SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa: 1 curr_seq: _UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 95 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 480 n_atoms_counter: 480 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((((((((((..(((......))).....(((......)))..)))).....(((...((((......))))...)))..))))))))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 18, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 17, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 36, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 35, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 34, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 14, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 13, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 12, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 11, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 66, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 65, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 64, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 63, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 63, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 59, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 58, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 57, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 10, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 9, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 8, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 7, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 6, chain1: 0, <---> nucl2: 89, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 89 nucl1: 5, chain1: 0, <---> nucl2: 90, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 90 nucl1: 3, chain1: 0, <---> nucl2: 91, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 91 nucl1: 2, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 1, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 0, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 94 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 95.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa: 1 curr_seq: _UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 95 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 480 n_atoms_counter: 480 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((((((((((..(((......))).....(((......)))..)))).....(((...((((......))))...)))..))))))))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 18, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 17, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 36, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 35, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 34, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 14, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 13, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 12, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 11, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 66, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 65, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 64, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 63, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 63, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 59, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 58, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 57, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 10, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 9, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 8, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 7, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 6, chain1: 0, <---> nucl2: 89, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 89 nucl1: 5, chain1: 0, <---> nucl2: 90, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 90 nucl1: 3, chain1: 0, <---> nucl2: 91, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 91 nucl1: 2, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 1, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 0, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 94 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 95.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa: 1 curr_seq: _UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 95 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 480 n_atoms_counter: 480 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((((((((((..(((......))).....(((......)))..)))).....(((...((((......))))...)))..))))))))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 18, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 17, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 36, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 35, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 34, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 14, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 13, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 12, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 11, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 66, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 65, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 64, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 63, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 63, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 59, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 58, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 57, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 10, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 9, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 8, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 7, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 6, chain1: 0, <---> nucl2: 89, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 89 nucl1: 5, chain1: 0, <---> nucl2: 90, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 90 nucl1: 3, chain1: 0, <---> nucl2: 91, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 91 nucl1: 2, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 1, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 0, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 94 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 95.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa: 1 curr_seq: _UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 95 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 480 n_atoms_counter: 480 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((((((((((..(((......))).....(((......)))..)))).....(((...((((......))))...)))..))))))))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 18, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 17, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 36, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 35, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 34, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 14, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 13, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 12, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 11, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 66, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 65, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 64, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 63, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 63, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 59, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 58, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 57, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 10, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 9, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 8, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 7, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 6, chain1: 0, <---> nucl2: 89, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 89 nucl1: 5, chain1: 0, <---> nucl2: 90, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 90 nucl1: 3, chain1: 0, <---> nucl2: 91, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 91 nucl1: 2, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 1, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 0, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 94 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 95.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa: 1 curr_seq: _UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 95 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 480 n_atoms_counter: 480 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((((((((((..(((......))).....(((......)))..)))).....(((...((((......))))...)))..))))))))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 18, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 17, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 36, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 35, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 34, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 14, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 13, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 12, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 11, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 66, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 65, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 64, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 63, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 63, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 59, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 58, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 57, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 10, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 9, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 8, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 7, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 6, chain1: 0, <---> nucl2: 89, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 89 nucl1: 5, chain1: 0, <---> nucl2: 90, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 90 nucl1: 3, chain1: 0, <---> nucl2: 91, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 91 nucl1: 2, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 1, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 0, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 94 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 95.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa: 1 curr_seq: _UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 95 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 480 n_atoms_counter: 480 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((((((((((..(((......))).....(((......)))..)))).....(((...((((......))))...)))..))))))))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 18, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 17, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 36, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 35, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 34, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 14, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 13, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 12, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 11, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 66, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 65, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 64, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 63, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 63, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 59, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 58, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 57, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 10, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 9, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 8, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 7, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 6, chain1: 0, <---> nucl2: 89, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 89 nucl1: 5, chain1: 0, <---> nucl2: 90, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 90 nucl1: 3, chain1: 0, <---> nucl2: 91, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 91 nucl1: 2, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 1, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 0, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 94 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 95.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa: 1 curr_seq: _UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 95 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 480 n_atoms_counter: 480 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((((((((((..(((......))).....(((......)))..)))).....(((...((((......))))...)))..))))))))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 18, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 17, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 36, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 35, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 34, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 14, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 13, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 12, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 11, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 66, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 65, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 64, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 63, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 63, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 59, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 58, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 57, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 10, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 9, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 8, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 7, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 6, chain1: 0, <---> nucl2: 89, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 89 nucl1: 5, chain1: 0, <---> nucl2: 90, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 90 nucl1: 3, chain1: 0, <---> nucl2: 91, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 91 nucl1: 2, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 1, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 0, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 94 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 95.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa: 1 curr_seq: _UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 95 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 480 n_atoms_counter: 480 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((((((((((..(((......))).....(((......)))..)))).....(((...((((......))))...)))..))))))))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 18, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 17, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 36, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 35, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 34, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 14, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 13, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 12, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 11, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 66, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 65, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 64, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 63, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 63, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 59, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 58, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 57, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 10, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 9, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 8, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 7, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 6, chain1: 0, <---> nucl2: 89, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 89 nucl1: 5, chain1: 0, <---> nucl2: 90, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 90 nucl1: 3, chain1: 0, <---> nucl2: 91, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 91 nucl1: 2, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 1, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 0, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 94 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 95.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa: 1 curr_seq: _UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 95 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 480 n_atoms_counter: 480 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((((((((((..(((......))).....(((......)))..)))).....(((...((((......))))...)))..))))))))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 18, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 17, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 36, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 35, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 34, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 14, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 13, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 12, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 11, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 66, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 65, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 64, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 63, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 63, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 59, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 58, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 57, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 10, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 9, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 8, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 7, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 6, chain1: 0, <---> nucl2: 89, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 89 nucl1: 5, chain1: 0, <---> nucl2: 90, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 90 nucl1: 3, chain1: 0, <---> nucl2: 91, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 91 nucl1: 2, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 1, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 0, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 94 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 95.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/chem_pro_restr-129ce529/inputs/seq.fa: 1 curr_seq: _UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAAUUUCUUGUCGGAGUGCCUUAACUGGCUGAGACCGUUUAUUCGGGAUCCGCGGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACAAGAGUUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 95 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 480 n_atoms_counter: 480 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _((((.((((((((((..(((......))).....(((......)))..)))).....(((...((((......))))...)))..))))))))))