-P energy: -21.764 bonds (distance) P-C4' energy: -21.803 flat angles C4'-P-C4' energy: -27.559 flat angles P-C4'-P energy: -22.735 tors. eta vs tors. theta energy: -34.069 Dist. restrs. and SS energy: 2.968 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -440.849676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.849676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.153708 (E_RNA) where: Base-Base interactions energy: -322.525 where: short stacking energy: -134.239 Base-Backbone interact. energy: -0.049 local terms energy: -118.580322 where: bonds (distance) C4'-P energy: -21.098 bonds (distance) P-C4' energy: -15.615 flat angles C4'-P-C4' energy: -28.762 flat angles P-C4'-P energy: -18.653 tors. eta vs tors. theta energy: -34.453 Dist. restrs. and SS energy: 0.304 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -559.681617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.681617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.838721 (E_RNA) where: Base-Base interactions energy: -408.457 where: short stacking energy: -168.703 Base-Backbone interact. energy: -0.068 local terms energy: -151.313537 where: bonds (distance) C4'-P energy: -30.087 bonds (distance) P-C4' energy: -28.655 flat angles C4'-P-C4' energy: -32.420 flat angles P-C4'-P energy: -18.554 tors. eta vs tors. theta energy: -41.598 Dist. restrs. and SS energy: 0.157 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -540.334634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.334634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.561606 (E_RNA) where: Base-Base interactions energy: -382.685 where: short stacking energy: -161.015 Base-Backbone interact. energy: -0.094 local terms energy: -157.782241 where: bonds (distance) C4'-P energy: -29.693 bonds (distance) P-C4' energy: -30.438 flat angles C4'-P-C4' energy: -28.864 flat angles P-C4'-P energy: -24.947 tors. eta vs tors. theta energy: -43.841 Dist. restrs. and SS energy: 0.227 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -539.556126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.556126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.724788 (E_RNA) where: Base-Base interactions energy: -390.504 where: short stacking energy: -149.213 Base-Backbone interact. energy: -0.241 local terms energy: -148.979309 where: bonds (distance) C4'-P energy: -29.716 bonds (distance) P-C4' energy: -26.934 flat angles C4'-P-C4' energy: -33.677 flat angles P-C4'-P energy: -21.775 tors. eta vs tors. theta energy: -36.877 Dist. restrs. and SS energy: 0.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -533.509852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.509852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.719992 (E_RNA) where: Base-Base interactions energy: -390.334 where: short stacking energy: -161.324 Base-Backbone interact. energy: -0.380 local terms energy: -143.006468 where: bonds (distance) C4'-P energy: -19.146 bonds (distance) P-C4' energy: -31.950 flat angles C4'-P-C4' energy: -30.299 flat angles P-C4'-P energy: -21.977 tors. eta vs tors. theta energy: -39.635 Dist. restrs. and SS energy: 0.210 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -524.989662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.989662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.272173 (E_RNA) where: Base-Base interactions energy: -383.089 where: short stacking energy: -153.895 Base-Backbone interact. energy: -0.663 local terms energy: -141.520285 where: bonds (distance) C4'-P energy: -20.821 bonds (distance) P-C4' energy: -22.391 flat angles C4'-P-C4' energy: -30.814 flat angles P-C4'-P energy: -27.823 tors. eta vs tors. theta energy: -39.672 Dist. restrs. and SS energy: 0.283 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -480.534564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.534564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.228899 (E_RNA) where: Base-Base interactions energy: -354.124 where: short stacking energy: -144.064 Base-Backbone interact. energy: 0.428 local terms energy: -129.533410 where: bonds (distance) C4'-P energy: -27.910 bonds (distance) P-C4' energy: -25.038 flat angles C4'-P-C4' energy: -28.310 flat angles P-C4'-P energy: -17.265 tors. eta vs tors. theta energy: -31.011 Dist. restrs. and SS energy: 2.694 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -450.112210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.112210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.008675 (E_RNA) where: Base-Base interactions energy: -322.476 where: short stacking energy: -121.600 Base-Backbone interact. energy: -1.144 local terms energy: -128.389049 where: bonds (distance) C4'-P energy: -23.005 bonds (distance) P-C4' energy: -28.518 flat angles C4'-P-C4' energy: -27.862 flat angles P-C4'-P energy: -17.312 tors. eta vs tors. theta energy: -31.692 Dist. restrs. and SS energy: 1.896 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -447.462317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.462317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.435988 (E_RNA) where: Base-Base interactions energy: -314.629 where: short stacking energy: -128.572 Base-Backbone interact. energy: -0.020 local terms energy: -133.786131 where: bonds (distance) C4'-P energy: -21.671 bonds (distance) P-C4' energy: -32.390 flat angles C4'-P-C4' energy: -28.154 flat angles P-C4'-P energy: -19.021 tors. eta vs tors. theta energy: -32.550 Dist. restrs. and SS energy: 0.974 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -416.756134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.756134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.018351 (E_RNA) where: Base-Base interactions energy: -322.829 where: short stacking energy: -142.487 Base-Backbone interact. energy: 2.947 local terms energy: -99.136610 where: bonds (distance) C4'-P energy: -15.061 bonds (distance) P-C4' energy: -16.237 flat angles C4'-P-C4' energy: -16.933 flat angles P-C4'-P energy: -17.196 tors. eta vs tors. theta energy: -33.709 Dist. restrs. and SS energy: 2.262 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -420.597830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.597830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.878580 (E_RNA) where: Base-Base interactions energy: -313.210 where: short stacking energy: -121.722 Base-Backbone interact. energy: 2.229 local terms energy: -109.897781 where: bonds (distance) C4'-P energy: -13.686 bonds (distance) P-C4' energy: -24.451 flat angles C4'-P-C4' energy: -21.910 flat angles P-C4'-P energy: -21.052 tors. eta vs tors. theta energy: -28.799 Dist. restrs. and SS energy: 0.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -532.708982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.708982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.814031 (E_RNA) where: Base-Base interactions energy: -377.319 where: short stacking energy: -160.314 Base-Backbone interact. energy: -0.198 local terms energy: -155.297948 where: bonds (distance) C4'-P energy: -26.534 bonds (distance) P-C4' energy: -29.967 flat angles C4'-P-C4' energy: -31.058 flat angles P-C4'-P energy: -26.023 tors. eta vs tors. theta energy: -41.715 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -547.737814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.737814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.892468 (E_RNA) where: Base-Base interactions energy: -395.920 where: short stacking energy: -162.365 Base-Backbone interact. energy: -0.131 local terms energy: -151.841650 where: bonds (distance) C4'-P energy: -28.403 bonds (distance) P-C4' energy: -24.647 flat angles C4'-P-C4' energy: -35.577 flat angles P-C4'-P energy: -24.478 tors. eta vs tors. theta energy: -38.737 Dist. restrs. and SS energy: 0.155 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -542.275889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.275889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.454657 (E_RNA) where: Base-Base interactions energy: -394.688 where: short stacking energy: -157.599 Base-Backbone interact. energy: -0.411 local terms energy: -147.355888 where: bonds (distance) C4'-P energy: -29.131 bonds (distance) P-C4' energy: -24.415 flat angles C4'-P-C4' energy: -31.071 flat angles P-C4'-P energy: -25.605 tors. eta vs tors. theta energy: -37.135 Dist. restrs. and SS energy: 0.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -515.091295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.091295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.708927 (E_RNA) where: Base-Base interactions energy: -364.434 where: short stacking energy: -147.252 Base-Backbone interact. energy: -0.254 local terms energy: -151.021037 where: bonds (distance) C4'-P energy: -32.524 bonds (distance) P-C4' energy: -25.782 flat angles C4'-P-C4' energy: -31.816 flat angles P-C4'-P energy: -21.191 tors. eta vs tors. theta energy: -39.708 Dist. restrs. and SS energy: 0.618 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -520.507371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.507371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.606670 (E_RNA) where: Base-Base interactions energy: -369.931 where: short stacking energy: -153.776 Base-Backbone interact. energy: -0.174 local terms energy: -150.501762 where: bonds (distance) C4'-P energy: -26.403 bonds (distance) P-C4' energy: -31.675 flat angles C4'-P-C4' energy: -33.259 flat angles P-C4'-P energy: -20.201 tors. eta vs tors. theta energy: -38.964 Dist. restrs. and SS energy: 0.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -472.400147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.400147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.630838 (E_RNA) where: Base-Base interactions energy: -336.551 where: short stacking energy: -136.844 Base-Backbone interact. energy: -2.209 local terms energy: -133.870621 where: bonds (distance) C4'-P energy: -23.206 bonds (distance) P-C4' energy: -25.058 flat angles C4'-P-C4' energy: -32.919 flat angles P-C4'-P energy: -21.007 tors. eta vs tors. theta energy: -31.681 Dist. restrs. and SS energy: 0.231 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -491.451031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.451031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.795645 (E_RNA) where: Base-Base interactions energy: -356.033 where: short stacking energy: -141.912 Base-Backbone interact. energy: -0.475 local terms energy: -135.287541 where: bonds (distance) C4'-P energy: -27.338 bonds (distance) P-C4' energy: -28.858 flat angles C4'-P-C4' energy: -21.657 flat angles P-C4'-P energy: -12.443 tors. eta vs tors. theta energy: -44.991 Dist. restrs. and SS energy: 0.345 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -421.764381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.764381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.099202 (E_RNA) where: Base-Base interactions energy: -301.609 where: short stacking energy: -126.218 Base-Backbone interact. energy: 0.061 local terms energy: -124.551502 where: bonds (distance) C4'-P energy: -21.010 bonds (distance) P-C4' energy: -22.755 flat angles C4'-P-C4' energy: -29.048 flat angles P-C4'-P energy: -18.329 tors. eta vs tors. theta energy: -33.410 Dist. restrs. and SS energy: 4.335 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -405.620687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.620687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.527269 (E_RNA) where: Base-Base interactions energy: -293.603 where: short stacking energy: -121.486 Base-Backbone interact. energy: -0.198 local terms energy: -113.726251 where: bonds (distance) C4'-P energy: -20.908 bonds (distance) P-C4' energy: -17.578 flat angles C4'-P-C4' energy: -29.054 flat angles P-C4'-P energy: -15.040 tors. eta vs tors. theta energy: -31.145 Dist. restrs. and SS energy: 1.907 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -445.761975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.761975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.010214 (E_RNA) where: Base-Base interactions energy: -321.007 where: short stacking energy: -137.705 Base-Backbone interact. energy: -0.068 local terms energy: -125.935744 where: bonds (distance) C4'-P energy: -28.738 bonds (distance) P-C4' energy: -24.098 flat angles C4'-P-C4' energy: -22.550 flat angles P-C4'-P energy: -18.424 tors. eta vs tors. theta energy: -32.125 Dist. restrs. and SS energy: 1.248 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -535.652884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.652884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.757716 (E_RNA) where: Base-Base interactions energy: -381.068 where: short stacking energy: -159.629 Base-Backbone interact. energy: -2.012 local terms energy: -152.677938 where: bonds (distance) C4'-P energy: -28.518 bonds (distance) P-C4' energy: -27.580 flat angles C4'-P-C4' energy: -33.979 flat angles P-C4'-P energy: -21.557 tors. eta vs tors. theta energy: -41.044 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -548.277811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.277811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.452446 (E_RNA) where: Base-Base interactions energy: -391.377 where: short stacking energy: -155.892 Base-Backbone interact. energy: -0.108 local terms energy: -156.967674 where: bonds (distance) C4'-P energy: -32.386 bonds (distance) P-C4' energy: -31.689 flat angles C4'-P-C4' energy: -27.989 flat angles P-C4'-P energy: -25.337 tors. eta vs tors. theta energy: -39.567 Dist. restrs. and SS energy: 0.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -538.102955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.102955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.252511 (E_RNA) where: Base-Base interactions energy: -398.296 where: short stacking energy: -165.057 Base-Backbone interact. energy: -1.049 local terms energy: -138.907413 where: bonds (distance) C4'-P energy: -25.069 bonds (distance) P-C4' energy: -25.488 flat angles C4'-P-C4' energy: -31.925 flat angles P-C4'-P energy: -18.310 tors. eta vs tors. theta energy: -38.116 Dist. restrs. and SS energy: 0.150 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -535.145155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.145155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.427253 (E_RNA) where: Base-Base interactions energy: -390.184 where: short stacking energy: -159.056 Base-Backbone interact. energy: -0.203 local terms energy: -145.040020 where: bonds (distance) C4'-P energy: -27.569 bonds (distance) P-C4' energy: -25.701 flat angles C4'-P-C4' energy: -31.856 flat angles P-C4'-P energy: -21.641 tors. eta vs tors. theta energy: -38.273 Dist. restrs. and SS energy: 0.282 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -506.343458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.343458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.744850 (E_RNA) where: Base-Base interactions energy: -358.988 where: short stacking energy: -139.886 Base-Backbone interact. energy: -0.268 local terms energy: -147.489157 where: bonds (distance) C4'-P energy: -25.734 bonds (distance) P-C4' energy: -32.894 flat angles C4'-P-C4' energy: -32.453 flat angles P-C4'-P energy: -22.015 tors. eta vs tors. theta energy: -34.393 Dist. restrs. and SS energy: 0.401 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -507.211675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.211675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.541917 (E_RNA) where: Base-Base interactions energy: -368.382 where: short stacking energy: -149.496 Base-Backbone interact. energy: 1.027 local terms energy: -140.187154 where: bonds (distance) C4'-P energy: -25.578 bonds (distance) P-C4' energy: -14.310 flat angles C4'-P-C4' energy: -35.751 flat angles P-C4'-P energy: -21.841 tors. eta vs tors. theta energy: -42.707 Dist. restrs. and SS energy: 0.330 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -481.973748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.973748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.844475 (E_RNA) where: Base-Base interactions energy: -347.165 where: short stacking energy: -144.713 Base-Backbone interact. energy: -0.307 local terms energy: -135.372375 where: bonds (distance) C4'-P energy: -23.852 bonds (distance) P-C4' energy: -26.755 flat angles C4'-P-C4' energy: -26.362 flat angles P-C4'-P energy: -20.366 tors. eta vs tors. theta energy: -38.037 Dist. restrs. and SS energy: 0.871 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -443.911477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.911477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.787959 (E_RNA) where: Base-Base interactions energy: -303.043 where: short stacking energy: -130.293 Base-Backbone interact. energy: -0.060 local terms energy: -141.684877 where: bonds (distance) C4'-P energy: -28.509 bonds (distance) P-C4' energy: -27.525 flat angles C4'-P-C4' energy: -28.696 flat angles P-C4'-P energy: -20.424 tors. eta vs tors. theta energy: -36.531 Dist. restrs. and SS energy: 0.876 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -394.613622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.613622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.980641 (E_RNA) where: Base-Base interactions energy: -275.238 where: short stacking energy: -111.283 Base-Backbone interact. energy: -0.605 local terms energy: -123.137508 where: bonds (distance) C4'-P energy: -28.644 bonds (distance) P-C4' energy: -24.888 flat angles C4'-P-C4' energy: -25.420 flat angles P-C4'-P energy: -16.237 tors. eta vs tors. theta energy: -27.947 Dist. restrs. and SS energy: 4.367 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -413.167049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.167049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.785517 (E_RNA) where: Base-Base interactions energy: -284.847 where: short stacking energy: -110.497 Base-Backbone interact. energy: -0.292 local terms energy: -128.646952 where: bonds (distance) C4'-P energy: -23.211 bonds (distance) P-C4' energy: -24.475 flat angles C4'-P-C4' energy: -30.406 flat angles P-C4'-P energy: -17.721 tors. eta vs tors. theta energy: -32.834 Dist. restrs. and SS energy: 0.618 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -558.896393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.896393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.173333 (E_RNA) where: Base-Base interactions energy: -400.172 where: short stacking energy: -165.182 Base-Backbone interact. energy: -0.114 local terms energy: -158.887958 where: bonds (distance) C4'-P energy: -30.507 bonds (distance) P-C4' energy: -30.949 flat angles C4'-P-C4' energy: -32.885 flat angles P-C4'-P energy: -25.069 tors. eta vs tors. theta energy: -39.478 Dist. restrs. and SS energy: 0.277 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -549.675257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.675257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.879972 (E_RNA) where: Base-Base interactions energy: -400.949 where: short stacking energy: -159.436 Base-Backbone interact. energy: 0.679 local terms energy: -149.610148 where: bonds (distance) C4'-P energy: -28.519 bonds (distance) P-C4' energy: -31.337 flat angles C4'-P-C4' energy: -28.559 flat angles P-C4'-P energy: -21.141 tors. eta vs tors. theta energy: -40.055 Dist. restrs. and SS energy: 0.205 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -547.689143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.689143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.745467 (E_RNA) where: Base-Base interactions energy: -390.312 where: short stacking energy: -166.421 Base-Backbone interact. energy: -0.134 local terms energy: -157.299453 where: bonds (distance) C4'-P energy: -34.110 bonds (distance) P-C4' energy: -28.036 flat angles C4'-P-C4' energy: -30.822 flat angles P-C4'-P energy: -17.341 tors. eta vs tors. theta energy: -46.991 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -526.532419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.532419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.759469 (E_RNA) where: Base-Base interactions energy: -380.487 where: short stacking energy: -161.794 Base-Backbone interact. energy: -0.524 local terms energy: -145.748717 where: bonds (distance) C4'-P energy: -23.802 bonds (distance) P-C4' energy: -22.215 flat angles C4'-P-C4' energy: -34.495 flat angles P-C4'-P energy: -22.775 tors. eta vs tors. theta energy: -42.462 Dist. restrs. and SS energy: 0.227 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -528.349823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.349823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.610995 (E_RNA) where: Base-Base interactions energy: -386.156 where: short stacking energy: -160.178 Base-Backbone interact. energy: -0.143 local terms energy: -142.311568 where: bonds (distance) C4'-P energy: -21.974 bonds (distance) P-C4' energy: -29.922 flat angles C4'-P-C4' energy: -31.100 flat angles P-C4'-P energy: -18.887 tors. eta vs tors. theta energy: -40.428 Dist. restrs. and SS energy: 0.261 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -496.367602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.367602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.933957 (E_RNA) where: Base-Base interactions energy: -358.280 where: short stacking energy: -139.342 Base-Backbone interact. energy: -0.280 local terms energy: -138.373907 where: bonds (distance) C4'-P energy: -25.101 bonds (distance) P-C4' energy: -26.305 flat angles C4'-P-C4' energy: -28.951 flat angles P-C4'-P energy: -20.682 tors. eta vs tors. theta energy: -37.334 Dist. restrs. and SS energy: 0.566 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -506.792032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.792032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.169831 (E_RNA) where: Base-Base interactions energy: -365.899 where: short stacking energy: -153.705 Base-Backbone interact. energy: -0.204 local terms energy: -141.067398 where: bonds (distance) C4'-P energy: -26.992 bonds (distance) P-C4' energy: -23.968 flat angles C4'-P-C4' energy: -26.708 flat angles P-C4'-P energy: -22.050 tors. eta vs tors. theta energy: -41.350 Dist. restrs. and SS energy: 0.378 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -462.538503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.538503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.843639 (E_RNA) where: Base-Base interactions energy: -329.890 where: short stacking energy: -132.618 Base-Backbone interact. energy: -0.184 local terms energy: -132.769421 where: bonds (distance) C4'-P energy: -28.681 bonds (distance) P-C4' energy: -25.017 flat angles C4'-P-C4' energy: -31.655 flat angles P-C4'-P energy: -13.549 tors. eta vs tors. theta energy: -33.867 Dist. restrs. and SS energy: 0.305 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -425.361019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.361019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.456802 (E_RNA) where: Base-Base interactions energy: -304.307 where: short stacking energy: -115.930 Base-Backbone interact. energy: -0.243 local terms energy: -121.906634 where: bonds (distance) C4'-P energy: -20.686 bonds (distance) P-C4' energy: -25.068 flat angles C4'-P-C4' energy: -26.571 flat angles P-C4'-P energy: -17.434 tors. eta vs tors. theta energy: -32.148 Dist. restrs. and SS energy: 1.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -358.700619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.700619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.788308 (E_RNA) where: Base-Base interactions energy: -251.304 where: short stacking energy: -108.886 Base-Backbone interact. energy: 0.140 local terms energy: -111.624261 where: bonds (distance) C4'-P energy: -20.985 bonds (distance) P-C4' energy: -30.812 flat angles C4'-P-C4' energy: -22.975 flat angles P-C4'-P energy: -16.477 tors. eta vs tors. theta energy: -20.376 Dist. restrs. and SS energy: 4.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -555.898085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.898085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.043045 (E_RNA) where: Base-Base interactions energy: -397.339 where: short stacking energy: -166.528 Base-Backbone interact. energy: -0.365 local terms energy: -158.339231 where: bonds (distance) C4'-P energy: -26.507 bonds (distance) P-C4' energy: -33.911 flat angles C4'-P-C4' energy: -31.452 flat angles P-C4'-P energy: -24.175 tors. eta vs tors. theta energy: -42.294 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -562.748922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.748922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.828898 (E_RNA) where: Base-Base interactions energy: -401.628 where: short stacking energy: -168.398 Base-Backbone interact. energy: -0.350 local terms energy: -160.851740 where: bonds (distance) C4'-P energy: -29.274 bonds (distance) P-C4' energy: -31.660 flat angles C4'-P-C4' energy: -36.274 flat angles P-C4'-P energy: -20.969 tors. eta vs tors. theta energy: -42.675 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -541.171860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.171860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.526907 (E_RNA) where: Base-Base interactions energy: -380.488 where: short stacking energy: -159.222 Base-Backbone interact. energy: -0.122 local terms energy: -160.916592 where: bonds (distance) C4'-P energy: -29.015 bonds (distance) P-C4' energy: -31.612 flat angles C4'-P-C4' energy: -32.853 flat angles P-C4'-P energy: -20.612 tors. eta vs tors. theta energy: -46.824 Dist. restrs. and SS energy: 0.355 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -533.660953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.660953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.682611 (E_RNA) where: Base-Base interactions energy: -392.662 where: short stacking energy: -160.551 Base-Backbone interact. energy: -0.214 local terms energy: -140.806929 where: bonds (distance) C4'-P energy: -22.050 bonds (distance) P-C4' energy: -25.083 flat angles C4'-P-C4' energy: -34.910 flat angles P-C4'-P energy: -15.750 tors. eta vs tors. theta energy: -43.014 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -503.957463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.957463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.690534 (E_RNA) where: Base-Base interactions energy: -364.993 where: short stacking energy: -155.409 Base-Backbone interact. energy: -0.650 local terms energy: -141.046861 where: bonds (distance) C4'-P energy: -20.267 bonds (distance) P-C4' energy: -26.619 flat angles C4'-P-C4' energy: -33.523 flat angles P-C4'-P energy: -18.437 tors. eta vs tors. theta energy: -42.200 Dist. restrs. and SS energy: 2.733 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -511.897192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.897192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.111725 (E_RNA) where: Base-Base interactions energy: -370.353 where: short stacking energy: -147.702 Base-Backbone interact. energy: 1.009 local terms energy: -142.768008 where: bonds (distance) C4'-P energy: -27.038 bonds (distance) P-C4' energy: -22.183 flat angles C4'-P-C4' energy: -30.854 flat angles P-C4'-P energy: -20.974 tors. eta vs tors. theta energy: -41.719 Dist. restrs. and SS energy: 0.215 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -480.620813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.620813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.910813 (E_RNA) where: Base-Base interactions energy: -341.961 where: short stacking energy: -150.231 Base-Backbone interact. energy: 0.146 local terms energy: -139.095371 where: bonds (distance) C4'-P energy: -25.158 bonds (distance) P-C4' energy: -26.845 flat angles C4'-P-C4' energy: -30.054 flat angles P-C4'-P energy: -19.613 tors. eta vs tors. theta energy: -37.426 Dist. restrs. and SS energy: 0.290 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -458.462029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.462029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.790459 (E_RNA) where: Base-Base interactions energy: -316.108 where: short stacking energy: -120.769 Base-Backbone interact. energy: -0.107 local terms energy: -142.575004 where: bonds (distance) C4'-P energy: -23.816 bonds (distance) P-C4' energy: -33.599 flat angles C4'-P-C4' energy: -30.216 flat angles P-C4'-P energy: -22.030 tors. eta vs tors. theta energy: -32.914 Dist. restrs. and SS energy: 0.328 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -430.826185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.826185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.892450 (E_RNA) where: Base-Base interactions energy: -299.465 where: short stacking energy: -137.069 Base-Backbone interact. energy: -0.661 local terms energy: -132.766891 where: bonds (distance) C4'-P energy: -22.586 bonds (distance) P-C4' energy: -25.295 flat angles C4'-P-C4' energy: -22.526 flat angles P-C4'-P energy: -23.363 tors. eta vs tors. theta energy: -38.996 Dist. restrs. and SS energy: 2.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -372.317376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.317376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.832918 (E_RNA) where: Base-Base interactions energy: -274.268 where: short stacking energy: -108.326 Base-Backbone interact. energy: 1.283 local terms energy: -104.848310 where: bonds (distance) C4'-P energy: -20.251 bonds (distance) P-C4' energy: -27.750 flat angles C4'-P-C4' energy: -25.846 flat angles P-C4'-P energy: -7.456 tors. eta vs tors. theta energy: -23.545 Dist. restrs. and SS energy: 5.516 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -559.297978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.297978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.427484 (E_RNA) where: Base-Base interactions energy: -400.870 where: short stacking energy: -166.810 Base-Backbone interact. energy: -0.376 local terms energy: -158.180970 where: bonds (distance) C4'-P energy: -26.963 bonds (distance) P-C4' energy: -29.913 flat angles C4'-P-C4' energy: -29.860 flat angles P-C4'-P energy: -27.122 tors. eta vs tors. theta energy: -44.322 Dist. restrs. and SS energy: 0.130 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -553.299407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.299407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.941011 (E_RNA) where: Base-Base interactions energy: -395.397 where: short stacking energy: -169.961 Base-Backbone interact. energy: -0.155 local terms energy: -158.389719 where: bonds (distance) C4'-P energy: -29.031 bonds (distance) P-C4' energy: -34.730 flat angles C4'-P-C4' energy: -31.796 flat angles P-C4'-P energy: -21.290 tors. eta vs tors. theta energy: -41.542 Dist. restrs. and SS energy: 0.642 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -547.536434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.536434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.957360 (E_RNA) where: Base-Base interactions energy: -386.635 where: short stacking energy: -160.306 Base-Backbone interact. energy: -0.190 local terms energy: -161.132555 where: bonds (distance) C4'-P energy: -28.655 bonds (distance) P-C4' energy: -29.450 flat angles C4'-P-C4' energy: -31.506 flat angles P-C4'-P energy: -25.930 tors. eta vs tors. theta energy: -45.591 Dist. restrs. and SS energy: 0.421 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -525.574178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.574178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.953986 (E_RNA) where: Base-Base interactions energy: -371.742 where: short stacking energy: -157.763 Base-Backbone interact. energy: -0.947 local terms energy: -153.264287 where: bonds (distance) C4'-P energy: -29.973 bonds (distance) P-C4' energy: -26.967 flat angles C4'-P-C4' energy: -33.202 flat angles P-C4'-P energy: -18.565 tors. eta vs tors. theta energy: -44.557 Dist. restrs. and SS energy: 0.380 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -529.843497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.843497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.035600 (E_RNA) where: Base-Base interactions energy: -379.559 where: short stacking energy: -152.641 Base-Backbone interact. energy: -1.016 local terms energy: -149.460788 where: bonds (distance) C4'-P energy: -20.708 bonds (distance) P-C4' energy: -28.564 flat angles C4'-P-C4' energy: -34.723 flat angles P-C4'-P energy: -25.920 tors. eta vs tors. theta energy: -39.546 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -496.467303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.467303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.689619 (E_RNA) where: Base-Base interactions energy: -350.517 where: short stacking energy: -151.054 Base-Backbone interact. energy: -0.225 local terms energy: -148.947787 where: bonds (distance) C4'-P energy: -25.389 bonds (distance) P-C4' energy: -26.190 flat angles C4'-P-C4' energy: -33.825 flat angles P-C4'-P energy: -23.374 tors. eta vs tors. theta energy: -40.170 Dist. restrs. and SS energy: 3.222 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -476.012887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.012887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.341528 (E_RNA) where: Base-Base interactions energy: -341.644 where: short stacking energy: -128.237 Base-Backbone interact. energy: -0.989 local terms energy: -133.707698 where: bonds (distance) C4'-P energy: -23.360 bonds (distance) P-C4' energy: -27.142 flat angles C4'-P-C4' energy: -27.113 flat angles P-C4'-P energy: -18.656 tors. eta vs tors. theta energy: -37.437 Dist. restrs. and SS energy: 0.329 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -482.943526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.943526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.314633 (E_RNA) where: Base-Base interactions energy: -336.100 where: short stacking energy: -136.796 Base-Backbone interact. energy: -0.275 local terms energy: -146.940418 where: bonds (distance) C4'-P energy: -30.904 bonds (distance) P-C4' energy: -27.266 flat angles C4'-P-C4' energy: -26.989 flat angles P-C4'-P energy: -22.603 tors. eta vs tors. theta energy: -39.178 Dist. restrs. and SS energy: 0.371 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -418.884986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.884986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.953145 (E_RNA) where: Base-Base interactions energy: -295.928 where: short stacking energy: -121.272 Base-Backbone interact. energy: -0.584 local terms energy: -123.440380 where: bonds (distance) C4'-P energy: -23.608 bonds (distance) P-C4' energy: -29.706 flat angles C4'-P-C4' energy: -20.288 flat angles P-C4'-P energy: -20.219 tors. eta vs tors. theta energy: -29.620 Dist. restrs. and SS energy: 1.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -344.995042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.995042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.512588 (E_RNA) where: Base-Base interactions energy: -246.044 where: short stacking energy: -83.865 Base-Backbone interact. energy: -0.745 local terms energy: -99.723645 where: bonds (distance) C4'-P energy: -20.805 bonds (distance) P-C4' energy: -18.996 flat angles C4'-P-C4' energy: -27.621 flat angles P-C4'-P energy: -19.290 tors. eta vs tors. theta energy: -13.012 Dist. restrs. and SS energy: 1.518 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -553.774468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.774468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.899302 (E_RNA) where: Base-Base interactions energy: -390.332 where: short stacking energy: -162.147 Base-Backbone interact. energy: -0.271 local terms energy: -163.297043 where: bonds (distance) C4'-P energy: -29.061 bonds (distance) P-C4' energy: -30.403 flat angles C4'-P-C4' energy: -32.511 flat angles P-C4'-P energy: -24.718 tors. eta vs tors. theta energy: -46.603 Dist. restrs. and SS energy: 0.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -544.581466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.581466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.641720 (E_RNA) where: Base-Base interactions energy: -395.526 where: short stacking energy: -162.671 Base-Backbone interact. energy: -1.402 local terms energy: -147.714029 where: bonds (distance) C4'-P energy: -29.812 bonds (distance) P-C4' energy: -26.860 flat angles C4'-P-C4' energy: -25.432 flat angles P-C4'-P energy: -21.531 tors. eta vs tors. theta energy: -44.079 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -537.653307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.653307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.732821 (E_RNA) where: Base-Base interactions energy: -382.246 where: short stacking energy: -158.688 Base-Backbone interact. energy: -0.860 local terms energy: -154.627354 where: bonds (distance) C4'-P energy: -27.243 bonds (distance) P-C4' energy: -27.476 flat angles C4'-P-C4' energy: -32.551 flat angles P-C4'-P energy: -26.575 tors. eta vs tors. theta energy: -40.782 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -528.708715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.708715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.790846 (E_RNA) where: Base-Base interactions energy: -375.402 where: short stacking energy: -155.765 Base-Backbone interact. energy: -0.586 local terms energy: -152.802475 where: bonds (distance) C4'-P energy: -22.963 bonds (distance) P-C4' energy: -30.375 flat angles C4'-P-C4' energy: -31.214 flat angles P-C4'-P energy: -25.916 tors. eta vs tors. theta energy: -42.334 Dist. restrs. and SS energy: 0.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -533.458775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.458775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.522714 (E_RNA) where: Base-Base interactions energy: -382.213 where: short stacking energy: -153.523 Base-Backbone interact. energy: -0.228 local terms energy: -151.081699 where: bonds (distance) C4'-P energy: -30.751 bonds (distance) P-C4' energy: -26.576 flat angles C4'-P-C4' energy: -29.361 flat angles P-C4'-P energy: -23.743 tors. eta vs tors. theta energy: -40.651 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -516.749017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.749017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.941698 (E_RNA) where: Base-Base interactions energy: -376.086 where: short stacking energy: -156.198 Base-Backbone interact. energy: -0.117 local terms energy: -140.738123 where: bonds (distance) C4'-P energy: -25.589 bonds (distance) P-C4' energy: -26.645 flat angles C4'-P-C4' energy: -27.106 flat angles P-C4'-P energy: -19.585 tors. eta vs tors. theta energy: -41.814 Dist. restrs. and SS energy: 0.193 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -503.016519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.016519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.572168 (E_RNA) where: Base-Base interactions energy: -367.378 where: short stacking energy: -155.161 Base-Backbone interact. energy: -0.376 local terms energy: -135.818846 where: bonds (distance) C4'-P energy: -26.848 bonds (distance) P-C4' energy: -25.080 flat angles C4'-P-C4' energy: -27.036 flat angles P-C4'-P energy: -17.374 tors. eta vs tors. theta energy: -39.481 Dist. restrs. and SS energy: 0.556 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -478.591590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.591590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.142802 (E_RNA) where: Base-Base interactions energy: -357.471 where: short stacking energy: -145.485 Base-Backbone interact. energy: -0.224 local terms energy: -122.448593 where: bonds (distance) C4'-P energy: -22.275 bonds (distance) P-C4' energy: -20.219 flat angles C4'-P-C4' energy: -24.149 flat angles P-C4'-P energy: -13.406 tors. eta vs tors. theta energy: -42.399 Dist. restrs. and SS energy: 1.551 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -415.654457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.654457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.039871 (E_RNA) where: Base-Base interactions energy: -296.973 where: short stacking energy: -129.993 Base-Backbone interact. energy: -0.548 local terms energy: -120.518373 where: bonds (distance) C4'-P energy: -26.409 bonds (distance) P-C4' energy: -25.197 flat angles C4'-P-C4' energy: -23.703 flat angles P-C4'-P energy: -18.722 tors. eta vs tors. theta energy: -26.488 Dist. restrs. and SS energy: 2.385 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -352.995840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.995840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.863303 (E_RNA) where: Base-Base interactions energy: -249.820 where: short stacking energy: -98.194 Base-Backbone interact. energy: 0.990 local terms energy: -108.033070 where: bonds (distance) C4'-P energy: -17.504 bonds (distance) P-C4' energy: -29.517 flat angles C4'-P-C4' energy: -21.312 flat angles P-C4'-P energy: -17.188 tors. eta vs tors. theta energy: -22.512 Dist. restrs. and SS energy: 3.867 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -550.777968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.777968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.084805 (E_RNA) where: Base-Base interactions energy: -393.077 where: short stacking energy: -163.232 Base-Backbone interact. energy: -0.861 local terms energy: -157.146883 where: bonds (distance) C4'-P energy: -25.050 bonds (distance) P-C4' energy: -34.801 flat angles C4'-P-C4' energy: -29.725 flat angles P-C4'-P energy: -21.872 tors. eta vs tors. theta energy: -45.698 Dist. restrs. and SS energy: 0.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -548.941896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.941896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.110273 (E_RNA) where: Base-Base interactions energy: -388.873 where: short stacking energy: -165.712 Base-Backbone interact. energy: -0.111 local terms energy: -160.126137 where: bonds (distance) C4'-P energy: -27.591 bonds (distance) P-C4' energy: -32.602 flat angles C4'-P-C4' energy: -36.163 flat angles P-C4'-P energy: -21.036 tors. eta vs tors. theta energy: -42.735 Dist. restrs. and SS energy: 0.168 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -524.600918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.600918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.001202 (E_RNA) where: Base-Base interactions energy: -377.323 where: short stacking energy: -155.106 Base-Backbone interact. energy: -0.479 local terms energy: -147.199615 where: bonds (distance) C4'-P energy: -25.008 bonds (distance) P-C4' energy: -28.256 flat angles C4'-P-C4' energy: -32.797 flat angles P-C4'-P energy: -21.243 tors. eta vs tors. theta energy: -39.895 Dist. restrs. and SS energy: 0.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -521.884868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.884868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.437217 (E_RNA) where: Base-Base interactions energy: -370.577 where: short stacking energy: -157.500 Base-Backbone interact. energy: -0.136 local terms energy: -151.724511 where: bonds (distance) C4'-P energy: -27.084 bonds (distance) P-C4' energy: -29.907 flat angles C4'-P-C4' energy: -32.450 flat angles P-C4'-P energy: -20.644 tors. eta vs tors. theta energy: -41.639 Dist. restrs. and SS energy: 0.552 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -529.510176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.510176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.942501 (E_RNA) where: Base-Base interactions energy: -383.327 where: short stacking energy: -167.802 Base-Backbone interact. energy: -0.815 local terms energy: -145.800858 where: bonds (distance) C4'-P energy: -27.145 bonds (distance) P-C4' energy: -20.904 flat angles C4'-P-C4' energy: -30.113 flat angles P-C4'-P energy: -24.042 tors. eta vs tors. theta energy: -43.596 Dist. restrs. and SS energy: 0.432 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -530.803580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.803580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.119079 (E_RNA) where: Base-Base interactions energy: -379.392 where: short stacking energy: -157.169 Base-Backbone interact. energy: 0.177 local terms energy: -151.903139 where: bonds (distance) C4'-P energy: -26.459 bonds (distance) P-C4' energy: -29.120 flat angles C4'-P-C4' energy: -31.000 flat angles P-C4'-P energy: -23.245 tors. eta vs tors. theta energy: -42.078 Dist. restrs. and SS energy: 0.315 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -492.992550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.992550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.148389 (E_RNA) where: Base-Base interactions energy: -354.147 where: short stacking energy: -141.547 Base-Backbone interact. energy: -0.615 local terms energy: -138.387101 where: bonds (distance) C4'-P energy: -29.400 bonds (distance) P-C4' energy: -31.041 flat angles C4'-P-C4' energy: -32.247 flat angles P-C4'-P energy: -10.660 tors. eta vs tors. theta energy: -35.039 Dist. restrs. and SS energy: 0.156 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -434.286143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.286143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.525361 (E_RNA) where: Base-Base interactions energy: -314.370 where: short stacking energy: -123.554 Base-Backbone interact. energy: -0.078 local terms energy: -124.077939 where: bonds (distance) C4'-P energy: -21.240 bonds (distance) P-C4' energy: -24.038 flat angles C4'-P-C4' energy: -27.513 flat angles P-C4'-P energy: -20.440 tors. eta vs tors. theta energy: -30.846 Dist. restrs. and SS energy: 4.239 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -422.097411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.097411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.462654 (E_RNA) where: Base-Base interactions energy: -299.217 where: short stacking energy: -116.612 Base-Backbone interact. energy: -0.413 local terms energy: -122.833166 where: bonds (distance) C4'-P energy: -20.943 bonds (distance) P-C4' energy: -31.484 flat angles C4'-P-C4' energy: -24.215 flat angles P-C4'-P energy: -17.231 tors. eta vs tors. theta energy: -28.960 Dist. restrs. and SS energy: 0.365 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -369.306556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.306556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.306503 (E_RNA) where: Base-Base interactions energy: -264.693 where: short stacking energy: -98.845 Base-Backbone interact. energy: -0.438 local terms energy: -105.176085 where: bonds (distance) C4'-P energy: -21.441 bonds (distance) P-C4' energy: -21.933 flat angles C4'-P-C4' energy: -29.407 flat angles P-C4'-P energy: -14.703 tors. eta vs tors. theta energy: -17.692 Dist. restrs. and SS energy: 1.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -552.899374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.899374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.076363 (E_RNA) where: Base-Base interactions energy: -398.255 where: short stacking energy: -171.094 Base-Backbone interact. energy: -0.823 local terms energy: -153.999118 where: bonds (distance) C4'-P energy: -25.919 bonds (distance) P-C4' energy: -28.272 flat angles C4'-P-C4' energy: -34.107 flat angles P-C4'-P energy: -21.229 tors. eta vs tors. theta energy: -44.472 Dist. restrs. and SS energy: 0.177 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -534.328013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.328013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.344583 (E_RNA) where: Base-Base interactions energy: -384.825 where: short stacking energy: -163.035 Base-Backbone interact. energy: -0.120 local terms energy: -149.399437 where: bonds (distance) C4'-P energy: -32.050 bonds (distance) P-C4' energy: -26.295 flat angles C4'-P-C4' energy: -34.110 flat angles P-C4'-P energy: -15.868 tors. eta vs tors. theta energy: -41.077 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -539.649757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.649757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.730474 (E_RNA) where: Base-Base interactions energy: -389.312 where: short stacking energy: -159.179 Base-Backbone interact. energy: -0.917 local terms energy: -149.501452 where: bonds (distance) C4'-P energy: -23.196 bonds (distance) P-C4' energy: -25.493 flat angles C4'-P-C4' energy: -31.988 flat angles P-C4'-P energy: -25.804 tors. eta vs tors. theta energy: -43.021 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -527.892242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.892242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.978266 (E_RNA) where: Base-Base interactions energy: -380.130 where: short stacking energy: -165.401 Base-Backbone interact. energy: -0.110 local terms energy: -147.739014 where: bonds (distance) C4'-P energy: -27.562 bonds (distance) P-C4' energy: -29.405 flat angles C4'-P-C4' energy: -30.851 flat angles P-C4'-P energy: -17.807 tors. eta vs tors. theta energy: -42.115 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -527.482440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.482440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.860682 (E_RNA) where: Base-Base interactions energy: -380.273 where: short stacking energy: -155.243 Base-Backbone interact. energy: -0.143 local terms energy: -147.444563 where: bonds (distance) C4'-P energy: -22.452 bonds (distance) P-C4' energy: -28.034 flat angles C4'-P-C4' energy: -32.637 flat angles P-C4'-P energy: -23.361 tors. eta vs tors. theta energy: -40.960 Dist. restrs. and SS energy: 0.378 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -517.084413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.084413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.173452 (E_RNA) where: Base-Base interactions energy: -382.326 where: short stacking energy: -158.041 Base-Backbone interact. energy: -0.551 local terms energy: -134.296637 where: bonds (distance) C4'-P energy: -22.193 bonds (distance) P-C4' energy: -24.266 flat angles C4'-P-C4' energy: -31.446 flat angles P-C4'-P energy: -17.021 tors. eta vs tors. theta energy: -39.371 Dist. restrs. and SS energy: 0.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -492.752357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.752357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.816292 (E_RNA) where: Base-Base interactions energy: -351.408 where: short stacking energy: -154.383 Base-Backbone interact. energy: -0.830 local terms energy: -140.578553 where: bonds (distance) C4'-P energy: -20.669 bonds (distance) P-C4' energy: -28.141 flat angles C4'-P-C4' energy: -23.666 flat angles P-C4'-P energy: -21.903 tors. eta vs tors. theta energy: -46.200 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -434.150461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.150461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.335274 (E_RNA) where: Base-Base interactions energy: -309.674 where: short stacking energy: -125.745 Base-Backbone interact. energy: -0.449 local terms energy: -124.212195 where: bonds (distance) C4'-P energy: -19.092 bonds (distance) P-C4' energy: -25.096 flat angles C4'-P-C4' energy: -27.692 flat angles P-C4'-P energy: -21.069 tors. eta vs tors. theta energy: -31.263 Dist. restrs. and SS energy: 0.185 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -434.025028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.025028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.467331 (E_RNA) where: Base-Base interactions energy: -314.729 where: short stacking energy: -135.311 Base-Backbone interact. energy: -0.288 local terms energy: -119.450744 where: bonds (distance) C4'-P energy: -22.970 bonds (distance) P-C4' energy: -18.370 flat angles C4'-P-C4' energy: -28.413 flat angles P-C4'-P energy: -17.639 tors. eta vs tors. theta energy: -32.058 Dist. restrs. and SS energy: 0.442 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -374.658831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.658831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.228739 (E_RNA) where: Base-Base interactions energy: -272.391 where: short stacking energy: -104.054 Base-Backbone interact. energy: -2.697 local terms energy: -104.141515 where: bonds (distance) C4'-P energy: -21.281 bonds (distance) P-C4' energy: -17.884 flat angles C4'-P-C4' energy: -27.874 flat angles P-C4'-P energy: -15.367 tors. eta vs tors. theta energy: -21.735 Dist. restrs. and SS energy: 4.570 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -555.070993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.070993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.103626 (E_RNA) where: Base-Base interactions energy: -395.875 where: short stacking energy: -158.755 Base-Backbone interact. energy: -0.485 local terms energy: -158.743285 where: bonds (distance) C4'-P energy: -27.575 bonds (distance) P-C4' energy: -31.716 flat angles C4'-P-C4' energy: -35.699 flat angles P-C4'-P energy: -24.969 tors. eta vs tors. theta energy: -38.784 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -553.769553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.769553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.950281 (E_RNA) where: Base-Base interactions energy: -392.455 where: short stacking energy: -164.340 Base-Backbone interact. energy: -0.314 local terms energy: -161.181553 where: bonds (distance) C4'-P energy: -25.956 bonds (distance) P-C4' energy: -30.722 flat angles C4'-P-C4' energy: -31.646 flat angles P-C4'-P energy: -28.082 tors. eta vs tors. theta energy: -44.774 Dist. restrs. and SS energy: 0.181 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -539.751696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.751696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.015059 (E_RNA) where: Base-Base interactions energy: -383.615 where: short stacking energy: -160.706 Base-Backbone interact. energy: -0.708 local terms energy: -155.692030 where: bonds (distance) C4'-P energy: -25.737 bonds (distance) P-C4' energy: -30.298 flat angles C4'-P-C4' energy: -33.774 flat angles P-C4'-P energy: -22.025 tors. eta vs tors. theta energy: -43.858 Dist. restrs. and SS energy: 0.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -526.174783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.174783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.532631 (E_RNA) where: Base-Base interactions energy: -375.927 where: short stacking energy: -165.120 Base-Backbone interact. energy: -0.342 local terms energy: -150.263053 where: bonds (distance) C4'-P energy: -33.019 bonds (distance) P-C4' energy: -22.567 flat angles C4'-P-C4' energy: -28.664 flat angles P-C4'-P energy: -23.989 tors. eta vs tors. theta energy: -42.025 Dist. restrs. and SS energy: 0.358 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -518.311614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.311614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.600452 (E_RNA) where: Base-Base interactions energy: -367.400 where: short stacking energy: -162.688 Base-Backbone interact. energy: -0.566 local terms energy: -150.634566 where: bonds (distance) C4'-P energy: -26.262 bonds (distance) P-C4' energy: -32.424 flat angles C4'-P-C4' energy: -29.590 flat angles P-C4'-P energy: -17.169 tors. eta vs tors. theta energy: -45.190 Dist. restrs. and SS energy: 0.289 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -513.795026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.795026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.885212 (E_RNA) where: Base-Base interactions energy: -377.694 where: short stacking energy: -155.575 Base-Backbone interact. energy: -0.371 local terms energy: -135.820224 where: bonds (distance) C4'-P energy: -21.289 bonds (distance) P-C4' energy: -22.136 flat angles C4'-P-C4' energy: -29.888 flat angles P-C4'-P energy: -20.674 tors. eta vs tors. theta energy: -41.833 Dist. restrs. and SS energy: 0.090 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -489.559135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.559135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.596134 (E_RNA) where: Base-Base interactions energy: -346.376 where: short stacking energy: -144.472 Base-Backbone interact. energy: -1.238 local terms energy: -142.982284 where: bonds (distance) C4'-P energy: -27.508 bonds (distance) P-C4' energy: -31.938 flat angles C4'-P-C4' energy: -24.927 flat angles P-C4'-P energy: -21.677 tors. eta vs tors. theta energy: -36.933 Dist. restrs. and SS energy: 1.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -471.356536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.356536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.556452 (E_RNA) where: Base-Base interactions energy: -331.905 where: short stacking energy: -142.042 Base-Backbone interact. energy: -0.180 local terms energy: -139.470973 where: bonds (distance) C4'-P energy: -20.567 bonds (distance) P-C4' energy: -29.016 flat angles C4'-P-C4' energy: -29.775 flat angles P-C4'-P energy: -18.078 tors. eta vs tors. theta energy: -42.035 Dist. restrs. and SS energy: 0.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -418.821640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.821640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.659690 (E_RNA) where: Base-Base interactions energy: -284.330 where: short stacking energy: -120.530 Base-Backbone interact. energy: -0.137 local terms energy: -135.192337 where: bonds (distance) C4'-P energy: -28.619 bonds (distance) P-C4' energy: -28.384 flat angles C4'-P-C4' energy: -27.692 flat angles P-C4'-P energy: -14.523 tors. eta vs tors. theta energy: -35.975 Dist. restrs. and SS energy: 0.838 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -374.935906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.935906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.087207 (E_RNA) where: Base-Base interactions energy: -261.555 where: short stacking energy: -108.183 Base-Backbone interact. energy: -0.949 local terms energy: -113.583084 where: bonds (distance) C4'-P energy: -11.790 bonds (distance) P-C4' energy: -29.840 flat angles C4'-P-C4' energy: -23.347 flat angles P-C4'-P energy: -19.331 tors. eta vs tors. theta energy: -29.275 Dist. restrs. and SS energy: 1.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -554.518448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.518448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.629931 (E_RNA) where: Base-Base interactions energy: -402.698 where: short stacking energy: -161.203 Base-Backbone interact. energy: -0.199 local terms energy: -151.732083 where: bonds (distance) C4'-P energy: -26.597 bonds (distance) P-C4' energy: -26.845 flat angles C4'-P-C4' energy: -34.558 flat angles P-C4'-P energy: -21.927 tors. eta vs tors. theta energy: -41.805 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -541.095489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.095489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.270005 (E_RNA) where: Base-Base interactions energy: -384.433 where: short stacking energy: -161.883 Base-Backbone interact. energy: -0.021 local terms energy: -156.816356 where: bonds (distance) C4'-P energy: -31.657 bonds (distance) P-C4' energy: -28.005 flat angles C4'-P-C4' energy: -29.987 flat angles P-C4'-P energy: -25.488 tors. eta vs tors. theta energy: -41.679 Dist. restrs. and SS energy: 0.