_ nucl1: 19, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 18, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 17, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 36, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 35, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 34, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 14, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 13, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 12, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 11, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 66, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 65, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 64, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 63, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 63, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 59, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 58, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 57, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 10, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 9, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 8, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 7, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 6, chain1: 0, <---> nucl2: 89, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 89 nucl1: 5, chain1: 0, <---> nucl2: 90, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 90 nucl1: 3, chain1: 0, <---> nucl2: 91, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 91 nucl1: 2, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 1, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 0, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 94 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 95.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -352.890110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.890110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.640110 (E_RNA) where: Base-Base interactions energy: -6.644 where: short stacking energy: -6.644 Base-Backbone interact. energy: -0.000 local terms energy: -369.996331 where: bonds (distance) C4'-P energy: -92.300 bonds (distance) P-C4' energy: -85.887 flat angles C4'-P-C4' energy: -69.751 flat angles P-C4'-P energy: -79.788 tors. eta vs tors. theta energy: -42.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -352.890110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.890110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.640110 (E_RNA) where: Base-Base interactions energy: -6.644 where: short stacking energy: -6.644 Base-Backbone interact. energy: -0.000 local terms energy: -369.996331 where: bonds (distance) C4'-P energy: -92.300 bonds (distance) P-C4' energy: -85.887 flat angles C4'-P-C4' energy: -69.751 flat angles P-C4'-P energy: -79.788 tors. eta vs tors. theta energy: -42.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -352.890110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.890110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.640110 (E_RNA) where: Base-Base interactions energy: -6.644 where: short stacking energy: -6.644 Base-Backbone interact. energy: -0.000 local terms energy: -369.996331 where: bonds (distance) C4'-P energy: -92.300 bonds (distance) P-C4' energy: -85.887 flat angles C4'-P-C4' energy: -69.751 flat angles P-C4'-P energy: -79.788 tors. eta vs tors. theta energy: -42.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -352.890110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.890110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.640110 (E_RNA) where: Base-Base interactions energy: -6.644 where: short stacking energy: -6.644 Base-Backbone interact. energy: -0.000 local terms energy: -369.996331 where: bonds (distance) C4'-P energy: -92.300 bonds (distance) P-C4' energy: -85.887 flat angles C4'-P-C4' energy: -69.751 flat angles P-C4'-P energy: -79.788 tors. eta vs tors. theta energy: -42.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -352.890110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.890110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.640110 (E_RNA) where: Base-Base interactions energy: -6.644 where: short stacking energy: -6.644 Base-Backbone interact. energy: -0.000 local terms energy: -369.996331 where: bonds (distance) C4'-P energy: -92.300 bonds (distance) P-C4' energy: -85.887 flat angles C4'-P-C4' energy: -69.751 flat angles P-C4'-P energy: -79.788 tors. eta vs tors. theta energy: -42.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -352.890110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.890110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.640110 (E_RNA) where: Base-Base interactions energy: -6.644 where: short stacking energy: -6.644 Base-Backbone interact. energy: -0.000 local terms energy: -369.996331 where: bonds (distance) C4'-P energy: -92.300 bonds (distance) P-C4' energy: -85.887 flat angles C4'-P-C4' energy: -69.751 flat angles P-C4'-P energy: -79.788 tors. eta vs tors. theta energy: -42.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -352.890110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.890110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.640110 (E_RNA) where: Base-Base interactions energy: -6.644 where: short stacking energy: -6.644 Base-Backbone interact. energy: -0.000 local terms energy: -369.996331 where: bonds (distance) C4'-P energy: -92.300 bonds (distance) P-C4' energy: -85.887 flat angles C4'-P-C4' energy: -69.751 flat angles P-C4'-P energy: -79.788 tors. eta vs tors. theta energy: -42.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -352.890110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.890110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.640110 (E_RNA) where: Base-Base interactions energy: -6.644 where: short stacking energy: -6.644 Base-Backbone interact. energy: -0.000 local terms energy: -369.996331 where: bonds (distance) C4'-P energy: -92.300 bonds (distance) P-C4' energy: -85.887 flat angles C4'-P-C4' energy: -69.751 flat angles P-C4'-P energy: -79.788 tors. eta vs tors. theta energy: -42.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -352.890110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.890110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.640110 (E_RNA) where: Base-Base interactions energy: -6.644 where: short stacking energy: -6.644 Base-Backbone interact. energy: -0.000 local terms energy: -369.996331 where: bonds (distance) C4'-P energy: -92.300 bonds (distance) P-C4' energy: -85.887 flat angles C4'-P-C4' energy: -69.751 flat angles P-C4'-P energy: -79.788 tors. eta vs tors. theta energy: -42.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -352.890110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.890110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.640110 (E_RNA) where: Base-Base interactions energy: -6.644 where: short stacking energy: -6.644 Base-Backbone interact. energy: -0.000 local terms energy: -369.996331 where: bonds (distance) C4'-P energy: -92.300 bonds (distance) P-C4' energy: -85.887 flat angles C4'-P-C4' energy: -69.751 flat angles P-C4'-P energy: -79.788 tors. eta vs tors. theta energy: -42.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -476.757419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.757419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.507419 (E_RNA) where: Base-Base interactions energy: -219.821 where: short stacking energy: -207.267 Base-Backbone interact. energy: 1.547 local terms energy: -282.233376 where: bonds (distance) C4'-P energy: -64.228 bonds (distance) P-C4' energy: -63.769 flat angles C4'-P-C4' energy: -63.249 flat angles P-C4'-P energy: -40.386 tors. eta vs tors. theta energy: -50.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -451.078745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.078745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.428745 (E_RNA) where: Base-Base interactions energy: -193.823 where: short stacking energy: -180.822 Base-Backbone interact. energy: -0.226 local terms energy: -275.379229 where: bonds (distance) C4'-P energy: -60.210 bonds (distance) P-C4' energy: -66.075 flat angles C4'-P-C4' energy: -62.021 flat angles P-C4'-P energy: -38.146 tors. eta vs tors. theta energy: -48.927 Dist. restrs. and SS energy: -5.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -412.508485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.508485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.258485 (E_RNA) where: Base-Base interactions energy: -181.070 where: short stacking energy: -159.067 Base-Backbone interact. energy: -0.436 local terms energy: -245.752162 where: bonds (distance) C4'-P energy: -58.601 bonds (distance) P-C4' energy: -54.599 flat angles C4'-P-C4' energy: -64.647 flat angles P-C4'-P energy: -42.928 tors. eta vs tors. theta energy: -24.977 Dist. restrs. and SS energy: -9.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -414.194222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.194222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.944222 (E_RNA) where: Base-Base interactions energy: -182.178 where: short stacking energy: -182.978 Base-Backbone interact. energy: 0.458 local terms energy: -256.224484 where: bonds (distance) C4'-P energy: -53.984 bonds (distance) P-C4' energy: -65.672 flat angles C4'-P-C4' energy: -55.420 flat angles P-C4'-P energy: -40.512 tors. eta vs tors. theta energy: -40.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -460.412108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.412108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.162108 (E_RNA) where: Base-Base interactions energy: -253.365 where: short stacking energy: -166.603 Base-Backbone interact. energy: -1.181 local terms energy: -220.616616 where: bonds (distance) C4'-P energy: -46.285 bonds (distance) P-C4' energy: -60.504 flat angles C4'-P-C4' energy: -59.230 flat angles P-C4'-P energy: -26.974 tors. eta vs tors. theta energy: -27.624 Dist. restrs. and SS energy: -9.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -353.447255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.447255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.197255 (E_RNA) where: Base-Base interactions energy: -17.648 where: short stacking energy: -17.648 Base-Backbone interact. energy: -0.000 local terms energy: -359.548868 where: bonds (distance) C4'-P energy: -87.408 bonds (distance) P-C4' energy: -82.622 flat angles C4'-P-C4' energy: -68.971 flat angles P-C4'-P energy: -78.518 tors. eta vs tors. theta energy: -42.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -354.402593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.402593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.152593 (E_RNA) where: Base-Base interactions energy: -17.222 where: short stacking energy: -17.222 Base-Backbone interact. energy: -0.000 local terms energy: -360.930980 where: bonds (distance) C4'-P energy: -87.114 bonds (distance) P-C4' energy: -84.644 flat angles C4'-P-C4' energy: -68.763 flat angles P-C4'-P energy: -78.386 tors. eta vs tors. theta energy: -42.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -354.199366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.199366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.949366 (E_RNA) where: Base-Base interactions energy: -17.217 where: short stacking energy: -17.217 Base-Backbone interact. energy: -0.000 local terms energy: -360.732752 where: bonds (distance) C4'-P energy: -87.114 bonds (distance) P-C4' energy: -84.644 flat angles C4'-P-C4' energy: -68.744 flat angles P-C4'-P energy: -78.349 tors. eta vs tors. theta energy: -41.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -356.086677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.086677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.236677 (E_RNA) where: Base-Base interactions energy: -139.520 where: short stacking energy: -67.838 Base-Backbone interact. energy: -1.171 local terms energy: -190.545370 where: bonds (distance) C4'-P energy: -56.698 bonds (distance) P-C4' energy: -56.605 flat angles C4'-P-C4' energy: -42.995 flat angles P-C4'-P energy: -34.249 tors. eta vs tors. theta energy: 0.001 Dist. restrs. and SS energy: -48.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -362.300858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.300858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.050858 (E_RNA) where: Base-Base interactions energy: -37.212 where: short stacking energy: -37.212 Base-Backbone interact. energy: -0.000 local terms energy: -348.838808 where: bonds (distance) C4'-P energy: -80.556 bonds (distance) P-C4' energy: -78.053 flat angles C4'-P-C4' energy: -71.548 flat angles P-C4'-P energy: -75.806 tors. eta vs tors. theta energy: -42.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -492.291306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.291306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.841306 (E_RNA) where: Base-Base interactions energy: -233.404 where: short stacking energy: -176.017 Base-Backbone interact. energy: -0.460 local terms energy: -265.977726 where: bonds (distance) C4'-P energy: -57.807 bonds (distance) P-C4' energy: -64.442 flat angles C4'-P-C4' energy: -63.562 flat angles P-C4'-P energy: -43.638 tors. eta vs tors. theta energy: -36.529 Dist. restrs. and SS energy: -16.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -486.119587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.119587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.669587 (E_RNA) where: Base-Base interactions energy: -236.435 where: short stacking energy: -201.157 Base-Backbone interact. energy: -1.727 local terms energy: -246.507036 where: bonds (distance) C4'-P energy: -43.865 bonds (distance) P-C4' energy: -64.686 flat angles C4'-P-C4' energy: -60.589 flat angles P-C4'-P energy: -32.107 tors. eta vs tors. theta energy: -45.261 Dist. restrs. and SS energy: -25.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -635.092561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.092561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.442561 (E_RNA) where: Base-Base interactions energy: -339.312 where: short stacking energy: -214.016 Base-Backbone interact. energy: -0.972 local terms energy: -268.157944 where: bonds (distance) C4'-P energy: -62.362 bonds (distance) P-C4' energy: -60.165 flat angles C4'-P-C4' energy: -65.140 flat angles P-C4'-P energy: -34.120 tors. eta vs tors. theta energy: -46.372 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -497.805421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.805421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.755421 (E_RNA) where: Base-Base interactions energy: -255.616 where: short stacking energy: -161.116 Base-Backbone interact. energy: 1.072 local terms energy: -247.211622 where: bonds (distance) C4'-P energy: -66.266 bonds (distance) P-C4' energy: -70.102 flat angles C4'-P-C4' energy: -44.735 flat angles P-C4'-P energy: -38.484 tors. eta vs tors. theta energy: -27.625 Dist. restrs. and SS energy: -19.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -501.891753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.891753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.241753 (E_RNA) where: Base-Base interactions energy: -262.918 where: short stacking energy: -148.696 Base-Backbone interact. energy: -0.583 local terms energy: -202.741047 where: bonds (distance) C4'-P energy: -59.779 bonds (distance) P-C4' energy: -49.241 flat angles C4'-P-C4' energy: -48.079 flat angles P-C4'-P energy: -22.660 tors. eta vs tors. theta energy: -22.982 Dist. restrs. and SS energy: -59.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -437.025823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.025823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.975823 (E_RNA) where: Base-Base interactions energy: -196.766 where: short stacking energy: -128.942 Base-Backbone interact. energy: 0.753 local terms energy: -217.962417 where: bonds (distance) C4'-P energy: -44.540 bonds (distance) P-C4' energy: -60.797 flat angles C4'-P-C4' energy: -51.773 flat angles P-C4'-P energy: -39.114 tors. eta vs tors. theta energy: -21.739 Dist. restrs. and SS energy: -46.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -427.168382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.168382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.318382 (E_RNA) where: Base-Base interactions energy: -228.240 where: short stacking energy: -102.458 Base-Backbone interact. energy: 0.536 local terms energy: -183.614464 where: bonds (distance) C4'-P energy: -37.896 bonds (distance) P-C4' energy: -53.445 flat angles C4'-P-C4' energy: -48.584 flat angles P-C4'-P energy: -34.220 tors. eta vs tors. theta energy: -9.470 Dist. restrs. and SS energy: -39.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -459.844627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.844627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.194627 (E_RNA) where: Base-Base interactions energy: -247.201 where: short stacking energy: -140.589 Base-Backbone interact. energy: 1.513 local terms energy: -187.506867 where: bonds (distance) C4'-P energy: -47.418 bonds (distance) P-C4' energy: -52.191 flat angles C4'-P-C4' energy: -55.081 flat angles P-C4'-P energy: -25.094 tors. eta vs tors. theta energy: -7.723 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -446.415241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.415241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.765241 (E_RNA) where: Base-Base interactions energy: -251.228 where: short stacking energy: -120.404 Base-Backbone interact. energy: 0.501 local terms energy: -169.038549 where: bonds (distance) C4'-P energy: -44.757 bonds (distance) P-C4' energy: -61.334 flat angles C4'-P-C4' energy: -36.561 flat angles P-C4'-P energy: -18.751 tors. eta vs tors. theta energy: -7.636 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -311.415649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.415649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.965649 (E_RNA) where: Base-Base interactions energy: -142.005 where: short stacking energy: -85.352 Base-Backbone interact. energy: 0.968 local terms energy: -159.928510 where: bonds (distance) C4'-P energy: -50.363 bonds (distance) P-C4' energy: -42.849 flat angles C4'-P-C4' energy: -40.224 flat angles P-C4'-P energy: -26.569 tors. eta vs tors. theta energy: 0.076 Dist. restrs. and SS energy: -34.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -608.347898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.347898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.897898 (E_RNA) where: Base-Base interactions energy: -311.325 where: short stacking energy: -213.666 Base-Backbone interact. energy: -0.800 local terms energy: -285.772724 where: bonds (distance) C4'-P energy: -69.029 bonds (distance) P-C4' energy: -57.723 flat angles C4'-P-C4' energy: -62.982 flat angles P-C4'-P energy: -37.607 tors. eta vs tors. theta energy: -58.431 Dist. restrs. and SS energy: -34.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -530.049028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.049028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.999028 (E_RNA) where: Base-Base interactions energy: -266.536 where: short stacking energy: -174.133 Base-Backbone interact. energy: 1.472 local terms energy: -259.934886 where: bonds (distance) C4'-P energy: -56.888 bonds (distance) P-C4' energy: -64.393 flat angles C4'-P-C4' energy: -66.952 flat angles P-C4'-P energy: -32.957 tors. eta vs tors. theta energy: -38.744 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -627.766365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -627.766365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.916365 (E_RNA) where: Base-Base interactions energy: -352.945 where: short stacking energy: -196.584 Base-Backbone interact. energy: -0.986 local terms energy: -248.985375 where: bonds (distance) C4'-P energy: -53.652 bonds (distance) P-C4' energy: -58.342 flat angles C4'-P-C4' energy: -60.580 flat angles P-C4'-P energy: -34.234 tors. eta vs tors. theta energy: -42.178 Dist. restrs. and SS energy: -48.