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -551.257683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.257683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.762793 (E_RNA) where: Base-Base interactions energy: -398.712 where: short stacking energy: -166.513 Base-Backbone interact. energy: -0.384 local terms energy: -152.667094 where: bonds (distance) C4'-P energy: -24.214 bonds (distance) P-C4' energy: -33.907 flat angles C4'-P-C4' energy: -33.884 flat angles P-C4'-P energy: -22.032 tors. eta vs tors. theta energy: -38.630 Dist. restrs. and SS energy: 0.505 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -519.045305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.045305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.353844 (E_RNA) where: Base-Base interactions energy: -363.546 where: short stacking energy: -166.729 Base-Backbone interact. energy: -0.071 local terms energy: -155.736623 where: bonds (distance) C4'-P energy: -21.023 bonds (distance) P-C4' energy: -26.248 flat angles C4'-P-C4' energy: -33.477 flat angles P-C4'-P energy: -27.782 tors. eta vs tors. theta energy: -47.207 Dist. restrs. and SS energy: 0.309 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -524.108990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.108990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.210791 (E_RNA) where: Base-Base interactions energy: -366.345 where: short stacking energy: -166.666 Base-Backbone interact. energy: -0.258 local terms energy: -157.607876 where: bonds (distance) C4'-P energy: -22.425 bonds (distance) P-C4' energy: -33.130 flat angles C4'-P-C4' energy: -33.670 flat angles P-C4'-P energy: -23.560 tors. eta vs tors. theta energy: -44.823 Dist. restrs. and SS energy: 0.102 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -516.237387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.237387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.644744 (E_RNA) where: Base-Base interactions energy: -373.573 where: short stacking energy: -157.832 Base-Backbone interact. energy: -0.101 local terms energy: -142.970443 where: bonds (distance) C4'-P energy: -24.283 bonds (distance) P-C4' energy: -25.876 flat angles C4'-P-C4' energy: -27.745 flat angles P-C4'-P energy: -20.085 tors. eta vs tors. theta energy: -44.981 Dist. restrs. and SS energy: 0.407 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -492.809135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.809135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.066492 (E_RNA) where: Base-Base interactions energy: -341.406 where: short stacking energy: -151.898 Base-Backbone interact. energy: -0.657 local terms energy: -151.003489 where: bonds (distance) C4'-P energy: -23.413 bonds (distance) P-C4' energy: -30.390 flat angles C4'-P-C4' energy: -32.964 flat angles P-C4'-P energy: -18.741 tors. eta vs tors. theta energy: -45.496 Dist. restrs. and SS energy: 0.257 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -484.540340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.540340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.742280 (E_RNA) where: Base-Base interactions energy: -338.403 where: short stacking energy: -141.663 Base-Backbone interact. energy: -0.470 local terms energy: -145.869474 where: bonds (distance) C4'-P energy: -27.856 bonds (distance) P-C4' energy: -30.228 flat angles C4'-P-C4' energy: -33.633 flat angles P-C4'-P energy: -14.182 tors. eta vs tors. theta energy: -39.971 Dist. restrs. and SS energy: 0.202 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -465.025342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.025342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.189047 (E_RNA) where: Base-Base interactions energy: -336.808 where: short stacking energy: -147.657 Base-Backbone interact. energy: -0.292 local terms energy: -128.088985 where: bonds (distance) C4'-P energy: -20.851 bonds (distance) P-C4' energy: -22.540 flat angles C4'-P-C4' energy: -22.921 flat angles P-C4'-P energy: -20.552 tors. eta vs tors. theta energy: -41.225 Dist. restrs. and SS energy: 0.164 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -428.210922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -428.210922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.546686 (E_RNA) where: Base-Base interactions energy: -317.132 where: short stacking energy: -124.047 Base-Backbone interact. energy: -0.392 local terms energy: -111.022947 where: bonds (distance) C4'-P energy: -21.510 bonds (distance) P-C4' energy: -17.912 flat angles C4'-P-C4' energy: -26.214 flat angles P-C4'-P energy: -8.036 tors. eta vs tors. theta energy: -37.352 Dist. restrs. and SS energy: 0.336 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -558.125704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.125704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.169754 (E_RNA) where: Base-Base interactions energy: -398.906 where: short stacking energy: -164.341 Base-Backbone interact. energy: -0.707 local terms energy: -158.557294 where: bonds (distance) C4'-P energy: -26.064 bonds (distance) P-C4' energy: -32.623 flat angles C4'-P-C4' energy: -30.884 flat angles P-C4'-P energy: -27.072 tors. eta vs tors. theta energy: -41.914 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -540.998761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.998761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.072128 (E_RNA) where: Base-Base interactions energy: -384.755 where: short stacking energy: -157.311 Base-Backbone interact. energy: -0.519 local terms energy: -155.798202 where: bonds (distance) C4'-P energy: -31.429 bonds (distance) P-C4' energy: -32.924 flat angles C4'-P-C4' energy: -31.991 flat angles P-C4'-P energy: -17.221 tors. eta vs tors. theta energy: -42.233 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -541.506349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.506349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.638719 (E_RNA) where: Base-Base interactions energy: -382.697 where: short stacking energy: -157.450 Base-Backbone interact. energy: -0.170 local terms energy: -158.772070 where: bonds (distance) C4'-P energy: -26.122 bonds (distance) P-C4' energy: -32.110 flat angles C4'-P-C4' energy: -33.546 flat angles P-C4'-P energy: -21.818 tors. eta vs tors. theta energy: -45.176 Dist. restrs. and SS energy: 0.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -526.376320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.376320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.613699 (E_RNA) where: Base-Base interactions energy: -371.191 where: short stacking energy: -170.414 Base-Backbone interact. energy: -0.597 local terms energy: -154.825253 where: bonds (distance) C4'-P energy: -27.992 bonds (distance) P-C4' energy: -18.714 flat angles C4'-P-C4' energy: -33.421 flat angles P-C4'-P energy: -23.935 tors. eta vs tors. theta energy: -50.763 Dist. restrs. and SS energy: 0.237 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -522.781368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.781368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.827269 (E_RNA) where: Base-Base interactions energy: -367.711 where: short stacking energy: -149.502 Base-Backbone interact. energy: -0.775 local terms energy: -154.341176 where: bonds (distance) C4'-P energy: -31.672 bonds (distance) P-C4' energy: -33.381 flat angles C4'-P-C4' energy: -32.323 flat angles P-C4'-P energy: -15.735 tors. eta vs tors. theta energy: -41.229 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -520.603232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.603232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.763509 (E_RNA) where: Base-Base interactions energy: -378.402 where: short stacking energy: -159.727 Base-Backbone interact. energy: -0.056 local terms energy: -142.304796 where: bonds (distance) C4'-P energy: -19.531 bonds (distance) P-C4' energy: -24.391 flat angles C4'-P-C4' energy: -31.817 flat angles P-C4'-P energy: -21.667 tors. eta vs tors. theta energy: -44.899 Dist. restrs. and SS energy: 0.160 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -485.103746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.103746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.437878 (E_RNA) where: Base-Base interactions energy: -337.906 where: short stacking energy: -141.832 Base-Backbone interact. energy: -0.646 local terms energy: -146.885878 where: bonds (distance) C4'-P energy: -23.610 bonds (distance) P-C4' energy: -27.774 flat angles C4'-P-C4' energy: -29.045 flat angles P-C4'-P energy: -24.273 tors. eta vs tors. theta energy: -42.184 Dist. restrs. and SS energy: 0.334 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -479.430577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.430577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.657442 (E_RNA) where: Base-Base interactions energy: -336.113 where: short stacking energy: -136.330 Base-Backbone interact. energy: -0.339 local terms energy: -143.205042 where: bonds (distance) C4'-P energy: -26.258 bonds (distance) P-C4' energy: -23.437 flat angles C4'-P-C4' energy: -28.118 flat angles P-C4'-P energy: -26.704 tors. eta vs tors. theta energy: -38.688 Dist. restrs. and SS energy: 0.227 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -482.854068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.854068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.973287 (E_RNA) where: Base-Base interactions energy: -343.451 where: short stacking energy: -144.912 Base-Backbone interact. energy: 1.153 local terms energy: -142.674686 where: bonds (distance) C4'-P energy: -29.499 bonds (distance) P-C4' energy: -22.154 flat angles C4'-P-C4' energy: -28.268 flat angles P-C4'-P energy: -21.202 tors. eta vs tors. theta energy: -41.551 Dist. restrs. and SS energy: 2.119 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -421.063460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.063460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.160684 (E_RNA) where: Base-Base interactions energy: -309.853 where: short stacking energy: -124.232 Base-Backbone interact. energy: -0.107 local terms energy: -111.200291 where: bonds (distance) C4'-P energy: -11.990 bonds (distance) P-C4' energy: -22.185 flat angles C4'-P-C4' energy: -26.693 flat angles P-C4'-P energy: -19.212 tors. eta vs tors. theta energy: -31.119 Dist. restrs. and SS energy: 0.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -559.997056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.997056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.100295 (E_RNA) where: Base-Base interactions energy: -395.740 where: short stacking energy: -160.117 Base-Backbone interact. energy: -0.736 local terms energy: -163.624205 where: bonds (distance) C4'-P energy: -28.812 bonds (distance) P-C4' energy: -30.998 flat angles C4'-P-C4' energy: -34.251 flat angles P-C4'-P energy: -27.804 tors. eta vs tors. theta energy: -41.759 Dist. restrs. and SS energy: 0.103 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -550.026950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.026950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.219111 (E_RNA) where: Base-Base interactions energy: -393.451 where: short stacking energy: -162.777 Base-Backbone interact. energy: -0.646 local terms energy: -156.122046 where: bonds (distance) C4'-P energy: -32.187 bonds (distance) P-C4' energy: -26.380 flat angles C4'-P-C4' energy: -33.848 flat angles P-C4'-P energy: -22.234 tors. eta vs tors. theta energy: -41.473 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -542.798045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.798045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.178586 (E_RNA) where: Base-Base interactions energy: -384.932 where: short stacking energy: -164.292 Base-Backbone interact. energy: -0.084 local terms energy: -158.162999 where: bonds (distance) C4'-P energy: -28.714 bonds (distance) P-C4' energy: -23.598 flat angles C4'-P-C4' energy: -33.843 flat angles P-C4'-P energy: -27.989 tors. eta vs tors. theta energy: -44.019 Dist. restrs. and SS energy: 0.381 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -521.857083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.857083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.867038 (E_RNA) where: Base-Base interactions energy: -376.798 where: short stacking energy: -152.773 Base-Backbone interact. energy: -0.762 local terms energy: -144.306691 where: bonds (distance) C4'-P energy: -23.295 bonds (distance) P-C4' energy: -30.058 flat angles C4'-P-C4' energy: -31.354 flat angles P-C4'-P energy: -23.166 tors. eta vs tors. theta energy: -36.433 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -520.312984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.312984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.657568 (E_RNA) where: Base-Base interactions energy: -377.368 where: short stacking energy: -161.966 Base-Backbone interact. energy: -0.096 local terms energy: -143.194197 where: bonds (distance) C4'-P energy: -26.122 bonds (distance) P-C4' energy: -27.130 flat angles C4'-P-C4' energy: -28.550 flat angles P-C4'-P energy: -20.221 tors. eta vs tors. theta energy: -41.172 Dist. restrs. and SS energy: 0.345 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -523.923615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.923615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.206378 (E_RNA) where: Base-Base interactions energy: -371.820 where: short stacking energy: -157.157 Base-Backbone interact. energy: -0.280 local terms energy: -152.106172 where: bonds (distance) C4'-P energy: -27.790 bonds (distance) P-C4' energy: -27.040 flat angles C4'-P-C4' energy: -35.541 flat angles P-C4'-P energy: -19.835 tors. eta vs tors. theta energy: -41.900 Dist. restrs. and SS energy: 0.283 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -499.425913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.425913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.506508 (E_RNA) where: Base-Base interactions energy: -354.560 where: short stacking energy: -151.030 Base-Backbone interact. energy: -0.045 local terms energy: -144.901658 where: bonds (distance) C4'-P energy: -31.225 bonds (distance) P-C4' energy: -24.738 flat angles C4'-P-C4' energy: -31.624 flat angles P-C4'-P energy: -15.897 tors. eta vs tors. theta energy: -41.418 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -477.509627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.509627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.705322 (E_RNA) where: Base-Base interactions energy: -343.468 where: short stacking energy: -139.616 Base-Backbone interact. energy: -0.162 local terms energy: -134.075577 where: bonds (distance) C4'-P energy: -27.094 bonds (distance) P-C4' energy: -22.735 flat angles C4'-P-C4' energy: -27.731 flat angles P-C4'-P energy: -15.774 tors. eta vs tors. theta energy: -40.742 Dist. restrs. and SS energy: 0.196 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -465.037532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.037532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.345286 (E_RNA) where: Base-Base interactions energy: -322.843 where: short stacking energy: -141.443 Base-Backbone interact. energy: -0.846 local terms energy: -141.656376 where: bonds (distance) C4'-P energy: -28.947 bonds (distance) P-C4' energy: -25.619 flat angles C4'-P-C4' energy: -29.865 flat angles P-C4'-P energy: -17.135 tors. eta vs tors. theta energy: -40.090 Dist. restrs. and SS energy: 0.308 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -418.100101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.100101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.206632 (E_RNA) where: Base-Base interactions energy: -290.607 where: short stacking energy: -116.788 Base-Backbone interact. energy: -0.549 local terms energy: -127.051122 where: bonds (distance) C4'-P energy: -26.747 bonds (distance) P-C4' energy: -23.657 flat angles C4'-P-C4' energy: -28.424 flat angles P-C4'-P energy: -17.373 tors. eta vs tors. theta energy: -30.849 Dist. restrs. and SS energy: 0.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -552.860931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.860931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.939679 (E_RNA) where: Base-Base interactions energy: -397.514 where: short stacking energy: -162.851 Base-Backbone interact. energy: -0.136 local terms energy: -155.288943 where: bonds (distance) C4'-P energy: -28.023 bonds (distance) P-C4' energy: -29.080 flat angles C4'-P-C4' energy: -31.318 flat angles P-C4'-P energy: -24.321 tors. eta vs tors. theta energy: -42.547 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -558.869494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.869494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.011387 (E_RNA) where: Base-Base interactions energy: -399.334 where: short stacking energy: -166.423 Base-Backbone interact. energy: -0.483 local terms energy: -159.194691 where: bonds (distance) C4'-P energy: -29.668 bonds (distance) P-C4' energy: -28.857 flat angles C4'-P-C4' energy: -32.253 flat angles P-C4'-P energy: -24.586 tors. eta vs tors. theta energy: -43.832 Dist. restrs. and SS energy: 0.142 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -531.083313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.083313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.137758 (E_RNA) where: Base-Base interactions energy: -385.239 where: short stacking energy: -156.205 Base-Backbone interact. energy: -0.541 local terms energy: -145.358310 where: bonds (distance) C4'-P energy: -26.825 bonds (distance) P-C4' energy: -28.232 flat angles C4'-P-C4' energy: -31.478 flat angles P-C4'-P energy: -21.533 tors. eta vs tors. theta energy: -37.290 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -526.813999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.813999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.983734 (E_RNA) where: Base-Base interactions energy: -364.020 where: short stacking energy: -162.237 Base-Backbone interact. energy: -0.029 local terms energy: -162.934799 where: bonds (distance) C4'-P energy: -32.770 bonds (distance) P-C4' energy: -29.871 flat angles C4'-P-C4' energy: -32.741 flat angles P-C4'-P energy: -23.022 tors. eta vs tors. theta energy: -44.531 Dist. restrs. and SS energy: 0.170 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -524.569212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.569212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.798821 (E_RNA) where: Base-Base interactions energy: -369.991 where: short stacking energy: -153.235 Base-Backbone interact. energy: -0.160 local terms energy: -154.647478 where: bonds (distance) C4'-P energy: -30.294 bonds (distance) P-C4' energy: -25.578 flat angles C4'-P-C4' energy: -33.712 flat angles P-C4'-P energy: -20.712 tors. eta vs tors. theta energy: -44.351 Dist. restrs. and SS energy: 0.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -501.028997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.028997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.386978 (E_RNA) where: Base-Base interactions energy: -366.677 where: short stacking energy: -158.131 Base-Backbone interact. energy: 0.333 local terms energy: -135.042311 where: bonds (distance) C4'-P energy: -20.990 bonds (distance) P-C4' energy: -23.282 flat angles C4'-P-C4' energy: -24.754 flat angles P-C4'-P energy: -22.440 tors. eta vs tors. theta energy: -43.576 Dist. restrs. and SS energy: 0.358 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -466.145629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.145629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.501495 (E_RNA) where: Base-Base interactions energy: -339.112 where: short stacking energy: -140.482 Base-Backbone interact. energy: -0.640 local terms energy: -126.749027 where: bonds (distance) C4'-P energy: -27.073 bonds (distance) P-C4' energy: -25.768 flat angles C4'-P-C4' energy: -23.829 flat angles P-C4'-P energy: -14.180 tors. eta vs tors. theta energy: -35.899 Dist. restrs. and SS energy: 0.356 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -493.474475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.474475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.933463 (E_RNA) where: Base-Base interactions energy: -354.899 where: short stacking energy: -157.655 Base-Backbone interact. energy: -0.066 local terms energy: -138.969061 where: bonds (distance) C4'-P energy: -26.700 bonds (distance) P-C4' energy: -23.220 flat angles C4'-P-C4' energy: -28.367 flat angles P-C4'-P energy: -17.344 tors. eta vs tors. theta energy: -43.337 Dist. restrs. and SS energy: 0.459 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -457.505233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.505233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.692416 (E_RNA) where: Base-Base interactions energy: -326.931 where: short stacking energy: -136.834 Base-Backbone interact. energy: -0.463 local terms energy: -131.297929 where: bonds (distance) C4'-P energy: -28.377 bonds (distance) P-C4' energy: -24.840 flat angles C4'-P-C4' energy: -30.430 flat angles P-C4'-P energy: -14.422 tors. eta vs tors. theta energy: -33.229 Dist. restrs. and SS energy: 1.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -437.041952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.041952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.272309 (E_RNA) where: Base-Base interactions energy: -321.379 where: short stacking energy: -126.324 Base-Backbone interact. energy: -0.983 local terms energy: -119.910783 where: bonds (distance) C4'-P energy: -24.360 bonds (distance) P-C4' energy: -29.623 flat angles C4'-P-C4' energy: -25.248 flat angles P-C4'-P energy: -7.164 tors. eta vs tors. theta energy: -33.516 Dist. restrs. and SS energy: 5.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -553.133286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.133286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.184682 (E_RNA) where: Base-Base interactions energy: -389.127 where: short stacking energy: -159.890 Base-Backbone interact. energy: -0.693 local terms energy: -163.364904 where: bonds (distance) C4'-P energy: -28.253 bonds (distance) P-C4' energy: -30.717 flat angles C4'-P-C4' energy: -35.516 flat angles P-C4'-P energy: -28.318 tors. eta vs tors. theta energy: -40.560 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -556.128280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.128280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.495029 (E_RNA) where: Base-Base interactions energy: -394.123 where: short stacking energy: -166.673 Base-Backbone interact. energy: -1.057 local terms energy: -161.315249 where: bonds (distance) C4'-P energy: -26.561 bonds (distance) P-C4' energy: -29.843 flat angles C4'-P-C4' energy: -36.364 flat angles P-C4'-P energy: -24.366 tors. eta vs tors. theta energy: -44.180 Dist. restrs. and SS energy: 0.367 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -525.370872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.370872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.561602 (E_RNA) where: Base-Base interactions energy: -378.416 where: short stacking energy: -154.089 Base-Backbone interact. energy: -0.333 local terms energy: -146.812506 where: bonds (distance) C4'-P energy: -23.125 bonds (distance) P-C4' energy: -29.406 flat angles C4'-P-C4' energy: -30.251 flat angles P-C4'-P energy: -22.554 tors. eta vs tors. theta energy: -41.477 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -537.005244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.005244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.078147 (E_RNA) where: Base-Base interactions energy: -396.129 where: short stacking energy: -157.450 Base-Backbone interact. energy: -0.216 local terms energy: -140.733099 where: bonds (distance) C4'-P energy: -26.759 bonds (distance) P-C4' energy: -21.261 flat angles C4'-P-C4' energy: -25.029 flat angles P-C4'-P energy: -25.328 tors. eta vs tors. theta energy: -42.356 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -521.991671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.991671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.466856 (E_RNA) where: Base-Base interactions energy: -368.289 where: short stacking energy: -162.708 Base-Backbone interact. energy: 0.720 local terms energy: -154.898468 where: bonds (distance) C4'-P energy: -26.461 bonds (distance) P-C4' energy: -29.453 flat angles C4'-P-C4' energy: -31.427 flat angles P-C4'-P energy: -21.559 tors. eta vs tors. theta energy: -45.999 Dist. restrs. and SS energy: 0.475 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -483.269720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.269720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.658730 (E_RNA) where: Base-Base interactions energy: -341.945 where: short stacking energy: -159.478 Base-Backbone interact. energy: -0.137 local terms energy: -144.576675 where: bonds (distance) C4'-P energy: -21.818 bonds (distance) P-C4' energy: -23.538 flat angles C4'-P-C4' energy: -33.383 flat angles P-C4'-P energy: -21.842 tors. eta vs tors. theta energy: -43.996 Dist. restrs. and SS energy: 3.389 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -499.756805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.756805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.135892 (E_RNA) where: Base-Base interactions energy: -369.639 where: short stacking energy: -161.330 Base-Backbone interact. energy: -0.851 local terms energy: -129.645258 where: bonds (distance) C4'-P energy: -23.853 bonds (distance) P-C4' energy: -12.322 flat angles C4'-P-C4' energy: -29.095 flat angles P-C4'-P energy: -18.614 tors. eta vs tors. theta energy: -45.762 Dist. restrs. and SS energy: 0.379 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -483.676993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.676993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.028357 (E_RNA) where: Base-Base interactions energy: -353.103 where: short stacking energy: -158.821 Base-Backbone interact. energy: -0.208 local terms energy: -130.717156 where: bonds (distance) C4'-P energy: -29.884 bonds (distance) P-C4' energy: -19.603 flat angles C4'-P-C4' energy: -23.888 flat angles P-C4'-P energy: -11.396 tors. eta vs tors. theta energy: -45.948 Dist. restrs. and SS energy: 0.351 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -471.955004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.955004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.195220 (E_RNA) where: Base-Base interactions energy: -349.429 where: short stacking energy: -142.817 Base-Backbone interact. energy: -0.137 local terms energy: -123.629038 where: bonds (distance) C4'-P energy: -14.865 bonds (distance) P-C4' energy: -20.492 flat angles C4'-P-C4' energy: -29.594 flat angles P-C4'-P energy: -18.872 tors. eta vs tors. theta energy: -39.806 Dist. restrs. and SS energy: 1.240 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -467.185743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.185743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.274837 (E_RNA) where: Base-Base interactions energy: -346.571 where: short stacking energy: -148.660 Base-Backbone interact. energy: -0.863 local terms energy: -123.840333 where: bonds (distance) C4'-P energy: -17.717 bonds (distance) P-C4' energy: -22.259 flat angles C4'-P-C4' energy: -25.759 flat angles P-C4'-P energy: -17.479 tors. eta vs tors. theta energy: -40.627 Dist. restrs. and SS energy: 4.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -542.417320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.417320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.544847 (E_RNA) where: Base-Base interactions energy: -381.908 where: short stacking energy: -160.170 Base-Backbone interact. energy: -0.154 local terms energy: -160.483037 where: bonds (distance) C4'-P energy: -29.691 bonds (distance) P-C4' energy: -33.366 flat angles C4'-P-C4' energy: -33.157 flat angles P-C4'-P energy: -22.925 tors. eta vs tors. theta energy: -41.344 Dist. restrs. and SS energy: 0.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -545.649651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.649651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.791438 (E_RNA) where: Base-Base interactions energy: -395.949 where: short stacking energy: -161.851 Base-Backbone interact. energy: -0.328 local terms energy: -149.514466 where: bonds (distance) C4'-P energy: -25.703 bonds (distance) P-C4' energy: -24.373 flat angles C4'-P-C4' energy: -29.534 flat angles P-C4'-P energy: -25.556 tors. eta vs tors. theta energy: -44.348 Dist. restrs. and SS energy: 0.142 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -532.770865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.770865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.089773 (E_RNA) where: Base-Base interactions energy: -384.502 where: short stacking energy: -153.185 Base-Backbone interact. energy: 0.102 local terms energy: -148.689101 where: bonds (distance) C4'-P energy: -22.906 bonds (distance) P-C4' energy: -30.607 flat angles C4'-P-C4' energy: -33.577 flat angles P-C4'-P energy: -23.742 tors. eta vs tors. theta energy: -37.857 Dist. restrs. and SS energy: 0.319 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -543.374921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.374921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.442450 (E_RNA) where: Base-Base interactions energy: -386.192 where: short stacking energy: -152.872 Base-Backbone interact. energy: -1.033 local terms energy: -156.217506 where: bonds (distance) C4'-P energy: -25.731 bonds (distance) P-C4' energy: -35.843 flat angles C4'-P-C4' energy: -28.610 flat angles P-C4'-P energy: -23.229 tors. eta vs tors. theta energy: -42.804 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -519.714358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.714358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.906093 (E_RNA) where: Base-Base interactions energy: -375.364 where: short stacking energy: -165.962 Base-Backbone interact. energy: -0.505 local terms energy: -144.037115 where: bonds (distance) C4'-P energy: -22.415 bonds (distance) P-C4' energy: -27.414 flat angles C4'-P-C4' energy: -32.920 flat angles P-C4'-P energy: -20.737 tors. eta vs tors. theta energy: -40.551 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -496.172646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.172646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.432093 (E_RNA) where: Base-Base interactions energy: -359.539 where: short stacking energy: -158.109 Base-Backbone interact. energy: -0.844 local terms energy: -136.049599 where: bonds (distance) C4'-P energy: -23.923 bonds (distance) P-C4' energy: -19.536 flat angles C4'-P-C4' energy: -30.792 flat angles P-C4'-P energy: -21.672 tors. eta vs tors. theta energy: -40.126 Dist. restrs. and SS energy: 0.259 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -494.599631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.599631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.760998 (E_RNA) where: Base-Base interactions energy: -356.473 where: short stacking energy: -153.739 Base-Backbone interact. energy: -0.163 local terms energy: -138.124591 where: bonds (distance) C4'-P energy: -20.250 bonds (distance) P-C4' energy: -20.812 flat angles C4'-P-C4' energy: -31.120 flat angles P-C4'-P energy: -23.192 tors. eta vs tors. theta energy: -42.750 Dist. restrs. and SS energy: 0.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -513.804732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.804732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.082995 (E_RNA) where: Base-Base interactions energy: -369.984 where: short stacking energy: -160.982 Base-Backbone interact. energy: -0.501 local terms energy: -143.597759 where: bonds (distance) C4'-P energy: -23.436 bonds (distance) P-C4' energy: -30.315 flat angles C4'-P-C4' energy: -28.271 flat angles P-C4'-P energy: -19.945 tors. eta vs tors. theta energy: -41.630 Dist. restrs. and SS energy: 0.278 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -479.935100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.935100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.084606 (E_RNA) where: Base-Base interactions energy: -341.946 where: short stacking energy: -139.953 Base-Backbone interact. energy: -1.610 local terms energy: -137.528367 where: bonds (distance) C4'-P energy: -26.395 bonds (distance) P-C4' energy: -24.238 flat angles C4'-P-C4' energy: -31.577 flat angles P-C4'-P energy: -13.626 tors. eta vs tors. theta energy: -41.693 Dist. restrs. and SS energy: 1.150 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -419.152760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.152760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.821686 (E_RNA) where: Base-Base interactions energy: -310.984 where: short stacking energy: -130.438 Base-Backbone interact. energy: -0.284 local terms energy: -109.553654 where: bonds (distance) C4'-P energy: -16.253 bonds (distance) P-C4' energy: -18.847 flat angles C4'-P-C4' energy: -30.673 flat angles P-C4'-P energy: -14.507 tors. eta vs tors. theta energy: -29.273 Dist. restrs. and SS energy: 1.669 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -546.723820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.723820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.886052 (E_RNA) where: Base-Base interactions energy: -400.991 where: short stacking energy: -166.053 Base-Backbone interact. energy: 1.647 local terms energy: -147.541882 where: bonds (distance) C4'-P energy: -23.323 bonds (distance) P-C4' energy: -32.479 flat angles C4'-P-C4' energy: -25.284 flat angles P-C4'-P energy: -22.899 tors. eta vs tors. theta energy: -43.556 Dist. restrs. and SS energy: 0.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -545.781609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.781609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.972115 (E_RNA) where: Base-Base interactions energy: -399.259 where: short stacking energy: -153.508 Base-Backbone interact. energy: 0.465 local terms energy: -147.177578 where: bonds (distance) C4'-P energy: -29.637 bonds (distance) P-C4' energy: -29.231 flat angles C4'-P-C4' energy: -27.552 flat angles P-C4'-P energy: -24.304 tors. eta vs tors. theta energy: -36.454 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -545.411630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.411630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.499321 (E_RNA) where: Base-Base interactions energy: -396.316 where: short stacking energy: -159.489 Base-Backbone interact. energy: -0.362 local terms energy: -148.821766 where: bonds (distance) C4'-P energy: -23.108 bonds (distance) P-C4' energy: -28.733 flat angles C4'-P-C4' energy: -33.325 flat angles P-C4'-P energy: -20.928 tors. eta vs tors. theta energy: -42.729 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -521.017719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.017719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.552743 (E_RNA) where: Base-Base interactions energy: -372.773 where: short stacking energy: -154.315 Base-Backbone interact. energy: -0.357 local terms energy: -148.423451 where: bonds (distance) C4'-P energy: -20.669 bonds (distance) P-C4' energy: -29.548 flat angles C4'-P-C4' energy: -31.569 flat angles P-C4'-P energy: -24.895 tors. eta vs tors. theta energy: -41.743 Dist. restrs. and SS energy: 0.535 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -515.640268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.640268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.335232 (E_RNA) where: Base-Base interactions energy: -371.749 where: short stacking energy: -163.701 Base-Backbone interact. energy: -1.066 local terms energy: -143.520014 where: bonds (distance) C4'-P energy: -26.499 bonds (distance) P-C4' energy: -22.152 flat angles C4'-P-C4' energy: -29.375 flat angles P-C4'-P energy: -20.139 tors. eta vs tors. theta energy: -45.355 Dist. restrs. and SS energy: 0.695 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -500.860623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.860623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.306863 (E_RNA) where: Base-Base interactions energy: -360.184 where: short stacking energy: -150.529 Base-Backbone interact. energy: -0.649 local terms energy: -141.474058 where: bonds (distance) C4'-P energy: -29.952 bonds (distance) P-C4' energy: -26.694 flat angles C4'-P-C4' energy: -29.862 flat angles P-C4'-P energy: -12.987 tors. eta vs tors. theta energy: -41.979 Dist. restrs. and SS energy: 1.446 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -500.466906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.466906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.628037 (E_RNA) where: Base-Base interactions energy: -366.523 where: short stacking energy: -153.535 Base-Backbone interact. energy: -0.400 local terms energy: -135.705501 where: bonds (distance) C4'-P energy: -23.447 bonds (distance) P-C4' energy: -19.991 flat angles C4'-P-C4' energy: -27.594 flat angles P-C4'-P energy: -21.749 tors. eta vs tors. theta energy: -42.924 Dist. restrs. and SS energy: 2.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -491.893480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.893480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.657919 (E_RNA) where: Base-Base interactions energy: -346.651 where: short stacking energy: -150.206 Base-Backbone interact. energy: -0.016 local terms energy: -146.989986 where: bonds (distance) C4'-P energy: -20.305 bonds (distance) P-C4' energy: -26.613 flat angles C4'-P-C4' energy: -30.266 flat angles P-C4'-P energy: -25.741 tors. eta vs tors. theta energy: -44.065 Dist. restrs. and SS energy: 1.764 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -451.671073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.671073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.160705 (E_RNA) where: Base-Base interactions energy: -321.880 where: short stacking energy: -137.210 Base-Backbone interact. energy: 0.621 local terms energy: -130.901664 where: bonds (distance) C4'-P energy: -21.839 bonds (distance) P-C4' energy: -21.446 flat angles C4'-P-C4' energy: -26.801 flat angles P-C4'-P energy: -21.048 tors. eta vs tors. theta energy: -39.768 Dist. restrs. and SS energy: 0.490 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -403.432502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.432502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.108467 (E_RNA) where: Base-Base interactions energy: -281.937 where: short stacking energy: -114.221 Base-Backbone interact. energy: -0.247 local terms energy: -121.924794 where: bonds (distance) C4'-P energy: -27.226 bonds (distance) P-C4' energy: -20.168 flat angles C4'-P-C4' energy: -27.676 flat angles P-C4'-P energy: -14.772 tors. eta vs tors. theta energy: -32.082 Dist. restrs. and SS energy: 0.676 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -560.807837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.807837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.854778 (E_RNA) where: Base-Base interactions energy: -405.356 where: short stacking energy: -165.627 Base-Backbone interact. energy: -1.302 local terms energy: -154.196548 where: bonds (distance) C4'-P energy: -28.037 bonds (distance) P-C4' energy: -26.240 flat angles C4'-P-C4' energy: -35.292 flat angles P-C4'-P energy: -21.723 tors. eta vs tors. theta energy: -42.903 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -534.756168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.756168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.024816 (E_RNA) where: Base-Base interactions energy: -388.653 where: short stacking energy: -146.904 Base-Backbone interact. energy: 0.018 local terms energy: -146.389999 where: bonds (distance) C4'-P energy: -29.689 bonds (distance) P-C4' energy: -30.933 flat angles C4'-P-C4' energy: -31.223 flat angles P-C4'-P energy: -17.290 tors. eta vs tors. theta energy: -37.256 Dist. restrs. and SS energy: 0.269 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -532.043173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.043173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.346985 (E_RNA) where: Base-Base interactions energy: -379.384 where: short stacking energy: -151.639 Base-Backbone interact. energy: -0.726 local terms energy: -152.236730 where: bonds (distance) C4'-P energy: -27.239 bonds (distance) P-C4' energy: -30.149 flat angles C4'-P-C4' energy: -28.531 flat angles P-C4'-P energy: -24.197 tors. eta vs tors. theta energy: -42.121 Dist. restrs. and SS energy: 0.304 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -524.109955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.109955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.266473 (E_RNA) where: Base-Base interactions energy: -385.814 where: short stacking energy: -156.003 Base-Backbone interact. energy: -1.003 local terms energy: -137.449058 where: bonds (distance) C4'-P energy: -15.407 bonds (distance) P-C4' energy: -29.676 flat angles C4'-P-C4' energy: -30.460 flat angles P-C4'-P energy: -20.869 tors. eta vs tors. theta energy: -41.038 Dist. restrs. and SS energy: 0.157 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -518.692381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.692381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.135599 (E_RNA) where: Base-Base interactions energy: -374.866 where: short stacking energy: -160.458 Base-Backbone interact. energy: -0.161 local terms energy: -144.108630 where: bonds (distance) C4'-P energy: -27.966 bonds (distance) P-C4' energy: -27.641 flat angles C4'-P-C4' energy: -27.209 flat angles P-C4'-P energy: -15.647 tors. eta vs tors. theta energy: -45.646 Dist. restrs. and SS energy: 0.443 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -508.035932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.035932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.410269 (E_RNA) where: Base-Base interactions energy: -367.459 where: short stacking energy: -156.640 Base-Backbone interact. energy: -0.618 local terms energy: -143.334050 where: bonds (distance) C4'-P energy: -25.948 bonds (distance) P-C4' energy: -27.497 flat angles C4'-P-C4' energy: -29.451 flat angles P-C4'-P energy: -20.438 tors. eta vs tors. theta energy: -40.001 Dist. restrs. and SS energy: 3.374 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -478.264210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.264210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.665479 (E_RNA) where: Base-Base interactions energy: -337.157 where: short stacking energy: -151.089 Base-Backbone interact. energy: -0.223 local terms energy: -141.285998 where: bonds (distance) C4'-P energy: -27.835 bonds (distance) P-C4' energy: -28.062 flat angles C4'-P-C4' energy: -32.765 flat angles P-C4'-P energy: -14.969 tors. eta vs tors. theta energy: -37.655 Dist. restrs. and SS energy: 0.401 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -477.701261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.701261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.966235 (E_RNA) where: Base-Base interactions energy: -339.972 where: short stacking energy: -143.766 Base-Backbone interact. energy: -0.013 local terms energy: -137.980362 where: bonds (distance) C4'-P energy: -25.203 bonds (distance) P-C4' energy: -28.783 flat angles C4'-P-C4' energy: -27.822 flat angles P-C4'-P energy: -18.953 tors. eta vs tors. theta energy: -37.219 Dist. restrs. and SS energy: 0.265 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -417.923123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.923123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.223237 (E_RNA) where: Base-Base interactions energy: -308.874 where: short stacking energy: -124.769 Base-Backbone interact. energy: -0.479 local terms energy: -108.870443 where: bonds (distance) C4'-P energy: -16.764 bonds (distance) P-C4' energy: -20.168 flat angles C4'-P-C4' energy: -24.676 flat angles P-C4'-P energy: -14.347 tors. eta vs tors. theta energy: -32.915 Dist. restrs. and SS energy: 0.300 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -441.926567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.926567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.305257 (E_RNA) where: Base-Base interactions energy: -308.166 where: short stacking energy: -122.417 Base-Backbone interact. energy: -2.100 local terms energy: -132.040049 where: bonds (distance) C4'-P energy: -20.321 bonds (distance) P-C4' energy: -25.800 flat angles C4'-P-C4' energy: -30.697 flat angles P-C4'-P energy: -18.498 tors. eta vs tors. theta energy: -36.723 Dist. restrs. and SS energy: 0.379 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -557.055963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.055963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.163557 (E_RNA) where: Base-Base interactions energy: -395.461 where: short stacking energy: -163.621 Base-Backbone interact. energy: -0.688 local terms energy: -161.014784 where: bonds (distance) C4'-P energy: -30.651 bonds (distance) P-C4' energy: -31.485 flat angles C4'-P-C4' energy: -35.227 flat angles P-C4'-P energy: -21.024 tors. eta vs tors. theta energy: -42.628 Dist. restrs. and SS energy: 0.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -541.834490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.834490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.890256 (E_RNA) where: Base-Base interactions energy: -398.108 where: short stacking energy: -160.681 Base-Backbone interact. energy: -0.347 local terms energy: -143.435427 where: bonds (distance) C4'-P energy: -21.026 bonds (distance) P-C4' energy: -27.897 flat angles C4'-P-C4' energy: -31.346 flat angles P-C4'-P energy: -21.595 tors. eta vs tors. theta energy: -41.573 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -523.342740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.342740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.396499 (E_RNA) where: Base-Base interactions energy: -376.085 where: short stacking energy: -155.414 Base-Backbone interact. energy: -0.353 local terms energy: -146.958574 where: bonds (distance) C4'-P energy: -27.815 bonds (distance) P-C4' energy: -28.986 flat angles C4'-P-C4' energy: -34.561 flat angles P-C4'-P energy: -16.069 tors. eta vs tors. theta energy: -39.528 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -530.874382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.874382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.975422 (E_RNA) where: Base-Base interactions energy: -382.860 where: short stacking energy: -151.942 Base-Backbone interact. energy: -0.304 local terms energy: -147.811200 where: bonds (distance) C4'-P energy: -25.340 bonds (distance) P-C4' energy: -28.383 flat angles C4'-P-C4' energy: -33.082 flat angles P-C4'-P energy: -25.153 tors. eta vs tors. theta energy: -35.854 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -518.414921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.414921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.553659 (E_RNA) where: Base-Base interactions energy: -369.687 where: short stacking energy: -159.422 Base-Backbone interact. energy: -0.347 local terms energy: -148.519576 where: bonds (distance) C4'-P energy: -20.920 bonds (distance) P-C4' energy: -31.341 flat angles C4'-P-C4' energy: -32.682 flat angles P-C4'-P energy: -18.736 tors. eta vs tors. theta energy: -44.840 Dist. restrs. and SS energy: 0.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -497.378934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.378934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.925995 (E_RNA) where: Base-Base interactions energy: -366.046 where: short stacking energy: -155.929 Base-Backbone interact. energy: -0.138 local terms energy: -131.742150 where: bonds (distance) C4'-P energy: -24.557 bonds (distance) P-C4' energy: -21.071 flat angles C4'-P-C4' energy: -28.230 flat angles P-C4'-P energy: -18.223 tors. eta vs tors. theta energy: -39.661 Dist. restrs. and SS energy: 0.547 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -489.150670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.150670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.765123 (E_RNA) where: Base-Base interactions energy: -361.229 where: short stacking energy: -156.442 Base-Backbone interact. energy: -0.051 local terms energy: -131.485476 where: bonds (distance) C4'-P energy: -11.767 bonds (distance) P-C4' energy: -33.560 flat angles C4'-P-C4' energy: -26.191 flat angles P-C4'-P energy: -22.064 tors. eta vs tors. theta energy: -37.904 Dist. restrs. and SS energy: 3.614 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -474.061307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.061307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.506029 (E_RNA) where: Base-Base interactions energy: -338.996 where: short stacking energy: -136.960 Base-Backbone interact. energy: -0.315 local terms energy: -135.195058 where: bonds (distance) C4'-P energy: -28.551 bonds (distance) P-C4' energy: -26.425 flat angles C4'-P-C4' energy: -23.146 flat angles P-C4'-P energy: -20.922 tors. eta vs tors. theta energy: -36.152 Dist. restrs. and SS energy: 0.445 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -468.705669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.705669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.193247 (E_RNA) where: Base-Base interactions energy: -329.446 where: short stacking energy: -140.938 Base-Backbone interact. energy: -0.148 local terms energy: -139.599626 where: bonds (distance) C4'-P energy: -24.093 bonds (distance) P-C4' energy: -27.086 flat angles C4'-P-C4' energy: -28.347 flat angles P-C4'-P energy: -22.138 tors. eta vs tors. theta energy: -37.935 Dist. restrs. and SS energy: 0.488 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -439.338641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.338641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.490683 (E_RNA) where: Base-Base interactions energy: -329.361 where: short stacking energy: -133.586 Base-Backbone interact. energy: -0.147 local terms energy: -112.982651 where: bonds (distance) C4'-P energy: -16.340 bonds (distance) P-C4' energy: -23.747 flat angles C4'-P-C4' energy: -25.427 flat angles P-C4'-P energy: -15.899 tors. eta vs tors. theta energy: -31.568 Dist. restrs. and SS energy: 3.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -557.634684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.634684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.825752 (E_RNA) where: Base-Base interactions energy: -403.529 where: short stacking energy: -166.846 Base-Backbone interact. energy: -0.200 local terms energy: -154.096989 where: bonds (distance) C4'-P energy: -27.963 bonds (distance) P-C4' energy: -28.674 flat angles C4'-P-C4' energy: -34.088 flat angles P-C4'-P energy: -22.931 tors. eta vs tors. theta energy: -40.440 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -545.649008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.649008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.816238 (E_RNA) where: Base-Base interactions energy: -393.870 where: short stacking energy: -161.367 Base-Backbone interact. energy: -1.328 local terms energy: -150.618186 where: bonds (distance) C4'-P energy: -29.023 bonds (distance) P-C4' energy: -23.236 flat angles C4'-P-C4' energy: -31.579 flat angles P-C4'-P energy: -24.023 tors. eta vs tors. theta energy: -42.758 Dist. restrs. and SS energy: 0.167 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -534.681297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.681297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.970198 (E_RNA) where: Base-Base interactions energy: -377.680 where: short stacking energy: -167.948 Base-Backbone interact. energy: -0.079 local terms energy: -157.211460 where: bonds (distance) C4'-P energy: -26.325 bonds (distance) P-C4' energy: -31.319 flat angles C4'-P-C4' energy: -32.978 flat angles P-C4'-P energy: -21.650 tors. eta vs tors. theta energy: -44.938 Dist. restrs. and SS energy: 0.289 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -521.145804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.145804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.246553 (E_RNA) where: Base-Base interactions energy: -384.888 where: short stacking energy: -156.400 Base-Backbone interact. energy: 3.142 local terms energy: -139.500799 where: bonds (distance) C4'-P energy: -31.127 bonds (distance) P-C4' energy: -22.952 flat angles C4'-P-C4' energy: -29.788 flat angles P-C4'-P energy: -15.488 tors. eta vs tors. theta energy: -40.146 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -506.844286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.844286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.996549 (E_RNA) where: Base-Base interactions energy: -365.784 where: short stacking energy: -156.659 Base-Backbone interact. energy: -0.075 local terms energy: -143.137564 where: bonds (distance) C4'-P energy: -25.793 bonds (distance) P-C4' energy: -18.721 flat angles C4'-P-C4' energy: -33.997 flat angles P-C4'-P energy: -16.071 tors. eta vs tors. theta energy: -48.555 Dist. restrs. and SS energy: 2.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -513.023101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.023101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.197486 (E_RNA) where: Base-Base interactions energy: -373.738 where: short stacking energy: -158.203 Base-Backbone interact. energy: 0.225 local terms energy: -139.684892 where: bonds (distance) C4'-P energy: -19.093 bonds (distance) P-C4' energy: -28.675 flat angles C4'-P-C4' energy: -30.604 flat angles P-C4'-P energy: -22.527 tors. eta vs tors. theta energy: -38.786 Dist. restrs. and SS energy: 0.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -489.224724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.224724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.632451 (E_RNA) where: Base-Base interactions energy: -368.825 where: short stacking energy: -154.615 Base-Backbone interact. energy: -0.752 local terms energy: -120.055468 where: bonds (distance) C4'-P energy: -26.473 bonds (distance) P-C4' energy: -18.295 flat angles C4'-P-C4' energy: -26.263 flat angles P-C4'-P energy: -10.544 tors. eta vs tors. theta energy: -38.480 Dist. restrs. and SS energy: 0.408 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -482.905462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.905462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.162214 (E_RNA) where: Base-Base interactions energy: -338.206 where: short stacking energy: -140.081 Base-Backbone interact. energy: -1.146 local terms energy: -143.810174 where: bonds (distance) C4'-P energy: -30.066 bonds (distance) P-C4' energy: -28.544 flat angles C4'-P-C4' energy: -29.010 flat angles P-C4'-P energy: -20.128 tors. eta vs tors. theta energy: -36.062 Dist. restrs. and SS energy: 0.257 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -453.168302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.168302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.490211 (E_RNA) where: Base-Base interactions energy: -331.914 where: short stacking energy: -129.479 Base-Backbone interact. energy: -0.539 local terms energy: -121.037493 where: bonds (distance) C4'-P energy: -23.919 bonds (distance) P-C4' energy: -19.908 flat angles C4'-P-C4' energy: -26.268 flat angles P-C4'-P energy: -18.286 tors. eta vs tors. theta energy: -32.656 Dist. restrs. and SS energy: 0.322 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -440.671133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.671133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.448935 (E_RNA) where: Base-Base interactions energy: -328.884 where: short stacking energy: -136.318 Base-Backbone interact. energy: -0.060 local terms energy: -112.504867 where: bonds (distance) C4'-P energy: -15.770 bonds (distance) P-C4' energy: -14.706 flat angles C4'-P-C4' energy: -29.218 flat angles P-C4'-P energy: -14.342 tors. eta vs tors. theta energy: -38.470 Dist. restrs. and SS energy: 0.778 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -561.494813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.494813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.529877 (E_RNA) where: Base-Base interactions energy: -407.889 where: short stacking energy: -163.268 Base-Backbone interact. energy: -0.338 local terms energy: -153.303186 where: bonds (distance) C4'-P energy: -29.217 bonds (distance) P-C4' energy: -24.319 flat angles C4'-P-C4' energy: -32.773 flat angles P-C4'-P energy: -25.130 tors. eta vs tors. theta energy: -41.864 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -532.005711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.005711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.095669 (E_RNA) where: Base-Base interactions energy: -376.986 where: short stacking energy: -162.850 Base-Backbone interact. energy: -0.685 local terms energy: -154.424490 where: bonds (distance) C4'-P energy: -29.777 bonds (distance) P-C4' energy: -24.765 flat angles C4'-P-C4' energy: -31.237 flat angles P-C4'-P energy: -27.162 tors. eta vs tors. theta energy: -41.483 Dist. restrs. and SS energy: 0.090 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -543.544876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.544876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.544876 (E_RNA) where: Base-Base interactions energy: -385.840 where: short stacking energy: -159.390 Base-Backbone interact. energy: -0.394 local terms energy: -157.310801 where: bonds (distance) C4'-P energy: -29.850 bonds (distance) P-C4' energy: -28.892 flat angles C4'-P-C4' energy: -32.981 flat angles P-C4'-P energy: -22.489 tors. eta vs tors. theta energy: -43.100 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -516.678440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.678440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.951483 (E_RNA) where: Base-Base interactions energy: -373.254 where: short stacking energy: -155.617 Base-Backbone interact. energy: -0.718 local terms energy: -145.979995 where: bonds (distance) C4'-P energy: -29.511 bonds (distance) P-C4' energy: -22.880 flat angles C4'-P-C4' energy: -30.990 flat angles P-C4'-P energy: -20.345 tors. eta vs tors. theta energy: -42.253 Dist. restrs. and SS energy: 3.273 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -512.926849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.926849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.170161 (E_RNA) where: Base-Base interactions energy: -377.341 where: short stacking energy: -154.116 Base-Backbone interact. energy: -0.710 local terms energy: -135.118814 where: bonds (distance) C4'-P energy: -25.634 bonds (distance) P-C4' energy: -25.010 flat angles C4'-P-C4' energy: -28.818 flat angles P-C4'-P energy: -19.297 tors. eta vs tors. theta energy: -36.359 Dist. restrs. and SS energy: 0.243 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -506.906233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.906233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.236772 (E_RNA) where: Base-Base interactions energy: -352.255 where: short stacking energy: -156.649 Base-Backbone interact. energy: -0.655 local terms energy: -154.327494 where: bonds (distance) C4'-P energy: -29.399 bonds (distance) P-C4' energy: -26.018 flat angles C4'-P-C4' energy: -33.758 flat angles P-C4'-P energy: -21.763 tors. eta vs tors. theta energy: -43.390 Dist. restrs. and SS energy: 0.331 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -514.596595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.596595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.927271 (E_RNA) where: Base-Base interactions energy: -385.147 where: short stacking energy: -156.399 Base-Backbone interact. energy: -0.502 local terms energy: -129.277715 where: bonds (distance) C4'-P energy: -23.438 bonds (distance) P-C4' energy: -13.392 flat angles C4'-P-C4' energy: -29.523 flat angles P-C4'-P energy: -19.340 tors. eta vs tors. theta energy: -43.585 Dist. restrs. and SS energy: 0.331 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -477.425886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.425886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.790673 (E_RNA) where: Base-Base interactions energy: -349.426 where: short stacking energy: -154.128 Base-Backbone interact. energy: -0.157 local terms energy: -128.208124 where: bonds (distance) C4'-P energy: -13.796 bonds (distance) P-C4' energy: -22.703 flat angles C4'-P-C4' energy: -28.233 flat angles P-C4'-P energy: -18.548 tors. eta vs tors. theta energy: -44.928 Dist. restrs. and SS energy: 0.365 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -444.493617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.493617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.651003 (E_RNA) where: Base-Base interactions energy: -324.822 where: short stacking energy: -138.253 Base-Backbone interact. energy: -0.756 local terms energy: -119.073693 where: bonds (distance) C4'-P energy: -17.186 bonds (distance) P-C4' energy: -21.152 flat angles C4'-P-C4' energy: -24.258 flat angles P-C4'-P energy: -17.373 tors. eta vs tors. theta energy: -39.105 Dist. restrs. and SS energy: 0.157 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -457.023822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.023822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.691483 (E_RNA) where: Base-Base interactions energy: -337.769 where: short stacking energy: -138.250 Base-Backbone interact. energy: -0.734 local terms energy: -121.188265 where: bonds (distance) C4'-P energy: -25.023 bonds (distance) P-C4' energy: -15.980 flat angles C4'-P-C4' energy: -23.237 flat angles P-C4'-P energy: -16.081 tors. eta vs tors. theta energy: -40.867 Dist. restrs. and SS energy: 2.668 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -565.752878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.752878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.956798 (E_RNA) where: Base-Base interactions energy: -410.555 where: short stacking energy: -164.013 Base-Backbone interact. energy: -0.612 local terms energy: -154.790148 where: bonds (distance) C4'-P energy: -29.694 bonds (distance) P-C4' energy: -32.054 flat angles C4'-P-C4' energy: -30.539 flat angles P-C4'-P energy: -21.133 tors. eta vs tors. theta energy: -41.370 Dist. restrs. and SS energy: 0.204 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -543.979267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.979267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.082965 (E_RNA) where: Base-Base interactions energy: -391.037 where: short stacking energy: -160.227 Base-Backbone interact. energy: -0.963 local terms energy: -152.082639 where: bonds (distance) C4'-P energy: -26.415 bonds (distance) P-C4' energy: -30.497 flat angles C4'-P-C4' energy: -33.099 flat angles P-C4'-P energy: -20.867 tors. eta vs tors. theta energy: -41.205 Dist. restrs. and SS energy: 0.104 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -525.488412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.488412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.381800 (E_RNA) where: Base-Base interactions energy: -380.078 where: short stacking energy: -157.312 Base-Backbone interact. energy: -0.274 local terms energy: -149.030516 where: bonds (distance) C4'-P energy: -26.620 bonds (distance) P-C4' energy: -21.333 flat angles C4'-P-C4' energy: -34.683 flat angles P-C4'-P energy: -26.972 tors. eta vs tors. theta energy: -39.423 Dist. restrs. and SS energy: 3.893 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -532.806220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.806220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.854139 (E_RNA) where: Base-Base interactions energy: -385.518 where: short stacking energy: -162.863 Base-Backbone interact. energy: -0.680 local terms energy: -146.656406 where: bonds (distance) C4'-P energy: -20.862 bonds (distance) P-C4' energy: -29.300 flat angles C4'-P-C4' energy: -29.554 flat angles P-C4'-P energy: -24.415 tors. eta vs tors. theta energy: -42.525 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -524.410450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.410450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.475047 (E_RNA) where: Base-Base interactions energy: -371.195 where: short stacking energy: -146.902 Base-Backbone interact. energy: -1.152 local terms energy: -152.127959 where: bonds (distance) C4'-P energy: -25.716 bonds (distance) P-C4' energy: -31.844 flat angles C4'-P-C4' energy: -32.038 flat angles P-C4'-P energy: -21.135 tors. eta vs tors. theta energy: -41.395 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -495.329141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.329141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.630652 (E_RNA) where: Base-Base interactions energy: -361.347 where: short stacking energy: -152.179 Base-Backbone interact. energy: -0.995 local terms energy: -133.288309 where: bonds (distance) C4'-P energy: -26.360 bonds (distance) P-C4' energy: -25.953 flat angles C4'-P-C4' energy: -30.193 flat angles P-C4'-P energy: -16.721 tors. eta vs tors. theta energy: -34.061 Dist. restrs. and SS energy: 0.