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -537.505982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.505982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.655982 (E_RNA) where: Base-Base interactions energy: -298.076 where: short stacking energy: -174.233 Base-Backbone interact. energy: 1.017 local terms energy: -233.596984 where: bonds (distance) C4'-P energy: -58.373 bonds (distance) P-C4' energy: -63.097 flat angles C4'-P-C4' energy: -49.717 flat angles P-C4'-P energy: -38.247 tors. eta vs tors. theta energy: -24.163 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -708.134817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.134817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.084817 (E_RNA) where: Base-Base interactions energy: -442.213 where: short stacking energy: -185.969 Base-Backbone interact. energy: -2.596 local terms energy: -222.276076 where: bonds (distance) C4'-P energy: -50.684 bonds (distance) P-C4' energy: -56.755 flat angles C4'-P-C4' energy: -52.582 flat angles P-C4'-P energy: -26.403 tors. eta vs tors. theta energy: -35.852 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -472.749688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.749688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.099688 (E_RNA) where: Base-Base interactions energy: -236.465 where: short stacking energy: -116.442 Base-Backbone interact. energy: 0.150 local terms energy: -209.785517 where: bonds (distance) C4'-P energy: -56.138 bonds (distance) P-C4' energy: -46.809 flat angles C4'-P-C4' energy: -55.908 flat angles P-C4'-P energy: -35.377 tors. eta vs tors. theta energy: -15.552 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -493.692892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.692892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.042892 (E_RNA) where: Base-Base interactions energy: -265.684 where: short stacking energy: -121.924 Base-Backbone interact. energy: 0.959 local terms energy: -202.317301 where: bonds (distance) C4'-P energy: -46.751 bonds (distance) P-C4' energy: -58.169 flat angles C4'-P-C4' energy: -51.024 flat angles P-C4'-P energy: -27.882 tors. eta vs tors. theta energy: -18.491 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -614.459579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.459579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.409579 (E_RNA) where: Base-Base interactions energy: -359.222 where: short stacking energy: -161.891 Base-Backbone interact. energy: 0.226 local terms energy: -214.413578 where: bonds (distance) C4'-P energy: -51.957 bonds (distance) P-C4' energy: -53.897 flat angles C4'-P-C4' energy: -37.749 flat angles P-C4'-P energy: -38.082 tors. eta vs tors. theta energy: -32.730 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -549.677100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.677100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.227100 (E_RNA) where: Base-Base interactions energy: -313.506 where: short stacking energy: -135.158 Base-Backbone interact. energy: -1.869 local terms energy: -169.851694 where: bonds (distance) C4'-P energy: -44.778 bonds (distance) P-C4' energy: -39.619 flat angles C4'-P-C4' energy: -48.533 flat angles P-C4'-P energy: -28.748 tors. eta vs tors. theta energy: -8.175 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -324.381148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.381148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.731148 (E_RNA) where: Base-Base interactions energy: -165.263 where: short stacking energy: -89.115 Base-Backbone interact. energy: 1.724 local terms energy: -161.192591 where: bonds (distance) C4'-P energy: -45.288 bonds (distance) P-C4' energy: -47.135 flat angles C4'-P-C4' energy: -32.264 flat angles P-C4'-P energy: -28.056 tors. eta vs tors. theta energy: -8.450 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -669.132399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.132399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.082399 (E_RNA) where: Base-Base interactions energy: -363.487 where: short stacking energy: -218.343 Base-Backbone interact. energy: -1.000 local terms energy: -290.595643 where: bonds (distance) C4'-P energy: -64.411 bonds (distance) P-C4' energy: -64.076 flat angles C4'-P-C4' energy: -68.270 flat angles P-C4'-P energy: -38.338 tors. eta vs tors. theta energy: -55.500 Dist. restrs. and SS energy: -37.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -728.961803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.961803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.711803 (E_RNA) where: Base-Base interactions energy: -438.738 where: short stacking energy: -214.039 Base-Backbone interact. energy: -1.194 local terms energy: -249.778972 where: bonds (distance) C4'-P energy: -59.530 bonds (distance) P-C4' energy: -51.708 flat angles C4'-P-C4' energy: -57.959 flat angles P-C4'-P energy: -33.091 tors. eta vs tors. theta energy: -47.492 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -600.738993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.738993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.688993 (E_RNA) where: Base-Base interactions energy: -344.671 where: short stacking energy: -209.389 Base-Backbone interact. energy: 3.876 local terms energy: -254.893929 where: bonds (distance) C4'-P energy: -58.884 bonds (distance) P-C4' energy: -60.940 flat angles C4'-P-C4' energy: -58.545 flat angles P-C4'-P energy: -35.869 tors. eta vs tors. theta energy: -40.657 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -747.301370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.301370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.051370 (E_RNA) where: Base-Base interactions energy: -470.482 where: short stacking energy: -207.807 Base-Backbone interact. energy: 0.811 local terms energy: -238.380743 where: bonds (distance) C4'-P energy: -43.807 bonds (distance) P-C4' energy: -54.783 flat angles C4'-P-C4' energy: -59.884 flat angles P-C4'-P energy: -35.336 tors. eta vs tors. theta energy: -44.571 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -546.498940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.498940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.648940 (E_RNA) where: Base-Base interactions energy: -281.021 where: short stacking energy: -160.930 Base-Backbone interact. energy: -3.090 local terms energy: -255.537756 where: bonds (distance) C4'-P energy: -62.077 bonds (distance) P-C4' energy: -58.194 flat angles C4'-P-C4' energy: -56.218 flat angles P-C4'-P energy: -39.532 tors. eta vs tors. theta energy: -39.517 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -598.625656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.625656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.575656 (E_RNA) where: Base-Base interactions energy: -344.366 where: short stacking energy: -154.642 Base-Backbone interact. energy: -1.976 local terms energy: -211.233223 where: bonds (distance) C4'-P energy: -43.609 bonds (distance) P-C4' energy: -49.729 flat angles C4'-P-C4' energy: -54.994 flat angles P-C4'-P energy: -38.124 tors. eta vs tors. theta energy: -24.778 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -447.198269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.198269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.748269 (E_RNA) where: Base-Base interactions energy: -234.604 where: short stacking energy: -116.710 Base-Backbone interact. energy: -1.407 local terms energy: -182.736966 where: bonds (distance) C4'-P energy: -54.173 bonds (distance) P-C4' energy: -49.888 flat angles C4'-P-C4' energy: -40.896 flat angles P-C4'-P energy: -33.940 tors. eta vs tors. theta energy: -3.840 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -604.357244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.357244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.707244 (E_RNA) where: Base-Base interactions energy: -354.574 where: short stacking energy: -148.022 Base-Backbone interact. energy: 1.516 local terms energy: -206.649844 where: bonds (distance) C4'-P energy: -48.050 bonds (distance) P-C4' energy: -53.504 flat angles C4'-P-C4' energy: -47.787 flat angles P-C4'-P energy: -28.043 tors. eta vs tors. theta energy: -29.267 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -552.703062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.703062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.653062 (E_RNA) where: Base-Base interactions energy: -286.515 where: short stacking energy: -127.995 Base-Backbone interact. energy: -0.991 local terms energy: -206.147082 where: bonds (distance) C4'-P energy: -51.411 bonds (distance) P-C4' energy: -53.823 flat angles C4'-P-C4' energy: -63.720 flat angles P-C4'-P energy: -30.542 tors. eta vs tors. theta energy: -6.652 Dist. restrs. and SS energy: -82.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -394.889771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.889771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.839771 (E_RNA) where: Base-Base interactions energy: -189.236 where: short stacking energy: -102.818 Base-Backbone interact. energy: -1.552 local terms energy: -181.051961 where: bonds (distance) C4'-P energy: -51.741 bonds (distance) P-C4' energy: -53.691 flat angles C4'-P-C4' energy: -45.736 flat angles P-C4'-P energy: -34.616 tors. eta vs tors. theta energy: 4.733 Dist. restrs. and SS energy: -46.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -770.632335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.632335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.382335 (E_RNA) where: Base-Base interactions energy: -443.240 where: short stacking energy: -206.637 Base-Backbone interact. energy: -0.579 local terms energy: -287.563051 where: bonds (distance) C4'-P energy: -65.130 bonds (distance) P-C4' energy: -61.250 flat angles C4'-P-C4' energy: -69.370 flat angles P-C4'-P energy: -40.315 tors. eta vs tors. theta energy: -51.499 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -689.448105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.448105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.198105 (E_RNA) where: Base-Base interactions energy: -400.200 where: short stacking energy: -194.541 Base-Backbone interact. energy: -1.188 local terms energy: -266.810620 where: bonds (distance) C4'-P energy: -56.524 bonds (distance) P-C4' energy: -56.354 flat angles C4'-P-C4' energy: -61.434 flat angles P-C4'-P energy: -44.960 tors. eta vs tors. theta energy: -47.539 Dist. restrs. and SS energy: -45.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -788.180790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -788.180790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.730790 (E_RNA) where: Base-Base interactions energy: -480.828 where: short stacking energy: -213.243 Base-Backbone interact. energy: -1.189 local terms energy: -259.713323 where: bonds (distance) C4'-P energy: -52.412 bonds (distance) P-C4' energy: -63.707 flat angles C4'-P-C4' energy: -63.699 flat angles P-C4'-P energy: -41.455 tors. eta vs tors. theta energy: -38.441 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -555.727512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.727512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.477512 (E_RNA) where: Base-Base interactions energy: -306.597 where: short stacking energy: -189.009 Base-Backbone interact. energy: -0.685 local terms energy: -245.196258 where: bonds (distance) C4'-P energy: -54.446 bonds (distance) P-C4' energy: -64.538 flat angles C4'-P-C4' energy: -51.488 flat angles P-C4'-P energy: -35.507 tors. eta vs tors. theta energy: -39.218 Dist. restrs. and SS energy: -27.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -689.855047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.855047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.205047 (E_RNA) where: Base-Base interactions energy: -380.571 where: short stacking energy: -195.194 Base-Backbone interact. energy: -2.548 local terms energy: -262.086921 where: bonds (distance) C4'-P energy: -51.601 bonds (distance) P-C4' energy: -59.822 flat angles C4'-P-C4' energy: -64.664 flat angles P-C4'-P energy: -37.238 tors. eta vs tors. theta energy: -48.761 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -528.528602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.528602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.878602 (E_RNA) where: Base-Base interactions energy: -296.624 where: short stacking energy: -161.150 Base-Backbone interact. energy: 3.935 local terms energy: -227.189392 where: bonds (distance) C4'-P energy: -53.345 bonds (distance) P-C4' energy: -54.158 flat angles C4'-P-C4' energy: -49.264 flat angles P-C4'-P energy: -33.727 tors. eta vs tors. theta energy: -36.695 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -621.987772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.987772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.937772 (E_RNA) where: Base-Base interactions energy: -362.150 where: short stacking energy: -149.386 Base-Backbone interact. energy: -0.631 local terms energy: -218.157065 where: bonds (distance) C4'-P energy: -46.445 bonds (distance) P-C4' energy: -57.757 flat angles C4'-P-C4' energy: -49.295 flat angles P-C4'-P energy: -33.072 tors. eta vs tors. theta energy: -31.588 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -465.721675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.721675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.471675 (E_RNA) where: Base-Base interactions energy: -240.959 where: short stacking energy: -115.395 Base-Backbone interact. energy: -2.643 local terms energy: -182.868796 where: bonds (distance) C4'-P energy: -50.933 bonds (distance) P-C4' energy: -43.229 flat angles C4'-P-C4' energy: -46.575 flat angles P-C4'-P energy: -33.528 tors. eta vs tors. theta energy: -8.604 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -568.559924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.559924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.509924 (E_RNA) where: Base-Base interactions energy: -308.044 where: short stacking energy: -128.358 Base-Backbone interact. energy: -1.021 local terms energy: -191.445535 where: bonds (distance) C4'-P energy: -46.643 bonds (distance) P-C4' energy: -54.095 flat angles C4'-P-C4' energy: -46.516 flat angles P-C4'-P energy: -28.293 tors. eta vs tors. theta energy: -15.898 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -405.931660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.931660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.081660 (E_RNA) where: Base-Base interactions energy: -201.743 where: short stacking energy: -95.393 Base-Backbone interact. energy: -0.306 local terms energy: -170.033253 where: bonds (distance) C4'-P energy: -51.336 bonds (distance) P-C4' energy: -47.914 flat angles C4'-P-C4' energy: -41.876 flat angles P-C4'-P energy: -34.889 tors. eta vs tors. theta energy: 5.982 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -784.059731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.059731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.209731 (E_RNA) where: Base-Base interactions energy: -463.919 where: short stacking energy: -233.012 Base-Backbone interact. energy: -1.579 local terms energy: -284.711166 where: bonds (distance) C4'-P energy: -63.675 bonds (distance) P-C4' energy: -64.987 flat angles C4'-P-C4' energy: -62.304 flat angles P-C4'-P energy: -38.561 tors. eta vs tors. theta energy: -55.183 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -840.557873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.557873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.707873 (E_RNA) where: Base-Base interactions energy: -531.941 where: short stacking energy: -250.428 Base-Backbone interact. energy: 2.599 local terms energy: -268.366217 where: bonds (distance) C4'-P energy: -61.029 bonds (distance) P-C4' energy: -46.011 flat angles C4'-P-C4' energy: -59.748 flat angles P-C4'-P energy: -44.340 tors. eta vs tors. theta energy: -57.239 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -757.441230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -757.441230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.391230 (E_RNA) where: Base-Base interactions energy: -460.514 where: short stacking energy: -224.305 Base-Backbone interact. energy: -0.593 local terms energy: -273.283944 where: bonds (distance) C4'-P energy: -50.734 bonds (distance) P-C4' energy: -55.024 flat angles C4'-P-C4' energy: -63.357 flat angles P-C4'-P energy: -44.856 tors. eta vs tors. theta energy: -59.314 Dist. restrs. and SS energy: -46.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -713.122027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.122027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.472027 (E_RNA) where: Base-Base interactions energy: -412.702 where: short stacking energy: -188.279 Base-Backbone interact. energy: -0.792 local terms energy: -254.978162 where: bonds (distance) C4'-P energy: -67.546 bonds (distance) P-C4' energy: -57.397 flat angles C4'-P-C4' energy: -55.920 flat angles P-C4'-P energy: -31.077 tors. eta vs tors. theta energy: -43.038 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -567.207628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.207628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.357628 (E_RNA) where: Base-Base interactions energy: -323.125 where: short stacking energy: -155.900 Base-Backbone interact. energy: -1.904 local terms energy: -226.328506 where: bonds (distance) C4'-P energy: -50.517 bonds (distance) P-C4' energy: -56.241 flat angles C4'-P-C4' energy: -55.191 flat angles P-C4'-P energy: -38.249 tors. eta vs tors. theta energy: -26.131 Dist. restrs. and SS energy: -39.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -682.757006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.757006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.307006 (E_RNA) where: Base-Base interactions energy: -404.310 where: short stacking energy: -168.635 Base-Backbone interact. energy: -2.963 local terms energy: -229.034761 where: bonds (distance) C4'-P energy: -44.262 bonds (distance) P-C4' energy: -58.807 flat angles C4'-P-C4' energy: -57.529 flat angles P-C4'-P energy: -34.692 tors. eta vs tors. theta energy: -33.746 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -539.832695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.832695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.382695 (E_RNA) where: Base-Base interactions energy: -300.157 where: short stacking energy: -159.648 Base-Backbone interact. energy: 1.689 local terms energy: -212.914577 where: bonds (distance) C4'-P energy: -45.334 bonds (distance) P-C4' energy: -56.511 flat angles C4'-P-C4' energy: -54.336 flat angles P-C4'-P energy: -33.725 tors. eta vs tors. theta energy: -23.008 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -612.538194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.538194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.088194 (E_RNA) where: Base-Base interactions energy: -323.664 where: short stacking energy: -135.570 Base-Backbone interact. energy: -0.239 local terms energy: -215.185681 where: bonds (distance) C4'-P energy: -54.244 bonds (distance) P-C4' energy: -57.049 flat angles C4'-P-C4' energy: -60.224 flat angles P-C4'-P energy: -27.527 tors. eta vs tors. theta energy: -16.142 Dist. restrs. and SS energy: -97.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -487.362619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.362619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.712619 (E_RNA) where: Base-Base interactions energy: -276.574 where: short stacking energy: -111.573 Base-Backbone interact. energy: 0.442 local terms energy: -175.580066 where: bonds (distance) C4'-P energy: -54.534 bonds (distance) P-C4' energy: -38.829 flat angles C4'-P-C4' energy: -45.274 flat angles P-C4'-P energy: -27.879 tors. eta vs tors. theta energy: -9.064 Dist. restrs. and SS energy: -59.