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -503.831979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.831979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.145217 (E_RNA) where: Base-Base interactions energy: -364.063 where: short stacking energy: -152.006 Base-Backbone interact. energy: -0.743 local terms energy: -139.339626 where: bonds (distance) C4'-P energy: -20.698 bonds (distance) P-C4' energy: -27.048 flat angles C4'-P-C4' energy: -29.796 flat angles P-C4'-P energy: -18.601 tors. eta vs tors. theta energy: -43.197 Dist. restrs. and SS energy: 0.313 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -473.213019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.213019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.608173 (E_RNA) where: Base-Base interactions energy: -337.101 where: short stacking energy: -135.774 Base-Backbone interact. energy: -1.372 local terms energy: -135.135770 where: bonds (distance) C4'-P energy: -27.783 bonds (distance) P-C4' energy: -24.235 flat angles C4'-P-C4' energy: -31.107 flat angles P-C4'-P energy: -18.544 tors. eta vs tors. theta energy: -33.466 Dist. restrs. and SS energy: 0.395 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -463.939695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.939695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.217690 (E_RNA) where: Base-Base interactions energy: -336.571 where: short stacking energy: -148.910 Base-Backbone interact. energy: -0.054 local terms energy: -127.592684 where: bonds (distance) C4'-P energy: -19.447 bonds (distance) P-C4' energy: -17.047 flat angles C4'-P-C4' energy: -29.115 flat angles P-C4'-P energy: -18.773 tors. eta vs tors. theta energy: -43.211 Dist. restrs. and SS energy: 0.278 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -442.465159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.465159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.641765 (E_RNA) where: Base-Base interactions energy: -320.575 where: short stacking energy: -124.499 Base-Backbone interact. energy: -1.314 local terms energy: -121.752894 where: bonds (distance) C4'-P energy: -26.102 bonds (distance) P-C4' energy: -22.920 flat angles C4'-P-C4' energy: -22.695 flat angles P-C4'-P energy: -12.259 tors. eta vs tors. theta energy: -37.778 Dist. restrs. and SS energy: 1.177 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -563.131964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.131964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.185914 (E_RNA) where: Base-Base interactions energy: -396.411 where: short stacking energy: -158.549 Base-Backbone interact. energy: -0.743 local terms energy: -166.032307 where: bonds (distance) C4'-P energy: -31.476 bonds (distance) P-C4' energy: -34.219 flat angles C4'-P-C4' energy: -34.937 flat angles P-C4'-P energy: -22.910 tors. eta vs tors. theta energy: -42.490 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -543.600529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.600529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.796599 (E_RNA) where: Base-Base interactions energy: -394.867 where: short stacking energy: -163.233 Base-Backbone interact. energy: -0.329 local terms energy: -148.599998 where: bonds (distance) C4'-P energy: -27.488 bonds (distance) P-C4' energy: -30.054 flat angles C4'-P-C4' energy: -28.761 flat angles P-C4'-P energy: -21.276 tors. eta vs tors. theta energy: -41.021 Dist. restrs. and SS energy: 0.196 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -523.437810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.437810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.780999 (E_RNA) where: Base-Base interactions energy: -369.260 where: short stacking energy: -164.140 Base-Backbone interact. energy: -0.037 local terms energy: -154.483923 where: bonds (distance) C4'-P energy: -26.288 bonds (distance) P-C4' energy: -28.171 flat angles C4'-P-C4' energy: -36.726 flat angles P-C4'-P energy: -18.445 tors. eta vs tors. theta energy: -44.855 Dist. restrs. and SS energy: 0.343 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -529.486979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.486979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.487549 (E_RNA) where: Base-Base interactions energy: -375.351 where: short stacking energy: -161.347 Base-Backbone interact. energy: -0.356 local terms energy: -153.780343 where: bonds (distance) C4'-P energy: -22.387 bonds (distance) P-C4' energy: -28.973 flat angles C4'-P-C4' energy: -34.689 flat angles P-C4'-P energy: -23.444 tors. eta vs tors. theta energy: -44.288 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -516.145499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.145499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.198055 (E_RNA) where: Base-Base interactions energy: -372.430 where: short stacking energy: -154.122 Base-Backbone interact. energy: -1.032 local terms energy: -142.735285 where: bonds (distance) C4'-P energy: -26.489 bonds (distance) P-C4' energy: -30.855 flat angles C4'-P-C4' energy: -31.292 flat angles P-C4'-P energy: -19.980 tors. eta vs tors. theta energy: -34.120 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -511.276150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.276150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.999382 (E_RNA) where: Base-Base interactions energy: -366.649 where: short stacking energy: -148.832 Base-Backbone interact. energy: -0.165 local terms energy: -145.185679 where: bonds (distance) C4'-P energy: -26.390 bonds (distance) P-C4' energy: -30.292 flat angles C4'-P-C4' energy: -31.406 flat angles P-C4'-P energy: -21.863 tors. eta vs tors. theta energy: -35.236 Dist. restrs. and SS energy: 0.723 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -508.350169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.350169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.443396 (E_RNA) where: Base-Base interactions energy: -356.565 where: short stacking energy: -157.978 Base-Backbone interact. energy: -0.966 local terms energy: -150.912649 where: bonds (distance) C4'-P energy: -21.817 bonds (distance) P-C4' energy: -30.872 flat angles C4'-P-C4' energy: -32.032 flat angles P-C4'-P energy: -23.645 tors. eta vs tors. theta energy: -42.547 Dist. restrs. and SS energy: 0.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -486.563806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.563806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.315253 (E_RNA) where: Base-Base interactions energy: -341.662 where: short stacking energy: -149.889 Base-Backbone interact. energy: -0.035 local terms energy: -145.618002 where: bonds (distance) C4'-P energy: -20.763 bonds (distance) P-C4' energy: -30.181 flat angles C4'-P-C4' energy: -31.641 flat angles P-C4'-P energy: -22.637 tors. eta vs tors. theta energy: -40.396 Dist. restrs. and SS energy: 0.751 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -460.225241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.225241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.610581 (E_RNA) where: Base-Base interactions energy: -329.300 where: short stacking energy: -140.092 Base-Backbone interact. energy: 0.969 local terms energy: -132.280051 where: bonds (distance) C4'-P energy: -22.918 bonds (distance) P-C4' energy: -25.565 flat angles C4'-P-C4' energy: -28.052 flat angles P-C4'-P energy: -23.772 tors. eta vs tors. theta energy: -31.972 Dist. restrs. and SS energy: 0.385 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -427.344691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.344691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.971023 (E_RNA) where: Base-Base interactions energy: -310.444 where: short stacking energy: -123.424 Base-Backbone interact. energy: -0.454 local terms energy: -117.073051 where: bonds (distance) C4'-P energy: -19.726 bonds (distance) P-C4' energy: -25.168 flat angles C4'-P-C4' energy: -25.588 flat angles P-C4'-P energy: -16.941 tors. eta vs tors. theta energy: -29.650 Dist. restrs. and SS energy: 0.626 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -560.138658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.138658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.255812 (E_RNA) where: Base-Base interactions energy: -402.858 where: short stacking energy: -161.476 Base-Backbone interact. energy: -0.148 local terms energy: -157.250564 where: bonds (distance) C4'-P energy: -27.285 bonds (distance) P-C4' energy: -32.483 flat angles C4'-P-C4' energy: -32.103 flat angles P-C4'-P energy: -22.156 tors. eta vs tors. theta energy: -43.225 Dist. restrs. and SS energy: 0.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -544.634920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.634920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.712592 (E_RNA) where: Base-Base interactions energy: -385.016 where: short stacking energy: -156.125 Base-Backbone interact. energy: -0.901 local terms energy: -158.795369 where: bonds (distance) C4'-P energy: -27.291 bonds (distance) P-C4' energy: -33.548 flat angles C4'-P-C4' energy: -30.044 flat angles P-C4'-P energy: -24.648 tors. eta vs tors. theta energy: -43.265 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -535.485831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.485831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.677361 (E_RNA) where: Base-Base interactions energy: -388.124 where: short stacking energy: -159.163 Base-Backbone interact. energy: -0.409 local terms energy: -147.144236 where: bonds (distance) C4'-P energy: -22.413 bonds (distance) P-C4' energy: -32.254 flat angles C4'-P-C4' energy: -32.783 flat angles P-C4'-P energy: -20.015 tors. eta vs tors. theta energy: -39.679 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -528.326072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.326072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.531909 (E_RNA) where: Base-Base interactions energy: -384.064 where: short stacking energy: -165.835 Base-Backbone interact. energy: -0.414 local terms energy: -144.054080 where: bonds (distance) C4'-P energy: -21.138 bonds (distance) P-C4' energy: -25.376 flat angles C4'-P-C4' energy: -33.961 flat angles P-C4'-P energy: -22.831 tors. eta vs tors. theta energy: -40.748 Dist. restrs. and SS energy: 0.206 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -514.738996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.738996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.992941 (E_RNA) where: Base-Base interactions energy: -377.089 where: short stacking energy: -158.736 Base-Backbone interact. energy: -0.798 local terms energy: -137.105719 where: bonds (distance) C4'-P energy: -29.740 bonds (distance) P-C4' energy: -20.194 flat angles C4'-P-C4' energy: -32.225 flat angles P-C4'-P energy: -19.405 tors. eta vs tors. theta energy: -35.542 Dist. restrs. and SS energy: 0.254 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -505.645285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.645285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.905298 (E_RNA) where: Base-Base interactions energy: -356.329 where: short stacking energy: -155.712 Base-Backbone interact. energy: -0.711 local terms energy: -148.864533 where: bonds (distance) C4'-P energy: -26.319 bonds (distance) P-C4' energy: -28.548 flat angles C4'-P-C4' energy: -28.376 flat angles P-C4'-P energy: -23.039 tors. eta vs tors. theta energy: -42.583 Dist. restrs. and SS energy: 0.260 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -486.827444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.827444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.993203 (E_RNA) where: Base-Base interactions energy: -353.008 where: short stacking energy: -154.857 Base-Backbone interact. energy: -0.529 local terms energy: -133.456409 where: bonds (distance) C4'-P energy: -25.882 bonds (distance) P-C4' energy: -23.872 flat angles C4'-P-C4' energy: -22.174 flat angles P-C4'-P energy: -22.512 tors. eta vs tors. theta energy: -39.017 Dist. restrs. and SS energy: 0.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -503.673334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.673334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.829205 (E_RNA) where: Base-Base interactions energy: -361.623 where: short stacking energy: -148.330 Base-Backbone interact. energy: -0.099 local terms energy: -142.107200 where: bonds (distance) C4'-P energy: -22.991 bonds (distance) P-C4' energy: -27.774 flat angles C4'-P-C4' energy: -32.163 flat angles P-C4'-P energy: -19.781 tors. eta vs tors. theta energy: -39.397 Dist. restrs. and SS energy: 0.156 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -437.413306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.413306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.207852 (E_RNA) where: Base-Base interactions energy: -304.145 where: short stacking energy: -132.353 Base-Backbone interact. energy: -0.226 local terms energy: -134.836785 where: bonds (distance) C4'-P energy: -27.485 bonds (distance) P-C4' energy: -23.118 flat angles C4'-P-C4' energy: -30.139 flat angles P-C4'-P energy: -19.634 tors. eta vs tors. theta energy: -34.460 Dist. restrs. and SS energy: 1.795 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -477.741489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.741489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.251707 (E_RNA) where: Base-Base interactions energy: -337.786 where: short stacking energy: -149.573 Base-Backbone interact. energy: -0.381 local terms energy: -140.084429 where: bonds (distance) C4'-P energy: -30.659 bonds (distance) P-C4' energy: -25.776 flat angles C4'-P-C4' energy: -24.358 flat angles P-C4'-P energy: -17.159 tors. eta vs tors. theta energy: -42.134 Dist. restrs. and SS energy: 0.510 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -559.467919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.467919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.800818 (E_RNA) where: Base-Base interactions energy: -401.139 where: short stacking energy: -159.654 Base-Backbone interact. energy: -0.195 local terms energy: -158.466502 where: bonds (distance) C4'-P energy: -30.946 bonds (distance) P-C4' energy: -28.243 flat angles C4'-P-C4' energy: -31.301 flat angles P-C4'-P energy: -24.775 tors. eta vs tors. theta energy: -43.203 Dist. restrs. and SS energy: 0.333 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -542.071523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.071523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.293657 (E_RNA) where: Base-Base interactions energy: -396.529 where: short stacking energy: -159.607 Base-Backbone interact. energy: -0.205 local terms energy: -145.559996 where: bonds (distance) C4'-P energy: -23.877 bonds (distance) P-C4' energy: -30.879 flat angles C4'-P-C4' energy: -30.504 flat angles P-C4'-P energy: -17.722 tors. eta vs tors. theta energy: -42.578 Dist. restrs. and SS energy: 0.222 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -541.980290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.980290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.154021 (E_RNA) where: Base-Base interactions energy: -392.268 where: short stacking energy: -158.961 Base-Backbone interact. energy: -0.119 local terms energy: -149.767843 where: bonds (distance) C4'-P energy: -29.557 bonds (distance) P-C4' energy: -26.450 flat angles C4'-P-C4' energy: -29.373 flat angles P-C4'-P energy: -22.221 tors. eta vs tors. theta energy: -42.167 Dist. restrs. and SS energy: 0.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -530.106651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.106651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.228728 (E_RNA) where: Base-Base interactions energy: -377.507 where: short stacking energy: -164.392 Base-Backbone interact. energy: -0.653 local terms energy: -152.068774 where: bonds (distance) C4'-P energy: -27.595 bonds (distance) P-C4' energy: -26.426 flat angles C4'-P-C4' energy: -36.430 flat angles P-C4'-P energy: -20.376 tors. eta vs tors. theta energy: -41.241 Dist. restrs. and SS energy: 0.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -521.452481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.452481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.665612 (E_RNA) where: Base-Base interactions energy: -378.171 where: short stacking energy: -153.598 Base-Backbone interact. energy: -1.929 local terms energy: -141.565818 where: bonds (distance) C4'-P energy: -21.448 bonds (distance) P-C4' energy: -29.414 flat angles C4'-P-C4' energy: -29.006 flat angles P-C4'-P energy: -21.096 tors. eta vs tors. theta energy: -40.602 Dist. restrs. and SS energy: 0.213 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -495.344787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.344787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.247735 (E_RNA) where: Base-Base interactions energy: -350.304 where: short stacking energy: -143.803 Base-Backbone interact. energy: -0.262 local terms energy: -146.681576 where: bonds (distance) C4'-P energy: -21.903 bonds (distance) P-C4' energy: -28.221 flat angles C4'-P-C4' energy: -31.216 flat angles P-C4'-P energy: -22.030 tors. eta vs tors. theta energy: -43.312 Dist. restrs. and SS energy: 1.903 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -497.029839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.029839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.374237 (E_RNA) where: Base-Base interactions energy: -359.193 where: short stacking energy: -138.733 Base-Backbone interact. energy: 0.653 local terms energy: -138.834283 where: bonds (distance) C4'-P energy: -27.119 bonds (distance) P-C4' energy: -26.905 flat angles C4'-P-C4' energy: -28.960 flat angles P-C4'-P energy: -18.964 tors. eta vs tors. theta energy: -36.886 Dist. restrs. and SS energy: 0.344 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -501.249597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.249597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.335293 (E_RNA) where: Base-Base interactions energy: -360.681 where: short stacking energy: -148.211 Base-Backbone interact. energy: 0.504 local terms energy: -141.158665 where: bonds (distance) C4'-P energy: -26.968 bonds (distance) P-C4' energy: -25.712 flat angles C4'-P-C4' energy: -27.062 flat angles P-C4'-P energy: -23.568 tors. eta vs tors. theta energy: -37.848 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -430.569109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.569109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.044415 (E_RNA) where: Base-Base interactions energy: -310.577 where: short stacking energy: -129.558 Base-Backbone interact. energy: -1.525 local terms energy: -118.941643 where: bonds (distance) C4'-P energy: -24.504 bonds (distance) P-C4' energy: -17.702 flat angles C4'-P-C4' energy: -26.546 flat angles P-C4'-P energy: -18.290 tors. eta vs tors. theta energy: -31.900 Dist. restrs. and SS energy: 0.475 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -458.411031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.411031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.019368 (E_RNA) where: Base-Base interactions energy: -331.617 where: short stacking energy: -137.605 Base-Backbone interact. energy: -0.768 local terms energy: -126.634542 where: bonds (distance) C4'-P energy: -19.797 bonds (distance) P-C4' energy: -26.422 flat angles C4'-P-C4' energy: -24.829 flat angles P-C4'-P energy: -21.120 tors. eta vs tors. theta energy: -34.466 Dist. restrs. and SS energy: 0.608 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -561.616989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.616989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.793830 (E_RNA) where: Base-Base interactions energy: -399.795 where: short stacking energy: -165.795 Base-Backbone interact. energy: -0.171 local terms energy: -161.827804 where: bonds (distance) C4'-P energy: -29.363 bonds (distance) P-C4' energy: -32.453 flat angles C4'-P-C4' energy: -34.227 flat angles P-C4'-P energy: -21.830 tors. eta vs tors. theta energy: -43.955 Dist. restrs. and SS energy: 0.177 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -553.809842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.809842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.828146 (E_RNA) where: Base-Base interactions energy: -412.477 where: short stacking energy: -162.770 Base-Backbone interact. energy: -1.313 local terms energy: -140.038058 where: bonds (distance) C4'-P energy: -20.759 bonds (distance) P-C4' energy: -22.534 flat angles C4'-P-C4' energy: -29.853 flat angles P-C4'-P energy: -24.340 tors. eta vs tors. theta energy: -42.552 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -533.686104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.686104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.998242 (E_RNA) where: Base-Base interactions energy: -379.214 where: short stacking energy: -159.844 Base-Backbone interact. energy: -0.152 local terms energy: -154.632000 where: bonds (distance) C4'-P energy: -30.296 bonds (distance) P-C4' energy: -33.827 flat angles C4'-P-C4' energy: -29.032 flat angles P-C4'-P energy: -22.530 tors. eta vs tors. theta energy: -38.947 Dist. restrs. and SS energy: 0.312 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -542.410665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.410665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.577816 (E_RNA) where: Base-Base interactions energy: -398.178 where: short stacking energy: -163.408 Base-Backbone interact. energy: -0.124 local terms energy: -144.275832 where: bonds (distance) C4'-P energy: -27.626 bonds (distance) P-C4' energy: -28.196 flat angles C4'-P-C4' energy: -25.941 flat angles P-C4'-P energy: -21.426 tors. eta vs tors. theta energy: -41.086 Dist. restrs. and SS energy: 0.167 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -525.024043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.024043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.260018 (E_RNA) where: Base-Base interactions energy: -388.920 where: short stacking energy: -161.149 Base-Backbone interact. energy: -0.522 local terms energy: -135.817826 where: bonds (distance) C4'-P energy: -24.789 bonds (distance) P-C4' energy: -23.347 flat angles C4'-P-C4' energy: -30.139 flat angles P-C4'-P energy: -15.283 tors. eta vs tors. theta energy: -42.260 Dist. restrs. and SS energy: 0.236 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -515.204802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.204802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.304150 (E_RNA) where: Base-Base interactions energy: -375.585 where: short stacking energy: -151.727 Base-Backbone interact. energy: -0.884 local terms energy: -138.835452 where: bonds (distance) C4'-P energy: -23.927 bonds (distance) P-C4' energy: -30.804 flat angles C4'-P-C4' energy: -30.134 flat angles P-C4'-P energy: -17.611 tors. eta vs tors. theta energy: -36.359 Dist. restrs. and SS energy: 0.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -507.348938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.348938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.100741 (E_RNA) where: Base-Base interactions energy: -360.450 where: short stacking energy: -149.079 Base-Backbone interact. energy: -0.059 local terms energy: -147.591696 where: bonds (distance) C4'-P energy: -23.083 bonds (distance) P-C4' energy: -30.436 flat angles C4'-P-C4' energy: -31.957 flat angles P-C4'-P energy: -24.189 tors. eta vs tors. theta energy: -37.927 Dist. restrs. and SS energy: 0.752 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -487.957975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.957975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.363204 (E_RNA) where: Base-Base interactions energy: -359.640 where: short stacking energy: -143.393 Base-Backbone interact. energy: -0.398 local terms energy: -128.325548 where: bonds (distance) C4'-P energy: -25.277 bonds (distance) P-C4' energy: -21.733 flat angles C4'-P-C4' energy: -31.267 flat angles P-C4'-P energy: -9.077 tors. eta vs tors. theta energy: -40.972 Dist. restrs. and SS energy: 0.405 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -426.942117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.942117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.595897 (E_RNA) where: Base-Base interactions energy: -300.621 where: short stacking energy: -126.747 Base-Backbone interact. energy: -0.614 local terms energy: -126.361328 where: bonds (distance) C4'-P energy: -24.880 bonds (distance) P-C4' energy: -21.618 flat angles C4'-P-C4' energy: -27.367 flat angles P-C4'-P energy: -20.345 tors. eta vs tors. theta energy: -32.151 Dist. restrs. and SS energy: 0.654 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -469.191690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.191690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.400331 (E_RNA) where: Base-Base interactions energy: -339.275 where: short stacking energy: -146.918 Base-Backbone interact. energy: -0.196 local terms energy: -131.929294 where: bonds (distance) C4'-P energy: -28.708 bonds (distance) P-C4' energy: -28.172 flat angles C4'-P-C4' energy: -21.472 flat angles P-C4'-P energy: -18.954 tors. eta vs tors. theta energy: -34.623 Dist. restrs. and SS energy: 2.209 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -552.923989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.923989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.202326 (E_RNA) where: Base-Base interactions energy: -391.804 where: short stacking energy: -158.177 Base-Backbone interact. energy: -1.415 local terms energy: -159.983306 where: bonds (distance) C4'-P energy: -26.288 bonds (distance) P-C4' energy: -29.836 flat angles C4'-P-C4' energy: -33.808 flat angles P-C4'-P energy: -25.393 tors. eta vs tors. theta energy: -44.658 Dist. restrs. and SS energy: 0.278 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -546.039771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.039771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.274613 (E_RNA) where: Base-Base interactions energy: -389.430 where: short stacking energy: -164.562 Base-Backbone interact. energy: -0.296 local terms energy: -156.548139 where: bonds (distance) C4'-P energy: -32.588 bonds (distance) P-C4' energy: -21.128 flat angles C4'-P-C4' energy: -35.870 flat angles P-C4'-P energy: -27.682 tors. eta vs tors. theta energy: -39.281 Dist. restrs. and SS energy: 0.235 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -543.170040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.170040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.246776 (E_RNA) where: Base-Base interactions energy: -390.383 where: short stacking energy: -152.188 Base-Backbone interact. energy: -0.511 local terms energy: -152.352914 where: bonds (distance) C4'-P energy: -25.997 bonds (distance) P-C4' energy: -26.374 flat angles C4'-P-C4' energy: -33.309 flat angles P-C4'-P energy: -26.257 tors. eta vs tors. theta energy: -40.417 Dist. restrs. and SS energy: 0.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -539.350648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.350648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.561159 (E_RNA) where: Base-Base interactions energy: -382.599 where: short stacking energy: -157.667 Base-Backbone interact. energy: -0.735 local terms energy: -156.227555 where: bonds (distance) C4'-P energy: -34.018 bonds (distance) P-C4' energy: -29.547 flat angles C4'-P-C4' energy: -30.460 flat angles P-C4'-P energy: -24.003 tors. eta vs tors. theta energy: -38.199 Dist. restrs. and SS energy: 0.211 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -524.266640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.266640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.382968 (E_RNA) where: Base-Base interactions energy: -372.733 where: short stacking energy: -151.423 Base-Backbone interact. energy: -0.117 local terms energy: -151.532936 where: bonds (distance) C4'-P energy: -29.750 bonds (distance) P-C4' energy: -27.453 flat angles C4'-P-C4' energy: -31.876 flat angles P-C4'-P energy: -18.107 tors. eta vs tors. theta energy: -44.347 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -521.434560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.434560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.502023 (E_RNA) where: Base-Base interactions energy: -385.064 where: short stacking energy: -156.108 Base-Backbone interact. energy: 0.718 local terms energy: -137.155313 where: bonds (distance) C4'-P energy: -22.793 bonds (distance) P-C4' energy: -26.492 flat angles C4'-P-C4' energy: -26.797 flat angles P-C4'-P energy: -21.490 tors. eta vs tors. theta energy: -39.584 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -462.061520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.061520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.466018 (E_RNA) where: Base-Base interactions energy: -320.171 where: short stacking energy: -139.261 Base-Backbone interact. energy: -0.221 local terms energy: -142.074219 where: bonds (distance) C4'-P energy: -23.968 bonds (distance) P-C4' energy: -33.032 flat angles C4'-P-C4' energy: -27.818 flat angles P-C4'-P energy: -19.234 tors. eta vs tors. theta energy: -38.023 Dist. restrs. and SS energy: 0.404 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -483.518484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.518484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.847212 (E_RNA) where: Base-Base interactions energy: -340.576 where: short stacking energy: -144.197 Base-Backbone interact. energy: -0.433 local terms energy: -142.838128 where: bonds (distance) C4'-P energy: -25.712 bonds (distance) P-C4' energy: -29.300 flat angles C4'-P-C4' energy: -30.200 flat angles P-C4'-P energy: -19.003 tors. eta vs tors. theta energy: -38.622 Dist. restrs. and SS energy: 0.329 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -458.333106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.333106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.965343 (E_RNA) where: Base-Base interactions energy: -330.209 where: short stacking energy: -138.050 Base-Backbone interact. energy: 0.168 local terms energy: -128.923899 where: bonds (distance) C4'-P energy: -22.390 bonds (distance) P-C4' energy: -21.950 flat angles C4'-P-C4' energy: -28.480 flat angles P-C4'-P energy: -18.569 tors. eta vs tors. theta energy: -37.536 Dist. restrs. and SS energy: 0.632 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -428.061607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -428.061607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.552947 (E_RNA) where: Base-Base interactions energy: -305.629 where: short stacking energy: -136.611 Base-Backbone interact. energy: -0.144 local terms energy: -124.780745 where: bonds (distance) C4'-P energy: -19.561 bonds (distance) P-C4' energy: -23.690 flat angles C4'-P-C4' energy: -27.721 flat angles P-C4'-P energy: -15.828 tors. eta vs tors. theta energy: -37.980 Dist. restrs. and SS energy: 2.491 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -548.211349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.211349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.326742 (E_RNA) where: Base-Base interactions energy: -394.965 where: short stacking energy: -158.120 Base-Backbone interact. energy: -1.316 local terms energy: -152.045970 where: bonds (distance) C4'-P energy: -31.374 bonds (distance) P-C4' energy: -29.139 flat angles C4'-P-C4' energy: -34.476 flat angles P-C4'-P energy: -17.186 tors. eta vs tors. theta energy: -39.871 Dist. restrs. and SS energy: 0.115 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -564.605976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.605976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.969946 (E_RNA) where: Base-Base interactions energy: -404.164 where: short stacking energy: -168.913 Base-Backbone interact. energy: -0.363 local terms energy: -160.442943 where: bonds (distance) C4'-P energy: -31.910 bonds (distance) P-C4' energy: -30.624 flat angles C4'-P-C4' energy: -34.955 flat angles P-C4'-P energy: -20.825 tors. eta vs tors. theta energy: -42.130 Dist. restrs. and SS energy: 0.364 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -538.166273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.166273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.250007 (E_RNA) where: Base-Base interactions energy: -389.435 where: short stacking energy: -156.849 Base-Backbone interact. energy: -0.522 local terms energy: -148.293684 where: bonds (distance) C4'-P energy: -26.637 bonds (distance) P-C4' energy: -22.874 flat angles C4'-P-C4' energy: -33.329 flat angles P-C4'-P energy: -23.867 tors. eta vs tors. theta energy: -41.587 Dist. restrs. and SS energy: 0.084 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -523.045372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.045372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.289339 (E_RNA) where: Base-Base interactions energy: -375.527 where: short stacking energy: -165.786 Base-Backbone interact. energy: -0.488 local terms energy: -147.274042 where: bonds (distance) C4'-P energy: -20.434 bonds (distance) P-C4' energy: -31.096 flat angles C4'-P-C4' energy: -31.859 flat angles P-C4'-P energy: -21.382 tors. eta vs tors. theta energy: -42.503 Dist. restrs. and SS energy: 0.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -537.439710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.439710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.762734 (E_RNA) where: Base-Base interactions energy: -376.357 where: short stacking energy: -156.424 Base-Backbone interact. energy: -1.190 local terms energy: -160.215330 where: bonds (distance) C4'-P energy: -28.005 bonds (distance) P-C4' energy: -32.531 flat angles C4'-P-C4' energy: -29.961 flat angles P-C4'-P energy: -25.833 tors. eta vs tors. theta energy: -43.885 Dist. restrs. and SS energy: 0.323 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -511.659216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.659216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.753946 (E_RNA) where: Base-Base interactions energy: -364.377 where: short stacking energy: -150.029 Base-Backbone interact. energy: -1.249 local terms energy: -146.128034 where: bonds (distance) C4'-P energy: -26.875 bonds (distance) P-C4' energy: -26.889 flat angles C4'-P-C4' energy: -33.760 flat angles P-C4'-P energy: -21.497 tors. eta vs tors. theta energy: -37.107 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -491.052903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.052903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.322575 (E_RNA) where: Base-Base interactions energy: -352.914 where: short stacking energy: -152.912 Base-Backbone interact. energy: -0.040 local terms energy: -138.368906 where: bonds (distance) C4'-P energy: -29.914 bonds (distance) P-C4' energy: -24.423 flat angles C4'-P-C4' energy: -25.323 flat angles P-C4'-P energy: -16.716 tors. eta vs tors. theta energy: -41.994 Dist. restrs. and SS energy: 0.270 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -483.618846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.618846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.784970 (E_RNA) where: Base-Base interactions energy: -344.897 where: short stacking energy: -152.230 Base-Backbone interact. energy: -0.450 local terms energy: -138.438102 where: bonds (distance) C4'-P energy: -20.369 bonds (distance) P-C4' energy: -25.266 flat angles C4'-P-C4' energy: -34.087 flat angles P-C4'-P energy: -17.054 tors. eta vs tors. theta energy: -41.662 Dist. restrs. and SS energy: 0.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -462.728784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.728784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.925644 (E_RNA) where: Base-Base interactions energy: -337.898 where: short stacking energy: -148.404 Base-Backbone interact. energy: 0.771 local terms energy: -127.798707 where: bonds (distance) C4'-P energy: -18.572 bonds (distance) P-C4' energy: -20.395 flat angles C4'-P-C4' energy: -27.429 flat angles P-C4'-P energy: -21.738 tors. eta vs tors. theta energy: -39.664 Dist. restrs. and SS energy: 2.197 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -444.996458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.996458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.250371 (E_RNA) where: Base-Base interactions energy: -309.541 where: short stacking energy: -133.174 Base-Backbone interact. energy: -0.239 local terms energy: -136.470789 where: bonds (distance) C4'-P energy: -24.416 bonds (distance) P-C4' energy: -26.432 flat angles C4'-P-C4' energy: -27.684 flat angles P-C4'-P energy: -20.286 tors. eta vs tors. theta energy: -37.653 Dist. restrs. and SS energy: 1.254 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -552.610734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.610734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.811415 (E_RNA) where: Base-Base interactions energy: -392.643 where: short stacking energy: -161.374 Base-Backbone interact. energy: -0.122 local terms energy: -160.047216 where: bonds (distance) C4'-P energy: -32.499 bonds (distance) P-C4' energy: -32.192 flat angles C4'-P-C4' energy: -32.061 flat angles P-C4'-P energy: -22.816 tors. eta vs tors. theta energy: -40.480 Dist. restrs. and SS energy: 0.201 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -554.846167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.846167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.869415 (E_RNA) where: Base-Base interactions energy: -389.424 where: short stacking energy: -154.312 Base-Backbone interact. energy: -0.192 local terms energy: -165.253457 where: bonds (distance) C4'-P energy: -28.491 bonds (distance) P-C4' energy: -32.634 flat angles C4'-P-C4' energy: -35.614 flat angles P-C4'-P energy: -24.737 tors. eta vs tors. theta energy: -43.779 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -540.530826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.530826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.733363 (E_RNA) where: Base-Base interactions energy: -386.263 where: short stacking energy: -151.887 Base-Backbone interact. energy: -0.862 local terms energy: -153.609060 where: bonds (distance) C4'-P energy: -30.912 bonds (distance) P-C4' energy: -29.669 flat angles C4'-P-C4' energy: -33.634 flat angles P-C4'-P energy: -17.928 tors. eta vs tors. theta energy: -41.466 Dist. restrs. and SS energy: 0.203 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -528.878883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.878883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.122326 (E_RNA) where: Base-Base interactions energy: -374.973 where: short stacking energy: -156.767 Base-Backbone interact. energy: 0.078 local terms energy: -154.226996 where: bonds (distance) C4'-P energy: -32.481 bonds (distance) P-C4' energy: -27.202 flat angles C4'-P-C4' energy: -30.498 flat angles P-C4'-P energy: -21.477 tors. eta vs tors. theta energy: -42.569 Dist. restrs. and SS energy: 0.243 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -533.409133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.409133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.732259 (E_RNA) where: Base-Base interactions energy: -375.123 where: short stacking energy: -171.383 Base-Backbone interact. energy: -0.233 local terms energy: -158.376050 where: bonds (distance) C4'-P energy: -25.423 bonds (distance) P-C4' energy: -27.102 flat angles C4'-P-C4' energy: -33.084 flat angles P-C4'-P energy: -24.759 tors. eta vs tors. theta energy: -48.008 Dist. restrs. and SS energy: 0.323 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -503.680431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.680431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.843106 (E_RNA) where: Base-Base interactions energy: -356.751 where: short stacking energy: -159.749 Base-Backbone interact. energy: -0.010 local terms energy: -147.082165 where: bonds (distance) C4'-P energy: -29.201 bonds (distance) P-C4' energy: -23.276 flat angles C4'-P-C4' energy: -28.168 flat angles P-C4'-P energy: -19.846 tors. eta vs tors. theta energy: -46.591 Dist. restrs. and SS energy: 0.163 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -492.224386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.224386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.939649 (E_RNA) where: Base-Base interactions energy: -339.596 where: short stacking energy: -152.924 Base-Backbone interact. energy: -0.003 local terms energy: -153.341121 where: bonds (distance) C4'-P energy: -23.647 bonds (distance) P-C4' energy: -32.052 flat angles C4'-P-C4' energy: -28.595 flat angles P-C4'-P energy: -22.926 tors. eta vs tors. theta energy: -46.121 Dist. restrs. and SS energy: 0.715 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -500.026572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.026572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.457564 (E_RNA) where: Base-Base interactions energy: -372.131 where: short stacking energy: -151.628 Base-Backbone interact. energy: -0.288 local terms energy: -128.038491 where: bonds (distance) C4'-P energy: -26.888 bonds (distance) P-C4' energy: -19.538 flat angles C4'-P-C4' energy: -27.532 flat angles P-C4'-P energy: -14.167 tors. eta vs tors. theta energy: -39.913 Dist. restrs. and SS energy: 0.431 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -421.798980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.798980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.632039 (E_RNA) where: Base-Base interactions energy: -297.597 where: short stacking energy: -122.682 Base-Backbone interact. energy: -0.857 local terms energy: -125.177899 where: bonds (distance) C4'-P energy: -23.158 bonds (distance) P-C4' energy: -24.822 flat angles C4'-P-C4' energy: -25.531 flat angles P-C4'-P energy: -18.453 tors. eta vs tors. theta energy: -33.214 Dist. restrs. and SS energy: 1.833 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -455.065113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.065113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.460428 (E_RNA) where: Base-Base interactions energy: -328.975 where: short stacking energy: -139.890 Base-Backbone interact. energy: -0.249 local terms energy: -126.236347 where: bonds (distance) C4'-P energy: -27.372 bonds (distance) P-C4' energy: -17.150 flat angles C4'-P-C4' energy: -20.820 flat angles P-C4'-P energy: -22.973 tors. eta vs tors. theta energy: -37.921 Dist. restrs. and SS energy: 0.395 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -547.418212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.418212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.710328 (E_RNA) where: Base-Base interactions energy: -390.288 where: short stacking energy: -159.817 Base-Backbone interact. energy: -0.783 local terms energy: -156.639172 where: bonds (distance) C4'-P energy: -28.814 bonds (distance) P-C4' energy: -27.634 flat angles C4'-P-C4' energy: -32.060 flat angles P-C4'-P energy: -26.143 tors. eta vs tors. theta energy: -41.988 Dist. restrs. and SS energy: 0.292 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -549.675118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.675118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.904425 (E_RNA) where: Base-Base interactions energy: -402.082 where: short stacking energy: -162.375 Base-Backbone interact. energy: -0.508 local terms energy: -147.314093 where: bonds (distance) C4'-P energy: -30.024 bonds (distance) P-C4' energy: -22.531 flat angles C4'-P-C4' energy: -34.518 flat angles P-C4'-P energy: -19.334 tors. eta vs tors. theta energy: -40.907 Dist. restrs. and SS energy: 0.229 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -538.527061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.527061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.730997 (E_RNA) where: Base-Base interactions energy: -384.694 where: short stacking energy: -156.379 Base-Backbone interact. energy: -0.956 local terms energy: -153.080745 where: bonds (distance) C4'-P energy: -30.595 bonds (distance) P-C4' energy: -29.766 flat angles C4'-P-C4' energy: -29.359 flat angles P-C4'-P energy: -20.786 tors. eta vs tors. theta energy: -42.575 Dist. restrs. and SS energy: 0.204 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -531.952524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.952524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.141070 (E_RNA) where: Base-Base interactions energy: -386.379 where: short stacking energy: -154.406 Base-Backbone interact. energy: -0.620 local terms energy: -145.142002 where: bonds (distance) C4'-P energy: -21.472 bonds (distance) P-C4' energy: -27.334 flat angles C4'-P-C4' energy: -33.447 flat angles P-C4'-P energy: -20.629 tors. eta vs tors. theta energy: -42.259 Dist. restrs. and SS energy: 0.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -528.576618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.576618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.670555 (E_RNA) where: Base-Base interactions energy: -380.414 where: short stacking energy: -161.394 Base-Backbone interact. energy: -0.081 local terms energy: -148.175472 where: bonds (distance) C4'-P energy: -21.673 bonds (distance) P-C4' energy: -28.397 flat angles C4'-P-C4' energy: -29.346 flat angles P-C4'-P energy: -26.550 tors. eta vs tors. theta energy: -42.210 Dist. restrs. and SS energy: 0.094 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -496.225175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.225175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.321770 (E_RNA) where: Base-Base interactions energy: -356.509 where: short stacking energy: -153.742 Base-Backbone interact. energy: -0.301 local terms energy: -139.511750 where: bonds (distance) C4'-P energy: -24.838 bonds (distance) P-C4' energy: -24.463 flat angles C4'-P-C4' energy: -29.173 flat angles P-C4'-P energy: -19.198 tors. eta vs tors. theta energy: -41.840 Dist. restrs. and SS energy: 0.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -482.862698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.862698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.094692 (E_RNA) where: Base-Base interactions energy: -357.499 where: short stacking energy: -144.705 Base-Backbone interact. energy: -0.222 local terms energy: -125.373506 where: bonds (distance) C4'-P energy: -23.288 bonds (distance) P-C4' energy: -21.047 flat angles C4'-P-C4' energy: -28.307 flat angles P-C4'-P energy: -11.328 tors. eta vs tors. theta energy: -41.404 Dist. restrs. and SS energy: 0.232 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -488.207605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.207605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.339279 (E_RNA) where: Base-Base interactions energy: -343.306 where: short stacking energy: -154.266 Base-Backbone interact. energy: -0.420 local terms energy: -144.613388 where: bonds (distance) C4'-P energy: -26.487 bonds (distance) P-C4' energy: -22.428 flat angles C4'-P-C4' energy: -33.072 flat angles P-C4'-P energy: -18.195 tors. eta vs tors. theta energy: -44.432 Dist. restrs. and SS energy: 0.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -428.606604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -428.606604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.910651 (E_RNA) where: Base-Base interactions energy: -312.601 where: short stacking energy: -114.721 Base-Backbone interact. energy: -0.252 local terms energy: -116.056989 where: bonds (distance) C4'-P energy: -27.603 bonds (distance) P-C4' energy: -22.246 flat angles C4'-P-C4' energy: -23.189 flat angles P-C4'-P energy: -14.968 tors. eta vs tors. theta energy: -28.051 Dist. restrs. and SS energy: 0.304 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -417.535220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.535220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.244653 (E_RNA) where: Base-Base interactions energy: -292.357 where: short stacking energy: -115.684 Base-Backbone interact. energy: -0.676 local terms energy: -126.211830 where: bonds (distance) C4'-P energy: -28.893 bonds (distance) P-C4' energy: -28.138 flat angles C4'-P-C4' energy: -26.536 flat angles P-C4'-P energy: -22.728 tors. eta vs tors. theta energy: -19.917 Dist. restrs. and SS energy: 1.709 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -558.475375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.475375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.758526 (E_RNA) where: Base-Base interactions energy: -400.312 where: short stacking energy: -168.917 Base-Backbone interact. energy: -0.204 local terms energy: -158.242759 where: bonds (distance) C4'-P energy: -30.104 bonds (distance) P-C4' energy: -30.170 flat angles C4'-P-C4' energy: -34.610 flat angles P-C4'-P energy: -22.939 tors. eta vs tors. theta energy: -40.419 Dist. restrs. and SS energy: 0.283 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -546.007774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.007774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.221408 (E_RNA) where: Base-Base interactions energy: -396.019 where: short stacking energy: -163.972 Base-Backbone interact. energy: 0.643 local terms energy: -150.845574 where: bonds (distance) C4'-P energy: -27.922 bonds (distance) P-C4' energy: -26.609 flat angles C4'-P-C4' energy: -30.997 flat angles P-C4'-P energy: -23.060 tors. eta vs tors. theta energy: -42.257 Dist. restrs. and SS energy: 0.214 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -536.668096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.668096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.163501 (E_RNA) where: Base-Base interactions energy: -382.451 where: short stacking energy: -158.451 Base-Backbone interact. energy: -0.552 local terms energy: -154.160516 where: bonds (distance) C4'-P energy: -28.004 bonds (distance) P-C4' energy: -28.177 flat angles C4'-P-C4' energy: -30.026 flat angles P-C4'-P energy: -25.170 tors. eta vs tors. theta energy: -42.783 Dist. restrs. and SS energy: 0.495 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -524.415120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.415120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.717486 (E_RNA) where: Base-Base interactions energy: -371.053 where: short stacking energy: -156.369 Base-Backbone interact. energy: -2.281 local terms energy: -151.382973 where: bonds (distance) C4'-P energy: -22.403 bonds (distance) P-C4' energy: -25.603 flat angles C4'-P-C4' energy: -31.835 flat angles P-C4'-P energy: -22.465 tors. eta vs tors. theta energy: -49.077 Dist. restrs. and SS energy: 0.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -530.678918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.678918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.809567 (E_RNA) where: Base-Base interactions energy: -374.010 where: short stacking energy: -157.041 Base-Backbone interact. energy: -0.970 local terms energy: -155.828669 where: bonds (distance) C4'-P energy: -22.462 bonds (distance) P-C4' energy: -30.247 flat angles C4'-P-C4' energy: -35.882 flat angles P-C4'-P energy: -25.287 tors. eta vs tors. theta energy: -41.951 Dist. restrs. and SS energy: 0.