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -589.636806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.636806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.186806 (E_RNA) where: Base-Base interactions energy: -325.454 where: short stacking energy: -127.598 Base-Backbone interact. energy: -1.167 local terms energy: -180.566205 where: bonds (distance) C4'-P energy: -52.765 bonds (distance) P-C4' energy: -51.314 flat angles C4'-P-C4' energy: -53.841 flat angles P-C4'-P energy: -23.785 tors. eta vs tors. theta energy: 1.139 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -891.982192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -891.982192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -847.332192 (E_RNA) where: Base-Base interactions energy: -571.596 where: short stacking energy: -230.820 Base-Backbone interact. energy: -2.166 local terms energy: -273.570321 where: bonds (distance) C4'-P energy: -59.138 bonds (distance) P-C4' energy: -60.134 flat angles C4'-P-C4' energy: -64.366 flat angles P-C4'-P energy: -33.277 tors. eta vs tors. theta energy: -56.655 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -769.366480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.366480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.916480 (E_RNA) where: Base-Base interactions energy: -458.553 where: short stacking energy: -232.806 Base-Backbone interact. energy: -0.961 local terms energy: -272.402541 where: bonds (distance) C4'-P energy: -61.771 bonds (distance) P-C4' energy: -59.661 flat angles C4'-P-C4' energy: -62.871 flat angles P-C4'-P energy: -38.600 tors. eta vs tors. theta energy: -49.500 Dist. restrs. and SS energy: -61.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -739.017640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -739.017640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.167640 (E_RNA) where: Base-Base interactions energy: -456.608 where: short stacking energy: -220.097 Base-Backbone interact. energy: -0.124 local terms energy: -257.436186 where: bonds (distance) C4'-P energy: -47.574 bonds (distance) P-C4' energy: -61.468 flat angles C4'-P-C4' energy: -55.162 flat angles P-C4'-P energy: -38.719 tors. eta vs tors. theta energy: -54.513 Dist. restrs. and SS energy: -48.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -752.966580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.966580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.716580 (E_RNA) where: Base-Base interactions energy: -436.994 where: short stacking energy: -196.353 Base-Backbone interact. energy: 0.478 local terms energy: -268.201340 where: bonds (distance) C4'-P energy: -56.575 bonds (distance) P-C4' energy: -63.410 flat angles C4'-P-C4' energy: -63.832 flat angles P-C4'-P energy: -38.268 tors. eta vs tors. theta energy: -46.117 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -787.585408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -787.585408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.735408 (E_RNA) where: Base-Base interactions energy: -485.082 where: short stacking energy: -205.634 Base-Backbone interact. energy: -1.389 local terms energy: -249.264704 where: bonds (distance) C4'-P energy: -50.169 bonds (distance) P-C4' energy: -46.388 flat angles C4'-P-C4' energy: -65.983 flat angles P-C4'-P energy: -36.985 tors. eta vs tors. theta energy: -49.741 Dist. restrs. and SS energy: -75.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -559.772690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.772690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.922690 (E_RNA) where: Base-Base interactions energy: -339.429 where: short stacking energy: -125.486 Base-Backbone interact. energy: -1.290 local terms energy: -194.203716 where: bonds (distance) C4'-P energy: -55.863 bonds (distance) P-C4' energy: -57.218 flat angles C4'-P-C4' energy: -49.891 flat angles P-C4'-P energy: -29.659 tors. eta vs tors. theta energy: -1.572 Dist. restrs. and SS energy: -48.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -675.012549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.012549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.762549 (E_RNA) where: Base-Base interactions energy: -379.364 where: short stacking energy: -163.982 Base-Backbone interact. energy: -0.945 local terms energy: -219.453583 where: bonds (distance) C4'-P energy: -52.756 bonds (distance) P-C4' energy: -53.176 flat angles C4'-P-C4' energy: -54.262 flat angles P-C4'-P energy: -42.143 tors. eta vs tors. theta energy: -17.116 Dist. restrs. and SS energy: -99.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -588.449796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.449796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.999796 (E_RNA) where: Base-Base interactions energy: -322.890 where: short stacking energy: -152.713 Base-Backbone interact. energy: -1.192 local terms energy: -217.917067 where: bonds (distance) C4'-P energy: -54.174 bonds (distance) P-C4' energy: -60.874 flat angles C4'-P-C4' energy: -51.208 flat angles P-C4'-P energy: -35.552 tors. eta vs tors. theta energy: -16.109 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -686.668617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.668617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.418617 (E_RNA) where: Base-Base interactions energy: -377.936 where: short stacking energy: -150.249 Base-Backbone interact. energy: -0.177 local terms energy: -224.305731 where: bonds (distance) C4'-P energy: -52.593 bonds (distance) P-C4' energy: -53.966 flat angles C4'-P-C4' energy: -52.315 flat angles P-C4'-P energy: -36.836 tors. eta vs tors. theta energy: -28.596 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -500.300295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.300295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.650295 (E_RNA) where: Base-Base interactions energy: -287.500 where: short stacking energy: -129.548 Base-Backbone interact. energy: 3.513 local terms energy: -171.663328 where: bonds (distance) C4'-P energy: -48.160 bonds (distance) P-C4' energy: -53.847 flat angles C4'-P-C4' energy: -34.033 flat angles P-C4'-P energy: -22.150 tors. eta vs tors. theta energy: -13.472 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -928.997602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -928.997602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.947602 (E_RNA) where: Base-Base interactions energy: -602.280 where: short stacking energy: -250.720 Base-Backbone interact. energy: -2.097 local terms energy: -283.571313 where: bonds (distance) C4'-P energy: -60.307 bonds (distance) P-C4' energy: -57.809 flat angles C4'-P-C4' energy: -70.635 flat angles P-C4'-P energy: -33.511 tors. eta vs tors. theta energy: -61.309 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -761.242427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.242427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.792427 (E_RNA) where: Base-Base interactions energy: -462.890 where: short stacking energy: -212.387 Base-Backbone interact. energy: -0.752 local terms energy: -260.150132 where: bonds (distance) C4'-P energy: -58.942 bonds (distance) P-C4' energy: -64.333 flat angles C4'-P-C4' energy: -66.714 flat angles P-C4'-P energy: -29.155 tors. eta vs tors. theta energy: -41.006 Dist. restrs. and SS energy: -61.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -742.030292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.030292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.380292 (E_RNA) where: Base-Base interactions energy: -433.462 where: short stacking energy: -212.136 Base-Backbone interact. energy: -2.326 local terms energy: -279.592168 where: bonds (distance) C4'-P energy: -65.380 bonds (distance) P-C4' energy: -63.328 flat angles C4'-P-C4' energy: -62.277 flat angles P-C4'-P energy: -36.362 tors. eta vs tors. theta energy: -52.246 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -819.307119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.307119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.857119 (E_RNA) where: Base-Base interactions energy: -520.336 where: short stacking energy: -211.284 Base-Backbone interact. energy: -1.358 local terms energy: -242.163051 where: bonds (distance) C4'-P energy: -55.374 bonds (distance) P-C4' energy: -55.297 flat angles C4'-P-C4' energy: -48.307 flat angles P-C4'-P energy: -33.493 tors. eta vs tors. theta energy: -49.692 Dist. restrs. and SS energy: -79.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -677.365863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.365863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.915863 (E_RNA) where: Base-Base interactions energy: -399.752 where: short stacking energy: -182.370 Base-Backbone interact. energy: 1.923 local terms energy: -233.087032 where: bonds (distance) C4'-P energy: -44.347 bonds (distance) P-C4' energy: -54.197 flat angles C4'-P-C4' energy: -54.883 flat angles P-C4'-P energy: -35.582 tors. eta vs tors. theta energy: -44.078 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -694.966495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.966495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.916495 (E_RNA) where: Base-Base interactions energy: -382.158 where: short stacking energy: -171.958 Base-Backbone interact. energy: -1.734 local terms energy: -234.024538 where: bonds (distance) C4'-P energy: -40.617 bonds (distance) P-C4' energy: -59.969 flat angles C4'-P-C4' energy: -58.774 flat angles P-C4'-P energy: -41.419 tors. eta vs tors. theta energy: -33.246 Dist. restrs. and SS energy: -100.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -529.441263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.441263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.391263 (E_RNA) where: Base-Base interactions energy: -297.754 where: short stacking energy: -147.145 Base-Backbone interact. energy: -0.941 local terms energy: -207.696635 where: bonds (distance) C4'-P energy: -49.261 bonds (distance) P-C4' energy: -58.638 flat angles C4'-P-C4' energy: -46.465 flat angles P-C4'-P energy: -34.154 tors. eta vs tors. theta energy: -19.178 Dist. restrs. and SS energy: -46.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -721.643984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.643984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.193984 (E_RNA) where: Base-Base interactions energy: -410.159 where: short stacking energy: -174.637 Base-Backbone interact. energy: -2.348 local terms energy: -217.687054 where: bonds (distance) C4'-P energy: -50.257 bonds (distance) P-C4' energy: -48.960 flat angles C4'-P-C4' energy: -56.099 flat angles P-C4'-P energy: -22.035 tors. eta vs tors. theta energy: -40.335 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -580.263151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.263151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.613151 (E_RNA) where: Base-Base interactions energy: -316.541 where: short stacking energy: -149.934 Base-Backbone interact. energy: 1.775 local terms energy: -220.846593 where: bonds (distance) C4'-P energy: -50.576 bonds (distance) P-C4' energy: -49.275 flat angles C4'-P-C4' energy: -56.721 flat angles P-C4'-P energy: -41.775 tors. eta vs tors. theta energy: -22.499 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -545.658327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.658327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.608327 (E_RNA) where: Base-Base interactions energy: -285.659 where: short stacking energy: -119.157 Base-Backbone interact. energy: -1.531 local terms energy: -190.418789 where: bonds (distance) C4'-P energy: -52.463 bonds (distance) P-C4' energy: -58.129 flat angles C4'-P-C4' energy: -32.183 flat angles P-C4'-P energy: -36.786 tors. eta vs tors. theta energy: -10.858 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -938.877789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -938.877789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -890.627789 (E_RNA) where: Base-Base interactions energy: -591.628 where: short stacking energy: -258.168 Base-Backbone interact. energy: -2.413 local terms energy: -296.586918 where: bonds (distance) C4'-P energy: -59.507 bonds (distance) P-C4' energy: -67.282 flat angles C4'-P-C4' energy: -64.494 flat angles P-C4'-P energy: -35.422 tors. eta vs tors. theta energy: -69.881 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -769.704463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.704463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.254463 (E_RNA) where: Base-Base interactions energy: -447.614 where: short stacking energy: -225.906 Base-Backbone interact. energy: -1.309 local terms energy: -283.331859 where: bonds (distance) C4'-P energy: -50.541 bonds (distance) P-C4' energy: -59.716 flat angles C4'-P-C4' energy: -68.479 flat angles P-C4'-P energy: -41.182 tors. eta vs tors. theta energy: -63.413 Dist. restrs. and SS energy: -61.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -837.905739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.905739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.655739 (E_RNA) where: Base-Base interactions energy: -521.808 where: short stacking energy: -211.955 Base-Backbone interact. energy: -0.038 local terms energy: -258.808940 where: bonds (distance) C4'-P energy: -59.833 bonds (distance) P-C4' energy: -52.977 flat angles C4'-P-C4' energy: -67.125 flat angles P-C4'-P energy: -36.006 tors. eta vs tors. theta energy: -42.867 Dist. restrs. and SS energy: -81.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -790.278034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -790.278034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.028034 (E_RNA) where: Base-Base interactions energy: -508.588 where: short stacking energy: -222.736 Base-Backbone interact. energy: -0.467 local terms energy: -241.972556 where: bonds (distance) C4'-P energy: -49.952 bonds (distance) P-C4' energy: -44.889 flat angles C4'-P-C4' energy: -64.988 flat angles P-C4'-P energy: -31.922 tors. eta vs tors. theta energy: -50.222 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -705.417729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.417729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.167729 (E_RNA) where: Base-Base interactions energy: -387.091 where: short stacking energy: -161.463 Base-Backbone interact. energy: -1.045 local terms energy: -242.031635 where: bonds (distance) C4'-P energy: -37.654 bonds (distance) P-C4' energy: -63.934 flat angles C4'-P-C4' energy: -64.767 flat angles P-C4'-P energy: -41.721 tors. eta vs tors. theta energy: -33.957 Dist. restrs. and SS energy: -99.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -664.928580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.928580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.278580 (E_RNA) where: Base-Base interactions energy: -385.704 where: short stacking energy: -162.524 Base-Backbone interact. energy: 2.256 local terms energy: -227.830692 where: bonds (distance) C4'-P energy: -50.188 bonds (distance) P-C4' energy: -54.167 flat angles C4'-P-C4' energy: -60.181 flat angles P-C4'-P energy: -27.783 tors. eta vs tors. theta energy: -35.511 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -749.718011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -749.718011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.268011 (E_RNA) where: Base-Base interactions energy: -432.648 where: short stacking energy: -172.247 Base-Backbone interact. energy: 0.545 local terms energy: -226.165563 where: bonds (distance) C4'-P energy: -56.516 bonds (distance) P-C4' energy: -59.580 flat angles C4'-P-C4' energy: -55.485 flat angles P-C4'-P energy: -29.328 tors. eta vs tors. theta energy: -25.256 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -488.779147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.779147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.129147 (E_RNA) where: Base-Base interactions energy: -257.678 where: short stacking energy: -130.863 Base-Backbone interact. energy: -0.693 local terms energy: -203.758595 where: bonds (distance) C4'-P energy: -45.110 bonds (distance) P-C4' energy: -60.667 flat angles C4'-P-C4' energy: -49.617 flat angles P-C4'-P energy: -27.963 tors. eta vs tors. theta energy: -20.402 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -571.794341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.794341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.544341 (E_RNA) where: Base-Base interactions energy: -318.761 where: short stacking energy: -141.557 Base-Backbone interact. energy: 0.056 local terms energy: -186.838877 where: bonds (distance) C4'-P energy: -44.558 bonds (distance) P-C4' energy: -42.918 flat angles C4'-P-C4' energy: -54.609 flat angles P-C4'-P energy: -27.842 tors. eta vs tors. theta energy: -16.911 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -602.186352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.186352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.136352 (E_RNA) where: Base-Base interactions energy: -340.426 where: short stacking energy: -149.103 Base-Backbone interact. energy: 0.545 local terms energy: -194.256037 where: bonds (distance) C4'-P energy: -54.003 bonds (distance) P-C4' energy: -43.521 flat angles C4'-P-C4' energy: -42.291 flat angles P-C4'-P energy: -34.642 tors. eta vs tors. theta energy: -19.799 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -972.124208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.124208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.874208 (E_RNA) where: Base-Base interactions energy: -615.539 where: short stacking energy: -272.634 Base-Backbone interact. energy: -1.074 local terms energy: -307.260655 where: bonds (distance) C4'-P energy: -56.154 bonds (distance) P-C4' energy: -64.736 flat angles C4'-P-C4' energy: -64.159 flat angles P-C4'-P energy: -44.853 tors. eta vs tors. theta energy: -77.359 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -870.751468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -870.751468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.501468 (E_RNA) where: Base-Base interactions energy: -554.549 where: short stacking energy: -212.839 Base-Backbone interact. energy: -1.132 local terms energy: -257.820800 where: bonds (distance) C4'-P energy: -50.717 bonds (distance) P-C4' energy: -64.570 flat angles C4'-P-C4' energy: -61.816 flat angles P-C4'-P energy: -32.221 tors. eta vs tors. theta energy: -48.498 Dist. restrs. and SS energy: -81.