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -499.681785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.681785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.059520 (E_RNA) where: Base-Base interactions energy: -361.433 where: short stacking energy: -159.524 Base-Backbone interact. energy: -0.006 local terms energy: -138.620746 where: bonds (distance) C4'-P energy: -22.918 bonds (distance) P-C4' energy: -17.305 flat angles C4'-P-C4' energy: -31.181 flat angles P-C4'-P energy: -20.666 tors. eta vs tors. theta energy: -46.551 Dist. restrs. and SS energy: 0.378 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -493.636792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.636792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.087662 (E_RNA) where: Base-Base interactions energy: -356.720 where: short stacking energy: -152.739 Base-Backbone interact. energy: -0.117 local terms energy: -137.250308 where: bonds (distance) C4'-P energy: -21.470 bonds (distance) P-C4' energy: -27.432 flat angles C4'-P-C4' energy: -31.948 flat angles P-C4'-P energy: -15.960 tors. eta vs tors. theta energy: -40.440 Dist. restrs. and SS energy: 0.451 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -499.206250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.206250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.562916 (E_RNA) where: Base-Base interactions energy: -359.434 where: short stacking energy: -145.890 Base-Backbone interact. energy: -0.915 local terms energy: -139.213681 where: bonds (distance) C4'-P energy: -23.871 bonds (distance) P-C4' energy: -25.437 flat angles C4'-P-C4' energy: -32.778 flat angles P-C4'-P energy: -19.016 tors. eta vs tors. theta energy: -38.112 Dist. restrs. and SS energy: 0.357 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -430.102491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.102491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.439132 (E_RNA) where: Base-Base interactions energy: -312.719 where: short stacking energy: -126.748 Base-Backbone interact. energy: -0.748 local terms energy: -116.972718 where: bonds (distance) C4'-P energy: -26.205 bonds (distance) P-C4' energy: -9.576 flat angles C4'-P-C4' energy: -30.943 flat angles P-C4'-P energy: -16.461 tors. eta vs tors. theta energy: -33.788 Dist. restrs. and SS energy: 0.337 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -423.964864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.964864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.259415 (E_RNA) where: Base-Base interactions energy: -302.218 where: short stacking energy: -123.568 Base-Backbone interact. energy: -0.596 local terms energy: -121.445452 where: bonds (distance) C4'-P energy: -20.087 bonds (distance) P-C4' energy: -20.994 flat angles C4'-P-C4' energy: -22.699 flat angles P-C4'-P energy: -21.286 tors. eta vs tors. theta energy: -36.378 Dist. restrs. and SS energy: 0.295 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -560.484498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.484498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.666657 (E_RNA) where: Base-Base interactions energy: -409.770 where: short stacking energy: -167.373 Base-Backbone interact. energy: -0.701 local terms energy: -150.195191 where: bonds (distance) C4'-P energy: -31.708 bonds (distance) P-C4' energy: -24.527 flat angles C4'-P-C4' energy: -29.903 flat angles P-C4'-P energy: -21.594 tors. eta vs tors. theta energy: -42.464 Dist. restrs. and SS energy: 0.182 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -544.363095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.363095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.420658 (E_RNA) where: Base-Base interactions energy: -382.904 where: short stacking energy: -156.482 Base-Backbone interact. energy: -0.440 local terms energy: -161.076975 where: bonds (distance) C4'-P energy: -28.946 bonds (distance) P-C4' energy: -34.298 flat angles C4'-P-C4' energy: -31.344 flat angles P-C4'-P energy: -25.455 tors. eta vs tors. theta energy: -41.034 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -543.902416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.902416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.046823 (E_RNA) where: Base-Base interactions energy: -393.802 where: short stacking energy: -154.880 Base-Backbone interact. energy: -0.360 local terms energy: -149.884591 where: bonds (distance) C4'-P energy: -28.999 bonds (distance) P-C4' energy: -28.441 flat angles C4'-P-C4' energy: -30.551 flat angles P-C4'-P energy: -23.184 tors. eta vs tors. theta energy: -38.710 Dist. restrs. and SS energy: 0.144 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -523.199379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.199379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.510982 (E_RNA) where: Base-Base interactions energy: -379.746 where: short stacking energy: -165.014 Base-Backbone interact. energy: 0.192 local terms energy: -143.956806 where: bonds (distance) C4'-P energy: -20.511 bonds (distance) P-C4' energy: -19.548 flat angles C4'-P-C4' energy: -34.195 flat angles P-C4'-P energy: -22.458 tors. eta vs tors. theta energy: -47.244 Dist. restrs. and SS energy: 0.312 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -520.159675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.159675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.214612 (E_RNA) where: Base-Base interactions energy: -375.763 where: short stacking energy: -166.906 Base-Backbone interact. energy: -0.817 local terms energy: -143.635092 where: bonds (distance) C4'-P energy: -23.762 bonds (distance) P-C4' energy: -26.757 flat angles C4'-P-C4' energy: -30.151 flat angles P-C4'-P energy: -18.729 tors. eta vs tors. theta energy: -44.237 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -521.660036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.660036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.715530 (E_RNA) where: Base-Base interactions energy: -379.656 where: short stacking energy: -152.023 Base-Backbone interact. energy: -0.421 local terms energy: -141.638366 where: bonds (distance) C4'-P energy: -27.583 bonds (distance) P-C4' energy: -28.822 flat angles C4'-P-C4' energy: -27.336 flat angles P-C4'-P energy: -17.179 tors. eta vs tors. theta energy: -40.719 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -511.076247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.076247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.510984 (E_RNA) where: Base-Base interactions energy: -362.333 where: short stacking energy: -157.139 Base-Backbone interact. energy: -1.236 local terms energy: -147.942428 where: bonds (distance) C4'-P energy: -21.199 bonds (distance) P-C4' energy: -30.597 flat angles C4'-P-C4' energy: -31.163 flat angles P-C4'-P energy: -23.120 tors. eta vs tors. theta energy: -41.863 Dist. restrs. and SS energy: 0.435 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -488.267455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.267455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.601896 (E_RNA) where: Base-Base interactions energy: -345.773 where: short stacking energy: -149.846 Base-Backbone interact. energy: -0.074 local terms energy: -142.755582 where: bonds (distance) C4'-P energy: -26.522 bonds (distance) P-C4' energy: -26.494 flat angles C4'-P-C4' energy: -30.189 flat angles P-C4'-P energy: -18.620 tors. eta vs tors. theta energy: -40.930 Dist. restrs. and SS energy: 0.334 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -426.762926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.762926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.364373 (E_RNA) where: Base-Base interactions energy: -298.325 where: short stacking energy: -124.067 Base-Backbone interact. energy: -0.249 local terms energy: -129.791233 where: bonds (distance) C4'-P energy: -30.891 bonds (distance) P-C4' energy: -26.265 flat angles C4'-P-C4' energy: -29.055 flat angles P-C4'-P energy: -15.241 tors. eta vs tors. theta energy: -28.339 Dist. restrs. and SS energy: 1.601 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -415.632978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.632978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.935685 (E_RNA) where: Base-Base interactions energy: -291.509 where: short stacking energy: -115.000 Base-Backbone interact. energy: -0.420 local terms energy: -124.006564 where: bonds (distance) C4'-P energy: -25.933 bonds (distance) P-C4' energy: -21.394 flat angles C4'-P-C4' energy: -27.879 flat angles P-C4'-P energy: -22.546 tors. eta vs tors. theta energy: -26.256 Dist. restrs. and SS energy: 0.303 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -555.012292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.012292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.017880 (E_RNA) where: Base-Base interactions energy: -391.900 where: short stacking energy: -163.462 Base-Backbone interact. energy: -1.152 local terms energy: -161.966064 where: bonds (distance) C4'-P energy: -29.173 bonds (distance) P-C4' energy: -31.405 flat angles C4'-P-C4' energy: -34.837 flat angles P-C4'-P energy: -23.152 tors. eta vs tors. theta energy: -43.400 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -534.699117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.699117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.979757 (E_RNA) where: Base-Base interactions energy: -385.021 where: short stacking energy: -156.440 Base-Backbone interact. energy: -0.092 local terms energy: -149.866569 where: bonds (distance) C4'-P energy: -27.343 bonds (distance) P-C4' energy: -27.688 flat angles C4'-P-C4' energy: -33.755 flat angles P-C4'-P energy: -20.345 tors. eta vs tors. theta energy: -40.736 Dist. restrs. and SS energy: 0.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -539.857341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.857341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.978190 (E_RNA) where: Base-Base interactions energy: -390.041 where: short stacking energy: -159.855 Base-Backbone interact. energy: -1.806 local terms energy: -148.131162 where: bonds (distance) C4'-P energy: -22.248 bonds (distance) P-C4' energy: -24.592 flat angles C4'-P-C4' energy: -30.787 flat angles P-C4'-P energy: -27.422 tors. eta vs tors. theta energy: -43.081 Dist. restrs. and SS energy: 0.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -531.218494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.218494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.298095 (E_RNA) where: Base-Base interactions energy: -384.118 where: short stacking energy: -154.501 Base-Backbone interact. energy: -0.794 local terms energy: -146.385295 where: bonds (distance) C4'-P energy: -23.353 bonds (distance) P-C4' energy: -32.091 flat angles C4'-P-C4' energy: -30.098 flat angles P-C4'-P energy: -20.377 tors. eta vs tors. theta energy: -40.467 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -518.783249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.783249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.030599 (E_RNA) where: Base-Base interactions energy: -371.051 where: short stacking energy: -158.103 Base-Backbone interact. energy: -0.020 local terms energy: -147.959455 where: bonds (distance) C4'-P energy: -22.178 bonds (distance) P-C4' energy: -26.653 flat angles C4'-P-C4' energy: -27.791 flat angles P-C4'-P energy: -25.541 tors. eta vs tors. theta energy: -45.796 Dist. restrs. and SS energy: 0.247 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -518.374333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.374333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.421547 (E_RNA) where: Base-Base interactions energy: -374.137 where: short stacking energy: -158.357 Base-Backbone interact. energy: -0.683 local terms energy: -143.601569 where: bonds (distance) C4'-P energy: -26.992 bonds (distance) P-C4' energy: -24.594 flat angles C4'-P-C4' energy: -30.877 flat angles P-C4'-P energy: -19.549 tors. eta vs tors. theta energy: -41.589 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -512.126534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.126534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.467614 (E_RNA) where: Base-Base interactions energy: -368.852 where: short stacking energy: -149.451 Base-Backbone interact. energy: -1.164 local terms energy: -142.451713 where: bonds (distance) C4'-P energy: -25.728 bonds (distance) P-C4' energy: -26.687 flat angles C4'-P-C4' energy: -30.773 flat angles P-C4'-P energy: -18.420 tors. eta vs tors. theta energy: -40.844 Dist. restrs. and SS energy: 0.341 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -481.226816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.226816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.413831 (E_RNA) where: Base-Base interactions energy: -336.670 where: short stacking energy: -140.658 Base-Backbone interact. energy: -0.425 local terms energy: -144.319531 where: bonds (distance) C4'-P energy: -24.929 bonds (distance) P-C4' energy: -27.309 flat angles C4'-P-C4' energy: -27.091 flat angles P-C4'-P energy: -21.324 tors. eta vs tors. theta energy: -43.667 Dist. restrs. and SS energy: 0.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -438.211158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.211158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.695547 (E_RNA) where: Base-Base interactions energy: -308.891 where: short stacking energy: -137.409 Base-Backbone interact. energy: -0.212 local terms energy: -129.592625 where: bonds (distance) C4'-P energy: -16.915 bonds (distance) P-C4' energy: -28.607 flat angles C4'-P-C4' energy: -30.777 flat angles P-C4'-P energy: -19.072 tors. eta vs tors. theta energy: -34.222 Dist. restrs. and SS energy: 0.484 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -413.085025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.085025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.113363 (E_RNA) where: Base-Base interactions energy: -295.861 where: short stacking energy: -108.455 Base-Backbone interact. energy: -0.291 local terms energy: -117.961014 where: bonds (distance) C4'-P energy: -21.086 bonds (distance) P-C4' energy: -28.926 flat angles C4'-P-C4' energy: -27.611 flat angles P-C4'-P energy: -21.748 tors. eta vs tors. theta energy: -18.590 Dist. restrs. and SS energy: 1.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -549.375813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.375813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.385580 (E_RNA) where: Base-Base interactions energy: -392.444 where: short stacking energy: -156.583 Base-Backbone interact. energy: -0.112 local terms energy: -156.829871 where: bonds (distance) C4'-P energy: -29.712 bonds (distance) P-C4' energy: -28.184 flat angles C4'-P-C4' energy: -32.018 flat angles P-C4'-P energy: -27.275 tors. eta vs tors. theta energy: -39.641 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -543.355868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.355868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.444232 (E_RNA) where: Base-Base interactions energy: -384.259 where: short stacking energy: -155.776 Base-Backbone interact. energy: -2.000 local terms energy: -157.184296 where: bonds (distance) C4'-P energy: -27.504 bonds (distance) P-C4' energy: -32.492 flat angles C4'-P-C4' energy: -34.391 flat angles P-C4'-P energy: -22.631 tors. eta vs tors. theta energy: -40.166 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -546.306080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.306080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.580108 (E_RNA) where: Base-Base interactions energy: -389.361 where: short stacking energy: -155.484 Base-Backbone interact. energy: -0.375 local terms energy: -156.843913 where: bonds (distance) C4'-P energy: -26.357 bonds (distance) P-C4' energy: -33.079 flat angles C4'-P-C4' energy: -30.948 flat angles P-C4'-P energy: -23.729 tors. eta vs tors. theta energy: -42.731 Dist. restrs. and SS energy: 0.274 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -521.873756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.873756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.069744 (E_RNA) where: Base-Base interactions energy: -383.352 where: short stacking energy: -157.063 Base-Backbone interact. energy: -0.345 local terms energy: -138.372604 where: bonds (distance) C4'-P energy: -23.547 bonds (distance) P-C4' energy: -26.392 flat angles C4'-P-C4' energy: -32.346 flat angles P-C4'-P energy: -14.618 tors. eta vs tors. theta energy: -41.469 Dist. restrs. and SS energy: 0.196 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -519.145540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.145540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.322481 (E_RNA) where: Base-Base interactions energy: -370.645 where: short stacking energy: -160.945 Base-Backbone interact. energy: -0.652 local terms energy: -148.025675 where: bonds (distance) C4'-P energy: -20.773 bonds (distance) P-C4' energy: -29.113 flat angles C4'-P-C4' energy: -33.247 flat angles P-C4'-P energy: -18.822 tors. eta vs tors. theta energy: -46.070 Dist. restrs. and SS energy: 0.177 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -514.252989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.252989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.604522 (E_RNA) where: Base-Base interactions energy: -367.893 where: short stacking energy: -148.514 Base-Backbone interact. energy: -0.135 local terms energy: -146.576242 where: bonds (distance) C4'-P energy: -28.626 bonds (distance) P-C4' energy: -25.871 flat angles C4'-P-C4' energy: -31.718 flat angles P-C4'-P energy: -20.303 tors. eta vs tors. theta energy: -40.059 Dist. restrs. and SS energy: 0.352 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -497.611472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.611472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.111626 (E_RNA) where: Base-Base interactions energy: -347.674 where: short stacking energy: -135.775 Base-Backbone interact. energy: -0.213 local terms energy: -150.225100 where: bonds (distance) C4'-P energy: -28.050 bonds (distance) P-C4' energy: -27.001 flat angles C4'-P-C4' energy: -30.589 flat angles P-C4'-P energy: -24.373 tors. eta vs tors. theta energy: -40.212 Dist. restrs. and SS energy: 0.500 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -497.806317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.806317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.931979 (E_RNA) where: Base-Base interactions energy: -352.645 where: short stacking energy: -155.535 Base-Backbone interact. energy: -0.120 local terms energy: -145.166672 where: bonds (distance) C4'-P energy: -28.476 bonds (distance) P-C4' energy: -26.099 flat angles C4'-P-C4' energy: -29.550 flat angles P-C4'-P energy: -18.885 tors. eta vs tors. theta energy: -42.157 Dist. restrs. and SS energy: 0.126 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -432.180118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.180118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.913798 (E_RNA) where: Base-Base interactions energy: -297.063 where: short stacking energy: -125.435 Base-Backbone interact. energy: -0.992 local terms energy: -135.858430 where: bonds (distance) C4'-P energy: -14.978 bonds (distance) P-C4' energy: -30.555 flat angles C4'-P-C4' energy: -31.199 flat angles P-C4'-P energy: -22.158 tors. eta vs tors. theta energy: -36.969 Dist. restrs. and SS energy: 1.734 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -425.445487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.445487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.189467 (E_RNA) where: Base-Base interactions energy: -287.386 where: short stacking energy: -115.079 Base-Backbone interact. energy: 0.441 local terms energy: -139.244366 where: bonds (distance) C4'-P energy: -30.209 bonds (distance) P-C4' energy: -28.681 flat angles C4'-P-C4' energy: -29.295 flat angles P-C4'-P energy: -20.759 tors. eta vs tors. theta energy: -30.300 Dist. restrs. and SS energy: 0.744 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -548.538138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.538138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.027524 (E_RNA) where: Base-Base interactions energy: -391.598 where: short stacking energy: -165.149 Base-Backbone interact. energy: -0.737 local terms energy: -156.692367 where: bonds (distance) C4'-P energy: -29.782 bonds (distance) P-C4' energy: -25.761 flat angles C4'-P-C4' energy: -33.814 flat angles P-C4'-P energy: -22.239 tors. eta vs tors. theta energy: -45.096 Dist. restrs. and SS energy: 0.489 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -547.606960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.606960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.700053 (E_RNA) where: Base-Base interactions energy: -397.611 where: short stacking energy: -158.420 Base-Backbone interact. energy: -0.474 local terms energy: -149.615264 where: bonds (distance) C4'-P energy: -19.675 bonds (distance) P-C4' energy: -28.392 flat angles C4'-P-C4' energy: -36.185 flat angles P-C4'-P energy: -25.765 tors. eta vs tors. theta energy: -39.598 Dist. restrs. and SS energy: 0.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -540.801613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.801613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.147725 (E_RNA) where: Base-Base interactions energy: -388.249 where: short stacking energy: -159.346 Base-Backbone interact. energy: -1.455 local terms energy: -151.444117 where: bonds (distance) C4'-P energy: -28.317 bonds (distance) P-C4' energy: -31.117 flat angles C4'-P-C4' energy: -28.723 flat angles P-C4'-P energy: -21.888 tors. eta vs tors. theta energy: -41.398 Dist. restrs. and SS energy: 0.346 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -528.975671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.975671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.044483 (E_RNA) where: Base-Base interactions energy: -387.540 where: short stacking energy: -160.899 Base-Backbone interact. energy: -0.366 local terms energy: -141.138125 where: bonds (distance) C4'-P energy: -26.201 bonds (distance) P-C4' energy: -25.977 flat angles C4'-P-C4' energy: -31.020 flat angles P-C4'-P energy: -21.756 tors. eta vs tors. theta energy: -36.185 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -516.014159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.014159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.274270 (E_RNA) where: Base-Base interactions energy: -375.892 where: short stacking energy: -153.926 Base-Backbone interact. energy: -0.881 local terms energy: -139.500996 where: bonds (distance) C4'-P energy: -24.341 bonds (distance) P-C4' energy: -25.591 flat angles C4'-P-C4' energy: -31.449 flat angles P-C4'-P energy: -15.460 tors. eta vs tors. theta energy: -42.661 Dist. restrs. and SS energy: 0.260 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -515.874099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.874099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.541854 (E_RNA) where: Base-Base interactions energy: -369.240 where: short stacking energy: -169.405 Base-Backbone interact. energy: -0.067 local terms energy: -147.234734 where: bonds (distance) C4'-P energy: -21.750 bonds (distance) P-C4' energy: -25.740 flat angles C4'-P-C4' energy: -32.061 flat angles P-C4'-P energy: -23.383 tors. eta vs tors. theta energy: -44.301 Dist. restrs. and SS energy: 0.668 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -509.408313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.408313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.731839 (E_RNA) where: Base-Base interactions energy: -359.018 where: short stacking energy: -149.512 Base-Backbone interact. energy: -0.588 local terms energy: -150.125683 where: bonds (distance) C4'-P energy: -24.860 bonds (distance) P-C4' energy: -29.621 flat angles C4'-P-C4' energy: -31.685 flat angles P-C4'-P energy: -23.500 tors. eta vs tors. theta energy: -40.460 Dist. restrs. and SS energy: 0.324 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -480.579461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.579461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.766765 (E_RNA) where: Base-Base interactions energy: -335.902 where: short stacking energy: -148.420 Base-Backbone interact. energy: -1.186 local terms energy: -143.678891 where: bonds (distance) C4'-P energy: -27.696 bonds (distance) P-C4' energy: -28.805 flat angles C4'-P-C4' energy: -27.558 flat angles P-C4'-P energy: -22.116 tors. eta vs tors. theta energy: -37.505 Dist. restrs. and SS energy: 0.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -440.617738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.617738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.214682 (E_RNA) where: Base-Base interactions energy: -314.380 where: short stacking energy: -134.468 Base-Backbone interact. energy: -1.832 local terms energy: -129.001872 where: bonds (distance) C4'-P energy: -16.132 bonds (distance) P-C4' energy: -28.668 flat angles C4'-P-C4' energy: -29.969 flat angles P-C4'-P energy: -23.096 tors. eta vs tors. theta energy: -31.137 Dist. restrs. and SS energy: 4.597 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -408.373942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.373942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.074587 (E_RNA) where: Base-Base interactions energy: -284.519 where: short stacking energy: -117.467 Base-Backbone interact. energy: -0.795 local terms energy: -124.759775 where: bonds (distance) C4'-P energy: -21.005 bonds (distance) P-C4' energy: -28.914 flat angles C4'-P-C4' energy: -26.179 flat angles P-C4'-P energy: -22.709 tors. eta vs tors. theta energy: -25.953 Dist. restrs. and SS energy: 1.701 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -558.010647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.010647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.150281 (E_RNA) where: Base-Base interactions energy: -398.619 where: short stacking energy: -162.674 Base-Backbone interact. energy: -0.217 local terms energy: -159.314788 where: bonds (distance) C4'-P energy: -25.709 bonds (distance) P-C4' energy: -33.292 flat angles C4'-P-C4' energy: -35.446 flat angles P-C4'-P energy: -19.512 tors. eta vs tors. theta energy: -45.356 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -542.432512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.432512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.609066 (E_RNA) where: Base-Base interactions energy: -383.179 where: short stacking energy: -161.263 Base-Backbone interact. energy: -0.243 local terms energy: -159.187257 where: bonds (distance) C4'-P energy: -30.036 bonds (distance) P-C4' energy: -31.665 flat angles C4'-P-C4' energy: -30.041 flat angles P-C4'-P energy: -22.959 tors. eta vs tors. theta energy: -44.486 Dist. restrs. and SS energy: 0.177 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -540.489432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.489432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.571533 (E_RNA) where: Base-Base interactions energy: -391.414 where: short stacking energy: -160.448 Base-Backbone interact. energy: -0.071 local terms energy: -149.087014 where: bonds (distance) C4'-P energy: -23.544 bonds (distance) P-C4' energy: -28.474 flat angles C4'-P-C4' energy: -31.528 flat angles P-C4'-P energy: -26.512 tors. eta vs tors. theta energy: -39.029 Dist. restrs. and SS energy: 0.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -535.064321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.064321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.090844 (E_RNA) where: Base-Base interactions energy: -386.110 where: short stacking energy: -159.272 Base-Backbone interact. energy: -0.590 local terms energy: -148.390919 where: bonds (distance) C4'-P energy: -24.353 bonds (distance) P-C4' energy: -26.738 flat angles C4'-P-C4' energy: -31.912 flat angles P-C4'-P energy: -24.041 tors. eta vs tors. theta energy: -41.346 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -517.718295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.718295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.881446 (E_RNA) where: Base-Base interactions energy: -376.140 where: short stacking energy: -148.269 Base-Backbone interact. energy: -0.998 local terms energy: -140.742880 where: bonds (distance) C4'-P energy: -24.638 bonds (distance) P-C4' energy: -23.900 flat angles C4'-P-C4' energy: -32.228 flat angles P-C4'-P energy: -15.335 tors. eta vs tors. theta energy: -44.642 Dist. restrs. and SS energy: 0.163 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -513.188970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.188970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.884645 (E_RNA) where: Base-Base interactions energy: -363.075 where: short stacking energy: -155.457 Base-Backbone interact. energy: -0.222 local terms energy: -150.587445 where: bonds (distance) C4'-P energy: -25.574 bonds (distance) P-C4' energy: -31.247 flat angles C4'-P-C4' energy: -32.336 flat angles P-C4'-P energy: -17.194 tors. eta vs tors. theta energy: -44.236 Dist. restrs. and SS energy: 0.696 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -495.868828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.868828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.202901 (E_RNA) where: Base-Base interactions energy: -360.700 where: short stacking energy: -146.115 Base-Backbone interact. energy: -0.758 local terms energy: -134.744781 where: bonds (distance) C4'-P energy: -25.270 bonds (distance) P-C4' energy: -19.849 flat angles C4'-P-C4' energy: -34.312 flat angles P-C4'-P energy: -17.225 tors. eta vs tors. theta energy: -38.089 Dist. restrs. and SS energy: 0.334 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -468.431135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.431135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.703517 (E_RNA) where: Base-Base interactions energy: -330.607 where: short stacking energy: -144.085 Base-Backbone interact. energy: -0.038 local terms energy: -138.058808 where: bonds (distance) C4'-P energy: -25.940 bonds (distance) P-C4' energy: -29.472 flat angles C4'-P-C4' energy: -29.326 flat angles P-C4'-P energy: -14.489 tors. eta vs tors. theta energy: -38.833 Dist. restrs. and SS energy: 0.272 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -459.286009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.286009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.544111 (E_RNA) where: Base-Base interactions energy: -329.744 where: short stacking energy: -137.256 Base-Backbone interact. energy: -0.065 local terms energy: -129.734697 where: bonds (distance) C4'-P energy: -20.918 bonds (distance) P-C4' energy: -28.070 flat angles C4'-P-C4' energy: -25.594 flat angles P-C4'-P energy: -17.269 tors. eta vs tors. theta energy: -37.883 Dist. restrs. and SS energy: 0.258 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -422.339776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.339776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.139227 (E_RNA) where: Base-Base interactions energy: -292.723 where: short stacking energy: -118.742 Base-Backbone interact. energy: -0.359 local terms energy: -130.056969 where: bonds (distance) C4'-P energy: -27.727 bonds (distance) P-C4' energy: -26.017 flat angles C4'-P-C4' energy: -27.848 flat angles P-C4'-P energy: -18.521 tors. eta vs tors. theta energy: -29.944 Dist. restrs. and SS energy: 0.799 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -553.402391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.402391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.500385 (E_RNA) where: Base-Base interactions energy: -393.389 where: short stacking energy: -164.225 Base-Backbone interact. energy: -0.768 local terms energy: -159.343494 where: bonds (distance) C4'-P energy: -27.650 bonds (distance) P-C4' energy: -31.740 flat angles C4'-P-C4' energy: -30.890 flat angles P-C4'-P energy: -25.016 tors. eta vs tors. theta energy: -44.047 Dist. restrs. and SS energy: 0.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -544.607689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.607689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.760349 (E_RNA) where: Base-Base interactions energy: -389.560 where: short stacking energy: -156.923 Base-Backbone interact. energy: -1.025 local terms energy: -154.176004 where: bonds (distance) C4'-P energy: -32.421 bonds (distance) P-C4' energy: -26.904 flat angles C4'-P-C4' energy: -31.943 flat angles P-C4'-P energy: -21.501 tors. eta vs tors. theta energy: -41.407 Dist. restrs. and SS energy: 0.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -542.763871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.763871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.838890 (E_RNA) where: Base-Base interactions energy: -395.412 where: short stacking energy: -161.223 Base-Backbone interact. energy: -0.269 local terms energy: -147.158131 where: bonds (distance) C4'-P energy: -27.088 bonds (distance) P-C4' energy: -27.446 flat angles C4'-P-C4' energy: -26.599 flat angles P-C4'-P energy: -22.212 tors. eta vs tors. theta energy: -43.812 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -530.784498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.784498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.867836 (E_RNA) where: Base-Base interactions energy: -385.980 where: short stacking energy: -163.060 Base-Backbone interact. energy: -0.751 local terms energy: -144.137233 where: bonds (distance) C4'-P energy: -25.339 bonds (distance) P-C4' energy: -20.478 flat angles C4'-P-C4' energy: -29.125 flat angles P-C4'-P energy: -25.924 tors. eta vs tors. theta energy: -43.271 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -527.776099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.776099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.998999 (E_RNA) where: Base-Base interactions energy: -377.781 where: short stacking energy: -162.482 Base-Backbone interact. energy: -0.474 local terms energy: -150.744504 where: bonds (distance) C4'-P energy: -25.282 bonds (distance) P-C4' energy: -29.789 flat angles C4'-P-C4' energy: -29.199 flat angles P-C4'-P energy: -24.634 tors. eta vs tors. theta energy: -41.841 Dist. restrs. and SS energy: 1.223 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -508.138503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.138503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.366109 (E_RNA) where: Base-Base interactions energy: -365.835 where: short stacking energy: -158.139 Base-Backbone interact. energy: -0.910 local terms energy: -141.621006 where: bonds (distance) C4'-P energy: -23.215 bonds (distance) P-C4' energy: -30.097 flat angles C4'-P-C4' energy: -31.635 flat angles P-C4'-P energy: -17.743 tors. eta vs tors. theta energy: -38.932 Dist. restrs. and SS energy: 0.228 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -500.074017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.074017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.386045 (E_RNA) where: Base-Base interactions energy: -353.745 where: short stacking energy: -165.100 Base-Backbone interact. energy: -0.622 local terms energy: -146.019575 where: bonds (distance) C4'-P energy: -30.459 bonds (distance) P-C4' energy: -25.539 flat angles C4'-P-C4' energy: -32.168 flat angles P-C4'-P energy: -13.002 tors. eta vs tors. theta energy: -44.852 Dist. restrs. and SS energy: 0.312 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -479.485241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.485241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.488934 (E_RNA) where: Base-Base interactions energy: -351.598 where: short stacking energy: -150.487 Base-Backbone interact. energy: -0.296 local terms energy: -127.594694 where: bonds (distance) C4'-P energy: -17.253 bonds (distance) P-C4' energy: -12.622 flat angles C4'-P-C4' energy: -32.399 flat angles P-C4'-P energy: -22.641 tors. eta vs tors. theta energy: -42.680 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -458.546550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.546550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.077824 (E_RNA) where: Base-Base interactions energy: -342.049 where: short stacking energy: -139.951 Base-Backbone interact. energy: -1.283 local terms energy: -116.745778 where: bonds (distance) C4'-P energy: -18.388 bonds (distance) P-C4' energy: -20.855 flat angles C4'-P-C4' energy: -26.961 flat angles P-C4'-P energy: -13.367 tors. eta vs tors. theta energy: -37.175 Dist. restrs. and SS energy: 1.531 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -433.770812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.770812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.486011 (E_RNA) where: Base-Base interactions energy: -320.503 where: short stacking energy: -140.915 Base-Backbone interact. energy: -0.131 local terms energy: -113.852405 where: bonds (distance) C4'-P energy: -23.882 bonds (distance) P-C4' energy: -17.113 flat angles C4'-P-C4' energy: -19.304 flat angles P-C4'-P energy: -12.948 tors. eta vs tors. theta energy: -40.606 Dist. restrs. and SS energy: 0.715 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -556.161366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.161366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.387393 (E_RNA) where: Base-Base interactions energy: -399.539 where: short stacking energy: -157.638 Base-Backbone interact. energy: -0.504 local terms energy: -156.345090 where: bonds (distance) C4'-P energy: -27.960 bonds (distance) P-C4' energy: -28.255 flat angles C4'-P-C4' energy: -35.301 flat angles P-C4'-P energy: -23.957 tors. eta vs tors. theta energy: -40.871 Dist. restrs. and SS energy: 0.226 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -547.228560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.228560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.390830 (E_RNA) where: Base-Base interactions energy: -388.747 where: short stacking energy: -165.610 Base-Backbone interact. energy: -0.438 local terms energy: -158.205650 where: bonds (distance) C4'-P energy: -27.694 bonds (distance) P-C4' energy: -27.654 flat angles C4'-P-C4' energy: -33.692 flat angles P-C4'-P energy: -25.066 tors. eta vs tors. theta energy: -44.099 Dist. restrs. and SS energy: 0.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -542.176935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.176935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.395148 (E_RNA) where: Base-Base interactions energy: -389.841 where: short stacking energy: -158.515 Base-Backbone interact. energy: -0.270 local terms energy: -152.284702 where: bonds (distance) C4'-P energy: -26.168 bonds (distance) P-C4' energy: -26.369 flat angles C4'-P-C4' energy: -33.883 flat angles P-C4'-P energy: -21.200 tors. eta vs tors. theta energy: -44.665 Dist. restrs. and SS energy: 0.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -503.056303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.056303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.255776 (E_RNA) where: Base-Base interactions energy: -366.570 where: short stacking energy: -151.045 Base-Backbone interact. energy: -0.584 local terms energy: -136.102026 where: bonds (distance) C4'-P energy: -28.299 bonds (distance) P-C4' energy: -27.050 flat angles C4'-P-C4' energy: -26.900 flat angles P-C4'-P energy: -16.769 tors. eta vs tors. theta energy: -37.083 Dist. restrs. and SS energy: 0.199 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -525.369973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.369973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.823723 (E_RNA) where: Base-Base interactions energy: -381.112 where: short stacking energy: -163.980 Base-Backbone interact. energy: -0.541 local terms energy: -144.170397 where: bonds (distance) C4'-P energy: -23.780 bonds (distance) P-C4' energy: -26.658 flat angles C4'-P-C4' energy: -32.051 flat angles P-C4'-P energy: -23.539 tors. eta vs tors. theta energy: -38.143 Dist. restrs. and SS energy: 0.454 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -525.989144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.989144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.222305 (E_RNA) where: Base-Base interactions energy: -379.753 where: short stacking energy: -161.163 Base-Backbone interact. energy: -0.182 local terms energy: -146.286785 where: bonds (distance) C4'-P energy: -28.395 bonds (distance) P-C4' energy: -29.894 flat angles C4'-P-C4' energy: -31.281 flat angles P-C4'-P energy: -11.950 tors. eta vs tors. theta energy: -44.767 Dist. restrs. and SS energy: 0.233 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -502.622356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.622356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.823993 (E_RNA) where: Base-Base interactions energy: -365.702 where: short stacking energy: -155.146 Base-Backbone interact. energy: -0.230 local terms energy: -136.892061 where: bonds (distance) C4'-P energy: -27.099 bonds (distance) P-C4' energy: -27.383 flat angles C4'-P-C4' energy: -27.538 flat angles P-C4'-P energy: -16.455 tors. eta vs tors. theta energy: -38.417 Dist. restrs. and SS energy: 0.202 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -469.879460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.879460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.628179 (E_RNA) where: Base-Base interactions energy: -326.533 where: short stacking energy: -142.209 Base-Backbone interact. energy: -0.140 local terms energy: -143.955236 where: bonds (distance) C4'-P energy: -29.708 bonds (distance) P-C4' energy: -23.234 flat angles C4'-P-C4' energy: -35.950 flat angles P-C4'-P energy: -17.898 tors. eta vs tors. theta energy: -37.165 Dist. restrs. and SS energy: 0.749 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -455.911094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.911094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.000387 (E_RNA) where: Base-Base interactions energy: -334.155 where: short stacking energy: -140.205 Base-Backbone interact. energy: -0.823 local terms energy: -121.021783 where: bonds (distance) C4'-P energy: -25.629 bonds (distance) P-C4' energy: -22.744 flat angles C4'-P-C4' energy: -23.220 flat angles P-C4'-P energy: -15.076 tors. eta vs tors. theta energy: -34.352 Dist. restrs. and SS energy: 0.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -444.493339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.493339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.079122 (E_RNA) where: Base-Base interactions energy: -321.638 where: short stacking energy: -133.377 Base-Backbone interact. energy: -0.059 local terms energy: -123.381367 where: bonds (distance) C4'-P energy: -21.929 bonds (distance) P-C4' energy: -20.270 flat angles C4'-P-C4' energy: -28.809 flat angles P-C4'-P energy: -13.933 tors. eta vs tors. theta energy: -38.440 Dist. restrs. and SS energy: 0.586 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -549.722554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.722554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.746939 (E_RNA) where: Base-Base interactions energy: -395.364 where: short stacking energy: -161.541 Base-Backbone interact. energy: -0.073 local terms energy: -154.310021 where: bonds (distance) C4'-P energy: -29.161 bonds (distance) P-C4' energy: -30.413 flat angles C4'-P-C4' energy: -31.356 flat angles P-C4'-P energy: -20.418 tors. eta vs tors. theta energy: -42.962 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -546.396855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.396855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.615266 (E_RNA) where: Base-Base interactions energy: -391.580 where: short stacking energy: -165.541 Base-Backbone interact. energy: -0.275 local terms energy: -154.760079 where: bonds (distance) C4'-P energy: -30.166 bonds (distance) P-C4' energy: -26.620 flat angles C4'-P-C4' energy: -33.751 flat angles P-C4'-P energy: -20.728 tors. eta vs tors. theta energy: -43.494 Dist. restrs. and SS energy: 0.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -539.746870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.746870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.886099 (E_RNA) where: Base-Base interactions energy: -386.102 where: short stacking energy: -152.176 Base-Backbone interact. energy: -0.818 local terms energy: -152.966429 where: bonds (distance) C4'-P energy: -24.094 bonds (distance) P-C4' energy: -29.849 flat angles C4'-P-C4' energy: -33.834 flat angles P-C4'-P energy: -24.482 tors. eta vs tors. theta energy: -40.707 Dist. restrs. and SS energy: 0.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -512.110917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.110917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.259910 (E_RNA) where: Base-Base interactions energy: -371.688 where: short stacking energy: -159.734 Base-Backbone interact. energy: -0.093 local terms energy: -140.478295 where: bonds (distance) C4'-P energy: -20.963 bonds (distance) P-C4' energy: -23.830 flat angles C4'-P-C4' energy: -31.829 flat angles P-C4'-P energy: -22.418 tors. eta vs tors. theta energy: -41.438 Dist. restrs. and SS energy: 0.149 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -525.338659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.338659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.873016 (E_RNA) where: Base-Base interactions energy: -375.555 where: short stacking energy: -169.762 Base-Backbone interact. energy: -0.055 local terms energy: -150.262990 where: bonds (distance) C4'-P energy: -22.202 bonds (distance) P-C4' energy: -26.288 flat angles C4'-P-C4' energy: -33.655 flat angles P-C4'-P energy: -24.197 tors. eta vs tors. theta energy: -43.921 Dist. restrs. and SS energy: 0.534 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -519.333068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.333068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.577193 (E_RNA) where: Base-Base interactions energy: -366.090 where: short stacking energy: -156.408 Base-Backbone interact. energy: -1.234 local terms energy: -152.253253 where: bonds (distance) C4'-P energy: -24.048 bonds (distance) P-C4' energy: -26.802 flat angles C4'-P-C4' energy: -29.669 flat angles P-C4'-P energy: -26.997 tors. eta vs tors. theta energy: -44.737 Dist. restrs. and SS energy: 0.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -482.084579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.084579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.188628 (E_RNA) where: Base-Base interactions energy: -339.972 where: short stacking energy: -142.639 Base-Backbone interact. energy: -0.752 local terms energy: -141.464749 where: bonds (distance) C4'-P energy: -25.327 bonds (distance) P-C4' energy: -25.992 flat angles C4'-P-C4' energy: -31.609 flat angles P-C4'-P energy: -20.735 tors. eta vs tors. theta energy: -37.801 Dist. restrs. and SS energy: 0.104 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -475.426445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.426445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.996743 (E_RNA) where: Base-Base interactions energy: -357.824 where: short stacking energy: -139.747 Base-Backbone interact. energy: -0.204 local terms energy: -119.968355 where: bonds (distance) C4'-P energy: -19.035 bonds (distance) P-C4' energy: -20.210 flat angles C4'-P-C4' energy: -26.640 flat angles P-C4'-P energy: -16.367 tors. eta vs tors. theta energy: -37.716 Dist. restrs. and SS energy: 2.570 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -482.058174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.058174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.493556 (E_RNA) where: Base-Base interactions energy: -341.084 where: short stacking energy: -143.312 Base-Backbone interact. energy: -0.109 local terms energy: -141.300382 where: bonds (distance) C4'-P energy: -26.637 bonds (distance) P-C4' energy: -22.381 flat angles C4'-P-C4' energy: -28.285 flat angles P-C4'-P energy: -25.463 tors. eta vs tors. theta energy: -38.535 Dist. restrs. and SS energy: 0.435 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -464.907882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.907882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.950337 (E_RNA) where: Base-Base interactions energy: -345.203 where: short stacking energy: -144.224 Base-Backbone interact. energy: -0.513 local terms energy: -119.234397 where: bonds (distance) C4'-P energy: -25.205 bonds (distance) P-C4' energy: -17.908 flat angles C4'-P-C4' energy: -25.183 flat angles P-C4'-P energy: -13.247 tors. eta vs tors. theta energy: -37.692 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -555.170496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.170496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.408997 (E_RNA) where: Base-Base interactions energy: -391.920 where: short stacking energy: -164.289 Base-Backbone interact. energy: -0.699 local terms energy: -162.789505 where: bonds (distance) C4'-P energy: -30.707 bonds (distance) P-C4' energy: -33.706 flat angles C4'-P-C4' energy: -31.940 flat angles P-C4'-P energy: -24.241 tors. eta vs tors. theta energy: -42.195 Dist. restrs. and SS energy: 0.239 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -542.015407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.015407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.308210 (E_RNA) where: Base-Base interactions energy: -384.317 where: short stacking energy: -164.751 Base-Backbone interact. energy: -0.522 local terms energy: -157.468704 where: bonds (distance) C4'-P energy: -23.794 bonds (distance) P-C4' energy: -34.268 flat angles C4'-P-C4' energy: -33.686 flat angles P-C4'-P energy: -21.767 tors. eta vs tors. theta energy: -43.954 Dist. restrs. and SS energy: 0.293 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -538.970183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.970183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.212655 (E_RNA) where: Base-Base interactions energy: -386.757 where: short stacking energy: -155.232 Base-Backbone interact. energy: -0.234 local terms energy: -152.222145 where: bonds (distance) C4'-P energy: -24.053 bonds (distance) P-C4' energy: -30.459 flat angles C4'-P-C4' energy: -31.063 flat angles P-C4'-P energy: -24.188 tors. eta vs tors. theta energy: -42.459 Dist. restrs. and SS energy: 0.242 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -516.159982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.159982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.352381 (E_RNA) where: Base-Base interactions energy: -370.818 where: short stacking energy: -161.285 Base-Backbone interact. energy: -1.991 local terms energy: -143.543880 where: bonds (distance) C4'-P energy: -24.513 bonds (distance) P-C4' energy: -25.265 flat angles C4'-P-C4' energy: -30.242 flat angles P-C4'-P energy: -20.476 tors. eta vs tors. theta energy: -43.048 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -525.971079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.971079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.129053 (E_RNA) where: Base-Base interactions energy: -366.532 where: short stacking energy: -168.714 Base-Backbone interact. energy: -0.161 local terms energy: -159.436684 where: bonds (distance) C4'-P energy: -27.156 bonds (distance) P-C4' energy: -31.135 flat angles C4'-P-C4' energy: -32.115 flat angles P-C4'-P energy: -22.672 tors. eta vs tors. theta energy: -46.358 Dist. restrs. and SS energy: 0.158 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -503.461663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.461663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.759527 (E_RNA) where: Base-Base interactions energy: -359.224 where: short stacking energy: -146.350 Base-Backbone interact. energy: -0.698 local terms energy: -143.837131 where: bonds (distance) C4'-P energy: -25.030 bonds (distance) P-C4' energy: -30.571 flat angles C4'-P-C4' energy: -29.691 flat angles P-C4'-P energy: -21.593 tors. eta vs tors. theta energy: -36.953 Dist. restrs. and SS energy: 0.298 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -493.288912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.288912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.741255 (E_RNA) where: Base-Base interactions energy: -340.275 where: short stacking energy: -151.502 Base-Backbone interact. energy: -0.575 local terms energy: -152.891129 where: bonds (distance) C4'-P energy: -28.261 bonds (distance) P-C4' energy: -24.700 flat angles C4'-P-C4' energy: -30.251 flat angles P-C4'-P energy: -24.368 tors. eta vs tors. theta energy: -45.312 Dist. restrs. and SS energy: 0.452 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -486.550428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.550428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.083386 (E_RNA) where: Base-Base interactions energy: -354.355 where: short stacking energy: -150.050 Base-Backbone interact. energy: -0.501 local terms energy: -135.227313 where: bonds (distance) C4'-P energy: -21.142 bonds (distance) P-C4' energy: -26.872 flat angles C4'-P-C4' energy: -28.852 flat angles P-C4'-P energy: -17.056 tors. eta vs tors. theta energy: -41.305 Dist. restrs. and SS energy: 3.533 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -483.266111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.266111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.919050 (E_RNA) where: Base-Base interactions energy: -348.248 where: short stacking energy: -141.593 Base-Backbone interact. energy: -0.035 local terms energy: -135.635717 where: bonds (distance) C4'-P energy: -17.180 bonds (distance) P-C4' energy: -28.499 flat angles C4'-P-C4' energy: -28.138 flat angles P-C4'-P energy: -19.855 tors. eta vs tors. theta energy: -41.963 Dist. restrs. and SS energy: 0.653 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -445.010275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.010275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.957541 (E_RNA) where: Base-Base interactions energy: -328.441 where: short stacking energy: -138.280 Base-Backbone interact. energy: -0.139 local terms energy: -119.377856 where: bonds (distance) C4'-P energy: -10.335 bonds (distance) P-C4' energy: -28.804 flat angles C4'-P-C4' energy: -28.817 flat angles P-C4'-P energy: -15.072 tors. eta vs tors. theta energy: -36.350 Dist. restrs. and SS energy: 2.947 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -554.241935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.241935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.281449 (E_RNA) where: Base-Base interactions energy: -397.460 where: short stacking energy: -163.539 Base-Backbone interact. energy: -0.417 local terms energy: -156.404748 where: bonds (distance) C4'-P energy: -28.353 bonds (distance) P-C4' energy: -27.900 flat angles C4'-P-C4' energy: -32.480 flat angles P-C4'-P energy: -27.382 tors. eta vs tors. theta energy: -40.291 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -561.873675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.873675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.164161 (E_RNA) where: Base-Base interactions energy: -406.987 where: short stacking energy: -165.800 Base-Backbone interact. energy: -0.667 local terms energy: -154.510257 where: bonds (distance) C4'-P energy: -27.902 bonds (distance) P-C4' energy: -32.041 flat angles C4'-P-C4' energy: -35.117 flat angles P-C4'-P energy: -21.948 tors. eta vs tors. theta energy: -37.502 Dist. restrs. and SS energy: 0.290 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -548.515264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.515264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.813701 (E_RNA) where: Base-Base interactions energy: -391.606 where: short stacking energy: -164.569 Base-Backbone interact. energy: -0.731 local terms energy: -156.476759 where: bonds (distance) C4'-P energy: -31.465 bonds (distance) P-C4' energy: -27.140 flat angles C4'-P-C4' energy: -32.105 flat angles P-C4'-P energy: -22.221 tors. eta vs tors. theta energy: -43.547 Dist. restrs. and SS energy: 0.298 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -532.072264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.072264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.457679 (E_RNA) where: Base-Base interactions energy: -370.857 where: short stacking energy: -168.126 Base-Backbone interact. energy: -0.002 local terms energy: -161.598968 where: bonds (distance) C4'-P energy: -25.127 bonds (distance) P-C4' energy: -25.511 flat angles C4'-P-C4' energy: -35.520 flat angles P-C4'-P energy: -27.855 tors. eta vs tors. theta energy: -47.586 Dist. restrs. and SS energy: 0.385 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -518.845664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.845664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.108350 (E_RNA) where: Base-Base interactions energy: -367.294 where: short stacking energy: -155.191 Base-Backbone interact. energy: -0.983 local terms energy: -150.831061 where: bonds (distance) C4'-P energy: -28.199 bonds (distance) P-C4' energy: -30.440 flat angles C4'-P-C4' energy: -26.214 flat angles P-C4'-P energy: -21.288 tors. eta vs tors. theta energy: -44.690 Dist. restrs. and SS energy: 0.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -516.488236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.488236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.726516 (E_RNA) where: Base-Base interactions energy: -379.854 where: short stacking energy: -151.660 Base-Backbone interact. energy: -0.244 local terms energy: -136.628500 where: bonds (distance) C4'-P energy: -25.162 bonds (distance) P-C4' energy: -25.982 flat angles C4'-P-C4' energy: -26.150 flat angles P-C4'-P energy: -18.398 tors. eta vs tors. theta energy: -40.937 Dist. restrs. and SS energy: 0.238 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -486.092490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.092490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.335553 (E_RNA) where: Base-Base interactions energy: -341.137 where: short stacking energy: -138.983 Base-Backbone interact. energy: -0.284 local terms energy: -144.914491 where: bonds (distance) C4'-P energy: -30.199 bonds (distance) P-C4' energy: -24.904 flat angles C4'-P-C4' energy: -30.448 flat angles P-C4'-P energy: -16.551 tors. eta vs tors. theta energy: -42.813 Dist. restrs. and SS energy: 0.243 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -479.110853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.110853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.723280 (E_RNA) where: Base-Base interactions energy: -343.133 where: short stacking energy: -143.737 Base-Backbone interact. energy: -0.540 local terms energy: -136.049919 where: bonds (distance) C4'-P energy: -15.763 bonds (distance) P-C4' energy: -29.787 flat angles C4'-P-C4' energy: -27.533 flat angles P-C4'-P energy: -21.933 tors. eta vs tors. theta energy: -41.033 Dist. restrs. and SS energy: 0.612 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -473.872727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.872727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.397210 (E_RNA) where: Base-Base interactions energy: -351.008 where: short stacking energy: -144.132 Base-Backbone interact. energy: -0.262 local terms energy: -125.126576 where: bonds (distance) C4'-P energy: -18.160 bonds (distance) P-C4' energy: -27.919 flat angles C4'-P-C4' energy: -27.813 flat angles P-C4'-P energy: -10.582 tors. eta vs tors. theta energy: -40.652 Dist. restrs. and SS energy: 2.524 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -459.356767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.356767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.820015 (E_RNA) where: Base-Base interactions energy: -332.977 where: short stacking energy: -134.736 Base-Backbone interact. energy: -0.388 local terms energy: -126.455570 where: bonds (distance) C4'-P energy: -27.297 bonds (distance) P-C4' energy: -24.710 flat angles C4'-P-C4' energy: -22.978 flat angles P-C4'-P energy: -19.232 tors. eta vs tors. theta energy: -32.239 Dist. restrs. and SS energy: 0.463 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -557.727652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.727652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.929362 (E_RNA) where: Base-Base interactions energy: -409.558 where: short stacking energy: -169.134 Base-Backbone interact. energy: -0.540 local terms energy: -147.831350 where: bonds (distance) C4'-P energy: -27.910 bonds (distance) P-C4' energy: -25.721 flat angles C4'-P-C4' energy: -31.017 flat angles P-C4'-P energy: -21.070 tors. eta vs tors. theta energy: -42.114 Dist. restrs. and SS energy: 0.202 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -544.132593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.132593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.560789 (E_RNA) where: Base-Base interactions energy: -388.128 where: short stacking energy: -164.256 Base-Backbone interact. energy: -0.400 local terms energy: -156.032691 where: bonds (distance) C4'-P energy: -28.949 bonds (distance) P-C4' energy: -31.357 flat angles C4'-P-C4' energy: -33.526 flat angles P-C4'-P energy: -19.506 tors. eta vs tors. theta energy: -42.695 Dist. restrs. and SS energy: 0.428 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -539.867283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.867283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.008989 (E_RNA) where: Base-Base interactions energy: -387.441 where: short stacking energy: -157.232 Base-Backbone interact. energy: -0.511 local terms energy: -152.057369 where: bonds (distance) C4'-P energy: -26.304 bonds (distance) P-C4' energy: -29.334 flat angles C4'-P-C4' energy: -30.774 flat angles P-C4'-P energy: -24.058 tors. eta vs tors. theta energy: -41.588 Dist. restrs. and SS energy: 0.142 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -521.878970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.878970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.073913 (E_RNA) where: Base-Base interactions energy: -372.704 where: short stacking energy: -158.519 Base-Backbone interact. energy: 1.634 local terms energy: -151.003532 where: bonds (distance) C4'-P energy: -25.078 bonds (distance) P-C4' energy: -29.647 flat angles C4'-P-C4' energy: -27.919 flat angles P-C4'-P energy: -23.892 tors. eta vs tors. theta energy: -44.468 Dist. restrs. and SS energy: 0.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -536.868385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.868385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.072278 (E_RNA) where: Base-Base interactions energy: -381.155 where: short stacking energy: -153.722 Base-Backbone interact. energy: -0.438 local terms energy: -155.479927 where: bonds (distance) C4'-P energy: -28.692 bonds (distance) P-C4' energy: -29.577 flat angles C4'-P-C4' energy: -29.875 flat angles P-C4'-P energy: -24.680 tors. eta vs tors. theta energy: -42.656 Dist. restrs. and SS energy: 0.204 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -503.645105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.645105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.736132 (E_RNA) where: Base-Base interactions energy: -359.717 where: short stacking energy: -166.044 Base-Backbone interact. energy: -0.006 local terms energy: -144.012620 where: bonds (distance) C4'-P energy: -23.050 bonds (distance) P-C4' energy: -26.434 flat angles C4'-P-C4' energy: -27.186 flat angles P-C4'-P energy: -19.088 tors. eta vs tors. theta energy: -48.254 Dist. restrs. and SS energy: 0.