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -757.270500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -757.270500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.020500 (E_RNA) where: Base-Base interactions energy: -444.973 where: short stacking energy: -210.414 Base-Backbone interact. energy: -1.397 local terms energy: -271.650066 where: bonds (distance) C4'-P energy: -51.149 bonds (distance) P-C4' energy: -65.685 flat angles C4'-P-C4' energy: -51.994 flat angles P-C4'-P energy: -41.956 tors. eta vs tors. theta energy: -60.866 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -792.179825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -792.179825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.929825 (E_RNA) where: Base-Base interactions energy: -486.551 where: short stacking energy: -209.079 Base-Backbone interact. energy: -0.004 local terms energy: -266.375604 where: bonds (distance) C4'-P energy: -57.299 bonds (distance) P-C4' energy: -66.455 flat angles C4'-P-C4' energy: -64.468 flat angles P-C4'-P energy: -30.629 tors. eta vs tors. theta energy: -47.524 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -762.806321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.806321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.356321 (E_RNA) where: Base-Base interactions energy: -435.287 where: short stacking energy: -177.399 Base-Backbone interact. energy: -1.515 local terms energy: -234.555093 where: bonds (distance) C4'-P energy: -50.167 bonds (distance) P-C4' energy: -55.817 flat angles C4'-P-C4' energy: -50.646 flat angles P-C4'-P energy: -43.929 tors. eta vs tors. theta energy: -33.996 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -778.425677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.425677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.975677 (E_RNA) where: Base-Base interactions energy: -446.714 where: short stacking energy: -198.152 Base-Backbone interact. energy: -1.988 local terms energy: -238.273441 where: bonds (distance) C4'-P energy: -50.344 bonds (distance) P-C4' energy: -57.916 flat angles C4'-P-C4' energy: -53.089 flat angles P-C4'-P energy: -30.839 tors. eta vs tors. theta energy: -46.085 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -669.125490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.125490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.475490 (E_RNA) where: Base-Base interactions energy: -392.259 where: short stacking energy: -174.753 Base-Backbone interact. energy: 1.639 local terms energy: -224.855862 where: bonds (distance) C4'-P energy: -46.938 bonds (distance) P-C4' energy: -58.898 flat angles C4'-P-C4' energy: -47.039 flat angles P-C4'-P energy: -33.061 tors. eta vs tors. theta energy: -38.919 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -643.229444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.229444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.779444 (E_RNA) where: Base-Base interactions energy: -373.232 where: short stacking energy: -171.862 Base-Backbone interact. energy: -0.862 local terms energy: -204.685678 where: bonds (distance) C4'-P energy: -49.244 bonds (distance) P-C4' energy: -47.385 flat angles C4'-P-C4' energy: -51.858 flat angles P-C4'-P energy: -35.580 tors. eta vs tors. theta energy: -20.618 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -447.775241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.775241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.925241 (E_RNA) where: Base-Base interactions energy: -238.629 where: short stacking energy: -109.015 Base-Backbone interact. energy: -0.372 local terms energy: -183.924014 where: bonds (distance) C4'-P energy: -48.712 bonds (distance) P-C4' energy: -46.965 flat angles C4'-P-C4' energy: -46.657 flat angles P-C4'-P energy: -32.561 tors. eta vs tors. theta energy: -9.028 Dist. restrs. and SS energy: -48.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -610.196528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -610.196528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.746528 (E_RNA) where: Base-Base interactions energy: -341.229 where: short stacking energy: -150.498 Base-Backbone interact. energy: -3.044 local terms energy: -201.474046 where: bonds (distance) C4'-P energy: -48.723 bonds (distance) P-C4' energy: -35.164 flat angles C4'-P-C4' energy: -48.073 flat angles P-C4'-P energy: -40.539 tors. eta vs tors. theta energy: -28.975 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -953.432530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -953.432530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -906.982530 (E_RNA) where: Base-Base interactions energy: -597.144 where: short stacking energy: -268.884 Base-Backbone interact. energy: -3.540 local terms energy: -306.298912 where: bonds (distance) C4'-P energy: -61.360 bonds (distance) P-C4' energy: -63.979 flat angles C4'-P-C4' energy: -69.759 flat angles P-C4'-P energy: -42.088 tors. eta vs tors. theta energy: -69.113 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -890.286859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -890.286859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.836859 (E_RNA) where: Base-Base interactions energy: -556.740 where: short stacking energy: -246.175 Base-Backbone interact. energy: 1.654 local terms energy: -279.751333 where: bonds (distance) C4'-P energy: -59.573 bonds (distance) P-C4' energy: -63.904 flat angles C4'-P-C4' energy: -57.231 flat angles P-C4'-P energy: -39.940 tors. eta vs tors. theta energy: -59.103 Dist. restrs. and SS energy: -79.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -832.730022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.730022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.480022 (E_RNA) where: Base-Base interactions energy: -514.565 where: short stacking energy: -235.789 Base-Backbone interact. energy: -0.736 local terms energy: -278.179120 where: bonds (distance) C4'-P energy: -65.337 bonds (distance) P-C4' energy: -58.099 flat angles C4'-P-C4' energy: -57.245 flat angles P-C4'-P energy: -38.505 tors. eta vs tors. theta energy: -58.994 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -728.531446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.531446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.081446 (E_RNA) where: Base-Base interactions energy: -441.011 where: short stacking energy: -205.437 Base-Backbone interact. energy: 2.387 local terms energy: -252.457140 where: bonds (distance) C4'-P energy: -45.457 bonds (distance) P-C4' energy: -60.306 flat angles C4'-P-C4' energy: -55.738 flat angles P-C4'-P energy: -33.660 tors. eta vs tors. theta energy: -57.296 Dist. restrs. and SS energy: -61.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -822.457140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.457140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.207140 (E_RNA) where: Base-Base interactions energy: -464.571 where: short stacking energy: -198.354 Base-Backbone interact. energy: -0.088 local terms energy: -264.548587 where: bonds (distance) C4'-P energy: -66.303 bonds (distance) P-C4' energy: -52.435 flat angles C4'-P-C4' energy: -64.998 flat angles P-C4'-P energy: -37.246 tors. eta vs tors. theta energy: -43.567 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -755.097559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.097559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.447559 (E_RNA) where: Base-Base interactions energy: -429.106 where: short stacking energy: -183.823 Base-Backbone interact. energy: -0.929 local terms energy: -235.411781 where: bonds (distance) C4'-P energy: -55.360 bonds (distance) P-C4' energy: -58.685 flat angles C4'-P-C4' energy: -51.776 flat angles P-C4'-P energy: -35.557 tors. eta vs tors. theta energy: -34.034 Dist. restrs. and SS energy: -113.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -695.997959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.997959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.147959 (E_RNA) where: Base-Base interactions energy: -409.542 where: short stacking energy: -187.592 Base-Backbone interact. energy: -0.155 local terms energy: -216.450763 where: bonds (distance) C4'-P energy: -45.608 bonds (distance) P-C4' energy: -62.193 flat angles C4'-P-C4' energy: -44.388 flat angles P-C4'-P energy: -35.507 tors. eta vs tors. theta energy: -28.754 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -599.102170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.102170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.252170 (E_RNA) where: Base-Base interactions energy: -339.118 where: short stacking energy: -144.854 Base-Backbone interact. energy: -0.491 local terms energy: -198.643171 where: bonds (distance) C4'-P energy: -45.832 bonds (distance) P-C4' energy: -55.279 flat angles C4'-P-C4' energy: -51.748 flat angles P-C4'-P energy: -26.482 tors. eta vs tors. theta energy: -19.302 Dist. restrs. and SS energy: -84.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -595.624324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.624324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.574324 (E_RNA) where: Base-Base interactions energy: -345.268 where: short stacking energy: -141.557 Base-Backbone interact. energy: -0.860 local terms energy: -190.446414 where: bonds (distance) C4'-P energy: -42.551 bonds (distance) P-C4' energy: -46.712 flat angles C4'-P-C4' energy: -45.619 flat angles P-C4'-P energy: -29.217 tors. eta vs tors. theta energy: -26.348 Dist. restrs. and SS energy: -82.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -438.116113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.116113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.466113 (E_RNA) where: Base-Base interactions energy: -234.540 where: short stacking energy: -105.379 Base-Backbone interact. energy: 1.633 local terms energy: -178.558508 where: bonds (distance) C4'-P energy: -40.267 bonds (distance) P-C4' energy: -50.446 flat angles C4'-P-C4' energy: -51.153 flat angles P-C4'-P energy: -29.335 tors. eta vs tors. theta energy: -7.357 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -954.204170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -954.204170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.954170 (E_RNA) where: Base-Base interactions energy: -601.318 where: short stacking energy: -274.667 Base-Backbone interact. energy: 2.486 local terms energy: -307.121904 where: bonds (distance) C4'-P energy: -64.189 bonds (distance) P-C4' energy: -62.671 flat angles C4'-P-C4' energy: -62.801 flat angles P-C4'-P energy: -40.658 tors. eta vs tors. theta energy: -76.803 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -889.701290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.701290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.051290 (E_RNA) where: Base-Base interactions energy: -571.781 where: short stacking energy: -234.348 Base-Backbone interact. energy: -2.165 local terms energy: -262.105414 where: bonds (distance) C4'-P energy: -51.671 bonds (distance) P-C4' energy: -66.585 flat angles C4'-P-C4' energy: -58.430 flat angles P-C4'-P energy: -30.722 tors. eta vs tors. theta energy: -54.697 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -826.867055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.867055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -803.817055 (E_RNA) where: Base-Base interactions energy: -522.470 where: short stacking energy: -235.510 Base-Backbone interact. energy: -1.382 local terms energy: -279.965000 where: bonds (distance) C4'-P energy: -60.836 bonds (distance) P-C4' energy: -62.180 flat angles C4'-P-C4' energy: -58.019 flat angles P-C4'-P energy: -46.488 tors. eta vs tors. theta energy: -52.442 Dist. restrs. and SS energy: -46.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -884.578385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.578385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.728385 (E_RNA) where: Base-Base interactions energy: -515.578 where: short stacking energy: -214.672 Base-Backbone interact. energy: 1.376 local terms energy: -273.527349 where: bonds (distance) C4'-P energy: -56.571 bonds (distance) P-C4' energy: -61.601 flat angles C4'-P-C4' energy: -59.740 flat angles P-C4'-P energy: -35.002 tors. eta vs tors. theta energy: -60.614 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -652.712391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -652.712391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.462391 (E_RNA) where: Base-Base interactions energy: -370.142 where: short stacking energy: -166.008 Base-Backbone interact. energy: 0.971 local terms energy: -244.291402 where: bonds (distance) C4'-P energy: -55.850 bonds (distance) P-C4' energy: -55.424 flat angles C4'-P-C4' energy: -57.696 flat angles P-C4'-P energy: -48.548 tors. eta vs tors. theta energy: -26.774 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -754.252558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -754.252558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.202558 (E_RNA) where: Base-Base interactions energy: -449.340 where: short stacking energy: -188.890 Base-Backbone interact. energy: -0.483 local terms energy: -227.379624 where: bonds (distance) C4'-P energy: -46.707 bonds (distance) P-C4' energy: -57.094 flat angles C4'-P-C4' energy: -56.614 flat angles P-C4'-P energy: -26.431 tors. eta vs tors. theta energy: -40.533 Dist. restrs. and SS energy: -100.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -671.014993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.014993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.164993 (E_RNA) where: Base-Base interactions energy: -372.681 where: short stacking energy: -175.228 Base-Backbone interact. energy: 0.711 local terms energy: -229.194999 where: bonds (distance) C4'-P energy: -50.502 bonds (distance) P-C4' energy: -54.143 flat angles C4'-P-C4' energy: -52.771 flat angles P-C4'-P energy: -31.437 tors. eta vs tors. theta energy: -40.342 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -631.119394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -631.119394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.269394 (E_RNA) where: Base-Base interactions energy: -343.766 where: short stacking energy: -159.479 Base-Backbone interact. energy: -0.100 local terms energy: -217.403958 where: bonds (distance) C4'-P energy: -50.580 bonds (distance) P-C4' energy: -50.334 flat angles C4'-P-C4' energy: -54.444 flat angles P-C4'-P energy: -36.407 tors. eta vs tors. theta energy: -25.639 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -612.248932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.248932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.598932 (E_RNA) where: Base-Base interactions energy: -337.766 where: short stacking energy: -135.895 Base-Backbone interact. energy: -0.210 local terms energy: -211.623115 where: bonds (distance) C4'-P energy: -51.306 bonds (distance) P-C4' energy: -49.911 flat angles C4'-P-C4' energy: -67.115 flat angles P-C4'-P energy: -23.918 tors. eta vs tors. theta energy: -19.373 Dist. restrs. and SS energy: -86.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -457.764942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.764942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.514942 (E_RNA) where: Base-Base interactions energy: -238.380 where: short stacking energy: -93.394 Base-Backbone interact. energy: 2.864 local terms energy: -182.999156 where: bonds (distance) C4'-P energy: -51.620 bonds (distance) P-C4' energy: -53.376 flat angles C4'-P-C4' energy: -54.130 flat angles P-C4'-P energy: -28.577 tors. eta vs tors. theta energy: 4.703 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -982.511849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.511849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -936.061849 (E_RNA) where: Base-Base interactions energy: -643.851 where: short stacking energy: -271.796 Base-Backbone interact. energy: -2.180 local terms energy: -290.030471 where: bonds (distance) C4'-P energy: -61.882 bonds (distance) P-C4' energy: -44.508 flat angles C4'-P-C4' energy: -70.746 flat angles P-C4'-P energy: -42.294 tors. eta vs tors. theta energy: -70.600 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -904.480365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.480365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -847.230365 (E_RNA) where: Base-Base interactions energy: -553.617 where: short stacking energy: -228.753 Base-Backbone interact. energy: -2.052 local terms energy: -291.561139 where: bonds (distance) C4'-P energy: -61.290 bonds (distance) P-C4' energy: -58.123 flat angles C4'-P-C4' energy: -58.312 flat angles P-C4'-P energy: -44.219 tors. eta vs tors. theta energy: -69.617 Dist. restrs. and SS energy: -81.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -916.388858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -916.388858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -868.138858 (E_RNA) where: Base-Base interactions energy: -577.662 where: short stacking energy: -246.815 Base-Backbone interact. energy: -0.903 local terms energy: -289.573701 where: bonds (distance) C4'-P energy: -55.706 bonds (distance) P-C4' energy: -57.173 flat angles C4'-P-C4' energy: -67.205 flat angles P-C4'-P energy: -39.816 tors. eta vs tors. theta energy: -69.674 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -867.792542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -867.792542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.142542 (E_RNA) where: Base-Base interactions energy: -514.848 where: short stacking energy: -219.887 Base-Backbone interact. energy: 0.518 local terms energy: -254.811966 where: bonds (distance) C4'-P energy: -61.806 bonds (distance) P-C4' energy: -53.002 flat angles C4'-P-C4' energy: -56.721 flat angles P-C4'-P energy: -34.740 tors. eta vs tors. theta energy: -48.542 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -850.229801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.229801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.579801 (E_RNA) where: Base-Base interactions energy: -494.913 where: short stacking energy: -224.872 Base-Backbone interact. energy: -0.534 local terms energy: -265.132804 where: bonds (distance) C4'-P energy: -53.926 bonds (distance) P-C4' energy: -54.180 flat angles C4'-P-C4' energy: -61.093 flat angles P-C4'-P energy: -34.133 tors. eta vs tors. theta energy: -61.800 Dist. restrs. and SS energy: -113.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -595.861963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.861963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.611963 (E_RNA) where: Base-Base interactions energy: -331.714 where: short stacking energy: -156.402 Base-Backbone interact. energy: -2.586 local terms energy: -231.312549 where: bonds (distance) C4'-P energy: -60.836 bonds (distance) P-C4' energy: -54.464 flat angles C4'-P-C4' energy: -53.292 flat angles P-C4'-P energy: -34.883 tors. eta vs tors. theta energy: -27.838 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -718.203076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.203076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.553076 (E_RNA) where: Base-Base interactions energy: -410.391 where: short stacking energy: -177.559 Base-Backbone interact. energy: 1.699 local terms energy: -219.860662 where: bonds (distance) C4'-P energy: -57.669 bonds (distance) P-C4' energy: -44.517 flat angles C4'-P-C4' energy: -53.359 flat angles P-C4'-P energy: -34.183 tors. eta vs tors. theta energy: -30.133 Dist. restrs. and SS energy: -113.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -676.414885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.414885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.164885 (E_RNA) where: Base-Base interactions energy: -396.663 where: short stacking energy: -158.785 Base-Backbone interact. energy: -1.651 local terms energy: -211.850923 where: bonds (distance) C4'-P energy: -47.961 bonds (distance) P-C4' energy: -53.048 flat angles C4'-P-C4' energy: -43.558 flat angles P-C4'-P energy: -35.084 tors. eta vs tors. theta energy: -32.199 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -603.661825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.661825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.211825 (E_RNA) where: Base-Base interactions energy: -322.615 where: short stacking energy: -135.138 Base-Backbone interact. energy: -0.216 local terms energy: -216.381416 where: bonds (distance) C4'-P energy: -57.654 bonds (distance) P-C4' energy: -49.376 flat angles C4'-P-C4' energy: -49.756 flat angles P-C4'-P energy: -30.430 tors. eta vs tors. theta energy: -29.165 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -543.644617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.644617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.594617 (E_RNA) where: Base-Base interactions energy: -293.919 where: short stacking energy: -130.526 Base-Backbone interact. energy: -0.721 local terms energy: -189.954645 where: bonds (distance) C4'-P energy: -51.785 bonds (distance) P-C4' energy: -38.144 flat angles C4'-P-C4' energy: -50.510 flat angles P-C4'-P energy: -30.188 tors. eta vs tors. theta energy: -19.328 Dist. restrs. and SS energy: -82.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -980.034036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.034036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.784036 (E_RNA) where: Base-Base interactions energy: -615.012 where: short stacking energy: -270.681 Base-Backbone interact. energy: -1.533 local terms energy: -315.238456 where: bonds (distance) C4'-P energy: -67.149 bonds (distance) P-C4' energy: -63.599 flat angles C4'-P-C4' energy: -64.601 flat angles P-C4'-P energy: -43.708 tors. eta vs tors. theta energy: -76.182 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -920.776059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.776059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -870.726059 (E_RNA) where: Base-Base interactions energy: -589.261 where: short stacking energy: -248.313 Base-Backbone interact. energy: -0.576 local terms energy: -280.889380 where: bonds (distance) C4'-P energy: -55.790 bonds (distance) P-C4' energy: -65.145 flat angles C4'-P-C4' energy: -60.524 flat angles P-C4'-P energy: -43.136 tors. eta vs tors. theta energy: -56.294 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -894.425541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.425541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -844.375541 (E_RNA) where: Base-Base interactions energy: -552.818 where: short stacking energy: -250.608 Base-Backbone interact. energy: -0.199 local terms energy: -291.358007 where: bonds (distance) C4'-P energy: -63.455 bonds (distance) P-C4' energy: -62.550 flat angles C4'-P-C4' energy: -61.082 flat angles P-C4'-P energy: -40.250 tors. eta vs tors. theta energy: -64.022 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -917.359614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -917.359614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.509614 (E_RNA) where: Base-Base interactions energy: -542.783 where: short stacking energy: -232.896 Base-Backbone interact. energy: -1.355 local terms energy: -276.371892 where: bonds (distance) C4'-P energy: -54.875 bonds (distance) P-C4' energy: -48.443 flat angles C4'-P-C4' energy: -66.420 flat angles P-C4'-P energy: -40.536 tors. eta vs tors. theta energy: -66.099 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -842.284558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -842.284558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.634558 (E_RNA) where: Base-Base interactions energy: -505.346 where: short stacking energy: -210.888 Base-Backbone interact. energy: -0.964 local terms energy: -237.324162 where: bonds (distance) C4'-P energy: -50.916 bonds (distance) P-C4' energy: -57.312 flat angles C4'-P-C4' energy: -50.144 flat angles P-C4'-P energy: -29.819 tors. eta vs tors. theta energy: -49.133 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -835.444046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.444046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.994046 (E_RNA) where: Base-Base interactions energy: -486.074 where: short stacking energy: -231.795 Base-Backbone interact. energy: -2.994 local terms energy: -254.926149 where: bonds (distance) C4'-P energy: -43.739 bonds (distance) P-C4' energy: -49.188 flat angles C4'-P-C4' energy: -60.039 flat angles P-C4'-P energy: -44.242 tors. eta vs tors. theta energy: -57.718 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -604.558487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.558487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.908487 (E_RNA) where: Base-Base interactions energy: -342.350 where: short stacking energy: -169.462 Base-Backbone interact. energy: -2.499 local terms energy: -224.059283 where: bonds (distance) C4'-P energy: -45.782 bonds (distance) P-C4' energy: -60.269 flat angles C4'-P-C4' energy: -55.816 flat angles P-C4'-P energy: -32.955 tors. eta vs tors. theta energy: -29.237 Dist. restrs. and SS energy: -59.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -697.621160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.621160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.571160 (E_RNA) where: Base-Base interactions energy: -404.973 where: short stacking energy: -188.598 Base-Backbone interact. energy: -0.736 local terms energy: -223.862708 where: bonds (distance) C4'-P energy: -40.539 bonds (distance) P-C4' energy: -40.184 flat angles C4'-P-C4' energy: -59.339 flat angles P-C4'-P energy: -41.674 tors. eta vs tors. theta energy: -42.126 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -585.549743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.549743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.499743 (E_RNA) where: Base-Base interactions energy: -348.858 where: short stacking energy: -141.553 Base-Backbone interact. energy: -2.149 local terms energy: -166.493016 where: bonds (distance) C4'-P energy: -45.928 bonds (distance) P-C4' energy: -45.581 flat angles C4'-P-C4' energy: -48.597 flat angles P-C4'-P energy: -20.072 tors. eta vs tors. theta energy: -6.315 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -570.472632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.472632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.422632 (E_RNA) where: Base-Base interactions energy: -310.393 where: short stacking energy: -130.090 Base-Backbone interact. energy: -0.056 local terms energy: -191.973129 where: bonds (distance) C4'-P energy: -53.096 bonds (distance) P-C4' energy: -59.535 flat angles C4'-P-C4' energy: -50.572 flat angles P-C4'-P energy: -22.000 tors. eta vs tors. theta energy: -6.771 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -987.761309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.761309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.511309 (E_RNA) where: Base-Base interactions energy: -623.735 where: short stacking energy: -272.481 Base-Backbone interact. energy: -3.135 local terms energy: -312.641204 where: bonds (distance) C4'-P energy: -60.912 bonds (distance) P-C4' energy: -68.081 flat angles C4'-P-C4' energy: -60.957 flat angles P-C4'-P energy: -41.447 tors. eta vs tors. theta energy: -81.244 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -928.631657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -928.631657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -869.581657 (E_RNA) where: Base-Base interactions energy: -576.619 where: short stacking energy: -236.319 Base-Backbone interact. energy: -1.198 local terms energy: -291.764453 where: bonds (distance) C4'-P energy: -64.987 bonds (distance) P-C4' energy: -63.628 flat angles C4'-P-C4' energy: -60.412 flat angles P-C4'-P energy: -42.906 tors. eta vs tors. theta energy: -59.831 Dist. restrs. and SS energy: -82.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -948.130037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -948.130037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -835.080037 (E_RNA) where: Base-Base interactions energy: -542.530 where: short stacking energy: -242.502 Base-Backbone interact. energy: -0.779 local terms energy: -291.771231 where: bonds (distance) C4'-P energy: -49.161 bonds (distance) P-C4' energy: -68.445 flat angles C4'-P-C4' energy: -61.533 flat angles P-C4'-P energy: -48.060 tors. eta vs tors. theta energy: -64.573 Dist. restrs. and SS energy: -136.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -879.964735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.964735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.714735 (E_RNA) where: Base-Base interactions energy: -560.902 where: short stacking energy: -249.907 Base-Backbone interact. energy: -1.688 local terms energy: -269.125188 where: bonds (distance) C4'-P energy: -41.593 bonds (distance) P-C4' energy: -61.462 flat angles C4'-P-C4' energy: -61.317 flat angles P-C4'-P energy: -40.180 tors. eta vs tors. theta energy: -64.573 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -886.902129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -886.902129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.052129 (E_RNA) where: Base-Base interactions energy: -541.292 where: short stacking energy: -233.227 Base-Backbone interact. energy: -0.364 local terms energy: -248.396139 where: bonds (distance) C4'-P energy: -52.688 bonds (distance) P-C4' energy: -48.055 flat angles C4'-P-C4' energy: -60.976 flat angles P-C4'-P energy: -35.207 tors. eta vs tors. theta energy: -51.470 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -807.015428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -807.015428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.365428 (E_RNA) where: Base-Base interactions energy: -470.503 where: short stacking energy: -185.439 Base-Backbone interact. energy: -1.170 local terms energy: -236.692452 where: bonds (distance) C4'-P energy: -42.849 bonds (distance) P-C4' energy: -55.582 flat angles C4'-P-C4' energy: -57.355 flat angles P-C4'-P energy: -41.227 tors. eta vs tors. theta energy: -39.680 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -704.899656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.899656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.049656 (E_RNA) where: Base-Base interactions energy: -388.592 where: short stacking energy: -166.801 Base-Backbone interact. energy: -1.114 local terms energy: -245.343045 where: bonds (distance) C4'-P energy: -52.385 bonds (distance) P-C4' energy: -58.701 flat angles C4'-P-C4' energy: -60.675 flat angles P-C4'-P energy: -39.087 tors. eta vs tors. theta energy: -34.495 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -509.332647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.332647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.682647 (E_RNA) where: Base-Base interactions energy: -272.139 where: short stacking energy: -133.587 Base-Backbone interact. energy: -1.466 local terms energy: -200.078022 where: bonds (distance) C4'-P energy: -50.295 bonds (distance) P-C4' energy: -57.159 flat angles C4'-P-C4' energy: -43.840 flat angles P-C4'-P energy: -29.310 tors. eta vs tors. theta energy: -19.474 Dist. restrs. and SS energy: -59.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -612.185070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.185070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.135070 (E_RNA) where: Base-Base interactions energy: -341.987 where: short stacking energy: -160.360 Base-Backbone interact. energy: 5.865 local terms energy: -208.013631 where: bonds (distance) C4'-P energy: -50.846 bonds (distance) P-C4' energy: -54.143 flat angles C4'-P-C4' energy: -50.959 flat angles P-C4'-P energy: -34.248 tors. eta vs tors. theta energy: -17.817 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -562.052434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.052434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.802434 (E_RNA) where: Base-Base interactions energy: -297.596 where: short stacking energy: -126.982 Base-Backbone interact. energy: -0.247 local terms energy: -197.960329 where: bonds (distance) C4'-P energy: -48.896 bonds (distance) P-C4' energy: -58.098 flat angles C4'-P-C4' energy: -44.257 flat angles P-C4'-P energy: -29.266 tors. eta vs tors. theta energy: -17.443 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -984.154741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.154741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -935.904741 (E_RNA) where: Base-Base interactions energy: -616.688 where: short stacking energy: -275.701 Base-Backbone interact. energy: -1.506 local terms energy: -317.710411 where: bonds (distance) C4'-P energy: -65.007 bonds (distance) P-C4' energy: -60.293 flat angles C4'-P-C4' energy: -65.818 flat angles P-C4'-P energy: -45.939 tors. eta vs tors. theta energy: -80.654 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -1016.602615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.602615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -908.952615 (E_RNA) where: Base-Base interactions energy: -608.801 where: short stacking energy: -267.119 Base-Backbone interact. energy: -1.563 local terms energy: -298.588633 where: bonds (distance) C4'-P energy: -61.100 bonds (distance) P-C4' energy: -52.331 flat angles C4'-P-C4' energy: -63.826 flat angles P-C4'-P energy: -46.334 tors. eta vs tors. theta energy: -74.997 Dist. restrs. and SS energy: -131.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -929.256606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -929.256606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -868.406606 (E_RNA) where: Base-Base interactions energy: -606.233 where: short stacking energy: -237.060 Base-Backbone interact. energy: -1.893 local terms energy: -260.280888 where: bonds (distance) C4'-P energy: -60.834 bonds (distance) P-C4' energy: -55.211 flat angles C4'-P-C4' energy: -53.483 flat angles P-C4'-P energy: -36.341 tors. eta vs tors. theta energy: -54.411 Dist. restrs. and SS energy: -84.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -922.159654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.159654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.509654 (E_RNA) where: Base-Base interactions energy: -544.220 where: short stacking energy: -203.255 Base-Backbone interact. energy: -1.975 local terms energy: -277.314749 where: bonds (distance) C4'-P energy: -59.567 bonds (distance) P-C4' energy: -56.956 flat angles C4'-P-C4' energy: -68.564 flat angles P-C4'-P energy: -35.299 tors. eta vs tors. theta energy: -56.928 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -856.548759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.548759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -802.898759 (E_RNA) where: Base-Base interactions energy: -526.809 where: short stacking energy: -248.444 Base-Backbone interact. energy: -2.894 local terms energy: -273.195492 where: bonds (distance) C4'-P energy: -55.068 bonds (distance) P-C4' energy: -53.753 flat angles C4'-P-C4' energy: -58.813 flat angles P-C4'-P energy: -43.403 tors. eta vs tors. theta energy: -62.157 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -841.246418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.246418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.396418 (E_RNA) where: Base-Base interactions energy: -489.987 where: short stacking energy: -202.718 Base-Backbone interact. energy: -0.065 local terms energy: -254.344767 where: bonds (distance) C4'-P energy: -56.842 bonds (distance) P-C4' energy: -54.284 flat angles C4'-P-C4' energy: -61.492 flat angles P-C4'-P energy: -36.101 tors. eta vs tors. theta energy: -45.625 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -712.760765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.760765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.710765 (E_RNA) where: Base-Base interactions energy: -411.329 where: short stacking energy: -187.327 Base-Backbone interact. energy: -1.157 local terms energy: -232.224055 where: bonds (distance) C4'-P energy: -49.271 bonds (distance) P-C4' energy: -57.204 flat angles C4'-P-C4' energy: -52.743 flat angles P-C4'-P energy: -28.747 tors. eta vs tors. theta energy: -44.260 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -621.616829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.616829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.566829 (E_RNA) where: Base-Base interactions energy: -364.791 where: short stacking energy: -152.259 Base-Backbone interact. energy: -1.224 local terms energy: -187.552304 where: bonds (distance) C4'-P energy: -56.539 bonds (distance) P-C4' energy: -44.927 flat angles C4'-P-C4' energy: -46.284 flat angles P-C4'-P energy: -25.039 tors. eta vs tors. theta energy: -14.763 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -451.528999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.528999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.278999 (E_RNA) where: Base-Base interactions energy: -224.960 where: short stacking energy: -121.031 Base-Backbone interact. energy: 0.075 local terms energy: -196.394524 where: bonds (distance) C4'-P energy: -53.490 bonds (distance) P-C4' energy: -54.097 flat angles C4'-P-C4' energy: -51.519 flat angles P-C4'-P energy: -21.633 tors. eta vs tors. theta energy: -15.656 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -562.951910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.951910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.101910 (E_RNA) where: Base-Base interactions energy: -308.269 where: short stacking energy: -118.614 Base-Backbone interact. energy: -1.540 local terms energy: -183.292671 where: bonds (distance) C4'-P energy: -47.862 bonds (distance) P-C4' energy: -53.735 flat angles C4'-P-C4' energy: -47.529 flat angles P-C4'-P energy: -27.889 tors. eta vs tors. theta energy: -6.277 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -1036.941740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1036.941740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -918.491740 (E_RNA) where: Base-Base interactions energy: -607.389 where: short stacking energy: -266.094 Base-Backbone interact. energy: -1.409 local terms energy: -309.693941 where: bonds (distance) C4'-P energy: -56.666 bonds (distance) P-C4' energy: -63.574 flat angles C4'-P-C4' energy: -72.706 flat angles P-C4'-P energy: -44.635 tors. eta vs tors. theta energy: -72.112 Dist. restrs. and SS energy: -142.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -972.883661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.883661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.633661 (E_RNA) where: Base-Base interactions energy: -618.166 where: short stacking energy: -274.338 Base-Backbone interact. energy: -2.143 local terms energy: -304.324790 where: bonds (distance) C4'-P energy: -59.584 bonds (distance) P-C4' energy: -59.576 flat angles C4'-P-C4' energy: -61.937 flat angles P-C4'-P energy: -43.515 tors. eta vs tors. theta energy: -79.713 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -931.141279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -931.141279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -864.891279 (E_RNA) where: Base-Base interactions energy: -596.035 where: short stacking energy: -255.830 Base-Backbone interact. energy: -0.674 local terms energy: -268.182070 where: bonds (distance) C4'-P energy: -52.441 bonds (distance) P-C4' energy: -61.909 flat angles C4'-P-C4' energy: -54.723 flat angles P-C4'-P energy: -35.330 tors. eta vs tors. theta energy: -63.779 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -944.534308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -944.534308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -842.284308 (E_RNA) where: Base-Base interactions energy: -575.207 where: short stacking energy: -240.415 Base-Backbone interact. energy: -0.822 local terms energy: -266.255166 where: bonds (distance) C4'-P energy: -43.027 bonds (distance) P-C4' energy: -57.816 flat angles C4'-P-C4' energy: -56.840 flat angles P-C4'-P energy: -45.985 tors. eta vs tors. theta energy: -62.587 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -895.290405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -895.290405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -798.440405 (E_RNA) where: Base-Base interactions energy: -528.212 where: short stacking energy: -230.965 Base-Backbone interact. energy: -0.318 local terms energy: -269.911371 where: bonds (distance) C4'-P energy: -60.822 bonds (distance) P-C4' energy: -59.256 flat angles C4'-P-C4' energy: -50.032 flat angles P-C4'-P energy: -48.964 tors. eta vs tors. theta energy: -50.838 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -803.904251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.904251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.054251 (E_RNA) where: Base-Base interactions energy: -505.744 where: short stacking energy: -208.524 Base-Backbone interact. energy: -1.231 local terms energy: -254.079049 where: bonds (distance) C4'-P energy: -55.807 bonds (distance) P-C4' energy: -46.225 flat angles C4'-P-C4' energy: -57.293 flat angles P-C4'-P energy: -37.494 tors. eta vs tors. theta energy: -57.259 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -702.295461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.295461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.045461 (E_RNA) where: Base-Base interactions energy: -419.279 where: short stacking energy: -177.663 Base-Backbone interact. energy: -1.559 local terms energy: -215.206633 where: bonds (distance) C4'-P energy: -41.661 bonds (distance) P-C4' energy: -47.787 flat angles C4'-P-C4' energy: -58.031 flat angles P-C4'-P energy: -23.753 tors. eta vs tors. theta energy: -43.974 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -638.235365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.235365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.585365 (E_RNA) where: Base-Base interactions energy: -358.183 where: short stacking energy: -160.541 Base-Backbone interact. energy: 2.263 local terms energy: -210.665131 where: bonds (distance) C4'-P energy: -46.810 bonds (distance) P-C4' energy: -64.784 flat angles C4'-P-C4' energy: -51.182 flat angles P-C4'-P energy: -34.975 tors. eta vs tors. theta energy: -12.914 Dist. restrs. and SS energy: -95.