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -512.382363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.382363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.736207 (E_RNA) where: Base-Base interactions energy: -369.038 where: short stacking energy: -158.861 Base-Backbone interact. energy: -0.643 local terms energy: -143.054397 where: bonds (distance) C4'-P energy: -24.101 bonds (distance) P-C4' energy: -31.474 flat angles C4'-P-C4' energy: -28.334 flat angles P-C4'-P energy: -20.210 tors. eta vs tors. theta energy: -38.935 Dist. restrs. and SS energy: 0.354 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -485.854613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.854613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.052894 (E_RNA) where: Base-Base interactions energy: -345.860 where: short stacking energy: -141.533 Base-Backbone interact. energy: -0.022 local terms energy: -140.170390 where: bonds (distance) C4'-P energy: -30.184 bonds (distance) P-C4' energy: -23.939 flat angles C4'-P-C4' energy: -30.185 flat angles P-C4'-P energy: -14.976 tors. eta vs tors. theta energy: -40.887 Dist. restrs. and SS energy: 0.198 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -455.539018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.539018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.818040 (E_RNA) where: Base-Base interactions energy: -333.331 where: short stacking energy: -130.216 Base-Backbone interact. energy: -1.275 local terms energy: -121.212258 where: bonds (distance) C4'-P energy: -16.505 bonds (distance) P-C4' energy: -24.370 flat angles C4'-P-C4' energy: -29.773 flat angles P-C4'-P energy: -16.193 tors. eta vs tors. theta energy: -34.371 Dist. restrs. and SS energy: 0.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -460.723065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.723065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.342710 (E_RNA) where: Base-Base interactions energy: -338.694 where: short stacking energy: -151.887 Base-Backbone interact. energy: -0.052 local terms energy: -122.596628 where: bonds (distance) C4'-P energy: -20.057 bonds (distance) P-C4' energy: -20.801 flat angles C4'-P-C4' energy: -28.351 flat angles P-C4'-P energy: -13.661 tors. eta vs tors. theta energy: -39.726 Dist. restrs. and SS energy: 0.620 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -555.996348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.996348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.121872 (E_RNA) where: Base-Base interactions energy: -400.324 where: short stacking energy: -169.283 Base-Backbone interact. energy: -0.721 local terms energy: -155.076915 where: bonds (distance) C4'-P energy: -27.241 bonds (distance) P-C4' energy: -28.271 flat angles C4'-P-C4' energy: -34.998 flat angles P-C4'-P energy: -25.054 tors. eta vs tors. theta energy: -39.513 Dist. restrs. and SS energy: 0.126 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -546.302893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.302893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.415555 (E_RNA) where: Base-Base interactions energy: -385.392 where: short stacking energy: -151.113 Base-Backbone interact. energy: -0.059 local terms energy: -160.964121 where: bonds (distance) C4'-P energy: -28.826 bonds (distance) P-C4' energy: -28.609 flat angles C4'-P-C4' energy: -35.890 flat angles P-C4'-P energy: -25.749 tors. eta vs tors. theta energy: -41.889 Dist. restrs. and SS energy: 0.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -547.036419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.036419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.106050 (E_RNA) where: Base-Base interactions energy: -398.913 where: short stacking energy: -167.387 Base-Backbone interact. energy: -1.524 local terms energy: -146.668773 where: bonds (distance) C4'-P energy: -26.764 bonds (distance) P-C4' energy: -27.001 flat angles C4'-P-C4' energy: -31.894 flat angles P-C4'-P energy: -22.387 tors. eta vs tors. theta energy: -38.623 Dist. restrs. and SS energy: 0.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -539.997783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.997783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.056912 (E_RNA) where: Base-Base interactions energy: -389.144 where: short stacking energy: -161.261 Base-Backbone interact. energy: -0.101 local terms energy: -150.812121 where: bonds (distance) C4'-P energy: -29.199 bonds (distance) P-C4' energy: -24.162 flat angles C4'-P-C4' energy: -34.602 flat angles P-C4'-P energy: -20.085 tors. eta vs tors. theta energy: -42.764 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -531.784624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.784624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.220917 (E_RNA) where: Base-Base interactions energy: -379.520 where: short stacking energy: -152.299 Base-Backbone interact. energy: -1.051 local terms energy: -151.650050 where: bonds (distance) C4'-P energy: -29.180 bonds (distance) P-C4' energy: -27.187 flat angles C4'-P-C4' energy: -31.220 flat angles P-C4'-P energy: -23.061 tors. eta vs tors. theta energy: -41.002 Dist. restrs. and SS energy: 0.436 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -521.447725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.447725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.794355 (E_RNA) where: Base-Base interactions energy: -369.012 where: short stacking energy: -150.091 Base-Backbone interact. energy: -0.623 local terms energy: -152.160078 where: bonds (distance) C4'-P energy: -29.350 bonds (distance) P-C4' energy: -26.543 flat angles C4'-P-C4' energy: -34.180 flat angles P-C4'-P energy: -22.067 tors. eta vs tors. theta energy: -40.020 Dist. restrs. and SS energy: 0.347 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -495.786471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.786471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.478276 (E_RNA) where: Base-Base interactions energy: -344.080 where: short stacking energy: -157.330 Base-Backbone interact. energy: -0.322 local terms energy: -152.076222 where: bonds (distance) C4'-P energy: -26.721 bonds (distance) P-C4' energy: -25.742 flat angles C4'-P-C4' energy: -30.405 flat angles P-C4'-P energy: -23.704 tors. eta vs tors. theta energy: -45.504 Dist. restrs. and SS energy: 0.692 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -476.772826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.772826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.216606 (E_RNA) where: Base-Base interactions energy: -343.182 where: short stacking energy: -148.039 Base-Backbone interact. energy: 2.436 local terms energy: -136.470675 where: bonds (distance) C4'-P energy: -22.075 bonds (distance) P-C4' energy: -25.093 flat angles C4'-P-C4' energy: -28.168 flat angles P-C4'-P energy: -22.005 tors. eta vs tors. theta energy: -39.130 Dist. restrs. and SS energy: 0.444 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -462.955395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.955395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.774407 (E_RNA) where: Base-Base interactions energy: -319.444 where: short stacking energy: -141.485 Base-Backbone interact. energy: -1.011 local terms energy: -143.319859 where: bonds (distance) C4'-P energy: -21.764 bonds (distance) P-C4' energy: -30.410 flat angles C4'-P-C4' energy: -30.455 flat angles P-C4'-P energy: -20.260 tors. eta vs tors. theta energy: -40.431 Dist. restrs. and SS energy: 0.819 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -438.997723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.997723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.476829 (E_RNA) where: Base-Base interactions energy: -320.015 where: short stacking energy: -127.621 Base-Backbone interact. energy: -0.291 local terms energy: -119.170987 where: bonds (distance) C4'-P energy: -22.052 bonds (distance) P-C4' energy: -25.191 flat angles C4'-P-C4' energy: -24.648 flat angles P-C4'-P energy: -18.371 tors. eta vs tors. theta energy: -28.908 Dist. restrs. and SS energy: 0.479 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -555.877032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.877032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.036041 (E_RNA) where: Base-Base interactions energy: -393.418 where: short stacking energy: -157.745 Base-Backbone interact. energy: 0.482 local terms energy: -163.100050 where: bonds (distance) C4'-P energy: -30.690 bonds (distance) P-C4' energy: -32.074 flat angles C4'-P-C4' energy: -32.511 flat angles P-C4'-P energy: -24.795 tors. eta vs tors. theta energy: -43.031 Dist. restrs. and SS energy: 0.159 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -539.650073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.650073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.764267 (E_RNA) where: Base-Base interactions energy: -392.782 where: short stacking energy: -147.929 Base-Backbone interact. energy: -0.339 local terms energy: -146.643934 where: bonds (distance) C4'-P energy: -20.894 bonds (distance) P-C4' energy: -33.419 flat angles C4'-P-C4' energy: -31.640 flat angles P-C4'-P energy: -20.003 tors. eta vs tors. theta energy: -40.688 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -549.177415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.177415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.263459 (E_RNA) where: Base-Base interactions energy: -394.613 where: short stacking energy: -160.532 Base-Backbone interact. energy: -0.125 local terms energy: -154.525031 where: bonds (distance) C4'-P energy: -23.176 bonds (distance) P-C4' energy: -30.280 flat angles C4'-P-C4' energy: -35.392 flat angles P-C4'-P energy: -24.925 tors. eta vs tors. theta energy: -40.752 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -529.773660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.773660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.898841 (E_RNA) where: Base-Base interactions energy: -379.347 where: short stacking energy: -153.836 Base-Backbone interact. energy: -0.506 local terms energy: -150.045960 where: bonds (distance) C4'-P energy: -19.821 bonds (distance) P-C4' energy: -27.827 flat angles C4'-P-C4' energy: -33.174 flat angles P-C4'-P energy: -26.388 tors. eta vs tors. theta energy: -42.835 Dist. restrs. and SS energy: 0.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -505.678675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.678675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.951118 (E_RNA) where: Base-Base interactions energy: -360.838 where: short stacking energy: -154.841 Base-Backbone interact. energy: -0.270 local terms energy: -144.842658 where: bonds (distance) C4'-P energy: -25.682 bonds (distance) P-C4' energy: -29.247 flat angles C4'-P-C4' energy: -28.025 flat angles P-C4'-P energy: -20.121 tors. eta vs tors. theta energy: -41.767 Dist. restrs. and SS energy: 0.272 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -495.388135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.388135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.646192 (E_RNA) where: Base-Base interactions energy: -354.157 where: short stacking energy: -145.799 Base-Backbone interact. energy: -0.364 local terms energy: -141.125128 where: bonds (distance) C4'-P energy: -22.103 bonds (distance) P-C4' energy: -30.348 flat angles C4'-P-C4' energy: -28.189 flat angles P-C4'-P energy: -23.105 tors. eta vs tors. theta energy: -37.381 Dist. restrs. and SS energy: 0.258 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -496.832028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.832028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.966464 (E_RNA) where: Base-Base interactions energy: -349.619 where: short stacking energy: -147.526 Base-Backbone interact. energy: -0.328 local terms energy: -147.020144 where: bonds (distance) C4'-P energy: -24.904 bonds (distance) P-C4' energy: -25.315 flat angles C4'-P-C4' energy: -30.255 flat angles P-C4'-P energy: -22.664 tors. eta vs tors. theta energy: -43.882 Dist. restrs. and SS energy: 0.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -418.480168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.480168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.043285 (E_RNA) where: Base-Base interactions energy: -308.212 where: short stacking energy: -124.394 Base-Backbone interact. energy: -0.533 local terms energy: -112.298402 where: bonds (distance) C4'-P energy: -22.756 bonds (distance) P-C4' energy: -25.224 flat angles C4'-P-C4' energy: -25.122 flat angles P-C4'-P energy: -17.032 tors. eta vs tors. theta energy: -22.164 Dist. restrs. and SS energy: 2.563 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -485.569926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.569926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.995154 (E_RNA) where: Base-Base interactions energy: -348.764 where: short stacking energy: -151.441 Base-Backbone interact. energy: -0.083 local terms energy: -137.148817 where: bonds (distance) C4'-P energy: -22.988 bonds (distance) P-C4' energy: -28.011 flat angles C4'-P-C4' energy: -27.653 flat angles P-C4'-P energy: -23.365 tors. eta vs tors. theta energy: -35.132 Dist. restrs. and SS energy: 0.425 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -441.254506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.254506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.632898 (E_RNA) where: Base-Base interactions energy: -312.286 where: short stacking energy: -127.955 Base-Backbone interact. energy: -0.120 local terms energy: -129.227032 where: bonds (distance) C4'-P energy: -21.327 bonds (distance) P-C4' energy: -25.567 flat angles C4'-P-C4' energy: -29.540 flat angles P-C4'-P energy: -18.009 tors. eta vs tors. theta energy: -34.785 Dist. restrs. and SS energy: 0.378 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -556.530829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.530829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.616465 (E_RNA) where: Base-Base interactions energy: -398.127 where: short stacking energy: -159.970 Base-Backbone interact. energy: -0.638 local terms energy: -157.851300 where: bonds (distance) C4'-P energy: -30.606 bonds (distance) P-C4' energy: -30.245 flat angles C4'-P-C4' energy: -31.660 flat angles P-C4'-P energy: -21.058 tors. eta vs tors. theta energy: -44.282 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -544.333628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.333628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.538322 (E_RNA) where: Base-Base interactions energy: -392.474 where: short stacking energy: -158.131 Base-Backbone interact. energy: -1.620 local terms energy: -150.444308 where: bonds (distance) C4'-P energy: -23.975 bonds (distance) P-C4' energy: -29.556 flat angles C4'-P-C4' energy: -35.937 flat angles P-C4'-P energy: -19.473 tors. eta vs tors. theta energy: -41.504 Dist. restrs. and SS energy: 0.205 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -534.502272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.502272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.699091 (E_RNA) where: Base-Base interactions energy: -376.447 where: short stacking energy: -154.242 Base-Backbone interact. energy: -0.087 local terms energy: -158.164737 where: bonds (distance) C4'-P energy: -29.673 bonds (distance) P-C4' energy: -33.935 flat angles C4'-P-C4' energy: -29.693 flat angles P-C4'-P energy: -23.640 tors. eta vs tors. theta energy: -41.224 Dist. restrs. and SS energy: 0.197 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -530.383568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.383568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.545065 (E_RNA) where: Base-Base interactions energy: -367.237 where: short stacking energy: -153.551 Base-Backbone interact. energy: -0.483 local terms energy: -162.824726 where: bonds (distance) C4'-P energy: -32.062 bonds (distance) P-C4' energy: -31.331 flat angles C4'-P-C4' energy: -32.014 flat angles P-C4'-P energy: -20.716 tors. eta vs tors. theta energy: -46.701 Dist. restrs. and SS energy: 0.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -527.029049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.029049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.125315 (E_RNA) where: Base-Base interactions energy: -383.003 where: short stacking energy: -144.096 Base-Backbone interact. energy: -0.273 local terms energy: -143.849101 where: bonds (distance) C4'-P energy: -30.982 bonds (distance) P-C4' energy: -28.103 flat angles C4'-P-C4' energy: -21.504 flat angles P-C4'-P energy: -21.388 tors. eta vs tors. theta energy: -41.872 Dist. restrs. and SS energy: 0.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -517.925510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.925510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.156861 (E_RNA) where: Base-Base interactions energy: -365.144 where: short stacking energy: -166.011 Base-Backbone interact. energy: -0.107 local terms energy: -152.905327 where: bonds (distance) C4'-P energy: -26.920 bonds (distance) P-C4' energy: -25.544 flat angles C4'-P-C4' energy: -32.101 flat angles P-C4'-P energy: -21.956 tors. eta vs tors. theta energy: -46.383 Dist. restrs. and SS energy: 0.231 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -510.905681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.905681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.147947 (E_RNA) where: Base-Base interactions energy: -363.699 where: short stacking energy: -150.715 Base-Backbone interact. energy: -0.693 local terms energy: -146.755109 where: bonds (distance) C4'-P energy: -29.902 bonds (distance) P-C4' energy: -21.731 flat angles C4'-P-C4' energy: -30.761 flat angles P-C4'-P energy: -20.500 tors. eta vs tors. theta energy: -43.862 Dist. restrs. and SS energy: 0.242 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -489.728729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.728729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.164965 (E_RNA) where: Base-Base interactions energy: -344.641 where: short stacking energy: -146.909 Base-Backbone interact. energy: -1.475 local terms energy: -144.049059 where: bonds (distance) C4'-P energy: -26.011 bonds (distance) P-C4' energy: -27.204 flat angles C4'-P-C4' energy: -30.992 flat angles P-C4'-P energy: -15.168 tors. eta vs tors. theta energy: -44.675 Dist. restrs. and SS energy: 0.436 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -456.535138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.535138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.725366 (E_RNA) where: Base-Base interactions energy: -323.728 where: short stacking energy: -135.986 Base-Backbone interact. energy: -0.518 local terms energy: -132.479416 where: bonds (distance) C4'-P energy: -19.970 bonds (distance) P-C4' energy: -27.556 flat angles C4'-P-C4' energy: -31.250 flat angles P-C4'-P energy: -15.262 tors. eta vs tors. theta energy: -38.440 Dist. restrs. and SS energy: 0.190 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -437.031415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.031415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.537025 (E_RNA) where: Base-Base interactions energy: -309.458 where: short stacking energy: -127.378 Base-Backbone interact. energy: -0.527 local terms energy: -127.552507 where: bonds (distance) C4'-P energy: -30.317 bonds (distance) P-C4' energy: -23.068 flat angles C4'-P-C4' energy: -23.905 flat angles P-C4'-P energy: -17.569 tors. eta vs tors. theta energy: -32.693 Dist. restrs. and SS energy: 0.506 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -551.622805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.622805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.847809 (E_RNA) where: Base-Base interactions energy: -398.116 where: short stacking energy: -161.881 Base-Backbone interact. energy: -0.774 local terms energy: -152.957414 where: bonds (distance) C4'-P energy: -27.768 bonds (distance) P-C4' energy: -24.068 flat angles C4'-P-C4' energy: -33.640 flat angles P-C4'-P energy: -25.411 tors. eta vs tors. theta energy: -42.070 Dist. restrs. and SS energy: 0.225 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -546.401805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.401805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.588861 (E_RNA) where: Base-Base interactions energy: -395.661 where: short stacking energy: -165.823 Base-Backbone interact. energy: -1.186 local terms energy: -149.741190 where: bonds (distance) C4'-P energy: -28.597 bonds (distance) P-C4' energy: -29.872 flat angles C4'-P-C4' energy: -32.978 flat angles P-C4'-P energy: -19.458 tors. eta vs tors. theta energy: -38.836 Dist. restrs. and SS energy: 0.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -526.462763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.462763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.566627 (E_RNA) where: Base-Base interactions energy: -362.375 where: short stacking energy: -147.886 Base-Backbone interact. energy: -1.028 local terms energy: -163.163662 where: bonds (distance) C4'-P energy: -31.566 bonds (distance) P-C4' energy: -36.779 flat angles C4'-P-C4' energy: -31.510 flat angles P-C4'-P energy: -24.763 tors. eta vs tors. theta energy: -38.546 Dist. restrs. and SS energy: 0.104 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -533.603575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.603575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.649172 (E_RNA) where: Base-Base interactions energy: -382.493 where: short stacking energy: -149.224 Base-Backbone interact. energy: 0.289 local terms energy: -151.444775 where: bonds (distance) C4'-P energy: -26.617 bonds (distance) P-C4' energy: -28.102 flat angles C4'-P-C4' energy: -34.240 flat angles P-C4'-P energy: -20.440 tors. eta vs tors. theta energy: -42.045 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -515.583176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.583176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.642507 (E_RNA) where: Base-Base interactions energy: -365.746 where: short stacking energy: -152.805 Base-Backbone interact. energy: -0.476 local terms energy: -149.420339 where: bonds (distance) C4'-P energy: -24.063 bonds (distance) P-C4' energy: -28.094 flat angles C4'-P-C4' energy: -35.032 flat angles P-C4'-P energy: -21.353 tors. eta vs tors. theta energy: -40.879 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -508.796919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.796919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.914922 (E_RNA) where: Base-Base interactions energy: -365.966 where: short stacking energy: -157.469 Base-Backbone interact. energy: -0.305 local terms energy: -142.643803 where: bonds (distance) C4'-P energy: -17.800 bonds (distance) P-C4' energy: -25.238 flat angles C4'-P-C4' energy: -33.176 flat angles P-C4'-P energy: -22.434 tors. eta vs tors. theta energy: -43.996 Dist. restrs. and SS energy: 0.118 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -493.816404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.816404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.189075 (E_RNA) where: Base-Base interactions energy: -355.023 where: short stacking energy: -166.030 Base-Backbone interact. energy: -0.161 local terms energy: -139.005483 where: bonds (distance) C4'-P energy: -20.160 bonds (distance) P-C4' energy: -27.127 flat angles C4'-P-C4' energy: -27.858 flat angles P-C4'-P energy: -17.670 tors. eta vs tors. theta energy: -46.192 Dist. restrs. and SS energy: 0.373 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -476.122657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.122657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.357312 (E_RNA) where: Base-Base interactions energy: -340.990 where: short stacking energy: -145.282 Base-Backbone interact. energy: -0.442 local terms energy: -134.925239 where: bonds (distance) C4'-P energy: -24.783 bonds (distance) P-C4' energy: -26.850 flat angles C4'-P-C4' energy: -22.473 flat angles P-C4'-P energy: -23.446 tors. eta vs tors. theta energy: -37.372 Dist. restrs. and SS energy: 0.235 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -445.635352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.635352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.908451 (E_RNA) where: Base-Base interactions energy: -327.117 where: short stacking energy: -133.760 Base-Backbone interact. energy: 0.699 local terms energy: -125.490025 where: bonds (distance) C4'-P energy: -24.176 bonds (distance) P-C4' energy: -18.684 flat angles C4'-P-C4' energy: -29.033 flat angles P-C4'-P energy: -18.360 tors. eta vs tors. theta energy: -35.236 Dist. restrs. and SS energy: 6.273 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -456.638351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.638351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.378952 (E_RNA) where: Base-Base interactions energy: -330.996 where: short stacking energy: -136.405 Base-Backbone interact. energy: 0.382 local terms energy: -126.765542 where: bonds (distance) C4'-P energy: -19.689 bonds (distance) P-C4' energy: -28.516 flat angles C4'-P-C4' energy: -27.758 flat angles P-C4'-P energy: -16.250 tors. eta vs tors. theta energy: -34.552 Dist. restrs. and SS energy: 0.741 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -552.466393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.466393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.528370 (E_RNA) where: Base-Base interactions energy: -400.103 where: short stacking energy: -158.423 Base-Backbone interact. energy: -0.487 local terms energy: -151.937736 where: bonds (distance) C4'-P energy: -26.246 bonds (distance) P-C4' energy: -30.890 flat angles C4'-P-C4' energy: -31.728 flat angles P-C4'-P energy: -24.447 tors. eta vs tors. theta energy: -38.627 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -543.038629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.038629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.148990 (E_RNA) where: Base-Base interactions energy: -387.492 where: short stacking energy: -170.960 Base-Backbone interact. energy: -0.558 local terms energy: -155.098906 where: bonds (distance) C4'-P energy: -27.528 bonds (distance) P-C4' energy: -30.234 flat angles C4'-P-C4' energy: -31.949 flat angles P-C4'-P energy: -22.877 tors. eta vs tors. theta energy: -42.512 Dist. restrs. and SS energy: 0.110 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -530.711326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.711326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.058035 (E_RNA) where: Base-Base interactions energy: -370.144 where: short stacking energy: -155.481 Base-Backbone interact. energy: -0.117 local terms energy: -160.797202 where: bonds (distance) C4'-P energy: -29.222 bonds (distance) P-C4' energy: -32.791 flat angles C4'-P-C4' energy: -34.117 flat angles P-C4'-P energy: -24.182 tors. eta vs tors. theta energy: -40.485 Dist. restrs. and SS energy: 0.347 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -538.047343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.047343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.372510 (E_RNA) where: Base-Base interactions energy: -390.986 where: short stacking energy: -158.562 Base-Backbone interact. energy: -0.140 local terms energy: -147.246897 where: bonds (distance) C4'-P energy: -24.110 bonds (distance) P-C4' energy: -25.249 flat angles C4'-P-C4' energy: -32.464 flat angles P-C4'-P energy: -25.234 tors. eta vs tors. theta energy: -40.190 Dist. restrs. and SS energy: 0.325 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -519.140538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.140538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.200876 (E_RNA) where: Base-Base interactions energy: -376.342 where: short stacking energy: -165.533 Base-Backbone interact. energy: -0.630 local terms energy: -142.228881 where: bonds (distance) C4'-P energy: -18.689 bonds (distance) P-C4' energy: -31.576 flat angles C4'-P-C4' energy: -27.292 flat angles P-C4'-P energy: -15.943 tors. eta vs tors. theta energy: -48.729 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -503.928517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.928517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.142760 (E_RNA) where: Base-Base interactions energy: -362.056 where: short stacking energy: -164.721 Base-Backbone interact. energy: -0.578 local terms energy: -141.509026 where: bonds (distance) C4'-P energy: -19.818 bonds (distance) P-C4' energy: -19.229 flat angles C4'-P-C4' energy: -33.746 flat angles P-C4'-P energy: -24.891 tors. eta vs tors. theta energy: -43.825 Dist. restrs. and SS energy: 0.214 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -502.649337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.649337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.704080 (E_RNA) where: Base-Base interactions energy: -363.834 where: short stacking energy: -160.825 Base-Backbone interact. energy: -0.102 local terms energy: -138.767523 where: bonds (distance) C4'-P energy: -23.130 bonds (distance) P-C4' energy: -26.435 flat angles C4'-P-C4' energy: -25.389 flat angles P-C4'-P energy: -21.940 tors. eta vs tors. theta energy: -41.874 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -473.593875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.593875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.498448 (E_RNA) where: Base-Base interactions energy: -334.439 where: short stacking energy: -144.576 Base-Backbone interact. energy: -0.627 local terms energy: -140.432064 where: bonds (distance) C4'-P energy: -24.825 bonds (distance) P-C4' energy: -19.429 flat angles C4'-P-C4' energy: -32.243 flat angles P-C4'-P energy: -21.849 tors. eta vs tors. theta energy: -42.086 Dist. restrs. and SS energy: 1.905 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -479.692466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.692466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.159688 (E_RNA) where: Base-Base interactions energy: -335.515 where: short stacking energy: -155.626 Base-Backbone interact. energy: -0.050 local terms energy: -144.595016 where: bonds (distance) C4'-P energy: -24.813 bonds (distance) P-C4' energy: -26.071 flat angles C4'-P-C4' energy: -26.813 flat angles P-C4'-P energy: -22.962 tors. eta vs tors. theta energy: -43.937 Dist. restrs. and SS energy: 0.467 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -468.433350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.433350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.676800 (E_RNA) where: Base-Base interactions energy: -332.897 where: short stacking energy: -134.200 Base-Backbone interact. energy: -0.610 local terms energy: -135.169425 where: bonds (distance) C4'-P energy: -26.950 bonds (distance) P-C4' energy: -20.573 flat angles C4'-P-C4' energy: -30.642 flat angles P-C4'-P energy: -20.730 tors. eta vs tors. theta energy: -36.274 Dist. restrs. and SS energy: 0.243 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -559.095936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.095936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.244019 (E_RNA) where: Base-Base interactions energy: -399.770 where: short stacking energy: -165.713 Base-Backbone interact. energy: -0.147 local terms energy: -159.326474 where: bonds (distance) C4'-P energy: -29.029 bonds (distance) P-C4' energy: -28.265 flat angles C4'-P-C4' energy: -32.908 flat angles P-C4'-P energy: -24.249 tors. eta vs tors. theta energy: -44.875 Dist. restrs. and SS energy: 0.148 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -546.830050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.830050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.846299 (E_RNA) where: Base-Base interactions energy: -394.998 where: short stacking energy: -158.518 Base-Backbone interact. energy: -0.691 local terms energy: -151.157494 where: bonds (distance) C4'-P energy: -21.195 bonds (distance) P-C4' energy: -28.314 flat angles C4'-P-C4' energy: -33.616 flat angles P-C4'-P energy: -22.151 tors. eta vs tors. theta energy: -45.881 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -530.452638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.452638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.784942 (E_RNA) where: Base-Base interactions energy: -375.782 where: short stacking energy: -168.225 Base-Backbone interact. energy: -0.533 local terms energy: -154.469661 where: bonds (distance) C4'-P energy: -27.620 bonds (distance) P-C4' energy: -27.860 flat angles C4'-P-C4' energy: -30.664 flat angles P-C4'-P energy: -23.238 tors. eta vs tors. theta energy: -45.087 Dist. restrs. and SS energy: 0.332 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -517.318018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.318018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.439348 (E_RNA) where: Base-Base interactions energy: -368.106 where: short stacking energy: -151.199 Base-Backbone interact. energy: -0.123 local terms energy: -149.211100 where: bonds (distance) C4'-P energy: -28.437 bonds (distance) P-C4' energy: -25.813 flat angles C4'-P-C4' energy: -30.516 flat angles P-C4'-P energy: -23.701 tors. eta vs tors. theta energy: -40.744 Dist. restrs. and SS energy: 0.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -522.119421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.119421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.201001 (E_RNA) where: Base-Base interactions energy: -381.983 where: short stacking energy: -156.853 Base-Backbone interact. energy: -0.088 local terms energy: -140.130321 where: bonds (distance) C4'-P energy: -21.708 bonds (distance) P-C4' energy: -23.707 flat angles C4'-P-C4' energy: -30.540 flat angles P-C4'-P energy: -23.822 tors. eta vs tors. theta energy: -40.354 Dist. restrs. and SS energy: 0.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -517.840747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.840747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.438441 (E_RNA) where: Base-Base interactions energy: -371.598 where: short stacking energy: -166.733 Base-Backbone interact. energy: -0.147 local terms energy: -146.693802 where: bonds (distance) C4'-P energy: -26.785 bonds (distance) P-C4' energy: -28.449 flat angles C4'-P-C4' energy: -28.942 flat angles P-C4'-P energy: -20.180 tors. eta vs tors. theta energy: -42.338 Dist. restrs. and SS energy: 0.598 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -495.941270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.941270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.063529 (E_RNA) where: Base-Base interactions energy: -344.206 where: short stacking energy: -148.590 Base-Backbone interact. energy: -0.043 local terms energy: -151.815083 where: bonds (distance) C4'-P energy: -27.003 bonds (distance) P-C4' energy: -28.990 flat angles C4'-P-C4' energy: -28.608 flat angles P-C4'-P energy: -24.153 tors. eta vs tors. theta energy: -43.062 Dist. restrs. and SS energy: 0.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -489.994357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.994357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.834484 (E_RNA) where: Base-Base interactions energy: -346.900 where: short stacking energy: -152.903 Base-Backbone interact. energy: -0.392 local terms energy: -143.542117 where: bonds (distance) C4'-P energy: -24.248 bonds (distance) P-C4' energy: -24.610 flat angles C4'-P-C4' energy: -28.613 flat angles P-C4'-P energy: -20.597 tors. eta vs tors. theta energy: -45.474 Dist. restrs. and SS energy: 0.840 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -437.391370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.391370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.663013 (E_RNA) where: Base-Base interactions energy: -309.094 where: short stacking energy: -129.256 Base-Backbone interact. energy: -0.290 local terms energy: -131.279333 where: bonds (distance) C4'-P energy: -22.183 bonds (distance) P-C4' energy: -26.452 flat angles C4'-P-C4' energy: -31.856 flat angles P-C4'-P energy: -20.363 tors. eta vs tors. theta energy: -30.426 Dist. restrs. and SS energy: 3.272 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -451.900515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.900515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.275187 (E_RNA) where: Base-Base interactions energy: -326.468 where: short stacking energy: -136.169 Base-Backbone interact. energy: -0.542 local terms energy: -125.265143 where: bonds (distance) C4'-P energy: -28.814 bonds (distance) P-C4' energy: -23.753 flat angles C4'-P-C4' energy: -26.786 flat angles P-C4'-P energy: -12.126 tors. eta vs tors. theta energy: -33.786 Dist. restrs. and SS energy: 0.375 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -554.640361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.640361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.174831 (E_RNA) where: Base-Base interactions energy: -396.639 where: short stacking energy: -166.231 Base-Backbone interact. energy: -0.494 local terms energy: -158.041853 where: bonds (distance) C4'-P energy: -26.026 bonds (distance) P-C4' energy: -30.054 flat angles C4'-P-C4' energy: -31.225 flat angles P-C4'-P energy: -25.591 tors. eta vs tors. theta energy: -45.147 Dist. restrs. and SS energy: 0.534 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -545.133564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.133564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.241949 (E_RNA) where: Base-Base interactions energy: -390.650 where: short stacking energy: -174.403 Base-Backbone interact. energy: -0.290 local terms energy: -154.301508 where: bonds (distance) C4'-P energy: -25.495 bonds (distance) P-C4' energy: -30.361 flat angles C4'-P-C4' energy: -30.203 flat angles P-C4'-P energy: -22.884 tors. eta vs tors. theta energy: -45.358 Dist. restrs. and SS energy: 0.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -537.504462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.504462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.669025 (E_RNA) where: Base-Base interactions energy: -384.698 where: short stacking energy: -160.001 Base-Backbone interact. energy: -1.047 local terms energy: -151.924198 where: bonds (distance) C4'-P energy: -26.596 bonds (distance) P-C4' energy: -28.314 flat angles C4'-P-C4' energy: -31.773 flat angles P-C4'-P energy: -24.800 tors. eta vs tors. theta energy: -40.441 Dist. restrs. and SS energy: 0.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -528.953573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.953573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.482531 (E_RNA) where: Base-Base interactions energy: -373.029 where: short stacking energy: -146.366 Base-Backbone interact. energy: -1.877 local terms energy: -154.576001 where: bonds (distance) C4'-P energy: -29.226 bonds (distance) P-C4' energy: -28.262 flat angles C4'-P-C4' energy: -33.979 flat angles P-C4'-P energy: -23.360 tors. eta vs tors. theta energy: -39.748 Dist. restrs. and SS energy: 0.529 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -508.267668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.267668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.592405 (E_RNA) where: Base-Base interactions energy: -360.520 where: short stacking energy: -150.207 Base-Backbone interact. energy: -0.019 local terms energy: -148.053438 where: bonds (distance) C4'-P energy: -26.491 bonds (distance) P-C4' energy: -26.479 flat angles C4'-P-C4' energy: -30.625 flat angles P-C4'-P energy: -21.041 tors. eta vs tors. theta energy: -43.418 Dist. restrs. and SS energy: 0.325 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -508.364227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.364227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.097883 (E_RNA) where: Base-Base interactions energy: -369.035 where: short stacking energy: -159.396 Base-Backbone interact. energy: -0.228 local terms energy: -140.834536 where: bonds (distance) C4'-P energy: -21.282 bonds (distance) P-C4' energy: -31.162 flat angles C4'-P-C4' energy: -26.325 flat angles P-C4'-P energy: -17.860 tors. eta vs tors. theta energy: -44.206 Dist. restrs. and SS energy: 1.734 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -501.995619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.995619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.362774 (E_RNA) where: Base-Base interactions energy: -373.948 where: short stacking energy: -151.295 Base-Backbone interact. energy: -0.457 local terms energy: -127.957112 where: bonds (distance) C4'-P energy: -12.225 bonds (distance) P-C4' energy: -26.691 flat angles C4'-P-C4' energy: -28.053 flat angles P-C4'-P energy: -20.890 tors. eta vs tors. theta energy: -40.097 Dist. restrs. and SS energy: 0.367 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -440.164785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.164785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.352074 (E_RNA) where: Base-Base interactions energy: -317.790 where: short stacking energy: -137.022 Base-Backbone interact. energy: -0.949 local terms energy: -123.612609 where: bonds (distance) C4'-P energy: -26.877 bonds (distance) P-C4' energy: -19.474 flat angles C4'-P-C4' energy: -24.194 flat angles P-C4'-P energy: -16.628 tors. eta vs tors. theta energy: -36.439 Dist. restrs. and SS energy: 2.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -465.707863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.707863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.949849 (E_RNA) where: Base-Base interactions energy: -330.374 where: short stacking energy: -150.042 Base-Backbone interact. energy: -0.449 local terms energy: -136.125973 where: bonds (distance) C4'-P energy: -19.853 bonds (distance) P-C4' energy: -24.111 flat angles C4'-P-C4' energy: -28.041 flat angles P-C4'-P energy: -18.992 tors. eta vs tors. theta energy: -45.129 Dist. restrs. and SS energy: 1.242 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -442.669200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.669200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.268417 (E_RNA) where: Base-Base interactions energy: -314.752 where: short stacking energy: -126.867 Base-Backbone interact. energy: -0.059 local terms energy: -128.457787 where: bonds (distance) C4'-P energy: -30.275 bonds (distance) P-C4' energy: -25.070 flat angles C4'-P-C4' energy: -25.500 flat angles P-C4'-P energy: -11.890 tors. eta vs tors. theta energy: -35.723 Dist. restrs. and SS energy: 0.599 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -559.124232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.124232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.303050 (E_RNA) where: Base-Base interactions energy: -393.013 where: short stacking energy: -166.154 Base-Backbone interact. energy: -0.260 local terms energy: -166.030173 where: bonds (distance) C4'-P energy: -30.463 bonds (distance) P-C4' energy: -34.572 flat angles C4'-P-C4' energy: -34.576 flat angles P-C4'-P energy: -22.058 tors. eta vs tors. theta energy: -44.361 Dist. restrs. and SS energy: 0.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -540.603038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.603038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.872467 (E_RNA) where: Base-Base interactions energy: -387.847 where: short stacking energy: -159.962 Base-Backbone interact. energy: -0.240 local terms energy: -152.785680 where: bonds (distance) C4'-P energy: -24.304 bonds (distance) P-C4' energy: -34.241 flat angles C4'-P-C4' energy: -31.956 flat angles P-C4'-P energy: -20.071 tors. eta vs tors. theta energy: -42.214 Dist. restrs. and SS energy: 0.269 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -534.794336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.794336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.819310 (E_RNA) where: Base-Base interactions energy: -389.868 where: short stacking energy: -156.810 Base-Backbone interact. energy: -0.190 local terms energy: -144.762243 where: bonds (distance) C4'-P energy: -26.361 bonds (distance) P-C4' energy: -27.204 flat angles C4'-P-C4' energy: -28.559 flat angles P-C4'-P energy: -23.279 tors. eta vs tors. theta energy: -39.359 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -533.024094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.024094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.518897 (E_RNA) where: Base-Base interactions energy: -380.913 where: short stacking energy: -153.400 Base-Backbone interact. energy: -0.323 local terms energy: -152.282846 where: bonds (distance) C4'-P energy: -25.729 bonds (distance) P-C4' energy: -32.296 flat angles C4'-P-C4' energy: -33.341 flat angles P-C4'-P energy: -19.008 tors. eta vs tors. theta energy: -41.909 Dist. restrs. and SS energy: 0.495 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -514.365241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.365241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.648512 (E_RNA) where: Base-Base interactions energy: -372.876 where: short stacking energy: -158.290 Base-Backbone interact. energy: -0.123 local terms energy: -141.650224 where: bonds (distance) C4'-P energy: -20.056 bonds (distance) P-C4' energy: -29.472 flat angles C4'-P-C4' energy: -26.072 flat angles P-C4'-P energy: -21.013 tors. eta vs tors. theta energy: -45.037 Dist. restrs. and SS energy: 0.283 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -500.948628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.948628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.583701 (E_RNA) where: Base-Base interactions energy: -355.512 where: short stacking energy: -159.287 Base-Backbone interact. energy: 0.047 local terms energy: -146.118492 where: bonds (distance) C4'-P energy: -26.454 bonds (distance) P-C4' energy: -28.664 flat angles C4'-P-C4' energy: -29.091 flat angles P-C4'-P energy: -18.271 tors. eta vs tors. theta energy: -43.639 Dist. restrs. and SS energy: 0.635 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -504.528503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.528503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.571921 (E_RNA) where: Base-Base interactions energy: -365.217 where: short stacking energy: -144.189 Base-Backbone interact. energy: -0.157 local terms energy: -139.197541 where: bonds (distance) C4'-P energy: -24.795 bonds (distance) P-C4' energy: -27.777 flat angles C4'-P-C4' energy: -29.080 flat angles P-C4'-P energy: -16.656 tors. eta vs tors. theta energy: -40.889 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -444.822025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.822025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.547420 (E_RNA) where: Base-Base interactions energy: -318.354 where: short stacking energy: -129.944 Base-Backbone interact. energy: -0.235 local terms energy: -126.959038 where: bonds (distance) C4'-P energy: -23.094 bonds (distance) P-C4' energy: -16.636 flat angles C4'-P-C4' energy: -31.594 flat angles P-C4'-P energy: -22.803 tors. eta vs tors. theta energy: -32.832 Dist. restrs. and SS energy: 0.725 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -464.846760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.846760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.143739 (E_RNA) where: Base-Base interactions energy: -325.703 where: short stacking energy: -136.751 Base-Backbone interact. energy: -0.155 local terms energy: -139.285762 where: bonds (distance) C4'-P energy: -30.251 bonds (distance) P-C4' energy: -24.407 flat angles C4'-P-C4' energy: -27.855 flat angles P-C4'-P energy: -22.837 tors. eta vs tors. theta energy: -33.935 Dist. restrs. and SS energy: 0.297 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -432.235939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.235939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.755850 (E_RNA) where: Base-Base interactions energy: -313.557 where: short stacking energy: -134.320 Base-Backbone interact. energy: -0.258 local terms energy: -118.941052 where: bonds (distance) C4'-P energy: -14.919 bonds (distance) P-C4' energy: -23.705 flat angles C4'-P-C4' energy: -29.456 flat angles P-C4'-P energy: -16.857 tors. eta vs tors. theta energy: -34.004 Dist. restrs. and SS energy: 0.520 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -565.158985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.158985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.295781 (E_RNA) where: Base-Base interactions energy: -399.435 where: short stacking energy: -179.256 Base-Backbone interact. energy: -0.019 local terms energy: -165.841340 where: bonds (distance) C4'-P energy: -28.933 bonds (distance) P-C4' energy: -31.707 flat angles C4'-P-C4' energy: -33.801 flat angles P-C4'-P energy: -24.790 tors. eta vs tors. theta energy: -46.611 Dist. restrs. and SS energy: 0.137 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -548.926958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.926958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.107128 (E_RNA) where: Base-Base interactions energy: -404.356 where: short stacking energy: -167.324 Base-Backbone interact. energy: 0.084 local terms energy: -144.835353 where: bonds (distance) C4'-P energy: -23.653 bonds (distance) P-C4' energy: -29.184 flat angles C4'-P-C4' energy: -28.030 flat angles P-C4'-P energy: -21.225 tors. eta vs tors. theta energy: -42.743 Dist. restrs. and SS energy: 0.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -533.612542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.612542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.855364 (E_RNA) where: Base-Base interactions energy: -378.937 where: short stacking energy: -153.181 Base-Backbone interact. energy: -0.465 local terms energy: -154.453348 where: bonds (distance) C4'-P energy: -32.751 bonds (distance) P-C4' energy: -27.242 flat angles C4'-P-C4' energy: -32.592 flat angles P-C4'-P energy: -21.784 tors. eta vs tors. theta energy: -40.085 Dist. restrs. and SS energy: 0.243 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -534.460303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.460303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.695366 (E_RNA) where: Base-Base interactions energy: -389.218 where: short stacking energy: -159.335 Base-Backbone interact. energy: -0.135 local terms energy: -145.342167 where: bonds (distance) C4'-P energy: -27.368 bonds (distance) P-C4' energy: -23.795 flat angles C4'-P-C4' energy: -31.283 flat angles P-C4'-P energy: -20.009 tors. eta vs tors. theta energy: -42.888 Dist. restrs. and SS energy: 0.235 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -515.607112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.607112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.903304 (E_RNA) where: Base-Base interactions energy: -362.412 where: short stacking energy: -165.109 Base-Backbone interact. energy: -0.143 local terms energy: -153.348760 where: bonds (distance) C4'-P energy: -33.760 bonds (distance) P-C4' energy: -29.666 flat angles C4'-P-C4' energy: -29.521 flat angles P-C4'-P energy: -17.134 tors. eta vs tors. theta energy: -43.267 Dist. restrs. and SS energy: 0.296 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -506.708987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.708987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.019371 (E_RNA) where: Base-Base interactions energy: -362.618 where: short stacking energy: -165.960 Base-Backbone interact. energy: -0.001 local terms energy: -144.400498 where: bonds (distance) C4'-P energy: -21.458 bonds (distance) P-C4' energy: -28.490 flat angles C4'-P-C4' energy: -30.426 flat angles P-C4'-P energy: -17.558 tors. eta vs tors. theta energy: -46.468 Dist. restrs. and SS energy: 0.310 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -499.549207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.549207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.723734 (E_RNA) where: Base-Base interactions energy: -351.687 where: short stacking energy: -142.233 Base-Backbone interact. energy: 0.152 local terms energy: -148.188482 where: bonds (distance) C4'-P energy: -20.651 bonds (distance) P-C4' energy: -31.881 flat angles C4'-P-C4' energy: -28.926 flat angles P-C4'-P energy: -24.427 tors. eta vs tors. theta energy: -42.303 Dist. restrs. and SS energy: 0.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -447.143519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.143519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.888720 (E_RNA) where: Base-Base interactions energy: -325.402 where: short stacking energy: -135.578 Base-Backbone interact. energy: -0.564 local terms energy: -126.922851 where: bonds (distance) C4'-P energy: -26.597 bonds (distance) P-C4' energy: -31.576 flat angles C4'-P-C4' energy: -20.758 flat angles P-C4'-P energy: -13.436 tors. eta vs tors. theta energy: -34.556 Dist. restrs. and SS energy: 5.745 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -441.748507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.748507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.215632 (E_RNA) where: Base-Base interactions energy: -317.652 where: short stacking energy: -128.660 Base-Backbone interact. energy: -0.597 local terms energy: -123.967180 where: bonds (distance) C4'-P energy: -20.572 bonds (distance) P-C4' energy: -32.739 flat angles C4'-P-C4' energy: -19.568 flat angles P-C4'-P energy: -15.509 tors. eta vs tors. theta energy: -35.580 Dist. restrs. and SS energy: 0.467 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -408.589434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.589434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.173950 (E_RNA) where: Base-Base interactions energy: -286.566 where: short stacking energy: -124.115 Base-Backbone interact. energy: -0.211 local terms energy: -124.396799 where: bonds (distance) C4'-P energy: -24.297 bonds (distance) P-C4' energy: -25.366 flat angles C4'-P-C4' energy: -25.594 flat angles P-C4'-P energy: -19.614 tors. eta vs tors. theta energy: -29.527 Dist. restrs. and SS energy: 2.585 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -553.798884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.798884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.211289 (E_RNA) where: Base-Base interactions energy: -387.915 where: short stacking energy: -171.705 Base-Backbone interact. energy: -0.218 local terms energy: -166.078072 where: bonds (distance) C4'-P energy: -27.963 bonds (distance) P-C4' energy: -31.419 flat angles C4'-P-C4' energy: -35.662 flat angles P-C4'-P energy: -24.981 tors. eta vs tors. theta energy: -46.053 Dist. restrs. and SS energy: 0.412 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -546.349463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.349463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.473206 (E_RNA) where: Base-Base interactions energy: -389.200 where: short stacking energy: -163.468 Base-Backbone interact. energy: -0.299 local terms energy: -156.974652 where: bonds (distance) C4'-P energy: -31.902 bonds (distance) P-C4' energy: -24.340 flat angles C4'-P-C4' energy: -29.384 flat angles P-C4'-P energy: -27.205 tors. eta vs tors. theta energy: -44.143 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -543.594797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.594797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.998593 (E_RNA) where: Base-Base interactions energy: -395.613 where: short stacking energy: -165.074 Base-Backbone interact. energy: -0.317 local terms energy: -148.068215 where: bonds (distance) C4'-P energy: -25.630 bonds (distance) P-C4' energy: -25.479 flat angles C4'-P-C4' energy: -30.811 flat angles P-C4'-P energy: -21.702 tors. eta vs tors. theta energy: -44.446 Dist. restrs. and SS energy: 0.404 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -530.792732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.792732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.012008 (E_RNA) where: Base-Base interactions energy: -382.058 where: short stacking energy: -161.627 Base-Backbone interact. energy: -0.388 local terms energy: -148.565573 where: bonds (distance) C4'-P energy: -23.535 bonds (distance) P-C4' energy: -27.626 flat angles C4'-P-C4' energy: -33.215 flat angles P-C4'-P energy: -22.426 tors. eta vs tors. theta energy: -41.762 Dist. restrs. and SS energy: 0.219 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -529.607340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.607340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.644675 (E_RNA) where: Base-Base interactions energy: -369.225 where: short stacking energy: -156.030 Base-Backbone interact. energy: 0.053 local terms energy: -160.472204 where: bonds (distance) C4'-P energy: -32.757 bonds (distance) P-C4' energy: -26.240 flat angles C4'-P-C4' energy: -31.749 flat angles P-C4'-P energy: -24.447 tors. eta vs tors. theta energy: -45.279 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -512.839439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.839439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.366122 (E_RNA) where: Base-Base interactions energy: -360.198 where: short stacking energy: -161.996 Base-Backbone interact. energy: -0.652 local terms energy: -152.516595 where: bonds (distance) C4'-P energy: -31.193 bonds (distance) P-C4' energy: -23.848 flat angles C4'-P-C4' energy: -32.946 flat angles P-C4'-P energy: -20.591 tors. eta vs tors. theta energy: -43.940 Dist. restrs. and SS energy: 0.527 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -493.930816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.930816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.246386 (E_RNA) where: Base-Base interactions energy: -370.421 where: short stacking energy: -148.948 Base-Backbone interact. energy: -0.096 local terms energy: -123.729474 where: bonds (distance) C4'-P energy: -24.027 bonds (distance) P-C4' energy: -23.719 flat angles C4'-P-C4' energy: -25.077 flat angles P-C4'-P energy: -12.966 tors. eta vs tors. theta energy: -37.940 Dist. restrs. and SS energy: 0.316 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -446.233047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.233047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.654236 (E_RNA) where: Base-Base interactions energy: -323.419 where: short stacking energy: -127.438 Base-Backbone interact. energy: -0.058 local terms energy: -123.177695 where: bonds (distance) C4'-P energy: -19.883 bonds (distance) P-C4' energy: -22.937 flat angles C4'-P-C4' energy: -29.031 flat angles P-C4'-P energy: -12.838 tors. eta vs tors. theta energy: -38.488 Dist. restrs. and SS energy: 0.421 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -451.362380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.362380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.328479 (E_RNA) where: Base-Base interactions energy: -330.184 where: short stacking energy: -128.729 Base-Backbone interact. energy: -0.192 local terms energy: -123.953053 where: bonds (distance) C4'-P energy: -24.443 bonds (distance) P-C4' energy: -23.153 flat angles C4'-P-C4' energy: -27.416 flat angles P-C4'-P energy: -15.421 tors. eta vs tors. theta energy: -33.521 Dist. restrs. and SS energy: 2.966 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -435.299070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.299070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.681594 (E_RNA) where: Base-Base interactions energy: -318.807 where: short stacking energy: -134.759 Base-Backbone interact. energy: -0.005 local terms energy: -116.869487 where: bonds (distance) C4'-P energy: -16.549 bonds (distance) P-C4' energy: -25.656 flat angles C4'-P-C4' energy: -23.163 flat angles P-C4'-P energy: -13.759 tors. eta vs tors. theta energy: -37.742 Dist. restrs. and SS energy: 0.383 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -552.520671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.520671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.582774 (E_RNA) where: Base-Base interactions energy: -387.714 where: short stacking energy: -169.260 Base-Backbone interact. energy: -0.125 local terms energy: -164.743341 where: bonds (distance) C4'-P energy: -30.925 bonds (distance) P-C4' energy: -28.105 flat angles C4'-P-C4' energy: -37.193 flat angles P-C4'-P energy: -23.496 tors. eta vs tors. theta energy: -45.024 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -551.324880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.324880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.768601 (E_RNA) where: Base-Base interactions energy: -383.603 where: short stacking energy: -165.722 Base-Backbone interact. energy: -0.121 local terms energy: -168.045253 where: bonds (distance) C4'-P energy: -30.188 bonds (distance) P-C4' energy: -31.654 flat angles C4'-P-C4' energy: -34.946 flat angles P-C4'-P energy: -25.763 tors. eta vs tors. theta energy: -45.494 Dist. restrs. and SS energy: 0.444 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -537.230212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.230212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.698564 (E_RNA) where: Base-Base interactions energy: -392.156 where: short stacking energy: -168.097 Base-Backbone interact. energy: -0.669 local terms energy: -144.873575 where: bonds (distance) C4'-P energy: -20.935 bonds (distance) P-C4' energy: -24.674 flat angles C4'-P-C4' energy: -32.153 flat angles P-C4'-P energy: -23.320 tors. eta vs tors. theta energy: -43.792 Dist. restrs. and SS energy: 0.468 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -518.959466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.959466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.047791 (E_RNA) where: Base-Base interactions energy: -365.990 where: short stacking energy: -147.920 Base-Backbone interact. energy: -0.536 local terms energy: -152.522328 where: bonds (distance) C4'-P energy: -32.523 bonds (distance) P-C4' energy: -28.005 flat angles C4'-P-C4' energy: -29.949 flat angles P-C4'-P energy: -20.762 tors. eta vs tors. theta energy: -41.284 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -526.982297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.982297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.103622 (E_RNA) where: Base-Base interactions energy: -394.425 where: short stacking energy: -160.325 Base-Backbone interact. energy: -1.263 local terms energy: -131.414639 where: bonds (distance) C4'-P energy: -24.565 bonds (distance) P-C4' energy: -26.110 flat angles C4'-P-C4' energy: -27.108 flat angles P-C4'-P energy: -15.160 tors. eta vs tors. theta energy: -38.472 Dist. restrs. and SS energy: 0.