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -580.140327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.140327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.090327 (E_RNA) where: Base-Base interactions energy: -320.391 where: short stacking energy: -145.606 Base-Backbone interact. energy: -2.133 local terms energy: -198.566524 where: bonds (distance) C4'-P energy: -44.724 bonds (distance) P-C4' energy: -46.036 flat angles C4'-P-C4' energy: -53.750 flat angles P-C4'-P energy: -36.113 tors. eta vs tors. theta energy: -17.944 Dist. restrs. and SS energy: -82.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -497.667428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.667428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.817428 (E_RNA) where: Base-Base interactions energy: -257.333 where: short stacking energy: -123.758 Base-Backbone interact. energy: -1.557 local terms energy: -195.927952 where: bonds (distance) C4'-P energy: -50.370 bonds (distance) P-C4' energy: -43.527 flat angles C4'-P-C4' energy: -45.391 flat angles P-C4'-P energy: -42.749 tors. eta vs tors. theta energy: -13.891 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -1044.688620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1044.688620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.038620 (E_RNA) where: Base-Base interactions energy: -634.154 where: short stacking energy: -240.964 Base-Backbone interact. energy: 0.075 local terms energy: -284.959423 where: bonds (distance) C4'-P energy: -55.790 bonds (distance) P-C4' energy: -57.402 flat angles C4'-P-C4' energy: -69.283 flat angles P-C4'-P energy: -47.905 tors. eta vs tors. theta energy: -54.580 Dist. restrs. and SS energy: -149.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -965.978603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.978603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -899.728603 (E_RNA) where: Base-Base interactions energy: -600.576 where: short stacking energy: -247.983 Base-Backbone interact. energy: -0.858 local terms energy: -298.294991 where: bonds (distance) C4'-P energy: -58.952 bonds (distance) P-C4' energy: -65.399 flat angles C4'-P-C4' energy: -65.333 flat angles P-C4'-P energy: -37.857 tors. eta vs tors. theta energy: -70.754 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -936.352708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -936.352708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -888.102708 (E_RNA) where: Base-Base interactions energy: -591.579 where: short stacking energy: -247.532 Base-Backbone interact. energy: -1.960 local terms energy: -294.564017 where: bonds (distance) C4'-P energy: -62.074 bonds (distance) P-C4' energy: -59.577 flat angles C4'-P-C4' energy: -68.327 flat angles P-C4'-P energy: -36.577 tors. eta vs tors. theta energy: -68.009 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -921.399271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.399271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.549271 (E_RNA) where: Base-Base interactions energy: -547.604 where: short stacking energy: -219.540 Base-Backbone interact. energy: -1.238 local terms energy: -275.707440 where: bonds (distance) C4'-P energy: -52.732 bonds (distance) P-C4' energy: -61.245 flat angles C4'-P-C4' energy: -64.786 flat angles P-C4'-P energy: -36.934 tors. eta vs tors. theta energy: -60.010 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -912.036851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -912.036851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -807.986851 (E_RNA) where: Base-Base interactions energy: -526.787 where: short stacking energy: -225.492 Base-Backbone interact. energy: -2.610 local terms energy: -278.589746 where: bonds (distance) C4'-P energy: -62.239 bonds (distance) P-C4' energy: -49.551 flat angles C4'-P-C4' energy: -64.889 flat angles P-C4'-P energy: -42.307 tors. eta vs tors. theta energy: -59.605 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -776.309966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.309966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -726.259966 (E_RNA) where: Base-Base interactions energy: -483.893 where: short stacking energy: -224.308 Base-Backbone interact. energy: 0.287 local terms energy: -242.654154 where: bonds (distance) C4'-P energy: -46.436 bonds (distance) P-C4' energy: -52.490 flat angles C4'-P-C4' energy: -57.145 flat angles P-C4'-P energy: -27.571 tors. eta vs tors. theta energy: -59.012 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -719.737228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.737228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.287228 (E_RNA) where: Base-Base interactions energy: -413.371 where: short stacking energy: -166.228 Base-Backbone interact. energy: -1.991 local terms energy: -212.925220 where: bonds (distance) C4'-P energy: -53.901 bonds (distance) P-C4' energy: -49.868 flat angles C4'-P-C4' energy: -51.768 flat angles P-C4'-P energy: -28.344 tors. eta vs tors. theta energy: -29.044 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -598.496964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.496964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.446964 (E_RNA) where: Base-Base interactions energy: -340.550 where: short stacking energy: -136.466 Base-Backbone interact. energy: -0.414 local terms energy: -189.483283 where: bonds (distance) C4'-P energy: -53.204 bonds (distance) P-C4' energy: -60.065 flat angles C4'-P-C4' energy: -33.966 flat angles P-C4'-P energy: -30.843 tors. eta vs tors. theta energy: -11.405 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -596.460067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.460067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.410067 (E_RNA) where: Base-Base interactions energy: -335.583 where: short stacking energy: -152.413 Base-Backbone interact. energy: 0.122 local terms energy: -192.949162 where: bonds (distance) C4'-P energy: -42.071 bonds (distance) P-C4' energy: -41.295 flat angles C4'-P-C4' energy: -54.427 flat angles P-C4'-P energy: -27.542 tors. eta vs tors. theta energy: -27.614 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -528.364300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.364300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.114300 (E_RNA) where: Base-Base interactions energy: -281.312 where: short stacking energy: -125.276 Base-Backbone interact. energy: 0.299 local terms energy: -199.101385 where: bonds (distance) C4'-P energy: -53.272 bonds (distance) P-C4' energy: -57.806 flat angles C4'-P-C4' energy: -53.151 flat angles P-C4'-P energy: -24.081 tors. eta vs tors. theta energy: -10.791 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -1043.752738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.752738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -918.102738 (E_RNA) where: Base-Base interactions energy: -630.662 where: short stacking energy: -254.433 Base-Backbone interact. energy: -2.000 local terms energy: -285.441188 where: bonds (distance) C4'-P energy: -53.396 bonds (distance) P-C4' energy: -57.383 flat angles C4'-P-C4' energy: -64.883 flat angles P-C4'-P energy: -43.855 tors. eta vs tors. theta energy: -65.924 Dist. restrs. and SS energy: -149.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -942.599041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -942.599041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -892.549041 (E_RNA) where: Base-Base interactions energy: -599.809 where: short stacking energy: -258.010 Base-Backbone interact. energy: -1.057 local terms energy: -291.683005 where: bonds (distance) C4'-P energy: -60.921 bonds (distance) P-C4' energy: -60.611 flat angles C4'-P-C4' energy: -67.407 flat angles P-C4'-P energy: -39.028 tors. eta vs tors. theta energy: -63.715 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -921.704224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.704224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -873.454224 (E_RNA) where: Base-Base interactions energy: -603.874 where: short stacking energy: -250.401 Base-Backbone interact. energy: -4.343 local terms energy: -265.237299 where: bonds (distance) C4'-P energy: -55.147 bonds (distance) P-C4' energy: -52.986 flat angles C4'-P-C4' energy: -54.306 flat angles P-C4'-P energy: -38.247 tors. eta vs tors. theta energy: -64.551 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -895.297611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -895.297611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -798.447611 (E_RNA) where: Base-Base interactions energy: -534.280 where: short stacking energy: -223.290 Base-Backbone interact. energy: -2.009 local terms energy: -262.158489 where: bonds (distance) C4'-P energy: -51.987 bonds (distance) P-C4' energy: -60.080 flat angles C4'-P-C4' energy: -60.642 flat angles P-C4'-P energy: -40.045 tors. eta vs tors. theta energy: -49.405 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -911.895689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -911.895689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.645689 (E_RNA) where: Base-Base interactions energy: -539.264 where: short stacking energy: -247.230 Base-Backbone interact. energy: 0.518 local terms energy: -270.900277 where: bonds (distance) C4'-P energy: -50.359 bonds (distance) P-C4' energy: -52.424 flat angles C4'-P-C4' energy: -59.134 flat angles P-C4'-P energy: -42.152 tors. eta vs tors. theta energy: -66.831 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -781.195315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.195315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.345315 (E_RNA) where: Base-Base interactions energy: -470.850 where: short stacking energy: -209.822 Base-Backbone interact. energy: 0.638 local terms energy: -259.132967 where: bonds (distance) C4'-P energy: -55.876 bonds (distance) P-C4' energy: -61.496 flat angles C4'-P-C4' energy: -60.064 flat angles P-C4'-P energy: -31.617 tors. eta vs tors. theta energy: -50.081 Dist. restrs. and SS energy: -75.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -745.587078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.587078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.137078 (E_RNA) where: Base-Base interactions energy: -429.156 where: short stacking energy: -171.852 Base-Backbone interact. energy: -0.026 local terms energy: -224.954160 where: bonds (distance) C4'-P energy: -49.163 bonds (distance) P-C4' energy: -55.822 flat angles C4'-P-C4' energy: -50.906 flat angles P-C4'-P energy: -36.811 tors. eta vs tors. theta energy: -32.252 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -607.609895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.609895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.759895 (E_RNA) where: Base-Base interactions energy: -321.129 where: short stacking energy: -143.568 Base-Backbone interact. energy: 2.588 local terms energy: -219.219340 where: bonds (distance) C4'-P energy: -49.667 bonds (distance) P-C4' energy: -59.651 flat angles C4'-P-C4' energy: -60.471 flat angles P-C4'-P energy: -25.505 tors. eta vs tors. theta energy: -23.925 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -617.829647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -617.829647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.779647 (E_RNA) where: Base-Base interactions energy: -348.585 where: short stacking energy: -157.688 Base-Backbone interact. energy: 0.127 local terms energy: -201.321952 where: bonds (distance) C4'-P energy: -43.952 bonds (distance) P-C4' energy: -55.343 flat angles C4'-P-C4' energy: -43.176 flat angles P-C4'-P energy: -34.917 tors. eta vs tors. theta energy: -23.934 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -582.766787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.766787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.516787 (E_RNA) where: Base-Base interactions energy: -328.635 where: short stacking energy: -155.498 Base-Backbone interact. energy: -1.900 local terms energy: -185.982199 where: bonds (distance) C4'-P energy: -41.473 bonds (distance) P-C4' energy: -45.738 flat angles C4'-P-C4' energy: -46.219 flat angles P-C4'-P energy: -27.519 tors. eta vs tors. theta energy: -25.033 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -1044.084491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1044.084491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.034491 (E_RNA) where: Base-Base interactions energy: -611.820 where: short stacking energy: -264.232 Base-Backbone interact. energy: 0.879 local terms energy: -311.093293 where: bonds (distance) C4'-P energy: -56.810 bonds (distance) P-C4' energy: -59.998 flat angles C4'-P-C4' energy: -66.826 flat angles P-C4'-P energy: -52.646 tors. eta vs tors. theta energy: -74.814 Dist. restrs. and SS energy: -145.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -944.847777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -944.847777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -892.997777 (E_RNA) where: Base-Base interactions energy: -611.350 where: short stacking energy: -268.286 Base-Backbone interact. energy: 1.187 local terms energy: -282.835565 where: bonds (distance) C4'-P energy: -57.808 bonds (distance) P-C4' energy: -50.658 flat angles C4'-P-C4' energy: -62.346 flat angles P-C4'-P energy: -39.788 tors. eta vs tors. theta energy: -72.236 Dist. restrs. and SS energy: -75.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -884.594122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.594122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.344122 (E_RNA) where: Base-Base interactions energy: -543.121 where: short stacking energy: -237.922 Base-Backbone interact. energy: -1.578 local terms energy: -291.645169 where: bonds (distance) C4'-P energy: -64.982 bonds (distance) P-C4' energy: -52.126 flat angles C4'-P-C4' energy: -61.180 flat angles P-C4'-P energy: -49.190 tors. eta vs tors. theta energy: -64.167 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -937.454320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.454320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.404320 (E_RNA) where: Base-Base interactions energy: -569.396 where: short stacking energy: -239.387 Base-Backbone interact. energy: 4.929 local terms energy: -259.937176 where: bonds (distance) C4'-P energy: -53.456 bonds (distance) P-C4' energy: -53.186 flat angles C4'-P-C4' energy: -55.955 flat angles P-C4'-P energy: -37.366 tors. eta vs tors. theta energy: -59.974 Dist. restrs. and SS energy: -136.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -932.549693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -932.549693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.099693 (E_RNA) where: Base-Base interactions energy: -564.279 where: short stacking energy: -237.011 Base-Backbone interact. energy: -0.334 local terms energy: -258.486304 where: bonds (distance) C4'-P energy: -56.001 bonds (distance) P-C4' energy: -50.322 flat angles C4'-P-C4' energy: -57.574 flat angles P-C4'-P energy: -34.961 tors. eta vs tors. theta energy: -59.629 Dist. restrs. and SS energy: -133.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -766.183195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.183195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.333195 (E_RNA) where: Base-Base interactions energy: -466.241 where: short stacking energy: -186.753 Base-Backbone interact. energy: -0.219 local terms energy: -238.873990 where: bonds (distance) C4'-P energy: -53.867 bonds (distance) P-C4' energy: -63.796 flat angles C4'-P-C4' energy: -54.154 flat angles P-C4'-P energy: -25.166 tors. eta vs tors. theta energy: -41.892 Dist. restrs. and SS energy: -84.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -753.762191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.762191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.112191 (E_RNA) where: Base-Base interactions energy: -442.805 where: short stacking energy: -186.022 Base-Backbone interact. energy: -1.267 local terms energy: -220.040492 where: bonds (distance) C4'-P energy: -46.733 bonds (distance) P-C4' energy: -54.860 flat angles C4'-P-C4' energy: -56.416 flat angles P-C4'-P energy: -36.044 tors. eta vs tors. theta energy: -25.988 Dist. restrs. and SS energy: -113.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -669.361158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.361158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.311158 (E_RNA) where: Base-Base interactions energy: -408.317 where: short stacking energy: -175.063 Base-Backbone interact. energy: -1.199 local terms energy: -191.795406 where: bonds (distance) C4'-P energy: -42.273 bonds (distance) P-C4' energy: -48.299 flat angles C4'-P-C4' energy: -49.092 flat angles P-C4'-P energy: -27.315 tors. eta vs tors. theta energy: -24.816 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -588.031768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.031768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.781768 (E_RNA) where: Base-Base interactions energy: -329.233 where: short stacking energy: -142.907 Base-Backbone interact. energy: -2.615 local terms energy: -189.934492 where: bonds (distance) C4'-P energy: -49.150 bonds (distance) P-C4' energy: -49.253 flat angles C4'-P-C4' energy: -46.071 flat angles P-C4'-P energy: -21.768 tors. eta vs tors. theta energy: -23.693 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -585.739805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.739805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.689805 (E_RNA) where: Base-Base interactions energy: -333.191 where: short stacking energy: -150.163 Base-Backbone interact. energy: 0.595 local terms energy: -185.093499 where: bonds (distance) C4'-P energy: -45.487 bonds (distance) P-C4' energy: -41.071 flat angles C4'-P-C4' energy: -48.248 flat angles P-C4'-P energy: -31.969 tors. eta vs tors. theta energy: -18.319 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -1073.814457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.814457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -946.364457 (E_RNA) where: Base-Base interactions energy: -624.989 where: short stacking energy: -256.637 Base-Backbone interact. energy: -3.963 local terms energy: -317.411999 where: bonds (distance) C4'-P energy: -61.740 bonds (distance) P-C4' energy: -65.708 flat angles C4'-P-C4' energy: -71.013 flat angles P-C4'-P energy: -42.561 tors. eta vs tors. theta energy: -76.390 Dist. restrs. and SS energy: -151.