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -518.105948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.105948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.152601 (E_RNA) where: Base-Base interactions energy: -373.656 where: short stacking energy: -162.514 Base-Backbone interact. energy: -0.122 local terms energy: -144.374374 where: bonds (distance) C4'-P energy: -31.422 bonds (distance) P-C4' energy: -21.748 flat angles C4'-P-C4' energy: -33.936 flat angles P-C4'-P energy: -18.568 tors. eta vs tors. theta energy: -38.701 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -492.522257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.522257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.650486 (E_RNA) where: Base-Base interactions energy: -349.740 where: short stacking energy: -149.625 Base-Backbone interact. energy: -2.188 local terms energy: -140.722073 where: bonds (distance) C4'-P energy: -22.801 bonds (distance) P-C4' energy: -23.797 flat angles C4'-P-C4' energy: -34.965 flat angles P-C4'-P energy: -21.229 tors. eta vs tors. theta energy: -37.931 Dist. restrs. and SS energy: 0.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -455.216671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.216671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.076078 (E_RNA) where: Base-Base interactions energy: -321.541 where: short stacking energy: -138.737 Base-Backbone interact. energy: -0.132 local terms energy: -134.403130 where: bonds (distance) C4'-P energy: -25.819 bonds (distance) P-C4' energy: -29.930 flat angles C4'-P-C4' energy: -25.496 flat angles P-C4'-P energy: -14.010 tors. eta vs tors. theta energy: -39.149 Dist. restrs. and SS energy: 0.859 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -441.636554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.636554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.112171 (E_RNA) where: Base-Base interactions energy: -306.689 where: short stacking energy: -143.154 Base-Backbone interact. energy: -0.501 local terms energy: -135.922431 where: bonds (distance) C4'-P energy: -24.908 bonds (distance) P-C4' energy: -28.377 flat angles C4'-P-C4' energy: -31.159 flat angles P-C4'-P energy: -14.120 tors. eta vs tors. theta energy: -37.358 Dist. restrs. and SS energy: 1.476 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -404.556718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.556718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.478349 (E_RNA) where: Base-Base interactions energy: -288.147 where: short stacking energy: -125.795 Base-Backbone interact. energy: 0.002 local terms energy: -119.333938 where: bonds (distance) C4'-P energy: -14.186 bonds (distance) P-C4' energy: -25.735 flat angles C4'-P-C4' energy: -30.887 flat angles P-C4'-P energy: -15.841 tors. eta vs tors. theta energy: -32.684 Dist. restrs. and SS energy: 2.922 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -556.618614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.618614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.776808 (E_RNA) where: Base-Base interactions energy: -393.785 where: short stacking energy: -177.768 Base-Backbone interact. energy: -0.038 local terms energy: -162.954017 where: bonds (distance) C4'-P energy: -29.033 bonds (distance) P-C4' energy: -31.383 flat angles C4'-P-C4' energy: -34.096 flat angles P-C4'-P energy: -23.930 tors. eta vs tors. theta energy: -44.513 Dist. restrs. and SS energy: 0.158 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -543.439523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.439523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.548927 (E_RNA) where: Base-Base interactions energy: -381.423 where: short stacking energy: -157.920 Base-Backbone interact. energy: -0.321 local terms energy: -161.804827 where: bonds (distance) C4'-P energy: -32.909 bonds (distance) P-C4' energy: -31.857 flat angles C4'-P-C4' energy: -33.835 flat angles P-C4'-P energy: -22.765 tors. eta vs tors. theta energy: -40.440 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -540.297448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.297448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.550248 (E_RNA) where: Base-Base interactions energy: -390.545 where: short stacking energy: -168.113 Base-Backbone interact. energy: -0.114 local terms energy: -149.891807 where: bonds (distance) C4'-P energy: -32.980 bonds (distance) P-C4' energy: -22.977 flat angles C4'-P-C4' energy: -25.503 flat angles P-C4'-P energy: -25.093 tors. eta vs tors. theta energy: -43.339 Dist. restrs. and SS energy: 0.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -529.373404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.373404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.477042 (E_RNA) where: Base-Base interactions energy: -375.094 where: short stacking energy: -153.375 Base-Backbone interact. energy: -0.265 local terms energy: -154.118091 where: bonds (distance) C4'-P energy: -31.504 bonds (distance) P-C4' energy: -25.772 flat angles C4'-P-C4' energy: -33.157 flat angles P-C4'-P energy: -19.770 tors. eta vs tors. theta energy: -43.916 Dist. restrs. and SS energy: 0.104 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -522.482168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.482168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.499036 (E_RNA) where: Base-Base interactions energy: -376.042 where: short stacking energy: -152.760 Base-Backbone interact. energy: -0.133 local terms energy: -146.324188 where: bonds (distance) C4'-P energy: -25.960 bonds (distance) P-C4' energy: -25.189 flat angles C4'-P-C4' energy: -31.869 flat angles P-C4'-P energy: -21.315 tors. eta vs tors. theta energy: -41.991 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -505.706140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.706140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.819780 (E_RNA) where: Base-Base interactions energy: -363.758 where: short stacking energy: -145.405 Base-Backbone interact. energy: -0.284 local terms energy: -141.778576 where: bonds (distance) C4'-P energy: -24.486 bonds (distance) P-C4' energy: -29.683 flat angles C4'-P-C4' energy: -26.884 flat angles P-C4'-P energy: -17.932 tors. eta vs tors. theta energy: -42.794 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -497.463762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.463762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.578875 (E_RNA) where: Base-Base interactions energy: -362.557 where: short stacking energy: -145.190 Base-Backbone interact. energy: -0.088 local terms energy: -134.933537 where: bonds (distance) C4'-P energy: -21.153 bonds (distance) P-C4' energy: -29.671 flat angles C4'-P-C4' energy: -25.290 flat angles P-C4'-P energy: -21.609 tors. eta vs tors. theta energy: -37.211 Dist. restrs. and SS energy: 0.115 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -435.670619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.670619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.242063 (E_RNA) where: Base-Base interactions energy: -313.879 where: short stacking energy: -129.157 Base-Backbone interact. energy: -1.013 local terms energy: -121.350262 where: bonds (distance) C4'-P energy: -19.101 bonds (distance) P-C4' energy: -26.275 flat angles C4'-P-C4' energy: -22.955 flat angles P-C4'-P energy: -19.887 tors. eta vs tors. theta energy: -33.132 Dist. restrs. and SS energy: 0.571 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -423.260221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.260221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.485199 (E_RNA) where: Base-Base interactions energy: -317.391 where: short stacking energy: -127.440 Base-Backbone interact. energy: 1.001 local terms energy: -107.095106 where: bonds (distance) C4'-P energy: -15.589 bonds (distance) P-C4' energy: -20.776 flat angles C4'-P-C4' energy: -29.525 flat angles P-C4'-P energy: -12.018 tors. eta vs tors. theta energy: -29.187 Dist. restrs. and SS energy: 0.225 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -414.249096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.249096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.974923 (E_RNA) where: Base-Base interactions energy: -307.495 where: short stacking energy: -120.775 Base-Backbone interact. energy: 1.173 local terms energy: -110.653049 where: bonds (distance) C4'-P energy: -14.641 bonds (distance) P-C4' energy: -21.343 flat angles C4'-P-C4' energy: -30.578 flat angles P-C4'-P energy: -14.054 tors. eta vs tors. theta energy: -30.036 Dist. restrs. and SS energy: 2.726 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -551.008764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.008764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.150881 (E_RNA) where: Base-Base interactions energy: -393.488 where: short stacking energy: -172.725 Base-Backbone interact. energy: -0.479 local terms energy: -157.183313 where: bonds (distance) C4'-P energy: -23.737 bonds (distance) P-C4' energy: -30.070 flat angles C4'-P-C4' energy: -35.164 flat angles P-C4'-P energy: -25.324 tors. eta vs tors. theta energy: -42.889 Dist. restrs. and SS energy: 0.142 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -550.520809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.520809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.643748 (E_RNA) where: Base-Base interactions energy: -385.372 where: short stacking energy: -159.829 Base-Backbone interact. energy: -0.167 local terms energy: -165.105216 where: bonds (distance) C4'-P energy: -31.298 bonds (distance) P-C4' energy: -27.265 flat angles C4'-P-C4' energy: -33.344 flat angles P-C4'-P energy: -27.544 tors. eta vs tors. theta energy: -45.654 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -536.874559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.874559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.136257 (E_RNA) where: Base-Base interactions energy: -399.824 where: short stacking energy: -159.320 Base-Backbone interact. energy: -0.172 local terms energy: -137.139440 where: bonds (distance) C4'-P energy: -23.114 bonds (distance) P-C4' energy: -16.479 flat angles C4'-P-C4' energy: -33.957 flat angles P-C4'-P energy: -21.339 tors. eta vs tors. theta energy: -42.251 Dist. restrs. and SS energy: 0.262 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -522.800179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.800179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.958293 (E_RNA) where: Base-Base interactions energy: -371.756 where: short stacking energy: -154.980 Base-Backbone interact. energy: -0.128 local terms energy: -151.073974 where: bonds (distance) C4'-P energy: -28.585 bonds (distance) P-C4' energy: -27.374 flat angles C4'-P-C4' energy: -26.890 flat angles P-C4'-P energy: -24.576 tors. eta vs tors. theta energy: -43.649 Dist. restrs. and SS energy: 0.158 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -511.490798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.490798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.871090 (E_RNA) where: Base-Base interactions energy: -364.515 where: short stacking energy: -158.936 Base-Backbone interact. energy: -0.202 local terms energy: -147.153806 where: bonds (distance) C4'-P energy: -22.156 bonds (distance) P-C4' energy: -28.668 flat angles C4'-P-C4' energy: -32.977 flat angles P-C4'-P energy: -22.364 tors. eta vs tors. theta energy: -40.989 Dist. restrs. and SS energy: 0.380 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -509.706691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.706691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.836434 (E_RNA) where: Base-Base interactions energy: -365.762 where: short stacking energy: -147.384 Base-Backbone interact. energy: -0.121 local terms energy: -143.953452 where: bonds (distance) C4'-P energy: -26.493 bonds (distance) P-C4' energy: -25.946 flat angles C4'-P-C4' energy: -35.615 flat angles P-C4'-P energy: -15.925 tors. eta vs tors. theta energy: -39.974 Dist. restrs. and SS energy: 0.130 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -489.244055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.244055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.567246 (E_RNA) where: Base-Base interactions energy: -345.100 where: short stacking energy: -147.864 Base-Backbone interact. energy: -0.542 local terms energy: -143.924760 where: bonds (distance) C4'-P energy: -28.971 bonds (distance) P-C4' energy: -29.372 flat angles C4'-P-C4' energy: -32.509 flat angles P-C4'-P energy: -17.333 tors. eta vs tors. theta energy: -35.740 Dist. restrs. and SS energy: 0.323 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -463.339712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.339712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.681310 (E_RNA) where: Base-Base interactions energy: -322.510 where: short stacking energy: -140.955 Base-Backbone interact. energy: -0.122 local terms energy: -141.049184 where: bonds (distance) C4'-P energy: -28.790 bonds (distance) P-C4' energy: -28.946 flat angles C4'-P-C4' energy: -24.137 flat angles P-C4'-P energy: -19.689 tors. eta vs tors. theta energy: -39.488 Dist. restrs. and SS energy: 0.342 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -413.620634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.620634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.212174 (E_RNA) where: Base-Base interactions energy: -289.018 where: short stacking energy: -119.863 Base-Backbone interact. energy: -0.171 local terms energy: -128.023900 where: bonds (distance) C4'-P energy: -31.879 bonds (distance) P-C4' energy: -20.379 flat angles C4'-P-C4' energy: -25.433 flat angles P-C4'-P energy: -19.963 tors. eta vs tors. theta energy: -30.370 Dist. restrs. and SS energy: 3.592 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -450.001649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.001649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.142799 (E_RNA) where: Base-Base interactions energy: -331.800 where: short stacking energy: -132.837 Base-Backbone interact. energy: -0.674 local terms energy: -118.669097 where: bonds (distance) C4'-P energy: -22.869 bonds (distance) P-C4' energy: -17.339 flat angles C4'-P-C4' energy: -26.775 flat angles P-C4'-P energy: -14.311 tors. eta vs tors. theta energy: -37.376 Dist. restrs. and SS energy: 1.141 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -561.411943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.411943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.503003 (E_RNA) where: Base-Base interactions energy: -391.951 where: short stacking energy: -161.274 Base-Backbone interact. energy: -0.448 local terms energy: -169.103832 where: bonds (distance) C4'-P energy: -34.844 bonds (distance) P-C4' energy: -32.800 flat angles C4'-P-C4' energy: -32.822 flat angles P-C4'-P energy: -25.135 tors. eta vs tors. theta energy: -43.504 Dist. restrs. and SS energy: 0.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -545.687536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.687536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.984942 (E_RNA) where: Base-Base interactions energy: -383.060 where: short stacking energy: -174.387 Base-Backbone interact. energy: -0.630 local terms energy: -162.294469 where: bonds (distance) C4'-P energy: -31.719 bonds (distance) P-C4' energy: -27.760 flat angles C4'-P-C4' energy: -33.309 flat angles P-C4'-P energy: -23.273 tors. eta vs tors. theta energy: -46.233 Dist. restrs. and SS energy: 0.297 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -524.046391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.046391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.128694 (E_RNA) where: Base-Base interactions energy: -365.006 where: short stacking energy: -163.089 Base-Backbone interact. energy: -0.051 local terms energy: -159.072396 where: bonds (distance) C4'-P energy: -29.839 bonds (distance) P-C4' energy: -25.014 flat angles C4'-P-C4' energy: -32.817 flat angles P-C4'-P energy: -26.374 tors. eta vs tors. theta energy: -45.028 Dist. restrs. and SS energy: 0.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -524.516887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.516887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.528753 (E_RNA) where: Base-Base interactions energy: -383.556 where: short stacking energy: -153.564 Base-Backbone interact. energy: 0.119 local terms energy: -141.092005 where: bonds (distance) C4'-P energy: -28.837 bonds (distance) P-C4' energy: -19.768 flat angles C4'-P-C4' energy: -28.834 flat angles P-C4'-P energy: -23.560 tors. eta vs tors. theta energy: -40.092 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -515.907458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.907458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.222866 (E_RNA) where: Base-Base interactions energy: -376.445 where: short stacking energy: -148.795 Base-Backbone interact. energy: -0.618 local terms energy: -139.159965 where: bonds (distance) C4'-P energy: -25.960 bonds (distance) P-C4' energy: -19.320 flat angles C4'-P-C4' energy: -34.456 flat angles P-C4'-P energy: -17.196 tors. eta vs tors. theta energy: -42.228 Dist. restrs. and SS energy: 0.315 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -503.688318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.688318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.751672 (E_RNA) where: Base-Base interactions energy: -373.040 where: short stacking energy: -151.195 Base-Backbone interact. energy: -0.018 local terms energy: -130.693713 where: bonds (distance) C4'-P energy: -19.509 bonds (distance) P-C4' energy: -17.010 flat angles C4'-P-C4' energy: -29.564 flat angles P-C4'-P energy: -21.348 tors. eta vs tors. theta energy: -43.263 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -456.568463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.568463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.013930 (E_RNA) where: Base-Base interactions energy: -319.221 where: short stacking energy: -122.409 Base-Backbone interact. energy: 0.144 local terms energy: -137.936645 where: bonds (distance) C4'-P energy: -34.556 bonds (distance) P-C4' energy: -28.708 flat angles C4'-P-C4' energy: -29.557 flat angles P-C4'-P energy: -15.508 tors. eta vs tors. theta energy: -29.608 Dist. restrs. and SS energy: 0.445 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -474.784193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.784193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.397053 (E_RNA) where: Base-Base interactions energy: -347.499 where: short stacking energy: -147.184 Base-Backbone interact. energy: 0.804 local terms energy: -128.701779 where: bonds (distance) C4'-P energy: -22.644 bonds (distance) P-C4' energy: -18.145 flat angles C4'-P-C4' energy: -27.866 flat angles P-C4'-P energy: -19.303 tors. eta vs tors. theta energy: -40.743 Dist. restrs. and SS energy: 0.613 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -459.925257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.925257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.796311 (E_RNA) where: Base-Base interactions energy: -322.210 where: short stacking energy: -148.606 Base-Backbone interact. energy: -0.110 local terms energy: -138.476370 where: bonds (distance) C4'-P energy: -27.045 bonds (distance) P-C4' energy: -26.186 flat angles C4'-P-C4' energy: -29.910 flat angles P-C4'-P energy: -15.627 tors. eta vs tors. theta energy: -39.709 Dist. restrs. and SS energy: 0.871 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -407.587824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.587824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.736550 (E_RNA) where: Base-Base interactions energy: -284.742 where: short stacking energy: -118.093 Base-Backbone interact. energy: -1.761 local terms energy: -124.233489 where: bonds (distance) C4'-P energy: -21.817 bonds (distance) P-C4' energy: -31.437 flat angles C4'-P-C4' energy: -20.762 flat angles P-C4'-P energy: -15.519 tors. eta vs tors. theta energy: -34.699 Dist. restrs. and SS energy: 3.149 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -554.708320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.708320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.983400 (E_RNA) where: Base-Base interactions energy: -399.636 where: short stacking energy: -163.411 Base-Backbone interact. energy: -0.522 local terms energy: -154.825929 where: bonds (distance) C4'-P energy: -26.924 bonds (distance) P-C4' energy: -31.862 flat angles C4'-P-C4' energy: -29.796 flat angles P-C4'-P energy: -24.620 tors. eta vs tors. theta energy: -41.624 Dist. restrs. and SS energy: 0.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -542.466222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.466222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.725857 (E_RNA) where: Base-Base interactions energy: -382.807 where: short stacking energy: -168.671 Base-Backbone interact. energy: 2.557 local terms energy: -162.475866 where: bonds (distance) C4'-P energy: -29.625 bonds (distance) P-C4' energy: -29.664 flat angles C4'-P-C4' energy: -34.590 flat angles P-C4'-P energy: -23.510 tors. eta vs tors. theta energy: -45.088 Dist. restrs. and SS energy: 0.260 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -533.493856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.493856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.577498 (E_RNA) where: Base-Base interactions energy: -397.711 where: short stacking energy: -177.171 Base-Backbone interact. energy: -0.099 local terms energy: -135.767121 where: bonds (distance) C4'-P energy: -18.999 bonds (distance) P-C4' energy: -26.818 flat angles C4'-P-C4' energy: -28.251 flat angles P-C4'-P energy: -21.161 tors. eta vs tors. theta energy: -40.539 Dist. restrs. and SS energy: 0.084 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -548.953696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.953696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.026294 (E_RNA) where: Base-Base interactions energy: -395.991 where: short stacking energy: -164.131 Base-Backbone interact. energy: -0.057 local terms energy: -152.978667 where: bonds (distance) C4'-P energy: -30.730 bonds (distance) P-C4' energy: -27.333 flat angles C4'-P-C4' energy: -32.014 flat angles P-C4'-P energy: -19.070 tors. eta vs tors. theta energy: -43.833 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -534.640567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.640567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.836896 (E_RNA) where: Base-Base interactions energy: -383.517 where: short stacking energy: -158.556 Base-Backbone interact. energy: -1.117 local terms energy: -150.203049 where: bonds (distance) C4'-P energy: -27.073 bonds (distance) P-C4' energy: -26.100 flat angles C4'-P-C4' energy: -29.452 flat angles P-C4'-P energy: -22.191 tors. eta vs tors. theta energy: -45.386 Dist. restrs. and SS energy: 0.196 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -508.692842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.692842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.119345 (E_RNA) where: Base-Base interactions energy: -352.615 where: short stacking energy: -147.425 Base-Backbone interact. energy: -1.609 local terms energy: -154.894870 where: bonds (distance) C4'-P energy: -28.806 bonds (distance) P-C4' energy: -24.165 flat angles C4'-P-C4' energy: -32.581 flat angles P-C4'-P energy: -23.076 tors. eta vs tors. theta energy: -46.267 Dist. restrs. and SS energy: 0.427 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -469.571604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.571604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.339985 (E_RNA) where: Base-Base interactions energy: -335.389 where: short stacking energy: -137.077 Base-Backbone interact. energy: -0.461 local terms energy: -135.489881 where: bonds (distance) C4'-P energy: -23.001 bonds (distance) P-C4' energy: -26.042 flat angles C4'-P-C4' energy: -30.025 flat angles P-C4'-P energy: -21.561 tors. eta vs tors. theta energy: -34.860 Dist. restrs. and SS energy: 1.768 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -464.512850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.512850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.110106 (E_RNA) where: Base-Base interactions energy: -328.881 where: short stacking energy: -129.979 Base-Backbone interact. energy: -0.062 local terms energy: -136.167274 where: bonds (distance) C4'-P energy: -26.982 bonds (distance) P-C4' energy: -30.560 flat angles C4'-P-C4' energy: -26.514 flat angles P-C4'-P energy: -21.800 tors. eta vs tors. theta energy: -30.311 Dist. restrs. and SS energy: 0.597 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -483.439548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.439548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.719277 (E_RNA) where: Base-Base interactions energy: -368.496 where: short stacking energy: -151.101 Base-Backbone interact. energy: -0.328 local terms energy: -117.894900 where: bonds (distance) C4'-P energy: -16.906 bonds (distance) P-C4' energy: -14.606 flat angles C4'-P-C4' energy: -31.120 flat angles P-C4'-P energy: -15.247 tors. eta vs tors. theta energy: -40.016 Dist. restrs. and SS energy: 3.280 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -406.910451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.910451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.295851 (E_RNA) where: Base-Base interactions energy: -318.258 where: short stacking energy: -122.242 Base-Backbone interact. energy: 0.078 local terms energy: -89.115707 where: bonds (distance) C4'-P energy: -10.730 bonds (distance) P-C4' energy: -10.305 flat angles C4'-P-C4' energy: -21.855 flat angles P-C4'-P energy: -18.387 tors. eta vs tors. theta energy: -27.839 Dist. restrs. and SS energy: 0.385 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -539.321282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.321282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.353106 (E_RNA) where: Base-Base interactions energy: -378.565 where: short stacking energy: -160.462 Base-Backbone interact. energy: -0.027 local terms energy: -160.761497 where: bonds (distance) C4'-P energy: -30.828 bonds (distance) P-C4' energy: -32.334 flat angles C4'-P-C4' energy: -32.524 flat angles P-C4'-P energy: -24.849 tors. eta vs tors. theta energy: -40.227 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -544.595318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.595318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.642497 (E_RNA) where: Base-Base interactions energy: -394.840 where: short stacking energy: -158.204 Base-Backbone interact. energy: -0.942 local terms energy: -148.860235 where: bonds (distance) C4'-P energy: -22.923 bonds (distance) P-C4' energy: -26.361 flat angles C4'-P-C4' energy: -31.780 flat angles P-C4'-P energy: -26.217 tors. eta vs tors. theta energy: -41.579 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -542.245592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.245592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.488693 (E_RNA) where: Base-Base interactions energy: -380.661 where: short stacking energy: -171.800 Base-Backbone interact. energy: -0.047 local terms energy: -161.779906 where: bonds (distance) C4'-P energy: -32.416 bonds (distance) P-C4' energy: -25.644 flat angles C4'-P-C4' energy: -32.257 flat angles P-C4'-P energy: -24.425 tors. eta vs tors. theta energy: -47.038 Dist. restrs. and SS energy: 0.243 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -538.476952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.476952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.592284 (E_RNA) where: Base-Base interactions energy: -396.741 where: short stacking energy: -162.640 Base-Backbone interact. energy: -0.132 local terms energy: -141.719246 where: bonds (distance) C4'-P energy: -27.406 bonds (distance) P-C4' energy: -23.068 flat angles C4'-P-C4' energy: -31.087 flat angles P-C4'-P energy: -16.951 tors. eta vs tors. theta energy: -43.208 Dist. restrs. and SS energy: 0.115 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -515.814941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.814941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.004285 (E_RNA) where: Base-Base interactions energy: -361.271 where: short stacking energy: -155.997 Base-Backbone interact. energy: 0.045 local terms energy: -154.778350 where: bonds (distance) C4'-P energy: -30.148 bonds (distance) P-C4' energy: -26.340 flat angles C4'-P-C4' energy: -32.257 flat angles P-C4'-P energy: -24.943 tors. eta vs tors. theta energy: -41.090 Dist. restrs. and SS energy: 0.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -505.933540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.933540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.085579 (E_RNA) where: Base-Base interactions energy: -368.459 where: short stacking energy: -158.827 Base-Backbone interact. energy: -0.218 local terms energy: -137.408465 where: bonds (distance) C4'-P energy: -25.542 bonds (distance) P-C4' energy: -22.810 flat angles C4'-P-C4' energy: -30.036 flat angles P-C4'-P energy: -13.414 tors. eta vs tors. theta energy: -45.607 Dist. restrs. and SS energy: 0.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -483.761297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.761297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.731845 (E_RNA) where: Base-Base interactions energy: -356.577 where: short stacking energy: -149.749 Base-Backbone interact. energy: 0.158 local terms energy: -129.313450 where: bonds (distance) C4'-P energy: -18.912 bonds (distance) P-C4' energy: -17.132 flat angles C4'-P-C4' energy: -32.318 flat angles P-C4'-P energy: -19.403 tors. eta vs tors. theta energy: -41.548 Dist. restrs. and SS energy: 1.971 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -453.219053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.219053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.408282 (E_RNA) where: Base-Base interactions energy: -319.771 where: short stacking energy: -142.935 Base-Backbone interact. energy: -0.432 local terms energy: -134.205023 where: bonds (distance) C4'-P energy: -19.938 bonds (distance) P-C4' energy: -25.921 flat angles C4'-P-C4' energy: -29.949 flat angles P-C4'-P energy: -21.677 tors. eta vs tors. theta energy: -36.719 Dist. restrs. and SS energy: 1.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -480.875710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.875710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.977374 (E_RNA) where: Base-Base interactions energy: -339.846 where: short stacking energy: -140.273 Base-Backbone interact. energy: 0.975 local terms energy: -145.106366 where: bonds (distance) C4'-P energy: -26.873 bonds (distance) P-C4' energy: -25.437 flat angles C4'-P-C4' energy: -31.268 flat angles P-C4'-P energy: -21.005 tors. eta vs tors. theta energy: -40.524 Dist. restrs. and SS energy: 3.102 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -412.035363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.035363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.046991 (E_RNA) where: Base-Base interactions energy: -296.941 where: short stacking energy: -122.970 Base-Backbone interact. energy: -0.373 local terms energy: -117.732790 where: bonds (distance) C4'-P energy: -17.867 bonds (distance) P-C4' energy: -23.384 flat angles C4'-P-C4' energy: -26.539 flat angles P-C4'-P energy: -18.856 tors. eta vs tors. theta energy: -31.086 Dist. restrs. and SS energy: 3.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -556.071699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.071699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.250806 (E_RNA) where: Base-Base interactions energy: -388.534 where: short stacking energy: -162.726 Base-Backbone interact. energy: -1.446 local terms energy: -166.270599 where: bonds (distance) C4'-P energy: -28.802 bonds (distance) P-C4' energy: -33.940 flat angles C4'-P-C4' energy: -31.275 flat angles P-C4'-P energy: -25.420 tors. eta vs tors. theta energy: -46.834 Dist. restrs. and SS energy: 0.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -539.582133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.582133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.659891 (E_RNA) where: Base-Base interactions energy: -383.534 where: short stacking energy: -162.958 Base-Backbone interact. energy: -0.202 local terms energy: -155.923050 where: bonds (distance) C4'-P energy: -25.865 bonds (distance) P-C4' energy: -29.491 flat angles C4'-P-C4' energy: -32.188 flat angles P-C4'-P energy: -26.357 tors. eta vs tors. theta energy: -42.023 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -535.531556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.531556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.782109 (E_RNA) where: Base-Base interactions energy: -382.730 where: short stacking energy: -159.610 Base-Backbone interact. energy: -0.015 local terms energy: -153.036860 where: bonds (distance) C4'-P energy: -30.282 bonds (distance) P-C4' energy: -29.337 flat angles C4'-P-C4' energy: -32.434 flat angles P-C4'-P energy: -19.817 tors. eta vs tors. theta energy: -41.167 Dist. restrs. and SS energy: 0.251 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -539.190808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.190808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.524195 (E_RNA) where: Base-Base interactions energy: -396.087 where: short stacking energy: -169.064 Base-Backbone interact. energy: -0.375 local terms energy: -143.061954 where: bonds (distance) C4'-P energy: -27.798 bonds (distance) P-C4' energy: -24.357 flat angles C4'-P-C4' energy: -30.374 flat angles P-C4'-P energy: -18.398 tors. eta vs tors. theta energy: -42.135 Dist. restrs. and SS energy: 0.333 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -517.929927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.929927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.399937 (E_RNA) where: Base-Base interactions energy: -372.227 where: short stacking energy: -151.665 Base-Backbone interact. energy: -0.063 local terms energy: -146.109878 where: bonds (distance) C4'-P energy: -25.504 bonds (distance) P-C4' energy: -27.332 flat angles C4'-P-C4' energy: -31.902 flat angles P-C4'-P energy: -17.756 tors. eta vs tors. theta energy: -43.615 Dist. restrs. and SS energy: 0.470 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -507.664622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.664622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.009803 (E_RNA) where: Base-Base interactions energy: -344.291 where: short stacking energy: -146.568 Base-Backbone interact. energy: -0.574 local terms energy: -163.144574 where: bonds (distance) C4'-P energy: -31.023 bonds (distance) P-C4' energy: -31.350 flat angles C4'-P-C4' energy: -37.192 flat angles P-C4'-P energy: -22.485 tors. eta vs tors. theta energy: -41.094 Dist. restrs. and SS energy: 0.345 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -486.831652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.831652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.113716 (E_RNA) where: Base-Base interactions energy: -353.219 where: short stacking energy: -139.584 Base-Backbone interact. energy: -0.107 local terms energy: -133.787971 where: bonds (distance) C4'-P energy: -25.327 bonds (distance) P-C4' energy: -27.351 flat angles C4'-P-C4' energy: -29.728 flat angles P-C4'-P energy: -15.426 tors. eta vs tors. theta energy: -35.956 Dist. restrs. and SS energy: 0.282 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -472.473238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.473238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.022113 (E_RNA) where: Base-Base interactions energy: -345.511 where: short stacking energy: -148.779 Base-Backbone interact. energy: -0.644 local terms energy: -126.866472 where: bonds (distance) C4'-P energy: -23.370 bonds (distance) P-C4' energy: -20.504 flat angles C4'-P-C4' energy: -26.437 flat angles P-C4'-P energy: -18.061 tors. eta vs tors. theta energy: -38.495 Dist. restrs. and SS energy: 0.549 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -440.110550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.110550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.491315 (E_RNA) where: Base-Base interactions energy: -326.370 where: short stacking energy: -135.366 Base-Backbone interact. energy: -1.197 local terms energy: -114.924524 where: bonds (distance) C4'-P energy: -18.952 bonds (distance) P-C4' energy: -17.816 flat angles C4'-P-C4' energy: -24.023 flat angles P-C4'-P energy: -20.687 tors. eta vs tors. theta energy: -33.447 Dist. restrs. and SS energy: 2.381 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -436.895581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.895581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.611584 (E_RNA) where: Base-Base interactions energy: -321.832 where: short stacking energy: -132.682 Base-Backbone interact. energy: -0.641 local terms energy: -115.138244 where: bonds (distance) C4'-P energy: -18.713 bonds (distance) P-C4' energy: -19.025 flat angles C4'-P-C4' energy: -30.324 flat angles P-C4'-P energy: -11.786 tors. eta vs tors. theta energy: -35.290 Dist. restrs. and SS energy: 0.716 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -543.188215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.188215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.285511 (E_RNA) where: Base-Base interactions energy: -388.097 where: short stacking energy: -164.728 Base-Backbone interact. energy: -0.420 local terms energy: -154.768015 where: bonds (distance) C4'-P energy: -26.563 bonds (distance) P-C4' energy: -31.089 flat angles C4'-P-C4' energy: -29.913 flat angles P-C4'-P energy: -23.306 tors. eta vs tors. theta energy: -43.897 Dist. restrs. and SS energy: 0.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -548.436151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.436151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.517162 (E_RNA) where: Base-Base interactions energy: -394.765 where: short stacking energy: -162.076 Base-Backbone interact. energy: -0.391 local terms energy: -153.361063 where: bonds (distance) C4'-P energy: -29.456 bonds (distance) P-C4' energy: -30.013 flat angles C4'-P-C4' energy: -30.046 flat angles P-C4'-P energy: -20.113 tors. eta vs tors. theta energy: -43.733 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -541.877010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.877010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.065866 (E_RNA) where: Base-Base interactions energy: -394.054 where: short stacking energy: -163.347 Base-Backbone interact. energy: -0.431 local terms energy: -147.580867 where: bonds (distance) C4'-P energy: -25.582 bonds (distance) P-C4' energy: -32.233 flat angles C4'-P-C4' energy: -30.385 flat angles P-C4'-P energy: -24.224 tors. eta vs tors. theta energy: -35.158 Dist. restrs. and SS energy: 0.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -528.789514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.789514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.877335 (E_RNA) where: Base-Base interactions energy: -367.816 where: short stacking energy: -163.931 Base-Backbone interact. energy: -0.378 local terms energy: -160.683913 where: bonds (distance) C4'-P energy: -29.416 bonds (distance) P-C4' energy: -32.577 flat angles C4'-P-C4' energy: -30.810 flat angles P-C4'-P energy: -22.851 tors. eta vs tors. theta energy: -45.029 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -515.980961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.980961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.455410 (E_RNA) where: Base-Base interactions energy: -376.023 where: short stacking energy: -156.856 Base-Backbone interact. energy: -0.708 local terms energy: -139.724027 where: bonds (distance) C4'-P energy: -21.746 bonds (distance) P-C4' energy: -32.972 flat angles C4'-P-C4' energy: -26.811 flat angles P-C4'-P energy: -17.435 tors. eta vs tors. theta energy: -40.759 Dist. restrs. and SS energy: 0.474 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -510.389025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.389025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.706810 (E_RNA) where: Base-Base interactions energy: -367.472 where: short stacking energy: -147.443 Base-Backbone interact. energy: -0.717 local terms energy: -142.517652 where: bonds (distance) C4'-P energy: -31.123 bonds (distance) P-C4' energy: -22.064 flat angles C4'-P-C4' energy: -25.598 flat angles P-C4'-P energy: -27.284 tors. eta vs tors. theta energy: -36.450 Dist. restrs. and SS energy: 0.318 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -483.746974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.746974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.258642 (E_RNA) where: Base-Base interactions energy: -345.856 where: short stacking energy: -140.875 Base-Backbone interact. energy: -0.331 local terms energy: -138.071234 where: bonds (distance) C4'-P energy: -21.254 bonds (distance) P-C4' energy: -27.282 flat angles C4'-P-C4' energy: -27.709 flat angles P-C4'-P energy: -22.034 tors. eta vs tors. theta energy: -39.792 Dist. restrs. and SS energy: 0.512 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -486.626271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.626271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.097705 (E_RNA) where: Base-Base interactions energy: -356.223 where: short stacking energy: -143.782 Base-Backbone interact. energy: -1.614 local terms energy: -129.260764 where: bonds (distance) C4'-P energy: -22.158 bonds (distance) P-C4' energy: -22.800 flat angles C4'-P-C4' energy: -31.197 flat angles P-C4'-P energy: -16.319 tors. eta vs tors. theta energy: -36.788 Dist. restrs. and SS energy: 0.471 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -459.389072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.389072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.516737 (E_RNA) where: Base-Base interactions energy: -328.749 where: short stacking energy: -135.170 Base-Backbone interact. energy: -1.079 local terms energy: -129.687815 where: bonds (distance) C4'-P energy: -23.625 bonds (distance) P-C4' energy: -31.145 flat angles C4'-P-C4' energy: -26.663 flat angles P-C4'-P energy: -11.752 tors. eta vs tors. theta energy: -36.503 Dist. restrs. and SS energy: 0.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -436.294015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.294015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.754483 (E_RNA) where: Base-Base interactions energy: -322.636 where: short stacking energy: -133.713 Base-Backbone interact. energy: -0.136 local terms energy: -113.982041 where: bonds (distance) C4'-P energy: -20.814 bonds (distance) P-C4' energy: -24.874 flat angles C4'-P-C4' energy: -22.404 flat angles P-C4'-P energy: -16.528 tors. eta vs tors. theta energy: -29.362 Dist. restrs. and SS energy: 0.460 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -559.637570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.637570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.854862 (E_RNA) where: Base-Base interactions energy: -389.845 where: short stacking energy: -170.466 Base-Backbone interact. energy: -0.842 local terms energy: -169.168332 where: bonds (distance) C4'-P energy: -26.510 bonds (distance) P-C4' energy: -31.257 flat angles C4'-P-C4' energy: -33.256 flat angles P-C4'-P energy: -29.075 tors. eta vs tors. theta energy: -49.070 Dist. restrs. and SS energy: 0.217 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -549.924020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.924020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.114815 (E_RNA) where: Base-Base interactions energy: -393.900 where: short stacking energy: -164.909 Base-Backbone interact. energy: -0.734 local terms energy: -155.481027 where: bonds (distance) C4'-P energy: -25.983 bonds (distance) P-C4' energy: -33.011 flat angles C4'-P-C4' energy: -30.906 flat angles P-C4'-P energy: -23.778 tors. eta vs tors. theta energy: -41.803 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -541.951300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.951300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.020328 (E_RNA) where: Base-Base interactions energy: -389.896 where: short stacking energy: -158.768 Base-Backbone interact. energy: -1.284 local terms energy: -150.840692 where: bonds (distance) C4'-P energy: -26.867 bonds (distance) P-C4' energy: -28.972 flat angles C4'-P-C4' energy: -29.620 flat angles P-C4'-P energy: -21.969 tors. eta vs tors. theta energy: -43.413 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -521.131397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.131397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.303013 (E_RNA) where: Base-Base interactions energy: -374.578 where: short stacking energy: -171.195 Base-Backbone interact. energy: 0.155 local terms energy: -146.879636 where: bonds (distance) C4'-P energy: -21.544 bonds (distance) P-C4' energy: -26.573 flat angles C4'-P-C4' energy: -28.859 flat angles P-C4'-P energy: -24.164 tors. eta vs tors. theta energy: -45.740 Dist. restrs. and SS energy: 0.172 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -520.184992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.184992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.588262 (E_RNA) where: Base-Base interactions energy: -361.346 where: short stacking energy: -146.995 Base-Backbone interact. energy: -0.352 local terms energy: -158.890062 where: bonds (distance) C4'-P energy: -30.511 bonds (distance) P-C4' energy: -29.821 flat angles C4'-P-C4' energy: -31.936 flat angles P-C4'-P energy: -24.352 tors. eta vs tors. theta energy: -42.269 Dist. restrs. and SS energy: 0.403 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -511.284614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.284614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.477195 (E_RNA) where: Base-Base interactions energy: -377.016 where: short stacking energy: -146.262 Base-Backbone interact. energy: -0.572 local terms energy: -133.889024 where: bonds (distance) C4'-P energy: -15.635 bonds (distance) P-C4' energy: -27.255 flat angles C4'-P-C4' energy: -33.255 flat angles P-C4'-P energy: -18.380 tors. eta vs tors. theta energy: -39.365 Dist. restrs. and SS energy: 0.193 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -503.568062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.568062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.095346 (E_RNA) where: Base-Base interactions energy: -364.326 where: short stacking energy: -145.415 Base-Backbone interact. energy: -0.421 local terms energy: -139.348629 where: bonds (distance) C4'-P energy: -23.643 bonds (distance) P-C4' energy: -26.446 flat angles C4'-P-C4' energy: -31.949 flat angles P-C4'-P energy: -18.434 tors. eta vs tors. theta energy: -38.877 Dist. restrs. and SS energy: 0.527 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -471.636118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.636118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.933660 (E_RNA) where: Base-Base interactions energy: -341.327 where: short stacking energy: -145.024 Base-Backbone interact. energy: -0.307 local terms energy: -130.300617 where: bonds (distance) C4'-P energy: -15.906 bonds (distance) P-C4' energy: -21.870 flat angles C4'-P-C4' energy: -31.302 flat angles P-C4'-P energy: -24.441 tors. eta vs tors. theta energy: -36.781 Dist. restrs. and SS energy: 0.298 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -456.410979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.410979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.862544 (E_RNA) where: Base-Base interactions energy: -330.243 where: short stacking energy: -131.462 Base-Backbone interact. energy: -0.467 local terms energy: -126.152401 where: bonds (distance) C4'-P energy: -23.443 bonds (distance) P-C4' energy: -18.977 flat angles C4'-P-C4' energy: -28.336 flat angles P-C4'-P energy: -23.229 tors. eta vs tors. theta energy: -32.168 Dist. restrs. and SS energy: 0.452 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -422.357265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.357265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.283842 (E_RNA) where: Base-Base interactions energy: -294.196 where: short stacking energy: -125.893 Base-Backbone interact. energy: 0.083 local terms energy: -130.171148 where: bonds (distance) C4'-P energy: -27.655 bonds (distance) P-C4' energy: -23.935 flat angles C4'-P-C4' energy: -24.136 flat angles P-C4'-P energy: -22.301 tors. eta vs tors. theta energy: -32.145 Dist. restrs. and SS energy: 1.927 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -564.267694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.267694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.348553 (E_RNA) where: Base-Base interactions energy: -399.573 where: short stacking energy: -171.060 Base-Backbone interact. energy: -1.268 local terms energy: -163.506616 where: bonds (distance) C4'-P energy: -28.505 bonds (distance) P-C4' energy: -32.596 flat angles C4'-P-C4' energy: -36.890 flat angles P-C4'-P energy: -23.038 tors. eta vs tors. theta energy: -42.478 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -544.078174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.078174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.357060 (E_RNA) where: Base-Base interactions energy: -380.668 where: short stacking energy: -171.539 Base-Backbone interact. energy: -2.186 local terms energy: -161.503779 where: bonds (distance) C4'-P energy: -29.364 bonds (distance) P-C4' energy: -25.032 flat angles C4'-P-C4' energy: -35.718 flat angles P-C4'-P energy: -21.794 tors. eta vs tors. theta energy: -49.595 Dist. restrs. and SS energy: 0.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -538.950456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.950456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.101723 (E_RNA) where: Base-Base interactions energy: -388.247 where: short stacking energy: -159.837 Base-Backbone interact. energy: -0.621 local terms energy: -150.233343 where: bonds (distance) C4'-P energy: -29.850 bonds (distance) P-C4' energy: -21.721 flat angles C4'-P-C4' energy: -33.092 flat angles P-C4'-P energy: -25.161 tors. eta vs tors. theta energy: -40.409 Dist. restrs. and SS energy: 0.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -517.108108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.108108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.340210 (E_RNA) where: Base-Base interactions energy: -372.291 where: short stacking energy: -166.281 Base-Backbone interact. energy: -0.117 local terms energy: -144.932290 where: bonds (distance) C4'-P energy: -19.174 bonds (distance) P-C4' energy: -32.911 flat angles C4'-P-C4' energy: -24.305 flat angles P-C4'-P energy: -26.263 tors. eta vs tors. theta energy: -42.279 Dist. restrs. and SS energy: 0.232 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -524.128641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.128641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.245943 (E_RNA) where: Base-Base interactions energy: -377.725 where: short stacking energy: -154.778 Base-Backbone interact. energy: -0.097 local terms energy: -146.424309 where: bonds (distance) C4'-P energy: -27.118 bonds (distance) P-C4' energy: -27.321 flat angles C4'-P-C4' energy: -33.610 flat angles P-C4'-P energy: -19.117 tors. eta vs tors. theta energy: -39.259 Dist. restrs. and SS energy: 0.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -498.785764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.785764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.963366 (E_RNA) where: Base-Base interactions energy: -353.086 where: short stacking energy: -157.717 Base-Backbone interact. energy: -1.353 local terms energy: -144.523996 where: bonds (distance) C4'-P energy: -26.237 bonds (distance) P-C4' energy: -24.365 flat angles C4'-P-C4' energy: -31.121 flat angles P-C4'-P energy: -20.151 tors. eta vs tors. theta energy: -42.651 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -508.299000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.299000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.408245 (E_RNA) where: Base-Base interactions energy: -369.670 where: short stacking energy: -162.721 Base-Backbone interact. energy: -0.042 local terms energy: -138.696453 where: bonds (distance) C4'-P energy: -19.063 bonds (distance) P-C4' energy: -24.512 flat angles C4'-P-C4' energy: -32.089 flat angles P-C4'-P energy: -18.089 tors. eta vs tors. theta energy: -44.943 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -491.988055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.988055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.202394 (E_RNA) where: Base-Base interactions energy: -364.032 where: short stacking energy: -147.402 Base-Backbone interact. energy: -0.461 local terms energy: -127.710270 where: bonds (distance) C4'-P energy: -22.121 bonds (distance) P-C4' energy: -21.209 flat angles C4'-P-C4' energy: -29.485 flat angles P-C4'-P energy: -17.109 tors. eta vs tors. theta energy: -37.786 Dist. restrs. and SS energy: 0.214 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -427.092198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.092198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.407725 (E_RNA) where: Base-Base interactions energy: -306.261 where: short stacking energy: -126.345 Base-Backbone interact. energy: -0.608 local terms energy: -120.538979 where: bonds (distance) C4'-P energy: -23.840 bonds (distance) P-C4' energy: -20.991 flat angles C4'-P-C4' energy: -28.593 flat angles P-C4'-P energy: -15.505 tors. eta vs tors. theta energy: -31.610 Dist. restrs. and SS energy: 0.316 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -420.558449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.558449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.984800 (E_RNA) where: Base-Base interactions energy: -316.060 where: short stacking energy: -133.340 Base-Backbone interact. energy: -0.377 local terms energy: -108.547376 where: bonds (distance) C4'-P energy: -22.611 bonds (distance) P-C4' energy: -19.845 flat angles C4'-P-C4' energy: -27.452 flat angles P-C4'-P energy: -10.186 tors. eta vs tors. theta energy: -28.454 Dist. restrs. and SS energy: 4.426 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -561.719510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.719510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.075611 (E_RNA) where: Base-Base interactions energy: -402.187 where: short stacking energy: -161.728 Base-Backbone interact. energy: -0.314 local terms energy: -159.574703 where: bonds (distance) C4'-P energy: -29.699 bonds (distance) P-C4' energy: -33.320 flat angles C4'-P-C4' energy: -34.510 flat angles P-C4'-P energy: -24.000 tors. eta vs tors. theta energy: -38.045 Dist. restrs. and SS energy: 0.356 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -547.632984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.632984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.871996 (E_RNA) where: Base-Base interactions energy: -399.902 where: short stacking energy: -168.006 Base-Backbone interact. energy: -0.702 local terms energy: -147.267392 where: bonds (distance) C4'-P energy: -22.502 bonds (distance) P-C4' energy: -25.608 flat angles C4'-P-C4' energy: -31.049 flat angles P-C4'-P energy: -24.688 tors. eta vs tors. theta energy: -43.420 Dist. restrs. and SS energy: 0.239 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -535.984350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.984350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.176454 (E_RNA) where: Base-Base interactions energy: -377.518 where: short stacking energy: -165.742 Base-Backbone interact. energy: -0.467 local terms energy: -158.191540 where: bonds (distance) C4'-P energy: -26.717 bonds (distance) P-C4' energy: -29.768 flat angles C4'-P-C4' energy: -34.114 flat angles P-C4'-P energy: -22.921 tors. eta vs tors. theta energy: -44.671 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -538.822729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.822729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.092836 (E_RNA) where: Base-Base interactions energy: -385.868 where: short stacking energy: -158.733 Base-Backbone interact. energy: -0.842 local terms energy: -152.382564 where: bonds (distance) C4'-P energy: -21.971 bonds (distance) P-C4' energy: -30.777 flat angles C4'-P-C4' energy: -33.965 flat angles P-C4'-P energy: -22.631 tors. eta vs tors. theta energy: -43.039 Dist. restrs. and SS energy: 0.270 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -517.978427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.978427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.136223 (E_RNA) where: Base-Base interactions energy: -369.572 where: short stacking energy: -157.252 Base-Backbone interact. energy: -0.158 local terms energy: -148.406848 where: bonds (distance) C4'-P energy: -31.150 bonds (distance) P-C4' energy: -25.276 flat angles C4'-P-C4' energy: -31.259 flat angles P-C4'-P energy: -17.470 tors. eta vs tors. theta energy: -43.252 Dist. restrs. and SS energy: 0.158 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -498.420032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.420032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.509892 (E_RNA) where: Base-Base interactions energy: -357.406 where: short stacking energy: -154.671 Base-Backbone interact. energy: -0.202 local terms energy: -140.901441 where: bonds (distance) C4'-P energy: -22.705 bonds (distance) P-C4' energy: -21.861 flat angles C4'-P-C4' energy: -31.736 flat angles P-C4'-P energy: -22.110 tors. eta vs tors. theta energy: -42.489 Dist. restrs. and SS energy: 0.090 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -499.116557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.116557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.296704 (E_RNA) where: Base-Base interactions energy: -353.417 where: short stacking energy: -156.183 Base-Backbone interact. energy: -0.714 local terms energy: -145.165361 where: bonds (distance) C4'-P energy: -24.363 bonds (distance) P-C4' energy: -26.758 flat angles C4'-P-C4' energy: -26.448 flat angles P-C4'-P energy: -25.120 tors. eta vs tors. theta energy: -42.476 Dist. restrs. and SS energy: 0.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -457.938357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.938357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.001423 (E_RNA) where: Base-Base interactions energy: -322.749 where: short stacking energy: -145.029 Base-Backbone interact. energy: -1.212 local terms energy: -136.040494 where: bonds (distance) C4'-P energy: -22.042 bonds (distance) P-C4' energy: -29.519 flat angles C4'-P-C4' energy: -30.693 flat angles P-C4'-P energy: -16.271 tors. eta vs tors. theta energy: -37.516 Dist. restrs. and SS energy: 2.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -437.680498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.680498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.816611 (E_RNA) where: Base-Base interactions energy: -323.686 where: short stacking energy: -134.492 Base-Backbone interact. energy: -0.346 local terms energy: -113.784734 where: bonds (distance) C4'-P energy: -15.035 bonds (distance) P-C4' energy: -25.957 flat angles C4'-P-C4' energy: -23.352 flat angles P-C4'-P energy: -16.044 tors. eta vs tors. theta energy: -33.397 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -447.314072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.314072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.320645 (E_RNA) where: Base-Base interactions energy: -321.598 where: short stacking energy: -135.661 Base-Backbone interact. energy: -1.758 local terms energy: -125.964925 where: bonds (distance) C4'-P energy: -19.572 bonds (distance) P-C4' energy: -19.348 flat angles C4'-P-C4' energy: -28.985 flat angles P-C4'-P energy: -21.970 tors. eta vs tors. theta energy: -36.090 Dist. restrs. and SS energy: 2.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -551.024686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.024686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.345925 (E_RNA) where: Base-Base interactions energy: -397.288 where: short stacking energy: -159.649 Base-Backbone interact. energy: -0.742 local terms energy: -153.315824 where: bonds (distance) C4'-P energy: -26.272 bonds (distance) P-C4' energy: -31.893 flat angles C4'-P-C4' energy: -35.100 flat angles P-C4'-P energy: -20.620 tors. eta vs tors. theta energy: -39.431 Dist. restrs. and SS energy: 0.321 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -535.215525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.215525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.407086 (E_RNA) where: Base-Base interactions energy: -386.515 where: short stacking energy: -161.699 Base-Backbone interact. energy: -0.859 local terms energy: -148.033547 where: bonds (distance) C4'-P energy: -25.199 bonds (distance) P-C4' energy: -25.494 flat angles C4'-P-C4' energy: -32.757 flat angles P-C4'-P energy: -22.751 tors. eta vs tors. theta energy: -41.833 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -542.848540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.848540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.859454 (E_RNA) where: Base-Base interactions energy: -386.043 where: short stacking energy: -160.598 Base-Backbone interact. energy: -0.734 local terms energy: -156.083229 where: bonds (distance) C4'-P energy: -26.340 bonds (distance) P-C4' energy: -26.479 flat angles C4'-P-C4' energy: -33.027 flat angles P-C4'-P energy: -27.414 tors. eta vs tors. theta energy: -42.823 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -515.803006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.803006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.841584 (E_RNA) where: Base-Base interactions energy: -364.013 where: short stacking energy: -162.769 Base-Backbone interact. energy: 0.701 local terms energy: -152.530410 where: bonds (distance) C4'-P energy: -28.404 bonds (distance) P-C4' energy: -28.046 flat angles C4'-P-C4' energy: -28.088 flat angles P-C4'-P energy: -21.326 tors. eta vs tors. theta energy: -46.667 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -516.266908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.266908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.774431 (E_RNA) where: Base-Base interactions energy: -355.456 where: short stacking energy: -155.560 Base-Backbone interact. energy: -0.248 local terms energy: -161.070819 where: bonds (distance) C4'-P energy: -33.868 bonds (distance) P-C4' energy: -23.286 flat angles C4'-P-C4' energy: -33.509 flat angles P-C4'-P energy: -21.605 tors. eta vs tors. theta energy: -48.802 Dist. restrs. and SS energy: 0.508 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -500.558309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.558309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.876096 (E_RNA) where: Base-Base interactions energy: -357.676 where: short stacking energy: -159.788 Base-Backbone interact. energy: -0.143 local terms energy: -143.056621 where: bonds (distance) C4'-P energy: -14.165 bonds (distance) P-C4' energy: -27.230 flat angles C4'-P-C4' energy: -32.991 flat angles P-C4'-P energy: -25.749 tors. eta vs tors. theta energy: -42.921 Dist. restrs. and SS energy: 0.318 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -493.436685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.436685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.497796 (E_RNA) where: Base-Base interactions energy: -358.041 where: short stacking energy: -150.428 Base-Backbone interact. energy: -1.133 local terms energy: -134.324454 where: bonds (distance) C4'-P energy: -23.054 bonds (distance) P-C4' energy: -25.162 flat angles C4'-P-C4' energy: -30.767 flat angles P-C4'-P energy: -17.309 tors. eta vs tors. theta energy: -38.032 Dist. restrs. and SS energy: 0.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -448.277569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.277569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.512964 (E_RNA) where: Base-Base interactions energy: -314.359 where: short stacking energy: -131.908 Base-Backbone interact. energy: 0.479 local terms energy: -136.632915 where: bonds (distance) C4'-P energy: -24.384 bonds (distance) P-C4' energy: -26.712 flat angles C4'-P-C4' energy: -28.828 flat angles P-C4'-P energy: -21.355 tors. eta vs tors. theta energy: -35.354 Dist. restrs. and SS energy: 2.235 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -436.690426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.690426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.512153 (E_RNA) where: Base-Base interactions energy: -311.575 where: short stacking energy: -125.849 Base-Backbone interact. energy: 0.552 local terms energy: -126.488906 where: bonds (distance) C4'-P energy: -25.830 bonds (distance) P-C4' energy: -26.888 flat angles C4'-P-C4' energy: -28.960 flat angles P-C4'-P energy: -17.125 tors. eta vs tors. theta energy: -27.686 Dist. restrs. and SS energy: 0.822 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -419.968710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.968710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.515936 (E_RNA) where: Base-Base interactions energy: -299.231 where: short stacking energy: -122.756 Base-Backbone interact. energy: -0.305 local terms energy: -120.979711 where: bonds (distance) C4'-P energy: -22.075 bonds (distance) P-C4' energy: -24.480 flat angles C4'-P-C4' energy: -23.618 flat angles P-C4'-P energy: -21.107 tors. eta vs tors. theta energy: -29.699 Dist. restrs. and SS energy: 0.547 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -560.193580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.193580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.298871 (E_RNA) where: Base-Base interactions energy: -408.920 where: short stacking energy: -162.962 Base-Backbone interact. energy: -0.565 local terms energy: -150.814422 where: bonds (distance) C4'-P energy: -29.982 bonds (distance) P-C4' energy: -31.541 flat angles C4'-P-C4' energy: -30.263 flat angles P-C4'-P energy: -21.790 tors. eta vs tors. theta energy: -37.239 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -545.376734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.376734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.659989 (E_RNA) where: Base-Base interactions energy: -390.759 where: short stacking energy: -159.574 Base-Backbone interact. energy: -1.290 local terms energy: -153.611113 where: bonds (distance) C4'-P energy: -27.588 bonds (distance) P-C4' energy: -31.992 flat angles C4'-P-C4' energy: -29.324 flat angles P-C4'-P energy: -22.514 tors. eta vs tors. theta energy: -42.193 Dist. restrs. and SS energy: 0.283 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -535.998050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.998050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.290193 (E_RNA) where: Base-Base interactions energy: -386.220 where: short stacking energy: -156.793 Base-Backbone interact. energy: -0.856 local terms energy: -149.214028 where: bonds (distance) C4'-P energy: -28.347 bonds (distance) P-C4' energy: -23.759 flat angles C4'-P-C4' energy: -31.473 flat angles P-C4'-P energy: -24.094 tors. eta vs tors. theta energy: -41.541 Dist. restrs. and SS energy: 0.292 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -526.390075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.390075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.620600 (E_RNA) where: Base-Base interactions energy: -370.271 where: short stacking energy: -158.018 Base-Backbone interact. energy: -0.056 local terms energy: -156.293134 where: bonds (distance) C4'-P energy: -24.462 bonds (distance) P-C4' energy: -32.225 flat angles C4'-P-C4' energy: -31.257 flat angles P-C4'-P energy: -21.975 tors. eta vs tors. theta energy: -46.375 Dist. restrs. and SS energy: 0.231 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -514.282364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.282364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.546436 (E_RNA) where: Base-Base interactions energy: -373.396 where: short stacking energy: -162.963 Base-Backbone interact. energy: -1.056 local terms energy: -140.094197 where: bonds (distance) C4'-P energy: -21.900 bonds (distance) P-C4' energy: -25.898 flat angles C4'-P-C4' energy: -30.630 flat angles P-C4'-P energy: -19.425 tors. eta vs tors. theta energy: -42.242 Dist. restrs. and SS energy: 0.264 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -524.701143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.701143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.754788 (E_RNA) where: Base-Base interactions energy: -378.894 where: short stacking energy: -153.470 Base-Backbone interact. energy: -0.249 local terms energy: -145.611776 where: bonds (distance) C4'-P energy: -20.805 bonds (distance) P-C4' energy: -31.332 flat angles C4'-P-C4' energy: -35.234 flat angles P-C4'-P energy: -17.990 tors. eta vs tors. theta energy: -40.250 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -479.859038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.859038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.302676 (E_RNA) where: Base-Base interactions energy: -345.037 where: short stacking energy: -148.648 Base-Backbone interact. energy: 1.316 local terms energy: -136.581373 where: bonds (distance) C4'-P energy: -25.649 bonds (distance) P-C4' energy: -23.868 flat angles C4'-P-C4' energy: -24.586 flat angles P-C4'-P energy: -23.794 tors. eta vs tors. theta energy: -38.684 Dist. restrs. and SS energy: 0.444 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -477.903914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.903914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.477128 (E_RNA) where: Base-Base interactions energy: -355.008 where: short stacking energy: -153.991 Base-Backbone interact. energy: -0.327 local terms energy: -123.142773 where: bonds (distance) C4'-P energy: -23.858 bonds (distance) P-C4' energy: -20.134 flat angles C4'-P-C4' energy: -24.964 flat angles P-C4'-P energy: -14.246 tors. eta vs tors. theta energy: -39.941 Dist. restrs. and SS energy: 0.573 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -429.906421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.906421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.418581 (E_RNA) where: Base-Base interactions energy: -312.139 where: short stacking energy: -124.383 Base-Backbone interact. energy: -1.344 local terms energy: -116.935910 where: bonds (distance) C4'-P energy: -20.785 bonds (distance) P-C4' energy: -23.153 flat angles C4'-P-C4' energy: -30.353 flat angles P-C4'-P energy: -18.390 tors. eta vs tors. theta energy: -24.254 Dist. restrs. and SS energy: 0.512 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -421.163853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.163853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.088123 (E_RNA) where: Base-Base interactions energy: -293.991 where: short stacking energy: -121.342 Base-Backbone interact. energy: -0.359 local terms energy: -127.737874 where: bonds (distance) C4'-P energy: -18.747 bonds (distance) P-C4' energy: -26.205 flat angles C4'-P-C4' energy: -28.018 flat angles P-C4'-P energy: -20.233 tors. eta vs tors. theta energy: -34.535 Dist. restrs. and SS energy: 0.924 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -553.421735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.421735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.542617 (E_RNA) where: Base-Base interactions energy: -394.348 where: short stacking energy: -157.571 Base-Backbone interact. energy: -2.253 local terms energy: -156.941850 where: bonds (distance) C4'-P energy: -30.472 bonds (distance) P-C4' energy: -30.639 flat angles C4'-P-C4' energy: -36.879 flat angles P-C4'-P energy: -19.736 tors. eta vs tors. theta energy: -39.216 Dist. restrs. and SS energy: 0.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -547.246075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.246075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.475582 (E_RNA) where: Base-Base interactions energy: -386.694 where: short stacking energy: -159.538 Base-Backbone interact. energy: -0.996 local terms energy: -159.785562 where: bonds (distance) C4'-P energy: -29.898 bonds (distance) P-C4' energy: -27.800 flat angles C4'-P-C4' energy: -32.702 flat angles P-C4'-P energy: -27.088 tors. eta vs tors. theta energy: -42.297 Dist. restrs. and SS energy: 0.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -551.549820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.549820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.716162 (E_RNA) where: Base-Base interactions energy: -397.137 where: short stacking energy: -163.218 Base-Backbone interact. energy: -0.272 local terms energy: -154.306399 where: bonds (distance) C4'-P energy: -26.951 bonds (distance) P-C4' energy: -30.408 flat angles C4'-P-C4' energy: -33.274 flat angles P-C4'-P energy: -20.394 tors. eta vs tors. theta energy: -43.279 Dist. restrs. and SS energy: 0.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -526.585404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.585404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.701604 (E_RNA) where: Base-Base interactions energy: -377.759 where: short stacking energy: -166.540 Base-Backbone interact. energy: -0.125 local terms energy: -148.817227 where: bonds (distance) C4'-P energy: -29.248 bonds (distance) P-C4' energy: -28.271 flat angles C4'-P-C4' energy: -24.900 flat angles P-C4'-P energy: -22.525 tors. eta vs tors. theta energy: -43.873 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -515.571549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.571549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.956666 (E_RNA) where: Base-Base interactions energy: -365.533 where: short stacking energy: -153.330 Base-Backbone interact. energy: -0.492 local terms energy: -149.931952 where: bonds (distance) C4'-P energy: -23.948 bonds (distance) P-C4' energy: -29.942 flat angles C4'-P-C4' energy: -31.950 flat angles P-C4'-P energy: -23.597 tors. eta vs tors. theta energy: -40.495 Dist. restrs. and SS energy: 0.385 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -510.748693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.748693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.062297 (E_RNA) where: Base-Base interactions energy: -371.635 where: short stacking energy: -152.874 Base-Backbone interact. energy: 1.065 local terms energy: -140.492281 where: bonds (distance) C4'-P energy: -29.289 bonds (distance) P-C4' energy: -24.043 flat angles C4'-P-C4' energy: -29.283 flat angles P-C4'-P energy: -16.213 tors. eta vs tors. theta energy: -41.665 Dist. restrs. and SS energy: 0.314 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -506.646241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.646241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.727424 (E_RNA) where: Base-Base interactions energy: -355.017 where: short stacking energy: -155.961 Base-Backbone interact. energy: -0.248 local terms energy: -151.463003 where: bonds (distance) C4'-P energy: -28.089 bonds (distance) P-C4' energy: -25.741 flat angles C4'-P-C4' energy: -30.181 flat angles P-C4'-P energy: -21.587 tors. eta vs tors. theta energy: -45.866 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -487.612715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.612715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.218150 (E_RNA) where: Base-Base interactions energy: -351.404 where: short stacking energy: -145.708 Base-Backbone interact. energy: 0.050 local terms energy: -136.863938 where: bonds (distance) C4'-P energy: -25.924 bonds (distance) P-C4' energy: -24.226 flat angles C4'-P-C4' energy: -29.242 flat angles P-C4'-P energy: -16.426 tors. eta vs tors. theta energy: -41.047 Dist. restrs. and SS energy: 0.605 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -476.860193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.860193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.035003 (E_RNA) where: Base-Base interactions energy: -340.943 where: short stacking energy: -138.833 Base-Backbone interact. energy: 0.182 local terms energy: -136.274123 where: bonds (distance) C4'-P energy: -25.191 bonds (distance) P-C4' energy: -24.089 flat angles C4'-P-C4' energy: -24.957 flat angles P-C4'-P energy: -22.912 tors. eta vs tors. theta energy: -39.126 Dist. restrs. and SS energy: 0.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -420.716521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.716521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.318712 (E_RNA) where: Base-Base interactions energy: -299.638 where: short stacking energy: -118.336 Base-Backbone interact. energy: 1.603 local terms energy: -123.283594 where: bonds (distance) C4'-P energy: -26.541 bonds (distance) P-C4' energy: -26.927 flat angles C4'-P-C4' energy: -27.632 flat angles P-C4'-P energy: -18.550 tors. eta vs tors. theta energy: -23.633 Dist. restrs. and SS energy: 0.602 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -557.033687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.033687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.175544 (E_RNA) where: Base-Base interactions energy: -398.835 where: short stacking energy: -159.373 Base-Backbone interact. energy: -0.416 local terms energy: -157.923815 where: bonds (distance) C4'-P energy: -24.963 bonds (distance) P-C4' energy: -34.160 flat angles C4'-P-C4' energy: -33.332 flat angles P-C4'-P energy: -24.495 tors. eta vs tors. theta energy: -40.974 Dist. restrs. and SS energy: 0.142 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -553.994637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.994637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.147420 (E_RNA) where: Base-Base interactions energy: -387.856 where: short stacking energy: -158.453 Base-Backbone interact. energy: -1.126 local terms energy: -165.166152 where: bonds (distance) C4'-P energy: -30.849 bonds (distance) P-C4' energy: -29.261 flat angles C4'-P-C4' energy: -34.914 flat angles P-C4'-P energy: -24.636 tors. eta vs tors. theta energy: -45.506 Dist. restrs. and SS energy: 0.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -531.708564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.708564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.839553 (E_RNA) where: Base-Base interactions energy: -382.238 where: short stacking energy: -155.454 Base-Backbone interact. energy: -0.865 local terms energy: -148.737125 where: bonds (distance) C4'-P energy: -30.196 bonds (distance) P-C4' energy: -29.285 flat angles C4'-P-C4' energy: -33.695 flat angles P-C4'-P energy: -17.129 tors. eta vs tors. theta energy: -38.432 Dist. restrs. and SS energy: 0.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -516.017721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.017721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.293078 (E_RNA) where: Base-Base interactions energy: -369.669 where: short stacking energy: -151.669 Base-Backbone interact. energy: -0.255 local terms energy: -146.369766 where: bonds (distance) C4'-P energy: -26.651 bonds (distance) P-C4' energy: -26.431 flat angles C4'-P-C4' energy: -27.452 flat angles P-C4'-P energy: -25.042 tors. eta vs tors. theta energy: -40.794 Dist. restrs. and SS energy: 0.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -496.830849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.830849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.072776 (E_RNA) where: Base-Base interactions energy: -360.071 where: short stacking energy: -156.733 Base-Backbone interact. energy: -0.151 local terms energy: -136.850343 where: bonds (distance) C4'-P energy: -23.042 bonds (distance) P-C4' energy: -25.134 flat angles C4'-P-C4' energy: -25.700 flat angles P-C4'-P energy: -19.833 tors. eta vs tors. theta energy: -43.142 Dist. restrs. and SS energy: 0.242 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -502.796275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.796275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.874889 (E_RNA) where: Base-Base interactions energy: -348.437 where: short stacking energy: -151.802 Base-Backbone interact. energy: -1.338 local terms energy: -153.099459 where: bonds (distance) C4'-P energy: -28.857 bonds (distance) P-C4' energy: -29.195 flat angles C4'-P-C4' energy: -30.897 flat angles P-C4'-P energy: -20.316 tors. eta vs tors. theta energy: -43.835 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -514.756642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.756642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.196254 (E_RNA) where: Base-Base interactions energy: -370.003 where: short stacking energy: -154.737 Base-Backbone interact. energy: -0.222 local terms energy: -144.970441 where: bonds (distance) C4'-P energy: -21.319 bonds (distance) P-C4' energy: -25.516 flat angles C4'-P-C4' energy: -33.660 flat angles P-C4'-P energy: -23.370 tors. eta vs tors. theta energy: -41.105 Dist. restrs. and SS energy: 0.440 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -486.676594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.676594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.677387 (E_RNA) where: Base-Base interactions energy: -353.267 where: short stacking energy: -137.325 Base-Backbone interact. energy: -0.949 local terms energy: -132.460956 where: bonds (distance) C4'-P energy: -21.086 bonds (distance) P-C4' energy: -24.278 flat angles C4'-P-C4' energy: -26.383 flat angles P-C4'-P energy: -24.036 tors. eta vs tors. theta energy: -36.678 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -456.485223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.485223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.037459 (E_RNA) where: Base-Base interactions energy: -336.729 where: short stacking energy: -139.342 Base-Backbone interact. energy: -0.288 local terms energy: -120.020185 where: bonds (distance) C4'-P energy: -22.182 bonds (distance) P-C4' energy: -19.608 flat angles C4'-P-C4' energy: -25.567 flat angles P-C4'-P energy: -17.583 tors. eta vs tors. theta energy: -35.080 Dist. restrs. and SS energy: 0.552 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -430.539751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.539751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.537910 (E_RNA) where: Base-Base interactions energy: -312.364 where: short stacking energy: -133.884 Base-Backbone interact. energy: -0.565 local terms energy: -118.609166 where: bonds (distance) C4'-P energy: -27.443 bonds (distance) P-C4' energy: -20.063 flat angles C4'-P-C4' energy: -33.170 flat angles P-C4'-P energy: -6.808 tors. eta vs tors. theta energy: -31.126 Dist. restrs. and SS energy: 0.998 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -554.824404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.824404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.018177 (E_RNA) where: Base-Base interactions energy: -394.162 where: short stacking energy: -162.582 Base-Backbone interact. energy: -0.183 local terms energy: -160.673097 where: bonds (distance) C4'-P energy: -30.836 bonds (distance) P-C4' energy: -26.601 flat angles C4'-P-C4' energy: -34.582 flat angles P-C4'-P energy: -25.164 tors. eta vs tors. theta energy: -43.490 Dist. restrs. and SS energy: 0.194 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -555.807509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.807509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.998304 (E_RNA) where: Base-Base interactions energy: -398.135 where: short stacking energy: -166.869 Base-Backbone interact. energy: -1.669 local terms energy: -156.193966 where: bonds (distance) C4'-P energy: -29.368 bonds (distance) P-C4' energy: -28.098 flat angles C4'-P-C4' energy: -32.572 flat angles P-C4'-P energy: -22.913 tors. eta vs tors. theta energy: -43.244 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -537.792229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.792229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.004034 (E_RNA) where: Base-Base interactions energy: -380.704 where: short stacking energy: -156.006 Base-Backbone interact. energy: -0.343 local terms energy: -156.957056 where: bonds (distance) C4'-P energy: -25.427 bonds (distance) P-C4' energy: -31.831 flat angles C4'-P-C4' energy: -32.000 flat angles P-C4'-P energy: -23.427 tors. eta vs tors. theta energy: -44.272 Dist. restrs. and SS energy: 0.212 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -531.431874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.431874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.653779 (E_RNA) where: Base-Base interactions energy: -382.264 where: short stacking energy: -151.630 Base-Backbone interact. energy: -0.133 local terms energy: -149.255963 where: bonds (distance) C4'-P energy: -25.107 bonds (distance) P-C4' energy: -31.139 flat angles C4'-P-C4' energy: -29.840 flat angles P-C4'-P energy: -22.524 tors. eta vs tors. theta energy: -40.646 Dist. restrs. and SS energy: 0.222 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -519.271290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.271290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.646081 (E_RNA) where: Base-Base interactions energy: -371.556 where: short stacking energy: -164.793 Base-Backbone interact. energy: -1.194 local terms energy: -146.895949 where: bonds (distance) C4'-P energy: -24.270 bonds (distance) P-C4' energy: -23.620 flat angles C4'-P-C4' energy: -33.379 flat angles P-C4'-P energy: -20.546 tors. eta vs tors. theta energy: -45.080 Dist. restrs. and SS energy: 0.375 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -499.639060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.639060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.104061 (E_RNA) where: Base-Base interactions energy: -345.077 where: short stacking energy: -145.086 Base-Backbone interact. energy: 0.482 local terms energy: -155.509369 where: bonds (distance) C4'-P energy: -30.192 bonds (distance) P-C4' energy: -24.342 flat angles C4'-P-C4' energy: -33.249 flat angles P-C4'-P energy: -23.882 tors. eta vs tors. theta energy: -43.845 Dist. restrs. and SS energy: 0.465 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -506.043499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.043499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.392708 (E_RNA) where: Base-Base interactions energy: -361.829 where: short stacking energy: -152.519 Base-Backbone interact. energy: -0.053 local terms energy: -144.510328 where: bonds (distance) C4'-P energy: -27.218 bonds (distance) P-C4' energy: -26.748 flat angles C4'-P-C4' energy: -29.946 flat angles P-C4'-P energy: -19.991 tors. eta vs tors. theta energy: -40.607 Dist. restrs. and SS energy: 0.349 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -491.637992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.637992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.256474 (E_RNA) where: Base-Base interactions energy: -336.627 where: short stacking energy: -130.581 Base-Backbone interact. energy: -0.363 local terms energy: -155.266748 where: bonds (distance) C4'-P energy: -30.535 bonds (distance) P-C4' energy: -31.981 flat angles C4'-P-C4' energy: -30.332 flat angles P-C4'-P energy: -21.437 tors. eta vs tors. theta energy: -40.982 Dist. restrs. and SS energy: 0.618 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -487.508069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.508069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.995145 (E_RNA) where: Base-Base interactions energy: -354.593 where: short stacking energy: -153.368 Base-Backbone interact. energy: -0.392 local terms energy: -133.010679 where: bonds (distance) C4'-P energy: -23.913 bonds (distance) P-C4' energy: -16.247 flat angles C4'-P-C4' energy: -30.360 flat angles P-C4'-P energy: -19.192 tors. eta vs tors. theta energy: -43.299 Dist. restrs. and SS energy: 0.487 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -452.498090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.498090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.978513 (E_RNA) where: Base-Base interactions energy: -334.181 where: short stacking energy: -136.197 Base-Backbone interact. energy: -0.288 local terms energy: -118.509762 where: bonds (distance) C4'-P energy: -12.067 bonds (distance) P-C4' energy: -24.374 flat angles C4'-P-C4' energy: -23.715 flat angles P-C4'-P energy: -23.619 tors. eta vs tors. theta energy: -34.734 Dist. restrs. and SS energy: 0.480 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -552.485822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.485822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.703724 (E_RNA) where: Base-Base interactions energy: -391.617 where: short stacking energy: -164.134 Base-Backbone interact. energy: -0.400 local terms energy: -160.686591 where: bonds (distance) C4'-P energy: -28.838 bonds (distance) P-C4' energy: -26.958 flat angles C4'-P-C4' energy: -33.698 flat angles P-C4'-P energy: -24.046 tors. eta vs tors. theta energy: -47.147 Dist. restrs. and SS energy: 0.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -551.994878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.994878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.245063 (E_RNA) where: Base-Base interactions energy: -398.982 where: short stacking energy: -158.360 Base-Backbone interact. energy: -0.328 local terms energy: -152.935329 where: bonds (distance) C4'-P energy: -28.396 bonds (distance) P-C4' energy: -26.129 flat angles C4'-P-C4' energy: -32.181 flat angles P-C4'-P energy: -23.789 tors. eta vs tors. theta energy: -42.440 Dist. restrs. and SS energy: 0.250 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -538.866667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.866667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.961399 (E_RNA) where: Base-Base interactions energy: -380.270 where: short stacking energy: -160.402 Base-Backbone interact. energy: -0.415 local terms energy: -158.276415 where: bonds (distance) C4'-P energy: -26.781 bonds (distance) P-C4' energy: -31.217 flat angles C4'-P-C4' energy: -31.229 flat angles P-C4'-P energy: -25.614 tors. eta vs tors. theta energy: -43.435 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -540.853667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.853667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.963169 (E_RNA) where: Base-Base interactions energy: -392.197 where: short stacking energy: -156.175 Base-Backbone interact. energy: -1.088 local terms energy: -147.678325 where: bonds (distance) C4'-P energy: -29.996 bonds (distance) P-C4' energy: -25.664 flat angles C4'-P-C4' energy: -31.287 flat angles P-C4'-P energy: -22.378 tors. eta vs tors. theta energy: -38.353 Dist. restrs. and SS energy: 0.110 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -512.390698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.390698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.637018 (E_RNA) where: Base-Base interactions energy: -361.348 where: short stacking energy: -161.096 Base-Backbone interact. energy: -0.213 local terms energy: -151.075800 where: bonds (distance) C4'-P energy: -27.616 bonds (distance) P-C4' energy: -26.097 flat angles C4'-P-C4' energy: -30.988 flat angles P-C4'-P energy: -24.494 tors. eta vs tors. theta energy: -41.881 Dist. restrs. and SS energy: 0.246 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -509.365115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.365115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.618947 (E_RNA) where: Base-Base interactions energy: -363.675 where: short stacking energy: -145.920 Base-Backbone interact. energy: -0.451 local terms energy: -145.492665 where: bonds (distance) C4'-P energy: -29.495 bonds (distance) P-C4' energy: -26.097 flat angles C4'-P-C4' energy: -33.627 flat angles P-C4'-P energy: -16.484 tors. eta vs tors. theta energy: -39.790 Dist. restrs. and SS energy: 0.254 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -490.024794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.024794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.269744 (E_RNA) where: Base-Base interactions energy: -346.910 where: short stacking energy: -151.479 Base-Backbone interact. energy: -0.921 local terms energy: -142.438394 where: bonds (distance) C4'-P energy: -23.028 bonds (distance) P-C4' energy: -18.904 flat angles C4'-P-C4' energy: -30.023 flat angles P-C4'-P energy: -23.656 tors. eta vs tors. theta energy: -46.827 Dist. restrs. and SS energy: 0.245 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -492.128410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.128410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.305655 (E_RNA) where: Base-Base interactions energy: -350.617 where: short stacking energy: -151.579 Base-Backbone interact. energy: -0.883 local terms energy: -140.805906 where: bonds (distance) C4'-P energy: -21.477 bonds (distance) P-C4' energy: -32.956 flat angles C4'-P-C4' energy: -25.657 flat angles P-C4'-P energy: -16.040 tors. eta vs tors. theta energy: -44.676 Dist. restrs. and SS energy: 0.177 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -465.325721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.325721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.416878 (E_RNA) where: Base-Base interactions energy: -331.806 where: short stacking energy: -140.791 Base-Backbone interact. energy: -1.005 local terms energy: -132.606389 where: bonds (distance) C4'-P energy: -23.915 bonds (distance) P-C4' energy: -28.043 flat angles C4'-P-C4' energy: -26.160 flat angles P-C4'-P energy: -19.578 tors. eta vs tors. theta energy: -34.911 Dist. restrs. and SS energy: 0.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -444.217004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.217004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.946195 (E_RNA) where: Base-Base interactions energy: -323.892 where: short stacking energy: -133.429 Base-Backbone interact. energy: -0.934 local terms energy: -121.120428 where: bonds (distance) C4'-P energy: -23.104 bonds (distance) P-C4' energy: -19.987 flat angles C4'-P-C4' energy: -25.336 flat angles P-C4'-P energy: -16.491 tors. eta vs tors. theta energy: -36.202 Dist. restrs. and SS energy: 1.729 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -557.664455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.664455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.073197 (E_RNA) where: Base-Base interactions energy: -392.111 where: short stacking energy: -162.894 Base-Backbone interact. energy: -0.238 local terms energy: -165.724056 where: bonds (distance) C4'-P energy: -30.188 bonds (distance) P-C4' energy: -31.995 flat angles C4'-P-C4' energy: -33.624 flat angles P-C4'-P energy: -25.161 tors. eta vs tors. theta energy: -44.756 Dist. restrs. and SS energy: 0.409 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -555.887136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.887136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.031896 (E_RNA) where: Base-Base interactions energy: -393.513 where: short stacking energy: -159.840 Base-Backbone interact. energy: -1.343 local terms energy: -161.175818 where: bonds (distance) C4'-P energy: -33.486 bonds (distance) P-C4' energy: -28.831 flat angles C4'-P-C4' energy: -34.354 flat angles P-C4'-P energy: -23.435 tors. eta vs tors. theta energy: -41.070 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -537.386846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.386846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.850305 (E_RNA) where: Base-Base interactions energy: -384.646 where: short stacking energy: -158.732 Base-Backbone interact. energy: -0.298 local terms energy: -152.906418 where: bonds (distance) C4'-P energy: -26.139 bonds (distance) P-C4' energy: -31.977 flat angles C4'-P-C4' energy: -30.795 flat angles P-C4'-P energy: -24.271 tors. eta vs tors. theta energy: -39.724 Dist. restrs. and SS energy: 0.463 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -531.426506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.426506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.624768 (E_RNA) where: Base-Base interactions energy: -377.533 where: short stacking energy: -153.623 Base-Backbone interact. energy: -0.199 local terms energy: -153.892609 where: bonds (distance) C4'-P energy: -22.802 bonds (distance) P-C4' energy: -29.581 flat angles C4'-P-C4' energy: -33.991 flat angles P-C4'-P energy: -23.816 tors. eta vs tors. theta energy: -43.703 Dist. restrs. and SS energy: 0.198 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -522.356325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.356325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.514227 (E_RNA) where: Base-Base interactions energy: -374.725 where: short stacking energy: -157.035 Base-Backbone interact. energy: -0.771 local terms energy: -147.018372 where: bonds (distance) C4'-P energy: -21.626 bonds (distance) P-C4' energy: -29.711 flat angles C4'-P-C4' energy: -33.816 flat angles P-C4'-P energy: -21.566 tors. eta vs tors. theta energy: -40.298 Dist. restrs. and SS energy: 0.158 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -503.904356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.904356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.986224 (E_RNA) where: Base-Base interactions energy: -361.475 where: short stacking energy: -160.313 Base-Backbone interact. energy: -0.299 local terms energy: -142.211839 where: bonds (distance) C4'-P energy: -17.075 bonds (distance) P-C4' energy: -26.924 flat angles C4'-P-C4' energy: -35.297 flat angles P-C4'-P energy: -22.550 tors. eta vs tors. theta energy: -40.366 Dist. restrs. and SS energy: 0.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -486.996423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.996423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.015975 (E_RNA) where: Base-Base interactions energy: -347.028 where: short stacking energy: -155.633 Base-Backbone interact. energy: -0.803 local terms energy: -140.185642 where: bonds (distance) C4'-P energy: -21.955 bonds (distance) P-C4' energy: -26.512 flat angles C4'-P-C4' energy: -27.641 flat angles P-C4'-P energy: -22.131 tors. eta vs tors. theta energy: -41.946 Dist. restrs. and SS energy: 1.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -474.032439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.032439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.909367 (E_RNA) where: Base-Base interactions energy: -331.296 where: short stacking energy: -149.654 Base-Backbone interact. energy: -0.492 local terms energy: -144.121059 where: bonds (distance) C4'-P energy: -21.488 bonds (distance) P-C4' energy: -29.991 flat angles C4'-P-C4' energy: -34.203 flat angles P-C4'-P energy: -15.422 tors. eta vs tors. theta energy: -43.017 Dist. restrs. and SS energy: 1.877 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -465.559197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.559197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.861403 (E_RNA) where: Base-Base interactions energy: -326.762 where: short stacking energy: -129.929 Base-Backbone interact. energy: -0.828 local terms energy: -138.270999 where: bonds (distance) C4'-P energy: -27.005 bonds (distance) P-C4' energy: -28.114 flat angles C4'-P-C4' energy: -28.960 flat angles P-C4'-P energy: -19.222 tors. eta vs tors. theta energy: -34.971 Dist. restrs. and SS energy: 0.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -455.954584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.954584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.212422 (E_RNA) where: Base-Base interactions energy: -322.612 where: short stacking energy: -143.642 Base-Backbone interact. energy: -1.078 local terms energy: -135.522181 where: bonds (distance) C4'-P energy: -21.444 bonds (distance) P-C4' energy: -21.577 flat angles C4'-P-C4' energy: -30.120 flat angles P-C4'-P energy: -19.417 tors. eta vs tors. theta energy: -42.964 Dist. restrs. and SS energy: 3.258 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -556.244762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.244762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.356909 (E_RNA) where: Base-Base interactions energy: -397.675 where: short stacking energy: -162.953 Base-Backbone interact. energy: -0.784 local terms energy: -157.897702 where: bonds (distance) C4'-P energy: -28.291 bonds (distance) P-C4' energy: -29.285 flat angles C4'-P-C4' energy: -35.645 flat angles P-C4'-P energy: -24.662 tors. eta vs tors. theta energy: -40.014 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -545.625712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.625712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.708303 (E_RNA) where: Base-Base interactions energy: -388.361 where: short stacking energy: -153.115 Base-Backbone interact. energy: -1.588 local terms energy: -155.759306 where: bonds (distance) C4'-P energy: -27.177 bonds (distance) P-C4' energy: -26.062 flat angles C4'-P-C4' energy: -35.961 flat angles P-C4'-P energy: -25.126 tors. eta vs tors. theta energy: -41.432 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -540.890685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.890685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.905518 (E_RNA) where: Base-Base interactions energy: -390.129 where: short stacking energy: -160.353 Base-Backbone interact. energy: -0.152 local terms energy: -150.624522 where: bonds (distance) C4'-P energy: -29.410 bonds (distance) P-C4' energy: -30.497 flat angles C4'-P-C4' energy: -28.059 flat angles P-C4'-P energy: -21.156 tors. eta vs tors. theta energy: -41.501 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -527.079621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.079621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.253640 (E_RNA) where: Base-Base interactions energy: -370.704 where: short stacking energy: -147.393 Base-Backbone interact. energy: 0.540 local terms energy: -157.089966 where: bonds (distance) C4'-P energy: -25.085 bonds (distance) P-C4' energy: -31.316 flat angles C4'-P-C4' energy: -31.672 flat angles P-C4'-P energy: -26.033 tors. eta vs tors. theta energy: -42.984 Dist. restrs. and SS energy: 0.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -511.379005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.379005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.797536 (E_RNA) where: Base-Base interactions energy: -363.531 where: short stacking energy: -157.233 Base-Backbone interact. energy: -0.473 local terms energy: -147.793593 where: bonds (distance) C4'-P energy: -21.012 bonds (distance) P-C4' energy: -32.650 flat angles C4'-P-C4' energy: -29.803 flat angles P-C4'-P energy: -23.354 tors. eta vs tors. theta energy: -40.974 Dist. restrs. and SS energy: 0.419 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -496.571759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.571759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.371871 (E_RNA) where: Base-Base interactions energy: -349.805 where: short stacking energy: -152.998 Base-Backbone interact. energy: -0.804 local terms energy: -146.763765 where: bonds (distance) C4'-P energy: -25.488 bonds (distance) P-C4' energy: -26.037 flat angles C4'-P-C4' energy: -34.537 flat angles P-C4'-P energy: -21.242 tors. eta vs tors. theta energy: -39.461 Dist. restrs. and SS energy: 0.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -488.240287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.240287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.240287 (E_RNA) where: Base-Base interactions energy: -356.704 where: short stacking energy: -151.583 Base-Backbone interact. energy: -0.126 local terms energy: -131.409718 where: bonds (distance) C4'-P energy: -24.547 bonds (distance) P-C4' energy: -25.501 flat angles C4'-P-C4' energy: -22.861 flat angles P-C4'-P energy: -20.354 tors. eta vs tors. theta energy: -38.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -479.110480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.110480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.541183 (E_RNA) where: Base-Base interactions energy: -351.869 where: short stacking energy: -156.834 Base-Backbone interact. energy: -1.229 local terms energy: -126.444045 where: bonds (distance) C4'-P energy: -15.399 bonds (distance) P-C4' energy: -20.678 flat angles C4'-P-C4' energy: -31.989 flat angles P-C4'-P energy: -14.959 tors. eta vs tors. theta energy: -43.418 Dist. restrs. and SS energy: 0.431 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -476.209012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.209012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.128931 (E_RNA) where: Base-Base interactions energy: -341.273 where: short stacking energy: -144.505 Base-Backbone interact. energy: -0.655 local terms energy: -135.201737 where: bonds (distance) C4'-P energy: -17.460 bonds (distance) P-C4' energy: -25.696 flat angles C4'-P-C4' energy: -26.410 flat angles P-C4'-P energy: -22.512 tors. eta vs tors. theta energy: -43.123 Dist. restrs. and SS energy: 0.920 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -476.794384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.794384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.037211 (E_RNA) where: Base-Base interactions energy: -362.392 where: short stacking energy: -149.586 Base-Backbone interact. energy: -0.373 local terms energy: -114.272648 where: bonds (distance) C4'-P energy: -18.653 bonds (distance) P-C4' energy: -19.419 flat angles C4'-P-C4' energy: -20.088 flat angles P-C4'-P energy: -18.088 tors. eta vs tors. theta energy: -38.024 Dist. restrs. and SS energy: 0.243 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -553.158077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.158077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.318322 (E_RNA) where: Base-Base interactions energy: -394.682 where: short stacking energy: -160.708 Base-Backbone interact. energy: -1.139 local terms energy: -157.498217 where: bonds (distance) C4'-P energy: -32.377 bonds (distance) P-C4' energy: -28.247 flat angles C4'-P-C4' energy: -33.740 flat angles P-C4'-P energy: -22.721 tors. eta vs tors. theta energy: -40.413 Dist. restrs. and SS energy: 0.160 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -548.175674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.175674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.222147 (E_RNA) where: Base-Base interactions energy: -401.279 where: short stacking energy: -160.040 Base-Backbone interact. energy: -0.173 local terms energy: -146.769896 where: bonds (distance) C4'-P energy: -23.496 bonds (distance) P-C4' energy: -31.675 flat angles C4'-P-C4' energy: -27.501 flat angles P-C4'-P energy: -21.511 tors. eta vs tors. theta energy: -42.587 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -545.241975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.241975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.356127 (E_RNA) where: Base-Base interactions energy: -394.227 where: short stacking energy: -167.481 Base-Backbone interact. energy: -0.114 local terms energy: -151.014742 where: bonds (distance) C4'-P energy: -24.497 bonds (distance) P-C4' energy: -27.633 flat angles C4'-P-C4' energy: -30.418 flat angles P-C4'-P energy: -24.985 tors. eta vs tors. theta energy: -43.481 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -528.349749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.349749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.681783 (E_RNA) where: Base-Base interactions energy: -372.863 where: short stacking energy: -160.734 Base-Backbone interact. energy: -0.008 local terms energy: -155.810840 where: bonds (distance) C4'-P energy: -27.718 bonds (distance) P-C4' energy: -30.329 flat angles C4'-P-C4' energy: -30.150 flat angles P-C4'-P energy: -23.008 tors. eta vs tors. theta energy: -44.606 Dist. restrs. and SS energy: 0.332 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -512.365772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.365772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.710460 (E_RNA) where: Base-Base interactions energy: -360.226 where: short stacking energy: -152.134 Base-Backbone interact. energy: -1.591 local terms energy: -150.893528 where: bonds (distance) C4'-P energy: -25.013 bonds (distance) P-C4' energy: -29.785 flat angles C4'-P-C4' energy: -31.091 flat angles P-C4'-P energy: -19.353 tors. eta vs tors. theta energy: -45.652 Dist. restrs. and SS energy: 0.345 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -509.009052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.009052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.208225 (E_RNA) where: Base-Base interactions energy: -361.531 where: short stacking energy: -155.474 Base-Backbone interact. energy: -0.503 local terms energy: -147.174317 where: bonds (distance) C4'-P energy: -26.186 bonds (distance) P-C4' energy: -29.327 flat angles C4'-P-C4' energy: -29.107 flat angles P-C4'-P energy: -22.791 tors. eta vs tors. theta energy: -39.764 Dist. restrs. and SS energy: 0.199 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -490.368667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.368667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.791865 (E_RNA) where: Base-Base interactions energy: -356.234 where: short stacking energy: -154.918 Base-Backbone interact. energy: -0.649 local terms energy: -133.909281 where: bonds (distance) C4'-P energy: -22.147 bonds (distance) P-C4' energy: -21.873 flat angles C4'-P-C4' energy: -33.889 flat angles P-C4'-P energy: -12.111 tors. eta vs tors. theta energy: -43.889 Dist. restrs. and SS energy: 0.423 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -469.501283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.501283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.769891 (E_RNA) where: Base-Base interactions energy: -349.355 where: short stacking energy: -145.466 Base-Backbone interact. energy: -0.143 local terms energy: -120.272175 where: bonds (distance) C4'-P energy: -10.744 bonds (distance) P-C4' energy: -23.480 flat angles C4'-P-C4' energy: -31.156 flat angles P-C4'-P energy: -21.047 tors. eta vs tors. theta energy: -33.845 Dist. restrs. and SS energy: 0.269 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -488.764842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.764842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.089187 (E_RNA) where: Base-Base interactions energy: -359.047 where: short stacking energy: -154.222 Base-Backbone interact. energy: -0.015 local terms energy: -130.027368 where: bonds (distance) C4'-P energy: -25.021 bonds (distance) P-C4' energy: -22.889 flat angles C4'-P-C4' energy: -29.830 flat angles P-C4'-P energy: -10.197 tors. eta vs tors. theta energy: -42.090 Dist. restrs. and SS energy: 0.324 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -443.169664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.169664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.251175 (E_RNA) where: Base-Base interactions energy: -319.404 where: short stacking energy: -130.829 Base-Backbone interact. energy: -0.043 local terms energy: -123.803858 where: bonds (distance) C4'-P energy: -19.286 bonds (distance) P-C4' energy: -22.224 flat angles C4'-P-C4' energy: -30.611 flat angles P-C4'-P energy: -15.200 tors. eta vs tors. theta energy: -36.482 Dist. restrs. and SS energy: 0.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -548.355046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.355046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.481524 (E_RNA) where: Base-Base interactions energy: -389.976 where: short stacking energy: -158.770 Base-Backbone interact. energy: -0.707 local terms energy: -157.798366 where: bonds (distance) C4'-P energy: -31.144 bonds (distance) P-C4' energy: -33.021 flat angles C4'-P-C4' energy: -30.201 flat angles P-C4'-P energy: -22.389 tors. eta vs tors. theta energy: -41.044 Dist. restrs. and SS energy: 0.126 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -553.141503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.141503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.283229 (E_RNA) where: Base-Base interactions energy: -397.449 where: short stacking energy: -165.145 Base-Backbone interact. energy: -0.795 local terms energy: -155.039639 where: bonds (distance) C4'-P energy: -29.093 bonds (distance) P-C4' energy: -24.782 flat angles C4'-P-C4' energy: -35.578 flat angles P-C4'-P energy: -24.284 tors. eta vs tors. theta energy: -41.303 Dist. restrs. and SS energy: 0.142 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -536.809081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.809081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.094326 (E_RNA) where: Base-Base interactions energy: -378.941 where: short stacking energy: -158.675 Base-Backbone interact. energy: -0.467 local terms energy: -157.685677 where: bonds (distance) C4'-P energy: -29.781 bonds (distance) P-C4' energy: -30.023 flat angles C4'-P-C4' energy: -30.018 flat angles P-C4'-P energy: -22.811 tors. eta vs tors. theta energy: -45.053 Dist. restrs. and SS energy: 0.285 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -523.917723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.917723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.331783 (E_RNA) where: Base-Base interactions energy: -370.232 where: short stacking energy: -166.826 Base-Backbone interact. energy: -0.245 local terms energy: -153.854428 where: bonds (distance) C4'-P energy: -26.646 bonds (distance) P-C4' energy: -24.077 flat angles C4'-P-C4' energy: -31.592 flat angles P-C4'-P energy: -25.244 tors. eta vs tors. theta energy: -46.296 Dist. restrs. and SS energy: 0.414 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -519.188465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.188465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.363187 (E_RNA) where: Base-Base interactions energy: -363.610 where: short stacking energy: -156.213 Base-Backbone interact. energy: -0.354 local terms energy: -155.399965 where: bonds (distance) C4'-P energy: -28.110 bonds (distance) P-C4' energy: -29.707 flat angles C4'-P-C4' energy: -31.191 flat angles P-C4'-P energy: -23.580 tors. eta vs tors. theta energy: -42.811 Dist. restrs. and SS energy: 0.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -523.836609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.836609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.930289 (E_RNA) where: Base-Base interactions energy: -373.497 where: short stacking energy: -164.191 Base-Backbone interact. energy: -0.015 local terms energy: -150.418731 where: bonds (distance) C4'-P energy: -26.673 bonds (distance) P-C4' energy: -22.015 flat angles C4'-P-C4' energy: -30.778 flat angles P-C4'-P energy: -24.902 tors. eta vs tors. theta energy: -46.051 Dist. restrs. and SS energy: 0.094 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -489.802215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.802215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.257101 (E_RNA) where: Base-Base interactions energy: -357.695 where: short stacking energy: -159.171 Base-Backbone interact. energy: -0.224 local terms energy: -132.338267 where: bonds (distance) C4'-P energy: -24.063 bonds (distance) P-C4' energy: -21.009 flat angles C4'-P-C4' energy: -27.341 flat angles P-C4'-P energy: -15.762 tors. eta vs tors. theta energy: -44.163 Dist. restrs. and SS energy: 0.455 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -479.715175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.715175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.078613 (E_RNA) where: Base-Base interactions energy: -336.781 where: short stacking energy: -147.375 Base-Backbone interact. energy: -0.112 local terms energy: -143.186039 where: bonds (distance) C4'-P energy: -27.052 bonds (distance) P-C4' energy: -27.194 flat angles C4'-P-C4' energy: -32.586 flat angles P-C4'-P energy: -16.645 tors. eta vs tors. theta energy: -39.710 Dist. restrs. and SS energy: 0.363 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -469.875195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.875195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.294885 (E_RNA) where: Base-Base interactions energy: -350.678 where: short stacking energy: -143.103 Base-Backbone interact. energy: 0.407 local terms energy: -120.023580 where: bonds (distance) C4'-P energy: -14.293 bonds (distance) P-C4' energy: -24.383 flat angles C4'-P-C4' energy: -27.917 flat angles P-C4'-P energy: -18.187 tors. eta vs tors. theta energy: -35.244 Dist. restrs. and SS energy: 0.420 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -478.721899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.721899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.198881 (E_RNA) where: Base-Base interactions energy: -349.718 where: short stacking energy: -133.776 Base-Backbone interact. energy: -1.395 local terms energy: -128.085570 where: bonds (distance) C4'-P energy: -26.594 bonds (distance) P-C4' energy: -23.116 flat angles C4'-P-C4' energy: -21.515 flat angles P-C4'-P energy: -18.174 tors. eta vs tors. theta energy: -38.687 Dist. restrs. and SS energy: 0.477 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -561.362631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.362631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.568882 (E_RNA) where: Base-Base interactions energy: -401.994 where: short stacking energy: -163.414 Base-Backbone interact. energy: -0.612 local terms energy: -158.962620 where: bonds (distance) C4'-P energy: -28.059 bonds (distance) P-C4' energy: -33.314 flat angles C4'-P-C4' energy: -34.649 flat angles P-C4'-P energy: -23.276 tors. eta vs tors. theta energy: -39.665 Dist. restrs. and SS energy: 0.206 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -545.079973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.079973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.259515 (E_RNA) where: Base-Base interactions energy: -400.607 where: short stacking energy: -167.095 Base-Backbone interact. energy: -0.571 local terms energy: -144.082272 where: bonds (distance) C4'-P energy: -26.217 bonds (distance) P-C4' energy: -24.355 flat angles C4'-P-C4' energy: -32.061 flat angles P-C4'-P energy: -23.010 tors. eta vs tors. theta energy: -38.439 Dist. restrs. and SS energy: 0.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -536.571253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.571253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.675778 (E_RNA) where: Base-Base interactions energy: -378.066 where: short stacking energy: -167.682 Base-Backbone interact. energy: 0.702 local terms energy: -159.310969 where: bonds (distance) C4'-P energy: -30.240 bonds (distance) P-C4' energy: -23.352 flat angles C4'-P-C4' energy: -33.021 flat angles P-C4'-P energy: -27.546 tors. eta vs tors. theta energy: -45.152 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -532.070586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.070586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.226144 (E_RNA) where: Base-Base interactions energy: -378.431 where: short stacking energy: -153.555 Base-Backbone interact. energy: -0.317 local terms energy: -153.478005 where: bonds (distance) C4'-P energy: -20.213 bonds (distance) P-C4' energy: -27.939 flat angles C4'-P-C4' energy: -32.509 flat angles P-C4'-P energy: -26.768 tors. eta vs tors. theta energy: -46.049 Dist. restrs. and SS energy: 0.156 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -517.135402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.135402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.566095 (E_RNA) where: Base-Base interactions energy: -367.681 where: short stacking energy: -151.904 Base-Backbone interact. energy: -0.523 local terms energy: -149.362613 where: bonds (distance) C4'-P energy: -20.239 bonds (distance) P-C4' energy: -29.107 flat angles C4'-P-C4' energy: -34.190 flat angles P-C4'-P energy: -23.601 tors. eta vs tors. theta energy: -42.226 Dist. restrs. and SS energy: 0.431 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -515.719114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.719114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.087981 (E_RNA) where: Base-Base interactions energy: -360.550 where: short stacking energy: -159.822 Base-Backbone interact. energy: -0.847 local terms energy: -154.690409 where: bonds (distance) C4'-P energy: -29.138 bonds (distance) P-C4' energy: -29.626 flat angles C4'-P-C4' energy: -32.088 flat angles P-C4'-P energy: -21.064 tors. eta vs tors. theta energy: -42.775 Dist. restrs. and SS energy: 0.369 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -474.270892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.270892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.918323 (E_RNA) where: Base-Base interactions energy: -332.477 where: short stacking energy: -148.454 Base-Backbone interact. energy: -0.405 local terms energy: -142.035846 where: bonds (distance) C4'-P energy: -22.175 bonds (distance) P-C4' energy: -24.078 flat angles C4'-P-C4' energy: -32.633 flat angles P-C4'-P energy: -20.999 tors. eta vs tors. theta energy: -42.151 Dist. restrs. and SS energy: 0.647 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -481.615255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.615255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.676742 (E_RNA) where: Base-Base interactions energy: -346.227 where: short stacking energy: -142.187 Base-Backbone interact. energy: -0.998 local terms energy: -134.451949 where: bonds (distance) C4'-P energy: -25.184 bonds (distance) P-C4' energy: -22.706 flat angles C4'-P-C4' energy: -30.241 flat angles P-C4'-P energy: -20.407 tors. eta vs tors. theta energy: -35.913 Dist. restrs. and SS energy: 0.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -472.615695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.615695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.930506 (E_RNA) where: Base-Base interactions energy: -346.544 where: short stacking energy: -148.097 Base-Backbone interact. energy: 1.568 local terms energy: -127.955263 where: bonds (distance) C4'-P energy: -19.042 bonds (distance) P-C4' energy: -23.568 flat angles C4'-P-C4' energy: -25.883 flat angles P-C4'-P energy: -13.721 tors. eta vs tors. theta energy: -45.742 Dist. restrs. and SS energy: 0.315 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -455.054915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.054915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.513302 (E_RNA) where: Base-Base interactions energy: -322.254 where: short stacking energy: -128.535 Base-Backbone interact. energy: -2.006 local terms energy: -131.253371 where: bonds (distance) C4'-P energy: -21.192 bonds (distance) P-C4' energy: -30.000 flat angles C4'-P-C4' energy: -27.114 flat angles P-C4'-P energy: -16.476 tors. eta vs tors. theta energy: -36.471 Dist. restrs. and SS energy: 0.458 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -556.468840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.468840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.592572 (E_RNA) where: Base-Base interactions energy: -405.115 where: short stacking energy: -161.526 Base-Backbone interact. energy: -1.312 local terms energy: -150.165499 where: bonds (distance) C4'-P energy: -27.533 bonds (distance) P-C4' energy: -27.719 flat angles C4'-P-C4' energy: -35.580 flat angles P-C4'-P energy: -19.500 tors. eta vs tors. theta energy: -39.834 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -548.898507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.898507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.007139 (E_RNA) where: Base-Base interactions energy: -380.538 where: short stacking energy: -161.962 Base-Backbone interact. energy: -0.669 local terms energy: -167.799795 where: bonds (distance) C4'-P energy: -30.297 bonds (distance) P-C4' energy: -33.884 flat angles C4'-P-C4' energy: -34.023 flat angles P-C4'-P energy: -23.215 tors. eta vs tors. theta energy: -46.381 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -538.306358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.306358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.420613 (E_RNA) where: Base-Base interactions energy: -393.658 where: short stacking energy: -163.732 Base-Backbone interact. energy: -0.376 local terms energy: -144.386526 where: bonds (distance) C4'-P energy: -22.465 bonds (distance) P-C4' energy: -28.473 flat angles C4'-P-C4' energy: -29.671 flat angles P-C4'-P energy: -21.644 tors. eta vs tors. theta energy: -42.133 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -535.983381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.983381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.107681 (E_RNA) where: Base-Base interactions energy: -382.500 where: short stacking energy: -167.594 Base-Backbone interact. energy: -0.142 local terms energy: -153.465580 where: bonds (distance) C4'-P energy: -29.520 bonds (distance) P-C4' energy: -26.903 flat angles C4'-P-C4' energy: -29.157 flat angles P-C4'-P energy: -23.088 tors. eta vs tors. theta energy: -44.798 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -507.092352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.092352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.345210 (E_RNA) where: Base-Base interactions energy: -354.362 where: short stacking energy: -152.195 Base-Backbone interact. energy: 0.106 local terms energy: -153.089347 where: bonds (distance) C4'-P energy: -26.063 bonds (distance) P-C4' energy: -31.146 flat angles C4'-P-C4' energy: -30.491 flat angles P-C4'-P energy: -23.564 tors. eta vs tors. theta energy: -41.827 Dist. restrs. and SS energy: 0.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -511.952470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.952470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.032337 (E_RNA) where: Base-Base interactions energy: -372.994 where: short stacking energy: -160.250 Base-Backbone interact. energy: -0.534 local terms energy: -138.504800 where: bonds (distance) C4'-P energy: -23.419 bonds (distance) P-C4' energy: -21.739 flat angles C4'-P-C4' energy: -31.480 flat angles P-C4'-P energy: -17.735 tors. eta vs tors. theta energy: -44.131 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -492.922555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.922555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.301146 (E_RNA) where: Base-Base interactions energy: -350.910 where: short stacking energy: -157.163 Base-Backbone interact. energy: -1.060 local terms energy: -141.330982 where: bonds (distance) C4'-P energy: -25.877 bonds (distance) P-C4' energy: -28.625 flat angles C4'-P-C4' energy: -31.873 flat angles P-C4'-P energy: -16.244 tors. eta vs tors. theta energy: -38.712 Dist. restrs. and SS energy: 0.379 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -496.388894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.388894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.733187 (E_RNA) where: Base-Base interactions energy: -355.074 where: short stacking energy: -163.235 Base-Backbone interact. energy: -0.362 local terms energy: -141.296924 where: bonds (distance) C4'-P energy: -25.465 bonds (distance) P-C4' energy: -28.816 flat angles C4'-P-C4' energy: -31.321 flat angles P-C4'-P energy: -13.872 tors. eta vs tors. theta energy: -41.823 Dist. restrs. and SS energy: 0.344 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -482.757112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.757112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.156764 (E_RNA) where: Base-Base interactions energy: -343.655 where: short stacking energy: -150.891 Base-Backbone interact. energy: -0.417 local terms energy: -139.084984 where: bonds (distance) C4'-P energy: -21.071 bonds (distance) P-C4' energy: -27.608 flat angles C4'-P-C4' energy: -28.819 flat angles P-C4'-P energy: -22.356 tors. eta vs tors. theta energy: -39.231 Dist. restrs. and SS energy: 0.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -445.433013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.433013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.973427 (E_RNA) where: Base-Base interactions energy: -313.292 where: short stacking energy: -125.694 Base-Backbone interact. energy: -0.160 local terms energy: -132.521068 where: bonds (distance) C4'-P energy: -22.666 bonds (distance) P-C4' energy: -29.265 flat angles C4'-P-C4' energy: -26.994 flat angles P-C4'-P energy: -17.703 tors. eta vs tors. theta energy: -35.893 Dist. restrs. and SS energy: 0.540 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -556.253764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.253764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.562165 (E_RNA) where: Base-Base interactions energy: -402.441 where: short stacking energy: -167.423 Base-Backbone interact. energy: -0.181 local terms energy: -153.940867 where: bonds (distance) C4'-P energy: -30.526 bonds (distance) P-C4' energy: -26.892 flat angles C4'-P-C4' energy: -31.690 flat angles P-C4'-P energy: -23.136 tors. eta vs tors. theta energy: -41.698 Dist. restrs. and SS energy: 0.308 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -542.779026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.779026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.838567 (E_RNA) where: Base-Base interactions energy: -372.734 where: short stacking energy: -154.503 Base-Backbone interact. energy: -1.055 local terms energy: -169.049880 where: bonds (distance) C4'-P energy: -32.136 bonds (distance) P-C4' energy: -32.340 flat angles C4'-P-C4' energy: -33.247 flat angles P-C4'-P energy: -26.532 tors. eta vs tors. theta energy: -44.795 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -545.295894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.295894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.543704 (E_RNA) where: Base-Base interactions energy: -384.825 where: short stacking energy: -165.080 Base-Backbone interact. energy: -0.276 local terms energy: -160.442615 where: bonds (distance) C4'-P energy: -29.773 bonds (distance) P-C4' energy: -29.247 flat angles C4'-P-C4' energy: -32.703 flat angles P-C4'-P energy: -24.824 tors. eta vs tors. theta energy: -43.896 Dist. restrs. and SS energy: 0.248 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -524.346550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.346550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.573586 (E_RNA) where: Base-Base interactions energy: -375.673 where: short stacking energy: -155.875 Base-Backbone interact. energy: -0.854 local terms energy: -148.046827 where: bonds (distance) C4'-P energy: -28.246 bonds (distance) P-C4' energy: -24.528 flat angles C4'-P-C4' energy: -37.534 flat angles P-C4'-P energy: -19.953 tors. eta vs tors. theta energy: -37.785 Dist. restrs. and SS energy: 0.227 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -529.332884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.332884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.439504 (E_RNA) where: Base-Base interactions energy: -380.646 where: short stacking energy: -156.939 Base-Backbone interact. energy: -0.182 local terms energy: -148.611339 where: bonds (distance) C4'-P energy: -26.329 bonds (distance) P-C4' energy: -25.062 flat angles C4'-P-C4' energy: -30.891 flat angles P-C4'-P energy: -25.447 tors. eta vs tors. theta energy: -40.882 Dist. restrs. and SS energy: 0.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -515.553231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.553231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.737510 (E_RNA) where: Base-Base interactions energy: -369.027 where: short stacking energy: -162.494 Base-Backbone interact. energy: -0.008 local terms energy: -146.703076 where: bonds (distance) C4'-P energy: -25.217 bonds (distance) P-C4' energy: -28.417 flat angles C4'-P-C4' energy: -25.285 flat angles P-C4'-P energy: -22.545 tors. eta vs tors. theta energy: -45.238 Dist. restrs. and SS energy: 0.184 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -495.493426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.493426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.147761 (E_RNA) where: Base-Base interactions energy: -348.289 where: short stacking energy: -143.848 Base-Backbone interact. energy: -0.687 local terms energy: -147.171595 where: bonds (distance) C4'-P energy: -29.741 bonds (distance) P-C4' energy: -27.410 flat angles C4'-P-C4' energy: -29.756 flat angles P-C4'-P energy: -20.802 tors. eta vs tors. theta energy: -39.463 Dist. restrs. and SS energy: 0.654 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -495.263504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.263504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.397575 (E_RNA) where: Base-Base interactions energy: -341.645 where: short stacking energy: -150.998 Base-Backbone interact. energy: -0.526 local terms energy: -153.226363 where: bonds (distance) C4'-P energy: -30.054 bonds (distance) P-C4' energy: -30.313 flat angles C4'-P-C4' energy: -28.518 flat angles P-C4'-P energy: -22.754 tors. eta vs tors. theta energy: -41.588 Dist. restrs. and SS energy: 0.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -472.768050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.768050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.578204 (E_RNA) where: Base-Base interactions energy: -343.121 where: short stacking energy: -140.927 Base-Backbone interact. energy: -0.941 local terms energy: -129.516711 where: bonds (distance) C4'-P energy: -26.973 bonds (distance) P-C4' energy: -28.551 flat angles C4'-P-C4' energy: -23.328 flat angles P-C4'-P energy: -15.578 tors. eta vs tors. theta energy: -35.088 Dist. restrs. and SS energy: 0.810 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -425.079629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.079629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.153720 (E_RNA) where: Base-Base interactions energy: -296.856 where: short stacking energy: -125.906 Base-Backbone interact. energy: -0.331 local terms energy: -128.966719 where: bonds (distance) C4'-P energy: -19.429 bonds (distance) P-C4' energy: -28.155 flat angles C4'-P-C4' energy: -24.496 flat angles P-C4'-P energy: -20.357 tors. eta vs tors. theta energy: -36.529 Dist. restrs. and SS energy: 1.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -556.644434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.644434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.749331 (E_RNA) where: Base-Base interactions energy: -402.008 where: short stacking energy: -167.085 Base-Backbone interact. energy: -0.145 local terms energy: -154.597058 where: bonds (distance) C4'-P energy: -26.457 bonds (distance) P-C4' energy: -32.881 flat angles C4'-P-C4' energy: -31.601 flat angles P-C4'-P energy: -21.794 tors. eta vs tors. theta energy: -41.865 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -557.636503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.636503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.703905 (E_RNA) where: Base-Base interactions energy: -397.957 where: short stacking energy: -159.876 Base-Backbone interact. energy: -0.062 local terms energy: -159.685021 where: bonds (distance) C4'-P energy: -27.913 bonds (distance) P-C4' energy: -32.186 flat angles C4'-P-C4' energy: -32.341 flat angles P-C4'-P energy: -23.296 tors. eta vs tors. theta energy: -43.948 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -536.096802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.096802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.258732 (E_RNA) where: Base-Base interactions energy: -375.440 where: short stacking energy: -160.425 Base-Backbone interact. energy: -1.358 local terms energy: -159.460758 where: bonds (distance) C4'-P energy: -31.582 bonds (distance) P-C4' energy: -28.848 flat angles C4'-P-C4' energy: -35.849 flat angles P-C4'-P energy: -18.965 tors. eta vs tors. theta energy: -44.218 Dist. restrs. and SS energy: 0.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -529.202884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.202884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.297085 (E_RNA) where: Base-Base interactions energy: -385.184 where: short stacking energy: -157.277 Base-Backbone interact. energy: -0.129 local terms energy: -143.983936 where: bonds (distance) C4'-P energy: -22.133 bonds (distance) P-C4' energy: -24.131 flat angles C4'-P-C4' energy: -31.407 flat angles P-C4'-P energy: -20.446 tors. eta vs tors. theta energy: -45.867 Dist. restrs. and SS energy: 0.094 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -527.706333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.706333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.170680 (E_RNA) where: Base-Base interactions energy: -382.586 where: short stacking energy: -150.595 Base-Backbone interact. energy: -1.358 local terms energy: -144.226812 where: bonds (distance) C4'-P energy: -26.204 bonds (distance) P-C4' energy: -23.705 flat angles C4'-P-C4' energy: -35.275 flat angles P-C4'-P energy: -21.062 tors. eta vs tors. theta energy: -37.980 Dist. restrs. and SS energy: 0.464 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -519.439896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.439896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.656475 (E_RNA) where: Base-Base interactions energy: -382.497 where: short stacking energy: -156.520 Base-Backbone interact. energy: -0.928 local terms energy: -136.231443 where: bonds (distance) C4'-P energy: -27.709 bonds (distance) P-C4' energy: -27.143 flat angles C4'-P-C4' energy: -18.348 flat angles P-C4'-P energy: -22.185 tors. eta vs tors. theta energy: -40.847 Dist. restrs. and SS energy: 0.217 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -491.866793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.866793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.943732 (E_RNA) where: Base-Base interactions energy: -356.703 where: short stacking energy: -151.666 Base-Backbone interact. energy: -1.025 local terms energy: -134.216330 where: bonds (distance) C4'-P energy: -19.428 bonds (distance) P-C4' energy: -27.295 flat angles C4'-P-C4' energy: -24.874 flat angles P-C4'-P energy: -16.045 tors. eta vs tors. theta energy: -46.575 Dist. restrs. and SS energy: 0.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -494.015154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.015154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.456821 (E_RNA) where: Base-Base interactions energy: -349.490 where: short stacking energy: -157.118 Base-Backbone interact. energy: -0.524 local terms energy: -144.442600 where: bonds (distance) C4'-P energy: -19.966 bonds (distance) P-C4' energy: -25.220 flat angles C4'-P-C4' energy: -32.957 flat angles P-C4'-P energy: -20.204 tors. eta vs tors. theta energy: -46.097 Dist. restrs. and SS energy: 0.442 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -448.448594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.448594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.505015 (E_RNA) where: Base-Base interactions energy: -326.108 where: short stacking energy: -128.231 Base-Backbone interact. energy: -0.110 local terms energy: -123.286937 where: bonds (distance) C4'-P energy: -27.385 bonds (distance) P-C4' energy: -22.263 flat angles C4'-P-C4' energy: -23.709 flat angles P-C4'-P energy: -19.923 tors. eta vs tors. theta energy: -30.007 Dist. restrs. and SS energy: 1.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -432.186691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.186691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.692045 (E_RNA) where: Base-Base interactions energy: -317.465 where: short stacking energy: -133.635 Base-Backbone interact. energy: -0.303 local terms energy: -114.923721 where: bonds (distance) C4'-P energy: -17.804 bonds (distance) P-C4' energy: -17.241 flat angles C4'-P-C4' energy: -27.260 flat angles P-C4'-P energy: -16.861 tors. eta vs tors. theta energy: -35.759 Dist. restrs. and SS energy: 0.505 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -562.589215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.589215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.778219 (E_RNA) where: Base-Base interactions energy: -399.801 where: short stacking energy: -170.565 Base-Backbone interact. energy: -0.375 local terms energy: -162.602071 where: bonds (distance) C4'-P energy: -30.845 bonds (distance) P-C4' energy: -28.649 flat angles C4'-P-C4' energy: -34.283 flat angles P-C4'-P energy: -22.834 tors. eta vs tors. theta energy: -45.991 Dist. restrs. and SS energy: 0.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -540.461866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.461866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.777244 (E_RNA) where: Base-Base interactions energy: -384.601 where: short stacking energy: -155.730 Base-Backbone interact. energy: -0.509 local terms energy: -155.666879 where: bonds (distance) C4'-P energy: -28.472 bonds (distance) P-C4' energy: -30.135 flat angles C4'-P-C4' energy: -32.428 flat angles P-C4'-P energy: -22.502 tors. eta vs tors. theta energy: -42.129 Dist. restrs. and SS energy: 0.315 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -544.087220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.087220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.097180 (E_RNA) where: Base-Base interactions energy: -389.438 where: short stacking energy: -159.448 Base-Backbone interact. energy: -0.034 local terms energy: -154.624983 where: bonds (distance) C4'-P energy: -25.748 bonds (distance) P-C4' energy: -28.492 flat angles C4'-P-C4' energy: -31.581 flat angles P-C4'-P energy: -26.255 tors. eta vs tors. theta energy: -42.550 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -532.856397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.856397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.172843 (E_RNA) where: Base-Base interactions energy: -375.813 where: short stacking energy: -156.469 Base-Backbone interact. energy: -0.355 local terms energy: -157.004239 where: bonds (distance) C4'-P energy: -24.543 bonds (distance) P-C4' energy: -32.298 flat angles C4'-P-C4' energy: -29.875 flat angles P-C4'-P energy: -27.471 tors. eta vs tors. theta energy: -42.817 Dist. restrs. and SS energy: 0.316 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -522.606596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.606596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.811847 (E_RNA) where: Base-Base interactions energy: -373.400 where: short stacking energy: -157.232 Base-Backbone interact. energy: -0.912 local terms energy: -148.500154 where: bonds (distance) C4'-P energy: -24.452 bonds (distance) P-C4' energy: -26.191 flat angles C4'-P-C4' energy: -31.169 flat angles P-C4'-P energy: -25.487 tors. eta vs tors. theta energy: -41.201 Dist. restrs. and SS energy: 0.205 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -521.706471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.706471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.875208 (E_RNA) where: Base-Base interactions energy: -374.595 where: short stacking energy: -158.056 Base-Backbone interact. energy: -0.317 local terms energy: -146.963081 where: bonds (distance) C4'-P energy: -23.621 bonds (distance) P-C4' energy: -32.334 flat angles C4'-P-C4' energy: -32.049 flat angles P-C4'-P energy: -19.824 tors. eta vs tors. theta energy: -39.134 Dist. restrs. and SS energy: 0.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -499.097319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.097319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.231374 (E_RNA) where: Base-Base interactions energy: -364.807 where: short stacking energy: -163.444 Base-Backbone interact. energy: -0.087 local terms energy: -134.337249 where: bonds (distance) C4'-P energy: -22.371 bonds (distance) P-C4' energy: -26.162 flat angles C4'-P-C4' energy: -29.446 flat angles P-C4'-P energy: -16.624 tors. eta vs tors. theta energy: -39.735 Dist. restrs. and SS energy: 0.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -504.282554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.282554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.669456 (E_RNA) where: Base-Base interactions energy: -358.541 where: short stacking energy: -157.577 Base-Backbone interact. energy: -0.069 local terms energy: -146.058924 where: bonds (distance) C4'-P energy: -25.206 bonds (distance) P-C4' energy: -25.434 flat angles C4'-P-C4' energy: -29.775 flat angles P-C4'-P energy: -21.507 tors. eta vs tors. theta energy: -44.137 Dist. restrs. and SS energy: 0.387 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -468.453623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.453623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.797404 (E_RNA) where: Base-Base interactions energy: -340.905 where: short stacking energy: -141.374 Base-Backbone interact. energy: -0.547 local terms energy: -127.345978 where: bonds (distance) C4'-P energy: -21.307 bonds (distance) P-C4' energy: -20.839 flat angles C4'-P-C4' energy: -27.357 flat angles P-C4'-P energy: -19.760 tors. eta vs tors. theta energy: -38.084 Dist. restrs. and SS energy: 0.344 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -432.061303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.061303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.347581 (E_RNA) where: Base-Base interactions energy: -318.155 where: short stacking energy: -135.538 Base-Backbone interact. energy: -0.081 local terms energy: -114.111445 where: bonds (distance) C4'-P energy: -20.973 bonds (distance) P-C4' energy: -13.008 flat angles C4'-P-C4' energy: -25.922 flat angles P-C4'-P energy: -16.572 tors. eta vs tors. theta energy: -37.635 Dist. restrs. and SS energy: 0.286 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -563.728540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.728540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.814256 (E_RNA) where: Base-Base interactions energy: -401.255 where: short stacking energy: -167.768 Base-Backbone interact. energy: -0.072 local terms energy: -162.487564 where: bonds (distance) C4'-P energy: -28.374 bonds (distance) P-C4' energy: -28.067 flat angles C4'-P-C4' energy: -35.447 flat angles P-C4'-P energy: -23.814 tors. eta vs tors. theta energy: -46.785 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -550.874767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.874767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.198491 (E_RNA) where: Base-Base interactions energy: -393.206 where: short stacking energy: -159.080 Base-Backbone interact. energy: -0.542 local terms energy: -157.450895 where: bonds (distance) C4'-P energy: -28.991 bonds (distance) P-C4' energy: -29.050 flat angles C4'-P-C4' energy: -29.302 flat angles P-C4'-P energy: -26.246 tors. eta vs tors. theta energy: -43.862 Dist. restrs. and SS energy: 0.324 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -537.581340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.581340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.690102 (E_RNA) where: Base-Base interactions energy: -376.785 where: short stacking energy: -158.222 Base-Backbone interact. energy: -0.114 local terms energy: -160.791678 where: bonds (distance) C4'-P energy: -30.676 bonds (distance) P-C4' energy: -31.438 flat angles C4'-P-C4' energy: -29.313 flat angles P-C4'-P energy: -23.983 tors. eta vs tors. theta energy: -45.383 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -532.327896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.327896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.548119 (E_RNA) where: Base-Base interactions energy: -379.819 where: short stacking energy: -161.012 Base-Backbone interact. energy: -0.877 local terms energy: -151.852666 where: bonds (distance) C4'-P energy: -29.155 bonds (distance) P-C4' energy: -24.872 flat angles C4'-P-C4' energy: -32.815 flat angles P-C4'-P energy: -23.645 tors. eta vs tors. theta energy: -41.365 Dist. restrs. and SS energy: 0.220 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -517.248707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.248707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.474282 (E_RNA) where: Base-Base interactions energy: -369.019 where: short stacking energy: -151.877 Base-Backbone interact. energy: -0.214 local terms energy: -148.241846 where: bonds (distance) C4'-P energy: -28.854 bonds (distance) P-C4' energy: -26.132 flat angles C4'-P-C4' energy: -31.101 flat angles P-C4'-P energy: -19.887 tors. eta vs tors. theta energy: -42.268 Dist. restrs. and SS energy: 0.226 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -503.321480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.321480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.604205 (E_RNA) where: Base-Base interactions energy: -358.131 where: short stacking energy: -153.090 Base-Backbone interact. energy: -0.104 local terms energy: -145.369422 where: bonds (distance) C4'-P energy: -22.136 bonds (distance) P-C4' energy: -24.141 flat angles C4'-P-C4' energy: -30.773 flat angles P-C4'-P energy: -21.413 tors. eta vs tors. theta energy: -46.906 Dist. restrs. and SS energy: 0.283 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -493.405530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.405530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.758799 (E_RNA) where: Base-Base interactions energy: -361.301 where: short stacking energy: -147.920 Base-Backbone interact. energy: -0.211 local terms energy: -132.247222 where: bonds (distance) C4'-P energy: -24.107 bonds (distance) P-C4' energy: -19.465 flat angles C4'-P-C4' energy: -28.576 flat angles P-C4'-P energy: -20.696 tors. eta vs tors. theta energy: -39.403 Dist. restrs. and SS energy: 0.353 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -469.271633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.271633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.968158 (E_RNA) where: Base-Base interactions energy: -336.037 where: short stacking energy: -139.633 Base-Backbone interact. energy: -0.904 local terms energy: -133.027374 where: bonds (distance) C4'-P energy: -29.649 bonds (distance) P-C4' energy: -20.604 flat angles C4'-P-C4' energy: -27.147 flat angles P-C4'-P energy: -20.869 tors. eta vs tors. theta energy: -34.759 Dist. restrs. and SS energy: 0.697 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -463.132749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.132749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.577302 (E_RNA) where: Base-Base interactions energy: -335.623 where: short stacking energy: -145.375 Base-Backbone interact. energy: 0.319 local terms energy: -128.273977 where: bonds (distance) C4'-P energy: -21.020 bonds (distance) P-C4' energy: -18.709 flat angles C4'-P-C4' energy: -22.927 flat angles P-C4'-P energy: -20.705 tors. eta vs tors. theta energy: -44.912 Dist. restrs. and SS energy: 0.445 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -417.850276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.850276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.256770 (E_RNA) where: Base-Base interactions energy: -298.060 where: short stacking energy: -125.977 Base-Backbone interact. energy: -0.389 local terms energy: -124.807341 where: bonds (distance) C4'-P energy: -16.928 bonds (distance) P-C4' energy: -27.411 flat angles C4'-P-C4' energy: -27.281 flat angles P-C4'-P energy: -20.389 tors. eta vs tors. theta energy: -32.798 Dist. restrs. and SS energy: 5.406 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -558.873620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.873620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.246801 (E_RNA) where: Base-Base interactions energy: -397.357 where: short stacking energy: -163.057 Base-Backbone interact. energy: -0.553 local terms energy: -161.337155 where: bonds (distance) C4'-P energy: -30.762 bonds (distance) P-C4' energy: -30.350 flat angles C4'-P-C4' energy: -30.682 flat angles P-C4'-P energy: -24.974 tors. eta vs tors. theta energy: -44.568 Dist. restrs. and SS energy: 0.373 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -540.771725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.771725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.903986 (E_RNA) where: Base-Base interactions energy: -394.656 where: short stacking energy: -160.964 Base-Backbone interact. energy: -0.135 local terms energy: -146.113101 where: bonds (distance) C4'-P energy: -21.577 bonds (distance) P-C4' energy: -31.756 flat angles C4'-P-C4' energy: -25.812 flat angles P-C4'-P energy: -23.500 tors. eta vs tors. theta energy: -43.467 Dist. restrs. and SS energy: 0.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -528.437623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.437623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.532125 (E_RNA) where: Base-Base interactions energy: -376.014 where: short stacking energy: -149.697 Base-Backbone interact. energy: -0.629 local terms energy: -151.888417 where: bonds (distance) C4'-P energy: -25.957 bonds (distance) P-C4' energy: -30.334 flat angles C4'-P-C4' energy: -31.391 flat angles P-C4'-P energy: -23.006 tors. eta vs tors. theta energy: -41.200 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -523.473484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.473484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.666351 (E_RNA) where: Base-Base interactions energy: -381.044 where: short stacking energy: -153.644 Base-Backbone interact. energy: -0.222 local terms energy: -142.400708 where: bonds (distance) C4'-P energy: -25.222 bonds (distance) P-C4' energy: -22.775 flat angles C4'-P-C4' energy: -31.998 flat angles P-C4'-P energy: -21.593 tors. eta vs tors. theta energy: -40.813 Dist. restrs. and SS energy: 0.193 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -530.194311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.194311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.550380 (E_RNA) where: Base-Base interactions energy: -375.752 where: short stacking energy: -155.484 Base-Backbone interact. energy: -0.224 local terms energy: -154.574810 where: bonds (distance) C4'-P energy: -23.331 bonds (distance) P-C4' energy: -30.977 flat angles C4'-P-C4' energy: -33.497 flat angles P-C4'-P energy: -24.765 tors. eta vs tors. theta energy: -42.005 Dist. restrs. and SS energy: 0.356 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -491.192275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.192275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.430854 (E_RNA) where: Base-Base interactions energy: -346.662 where: short stacking energy: -152.717 Base-Backbone interact. energy: -0.815 local terms energy: -143.954259 where: bonds (distance) C4'-P energy: -25.073 bonds (distance) P-C4' energy: -29.914 flat angles C4'-P-C4' energy: -30.587 flat angles P-C4'-P energy: -16.739 tors. eta vs tors. theta energy: -41.642 Dist. restrs. and SS energy: 0.239 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -500.465231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.465231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.585023 (E_RNA) where: Base-Base interactions energy: -355.160 where: short stacking energy: -157.985 Base-Backbone interact. energy: -0.729 local terms energy: -144.695967 where: bonds (distance) C4'-P energy: -22.335 bonds (distance) P-C4' energy: -26.015 flat angles C4'-P-C4' energy: -34.061 flat angles P-C4'-P energy: -17.343 tors. eta vs tors. theta energy: -44.942 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -495.396407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.396407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.931801 (E_RNA) where: Base-Base interactions energy: -344.526 where: short stacking energy: -152.027 Base-Backbone interact. energy: -0.455 local terms energy: -150.950924 where: bonds (distance) C4'-P energy: -24.442 bonds (distance) P-C4' energy: -29.378 flat angles C4'-P-C4' energy: -27.659 flat angles P-C4'-P energy: -25.002 tors. eta vs tors. theta energy: -44.470 Dist. restrs. and SS energy: 0.535 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -452.146971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.146971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.889691 (E_RNA) where: Base-Base interactions energy: -326.208 where: short stacking energy: -143.601 Base-Backbone interact. energy: -1.003 local terms energy: -125.678718 where: bonds (distance) C4'-P energy: -22.642 bonds (distance) P-C4' energy: -20.431 flat angles C4'-P-C4' energy: -27.420 flat angles P-C4'-P energy: -16.403 tors. eta vs tors. theta energy: -38.782 Dist. restrs. and SS energy: 0.743 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -439.023250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.023250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.226729 (E_RNA) where: Base-Base interactions energy: -309.221 where: short stacking energy: -128.848 Base-Backbone interact. energy: -0.454 local terms energy: -129.551699 where: bonds (distance) C4'-P energy: -28.050 bonds (distance) P-C4' energy: -27.982 flat angles C4'-P-C4' energy: -23.118 flat angles P-C4'-P energy: -16.515 tors. eta vs tors. theta energy: -33.887 Dist. restrs. and SS energy: 0.203 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -559.154778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.154778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.315375 (E_RNA) where: Base-Base interactions energy: -404.855 where: short stacking energy: -169.655 Base-Backbone interact. energy: -0.817 local terms energy: -153.642929 where: bonds (distance) C4'-P energy: -27.224 bonds (distance) P-C4' energy: -29.803 flat angles C4'-P-C4' energy: -33.017 flat angles P-C4'-P energy: -24.646 tors. eta vs tors. theta energy: -38.953 Dist. restrs. and SS energy: 0.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -550.836748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.836748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.002164 (E_RNA) where: Base-Base interactions energy: -400.585 where: short stacking energy: -165.079 Base-Backbone interact. energy: -0.138 local terms energy: -150.278961 where: bonds (distance) C4'-P energy: -31.239 bonds (distance) P-C4' energy: -21.565 flat angles C4'-P-C4' energy: -30.130 flat angles P-C4'-P energy: -25.574 tors. eta vs tors. theta energy: -41.770 Dist. restrs. and SS energy: 0.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -531.686609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.686609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.957857 (E_RNA) where: Base-Base interactions energy: -380.736 where: short stacking energy: -165.821 Base-Backbone interact. energy: -0.117 local terms energy: -151.105409 where: bonds (distance) C4'-P energy: -24.944 bonds (distance) P-C4' energy: -30.780 flat angles C4'-P-C4' energy: -32.019 flat angles P-C4'-P energy: -21.698 tors. eta vs tors. theta energy: -41.664 Dist. restrs. and SS energy: 0.271 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -523.260825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.260825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.504121 (E_RNA) where: Base-Base interactions energy: -383.946 where: short stacking energy: -159.302 Base-Backbone interact. energy: -0.019 local terms energy: -139.538899 where: bonds (distance) C4'-P energy: -19.988 bonds (distance) P-C4' energy: -28.833 flat angles C4'-P-C4' energy: -28.634 flat angles P-C4'-P energy: -22.980 tors. eta vs tors. theta energy: -39.105 Dist. restrs. and SS energy: 0.243 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -525.960739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.960739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.341974 (E_RNA) where: Base-Base interactions energy: -382.187 where: short stacking energy: -159.630 Base-Backbone interact. energy: -0.656 local terms energy: -143.499050 where: bonds (distance) C4'-P energy: -31.781 bonds (distance) P-C4' energy: -23.860 flat angles C4'-P-C4' energy: -31.074 flat angles P-C4'-P energy: -13.582 tors. eta vs tors. theta energy: -43.201 Dist. restrs. and SS energy: 0.381 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -509.052208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.052208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.190922 (E_RNA) where: Base-Base interactions energy: -354.620 where: short stacking energy: -154.133 Base-Backbone interact. energy: -0.938 local terms energy: -153.633078 where: bonds (distance) C4'-P energy: -27.330 bonds (distance) P-C4' energy: -30.245 flat angles C4'-P-C4' energy: -32.149 flat angles P-C4'-P energy: -17.154 tors. eta vs tors. theta energy: -46.756 Dist. restrs. and SS energy: 0.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -487.876368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.876368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.195628 (E_RNA) where: Base-Base interactions energy: -345.203 where: short stacking energy: -152.358 Base-Backbone interact. energy: 0.714 local terms energy: -143.706847 where: bonds (distance) C4'-P energy: -25.794 bonds (distance) P-C4' energy: -26.259 flat angles C4'-P-C4' energy: -29.415 flat angles P-C4'-P energy: -21.349 tors. eta vs tors. theta energy: -40.890 Dist. restrs. and SS energy: 0.319 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -488.711847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.711847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.712858 (E_RNA) where: Base-Base interactions energy: -358.505 where: short stacking energy: -148.852 Base-Backbone interact. energy: -0.181 local terms energy: -130.027419 where: bonds (distance) C4'-P energy: -24.711 bonds (distance) P-C4' energy: -24.978 flat angles C4'-P-C4' energy: -25.471 flat angles P-C4'-P energy: -16.618 tors. eta vs tors. theta energy: -38.250 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -451.502855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.502855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.688687 (E_RNA) where: Base-Base interactions energy: -317.133 where: short stacking energy: -133.183 Base-Backbone interact. energy: 0.018 local terms energy: -134.574130 where: bonds (distance) C4'-P energy: -28.363 bonds (distance) P-C4' energy: -23.157 flat angles C4'-P-C4' energy: -29.464 flat angles P-C4'-P energy: -19.210 tors. eta vs tors. theta energy: -34.380 Dist. restrs. and SS energy: 0.186 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -417.183713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.183713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.057736 (E_RNA) where: Base-Base interactions energy: -298.095 where: short stacking energy: -116.263 Base-Backbone interact. energy: -0.049 local terms energy: -119.913503 where: bonds (distance) C4'-P energy: -23.898 bonds (distance) P-C4' energy: -25.947 flat angles C4'-P-C4' energy: -22.209 flat angles P-C4'-P energy: -15.824 tors. eta vs tors. theta energy: -32.035 Dist. restrs. and SS energy: 0.874 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -557.417779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.417779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.580107 (E_RNA) where: Base-Base interactions energy: -394.971 where: short stacking energy: -166.556 Base-Backbone interact. energy: -0.279 local terms energy: -162.329794 where: bonds (distance) C4'-P energy: -26.825 bonds (distance) P-C4' energy: -29.821 flat angles C4'-P-C4' energy: -35.331 flat angles P-C4'-P energy: -25.861 tors. eta vs tors. theta energy: -44.492 Dist. restrs. and SS energy: 0.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -551.451480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.451480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.540497 (E_RNA) where: Base-Base interactions energy: -405.088 where: short stacking energy: -166.159 Base-Backbone interact. energy: 0.693 local terms energy: -147.145214 where: bonds (distance) C4'-P energy: -26.560 bonds (distance) P-C4' energy: -26.302 flat angles C4'-P-C4' energy: -29.426 flat angles P-C4'-P energy: -22.234 tors. eta vs tors. theta energy: -42.622 Dist. restrs. and SS energy: 0.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -529.228456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.228456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.325718 (E_RNA) where: Base-Base interactions energy: -384.086 where: short stacking energy: -161.762 Base-Backbone interact. energy: -0.405 local terms energy: -144.835509 where: bonds (distance) C4'-P energy: -24.665 bonds (distance) P-C4' energy: -29.153 flat angles C4'-P-C4' energy: -24.354 flat angles P-C4'-P energy: -23.844 tors. eta vs tors. theta energy: -42.819 Dist. restrs. and SS energy: 0.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -533.866666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.866666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.112502 (E_RNA) where: Base-Base interactions energy: -388.388 where: short stacking energy: -158.497 Base-Backbone interact. energy: -0.073 local terms energy: -145.651224 where: bonds (distance) C4'-P energy: -23.970 bonds (distance) P-C4' energy: -28.868 flat angles C4'-P-C4' energy: -28.955 flat angles P-C4'-P energy: -18.822 tors. eta vs tors. theta energy: -45.036 Dist. restrs. and SS energy: 0.246 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -520.656988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.656988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.808863 (E_RNA) where: Base-Base interactions energy: -381.664 where: short stacking energy: -152.864 Base-Backbone interact. energy: -1.045 local terms energy: -138.099668 where: bonds (distance) C4'-P energy: -19.095 bonds (distance) P-C4' energy: -27.493 flat angles C4'-P-C4' energy: -29.763 flat angles P-C4'-P energy: -19.201 tors. eta vs tors. theta energy: -42.547 Dist. restrs. and SS energy: 0.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -512.513279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.513279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.610251 (E_RNA) where: Base-Base interactions energy: -355.461 where: short stacking energy: -151.803 Base-Backbone interact. energy: 1.235 local terms energy: -158.384872 where: bonds (distance) C4'-P energy: -28.331 bonds (distance) P-C4' energy: -25.550 flat angles C4'-P-C4' energy: -35.033 flat angles P-C4'-P energy: -24.940 tors. eta vs tors. theta energy: -44.531 Dist. restrs. and SS energy: 0.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -505.527961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.527961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.687750 (E_RNA) where: Base-Base interactions energy: -364.390 where: short stacking energy: -157.677 Base-Backbone interact. energy: -0.409 local terms energy: -140.889520 where: bonds (distance) C4'-P energy: -29.121 bonds (distance) P-C4' energy: -18.114 flat angles C4'-P-C4' energy: -30.433 flat angles P-C4'-P energy: -22.102 tors. eta vs tors. theta energy: -41.120 Dist. restrs. and SS energy: 0.160 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -472.361070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.361070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.814253 (E_RNA) where: Base-Base interactions energy: -330.772 where: short stacking energy: -149.787 Base-Backbone interact. energy: -0.002 local terms energy: -142.039893 where: bonds (distance) C4'-P energy: -24.483 bonds (distance) P-C4' energy: -27.443 flat angles C4'-P-C4' energy: -25.298 flat angles P-C4'-P energy: -21.951 tors. eta vs tors. theta energy: -42.865 Dist. restrs. and SS energy: 0.453 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -442.389869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.389869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.370660 (E_RNA) where: Base-Base interactions energy: -314.032 where: short stacking energy: -130.554 Base-Backbone interact. energy: -0.733 local terms energy: -128.605322 where: bonds (distance) C4'-P energy: -21.212 bonds (distance) P-C4' energy: -23.548 flat angles C4'-P-C4' energy: -30.955 flat angles P-C4'-P energy: -19.269 tors. eta vs tors. theta energy: -33.621 Dist. restrs. and SS energy: 0.981 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -450.236963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.236963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.927546 (E_RNA) where: Base-Base interactions energy: -330.735 where: short stacking energy: -157.199 Base-Backbone interact. energy: -0.317 local terms energy: -120.874617 where: bonds (distance) C4'-P energy: -15.053 bonds (distance) P-C4' energy: -20.646 flat angles C4'-P-C4' energy: -32.000 flat angles P-C4'-P energy: -13.195 tors. eta vs tors. theta energy: -39.979 Dist. restrs. and SS energy: 1.691 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -556.205939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.205939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.349782 (E_RNA) where: Base-Base interactions energy: -394.645 where: short stacking energy: -165.887 Base-Backbone interact. energy: -0.093 local terms energy: -161.611668 where: bonds (distance) C4'-P energy: -26.420 bonds (distance) P-C4' energy: -30.283 flat angles C4'-P-C4' energy: -33.096 flat angles P-C4'-P energy: -26.296 tors. eta vs tors. theta energy: -45.516 Dist. restrs. and SS energy: 0.144 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -534.483648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.483648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.684800 (E_RNA) where: Base-Base interactions energy: -386.023 where: short stacking energy: -159.872 Base-Backbone interact. energy: -0.257 local terms energy: -148.405543 where: bonds (distance) C4'-P energy: -28.957 bonds (distance) P-C4' energy: -25.719 flat angles C4'-P-C4' energy: -30.102 flat angles P-C4'-P energy: -22.772 tors. eta vs tors. theta energy: -40.855 Dist. restrs. and SS energy: 0.201 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -549.943621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.943621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.121123 (E_RNA) where: Base-Base interactions energy: -392.091 where: short stacking energy: -158.898 Base-Backbone interact. energy: -0.146 local terms energy: -157.884710 where: bonds (distance) C4'-P energy: -28.845 bonds (distance) P-C4' energy: -31.840 flat angles C4'-P-C4' energy: -32.488 flat angles P-C4'-P energy: -22.423 tors. eta vs tors. theta energy: -42.289 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -539.491829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.491829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.668665 (E_RNA) where: Base-Base interactions energy: -392.452 where: short stacking energy: -165.674 Base-Backbone interact. energy: -1.414 local terms energy: -145.802850 where: bonds (distance) C4'-P energy: -25.796 bonds (distance) P-C4' energy: -28.499 flat angles C4'-P-C4' energy: -28.575 flat angles P-C4'-P energy: -19.690 tors. eta vs tors. theta energy: -43.242 Dist. restrs. and SS energy: 0.177 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -518.648363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.648363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.686206 (E_RNA) where: Base-Base interactions energy: -364.231 where: short stacking energy: -159.570 Base-Backbone interact. energy: -0.628 local terms energy: -153.827188 where: bonds (distance) C4'-P energy: -26.618 bonds (distance) P-C4' energy: -28.833 flat angles C4'-P-C4' energy: -30.580 flat angles P-C4'-P energy: -24.766 tors. eta vs tors. theta energy: -43.030 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -501.135335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.135335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.420285 (E_RNA) where: Base-Base interactions energy: -352.616 where: short stacking energy: -157.350 Base-Backbone interact. energy: 0.870 local terms energy: -149.673444 where: bonds (distance) C4'-P energy: -25.981 bonds (distance) P-C4' energy: -20.965 flat angles C4'-P-C4' energy: -32.476 flat angles P-C4'-P energy: -24.551 tors. eta vs tors. theta energy: -45.700 Dist. restrs. and SS energy: 0.285 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -492.320388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.320388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.441936 (E_RNA) where: Base-Base interactions energy: -350.418 where: short stacking energy: -149.149 Base-Backbone interact. energy: -0.460 local terms energy: -141.563872 where: bonds (distance) C4'-P energy: -25.226 bonds (distance) P-C4' energy: -28.382 flat angles C4'-P-C4' energy: -28.544 flat angles P-C4'-P energy: -18.117 tors. eta vs tors. theta energy: -41.295 Dist. restrs. and SS energy: 0.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -450.166679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.166679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.649877 (E_RNA) where: Base-Base interactions energy: -328.327 where: short stacking energy: -137.338 Base-Backbone interact. energy: -0.118 local terms energy: -122.204988 where: bonds (distance) C4'-P energy: -17.841 bonds (distance) P-C4' energy: -21.779 flat angles C4'-P-C4' energy: -24.234 flat angles P-C4'-P energy: -20.713 tors. eta vs tors. theta energy: -37.638 Dist. restrs. and SS energy: 0.483 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -444.640445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.640445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.032823 (E_RNA) where: Base-Base interactions energy: -305.915 where: short stacking energy: -130.007 Base-Backbone interact. energy: -1.172 local terms energy: -137.946299 where: bonds (distance) C4'-P energy: -22.701 bonds (distance) P-C4' energy: -29.870 flat angles C4'-P-C4' energy: -32.152 flat angles P-C4'-P energy: -16.912 tors. eta vs tors. theta energy: -36.312 Dist. restrs. and SS energy: 0.392 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -461.553473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.553473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.020528 (E_RNA) where: Base-Base interactions energy: -344.135 where: short stacking energy: -142.609 Base-Backbone interact. energy: 0.198 local terms energy: -118.083480 where: bonds (distance) C4'-P energy: -13.085 bonds (distance) P-C4' energy: -24.363 flat angles C4'-P-C4' energy: -27.652 flat angles P-C4'-P energy: -15.949 tors. eta vs tors. theta energy: -37.035 Dist. restrs. and SS energy: 0.467 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 7 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 4144675 moves confirmed later: 4526017 all moves confirmed: 8670692 percent of confirmed moves: 5.419182 current total energy: -524.990604 recalc. total energy: -524.990604 replica 2 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 3898437 moves confirmed later: 4228274 all moves confirmed: 8126711 percent of confirmed moves: 5.079194 current total energy: -503.940301 recalc. total energy: -503.940301 replica 1 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 3627427 moves confirmed later: 3911225 all moves confirmed: 7538652 percent of confirmed moves: 4.711658 current total energy: -498.294348 recalc. total energy: -498.294348 replica 6 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 4275064 moves confirmed later: 4679067 all moves confirmed: 8954131 percent of confirmed moves: 5.596332 current total energy: -491.932461 recalc. total energy: -491.932461 replica 3 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 3890601 moves confirmed later: 4224738 all moves confirmed: 8115339 percent of confirmed moves: 5.072087 current total energy: -481.677616 recalc. total energy: -481.677616 replica 10 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 4019112 moves confirmed later: 4379977 all moves confirmed: 8399089 percent of confirmed moves: 5.249431 current total energy: -485.362037 recalc. total energy: -485.362037 replica 9 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 3897772 moves confirmed later: 4235371 all moves confirmed: 8133143 percent of confirmed moves: 5.083214 current total energy: -420.083640 recalc. total energy: -420.083640 replica 4 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 3716482 moves confirmed later: 3968090 all moves confirmed: 7684572 percent of confirmed moves: 4.802858 current total energy: -389.881647 recalc. total energy: -389.881647 replica 8 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 3512876 moves confirmed later: 3778802 all moves confirmed: 7291678 percent of confirmed moves: 4.557299 current total energy: -374.091407 recalc. total energy: -374.091407 replica 5 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 4380965 moves confirmed later: 4841893 all moves confirmed: 9222858 percent of confirmed moves: 5.764286 current total energy: -337.631248 recalc. total energy: -337.631248 out arg RESULTS//1/nima-ed34d04a_01 Time of doing 1600000 iterations: 1031.513 seconds