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -953.792922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -953.792922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.142922 (E_RNA) where: Base-Base interactions energy: -628.054 where: short stacking energy: -240.080 Base-Backbone interact. energy: -0.065 local terms energy: -272.024286 where: bonds (distance) C4'-P energy: -58.284 bonds (distance) P-C4' energy: -62.238 flat angles C4'-P-C4' energy: -59.556 flat angles P-C4'-P energy: -33.416 tors. eta vs tors. theta energy: -58.530 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -1013.035582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1013.035582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.585582 (E_RNA) where: Base-Base interactions energy: -603.333 where: short stacking energy: -261.967 Base-Backbone interact. energy: -1.341 local terms energy: -280.911903 where: bonds (distance) C4'-P energy: -53.103 bonds (distance) P-C4' energy: -58.930 flat angles C4'-P-C4' energy: -63.317 flat angles P-C4'-P energy: -38.245 tors. eta vs tors. theta energy: -67.317 Dist. restrs. and SS energy: -151.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -898.502992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.502992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -852.052992 (E_RNA) where: Base-Base interactions energy: -573.396 where: short stacking energy: -240.855 Base-Backbone interact. energy: -2.115 local terms energy: -276.541924 where: bonds (distance) C4'-P energy: -60.054 bonds (distance) P-C4' energy: -55.622 flat angles C4'-P-C4' energy: -62.304 flat angles P-C4'-P energy: -30.239 tors. eta vs tors. theta energy: -68.323 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -964.203973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.203973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.353973 (E_RNA) where: Base-Base interactions energy: -558.144 where: short stacking energy: -259.985 Base-Backbone interact. energy: -1.096 local terms energy: -290.113762 where: bonds (distance) C4'-P energy: -55.560 bonds (distance) P-C4' energy: -53.713 flat angles C4'-P-C4' energy: -69.827 flat angles P-C4'-P energy: -42.850 tors. eta vs tors. theta energy: -68.164 Dist. restrs. and SS energy: -138.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -793.919786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -793.919786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.869786 (E_RNA) where: Base-Base interactions energy: -470.672 where: short stacking energy: -206.793 Base-Backbone interact. energy: -0.574 local terms energy: -263.624210 where: bonds (distance) C4'-P energy: -56.180 bonds (distance) P-C4' energy: -61.699 flat angles C4'-P-C4' energy: -57.140 flat angles P-C4'-P energy: -43.466 tors. eta vs tors. theta energy: -45.139 Dist. restrs. and SS energy: -82.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -758.751564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.751564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.301564 (E_RNA) where: Base-Base interactions energy: -455.583 where: short stacking energy: -191.445 Base-Backbone interact. energy: -2.118 local terms energy: -209.599861 where: bonds (distance) C4'-P energy: -47.990 bonds (distance) P-C4' energy: -37.746 flat angles C4'-P-C4' energy: -53.069 flat angles P-C4'-P energy: -40.682 tors. eta vs tors. theta energy: -30.114 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -623.735880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -623.735880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.085880 (E_RNA) where: Base-Base interactions energy: -357.361 where: short stacking energy: -150.674 Base-Backbone interact. energy: -0.088 local terms energy: -203.637387 where: bonds (distance) C4'-P energy: -51.348 bonds (distance) P-C4' energy: -55.090 flat angles C4'-P-C4' energy: -47.081 flat angles P-C4'-P energy: -25.371 tors. eta vs tors. theta energy: -24.748 Dist. restrs. and SS energy: -86.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -621.723817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.723817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.873817 (E_RNA) where: Base-Base interactions energy: -343.332 where: short stacking energy: -158.481 Base-Backbone interact. energy: -1.416 local terms energy: -207.125832 where: bonds (distance) C4'-P energy: -52.189 bonds (distance) P-C4' energy: -55.561 flat angles C4'-P-C4' energy: -43.594 flat angles P-C4'-P energy: -28.341 tors. eta vs tors. theta energy: -27.440 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -560.020248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.020248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.170248 (E_RNA) where: Base-Base interactions energy: -313.447 where: short stacking energy: -133.885 Base-Backbone interact. energy: 2.906 local terms energy: -188.629137 where: bonds (distance) C4'-P energy: -43.753 bonds (distance) P-C4' energy: -47.971 flat angles C4'-P-C4' energy: -50.295 flat angles P-C4'-P energy: -27.793 tors. eta vs tors. theta energy: -18.818 Dist. restrs. and SS energy: -84.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -1114.135716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1114.135716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -970.485716 (E_RNA) where: Base-Base interactions energy: -679.930 where: short stacking energy: -277.103 Base-Backbone interact. energy: -1.106 local terms energy: -289.449830 where: bonds (distance) C4'-P energy: -51.237 bonds (distance) P-C4' energy: -60.621 flat angles C4'-P-C4' energy: -74.249 flat angles P-C4'-P energy: -32.327 tors. eta vs tors. theta energy: -71.015 Dist. restrs. and SS energy: -167.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -1102.397865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.397865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -971.347865 (E_RNA) where: Base-Base interactions energy: -665.994 where: short stacking energy: -275.323 Base-Backbone interact. energy: 1.389 local terms energy: -306.742699 where: bonds (distance) C4'-P energy: -53.627 bonds (distance) P-C4' energy: -62.324 flat angles C4'-P-C4' energy: -72.232 flat angles P-C4'-P energy: -40.647 tors. eta vs tors. theta energy: -77.913 Dist. restrs. and SS energy: -154.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -941.173273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -941.173273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.123273 (E_RNA) where: Base-Base interactions energy: -601.094 where: short stacking energy: -261.387 Base-Backbone interact. energy: -0.756 local terms energy: -280.273487 where: bonds (distance) C4'-P energy: -48.187 bonds (distance) P-C4' energy: -59.887 flat angles C4'-P-C4' energy: -61.762 flat angles P-C4'-P energy: -38.822 tors. eta vs tors. theta energy: -71.616 Dist. restrs. and SS energy: -82.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -977.253799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.253799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -869.603799 (E_RNA) where: Base-Base interactions energy: -584.255 where: short stacking energy: -255.555 Base-Backbone interact. energy: -0.138 local terms energy: -285.211339 where: bonds (distance) C4'-P energy: -49.634 bonds (distance) P-C4' energy: -49.350 flat angles C4'-P-C4' energy: -63.719 flat angles P-C4'-P energy: -45.803 tors. eta vs tors. theta energy: -76.706 Dist. restrs. and SS energy: -131.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -847.944273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -847.944273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.694273 (E_RNA) where: Base-Base interactions energy: -540.404 where: short stacking energy: -231.710 Base-Backbone interact. energy: -1.497 local terms energy: -257.793147 where: bonds (distance) C4'-P energy: -47.146 bonds (distance) P-C4' energy: -53.597 flat angles C4'-P-C4' energy: -59.756 flat angles P-C4'-P energy: -33.875 tors. eta vs tors. theta energy: -63.418 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -781.930111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.930111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.280111 (E_RNA) where: Base-Base interactions energy: -454.378 where: short stacking energy: -201.324 Base-Backbone interact. energy: -1.936 local terms energy: -226.966622 where: bonds (distance) C4'-P energy: -56.603 bonds (distance) P-C4' energy: -52.096 flat angles C4'-P-C4' energy: -52.815 flat angles P-C4'-P energy: -23.636 tors. eta vs tors. theta energy: -41.816 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -747.364635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.364635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.714635 (E_RNA) where: Base-Base interactions energy: -430.281 where: short stacking energy: -182.355 Base-Backbone interact. energy: -3.449 local terms energy: -241.984679 where: bonds (distance) C4'-P energy: -53.787 bonds (distance) P-C4' energy: -56.615 flat angles C4'-P-C4' energy: -60.734 flat angles P-C4'-P energy: -29.200 tors. eta vs tors. theta energy: -41.649 Dist. restrs. and SS energy: -95.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -647.526529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.526529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.476529 (E_RNA) where: Base-Base interactions energy: -371.434 where: short stacking energy: -148.157 Base-Backbone interact. energy: -0.776 local terms energy: -207.266564 where: bonds (distance) C4'-P energy: -48.912 bonds (distance) P-C4' energy: -46.034 flat angles C4'-P-C4' energy: -48.243 flat angles P-C4'-P energy: -39.784 tors. eta vs tors. theta energy: -24.294 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -605.701595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.701595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.451595 (E_RNA) where: Base-Base interactions energy: -330.636 where: short stacking energy: -142.801 Base-Backbone interact. energy: 2.093 local terms energy: -210.907839 where: bonds (distance) C4'-P energy: -61.367 bonds (distance) P-C4' energy: -50.502 flat angles C4'-P-C4' energy: -53.538 flat angles P-C4'-P energy: -27.799 tors. eta vs tors. theta energy: -17.702 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -588.362212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.362212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.312212 (E_RNA) where: Base-Base interactions energy: -327.331 where: short stacking energy: -142.667 Base-Backbone interact. energy: -0.769 local terms energy: -192.212205 where: bonds (distance) C4'-P energy: -47.553 bonds (distance) P-C4' energy: -50.003 flat angles C4'-P-C4' energy: -45.171 flat angles P-C4'-P energy: -33.719 tors. eta vs tors. theta energy: -15.765 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -1119.497604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1119.497604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.247604 (E_RNA) where: Base-Base interactions energy: -669.297 where: short stacking energy: -258.859 Base-Backbone interact. energy: 0.462 local terms energy: -303.412069 where: bonds (distance) C4'-P energy: -57.600 bonds (distance) P-C4' energy: -64.822 flat angles C4'-P-C4' energy: -69.019 flat angles P-C4'-P energy: -40.289 tors. eta vs tors. theta energy: -71.682 Dist. restrs. and SS energy: -171.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -1076.227199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.227199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -948.777199 (E_RNA) where: Base-Base interactions energy: -653.679 where: short stacking energy: -254.214 Base-Backbone interact. energy: -1.454 local terms energy: -293.644257 where: bonds (distance) C4'-P energy: -63.332 bonds (distance) P-C4' energy: -57.421 flat angles C4'-P-C4' energy: -59.792 flat angles P-C4'-P energy: -45.993 tors. eta vs tors. theta energy: -67.106 Dist. restrs. and SS energy: -151.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -1014.221245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.221245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -904.771245 (E_RNA) where: Base-Base interactions energy: -606.299 where: short stacking energy: -286.478 Base-Backbone interact. energy: 0.093 local terms energy: -298.565256 where: bonds (distance) C4'-P energy: -48.307 bonds (distance) P-C4' energy: -67.294 flat angles C4'-P-C4' energy: -59.982 flat angles P-C4'-P energy: -40.541 tors. eta vs tors. theta energy: -82.441 Dist. restrs. and SS energy: -133.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -920.274602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.274602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -857.624602 (E_RNA) where: Base-Base interactions energy: -581.675 where: short stacking energy: -248.603 Base-Backbone interact. energy: 5.371 local terms energy: -281.320280 where: bonds (distance) C4'-P energy: -44.261 bonds (distance) P-C4' energy: -61.465 flat angles C4'-P-C4' energy: -56.686 flat angles P-C4'-P energy: -53.752 tors. eta vs tors. theta energy: -65.156 Dist. restrs. and SS energy: -86.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -865.483888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -865.483888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -817.233888 (E_RNA) where: Base-Base interactions energy: -538.607 where: short stacking energy: -233.699 Base-Backbone interact. energy: -0.462 local terms energy: -278.164668 where: bonds (distance) C4'-P energy: -56.230 bonds (distance) P-C4' energy: -53.201 flat angles C4'-P-C4' energy: -64.951 flat angles P-C4'-P energy: -41.838 tors. eta vs tors. theta energy: -61.946 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -821.415247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -821.415247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.165247 (E_RNA) where: Base-Base interactions energy: -478.598 where: short stacking energy: -211.200 Base-Backbone interact. energy: 4.956 local terms energy: -254.523137 where: bonds (distance) C4'-P energy: -48.444 bonds (distance) P-C4' energy: -61.854 flat angles C4'-P-C4' energy: -58.092 flat angles P-C4'-P energy: -37.419 tors. eta vs tors. theta energy: -48.714 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -764.185761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -764.185761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.735761 (E_RNA) where: Base-Base interactions energy: -455.990 where: short stacking energy: -180.702 Base-Backbone interact. energy: -0.243 local terms energy: -225.503164 where: bonds (distance) C4'-P energy: -55.946 bonds (distance) P-C4' energy: -49.124 flat angles C4'-P-C4' energy: -51.120 flat angles P-C4'-P energy: -30.920 tors. eta vs tors. theta energy: -38.394 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -686.467487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.467487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.217487 (E_RNA) where: Base-Base interactions energy: -420.828 where: short stacking energy: -157.261 Base-Backbone interact. energy: -1.054 local terms energy: -198.334953 where: bonds (distance) C4'-P energy: -40.413 bonds (distance) P-C4' energy: -56.401 flat angles C4'-P-C4' energy: -44.689 flat angles P-C4'-P energy: -30.881 tors. eta vs tors. theta energy: -25.951 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -590.955425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.955425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.105425 (E_RNA) where: Base-Base interactions energy: -333.809 where: short stacking energy: -140.807 Base-Backbone interact. energy: 2.663 local terms energy: -189.959322 where: bonds (distance) C4'-P energy: -51.195 bonds (distance) P-C4' energy: -51.765 flat angles C4'-P-C4' energy: -46.482 flat angles P-C4'-P energy: -21.078 tors. eta vs tors. theta energy: -19.439 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -609.698147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -609.698147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.848147 (E_RNA) where: Base-Base interactions energy: -335.453 where: short stacking energy: -141.840 Base-Backbone interact. energy: 1.396 local terms energy: -205.790635 where: bonds (distance) C4'-P energy: -47.817 bonds (distance) P-C4' energy: -58.152 flat angles C4'-P-C4' energy: -42.601 flat angles P-C4'-P energy: -35.173 tors. eta vs tors. theta energy: -22.047 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -1136.464961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1136.464961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -985.614961 (E_RNA) where: Base-Base interactions energy: -686.823 where: short stacking energy: -284.890 Base-Backbone interact. energy: 4.702 local terms energy: -303.493881 where: bonds (distance) C4'-P energy: -55.649 bonds (distance) P-C4' energy: -62.036 flat angles C4'-P-C4' energy: -67.829 flat angles P-C4'-P energy: -49.497 tors. eta vs tors. theta energy: -68.484 Dist. restrs. and SS energy: -174.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -1087.938079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.938079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.888079 (E_RNA) where: Base-Base interactions energy: -658.194 where: short stacking energy: -265.137 Base-Backbone interact. energy: -2.402 local terms energy: -296.292318 where: bonds (distance) C4'-P energy: -57.906 bonds (distance) P-C4' energy: -64.096 flat angles C4'-P-C4' energy: -66.259 flat angles P-C4'-P energy: -37.656 tors. eta vs tors. theta energy: -70.375 Dist. restrs. and SS energy: -154.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -985.492846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.492846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.042846 (E_RNA) where: Base-Base interactions energy: -580.486 where: short stacking energy: -256.437 Base-Backbone interact. energy: 0.733 local terms energy: -296.289631 where: bonds (distance) C4'-P energy: -49.632 bonds (distance) P-C4' energy: -48.776 flat angles C4'-P-C4' energy: -73.556 flat angles P-C4'-P energy: -50.702 tors. eta vs tors. theta energy: -73.623 Dist. restrs. and SS energy: -133.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -899.360119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -899.360119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -852.910119 (E_RNA) where: Base-Base interactions energy: -576.513 where: short stacking energy: -238.957 Base-Backbone interact. energy: -1.723 local terms energy: -274.673536 where: bonds (distance) C4'-P energy: -52.778 bonds (distance) P-C4' energy: -60.913 flat angles C4'-P-C4' energy: -64.028 flat angles P-C4'-P energy: -39.509 tors. eta vs tors. theta energy: -57.446 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -877.118003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.118003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -816.268003 (E_RNA) where: Base-Base interactions energy: -561.514 where: short stacking energy: -246.289 Base-Backbone interact. energy: 0.110 local terms energy: -254.863691 where: bonds (distance) C4'-P energy: -42.098 bonds (distance) P-C4' energy: -52.813 flat angles C4'-P-C4' energy: -63.283 flat angles P-C4'-P energy: -39.482 tors. eta vs tors. theta energy: -57.188 Dist. restrs. and SS energy: -84.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -805.976280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -805.976280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.326280 (E_RNA) where: Base-Base interactions energy: -461.035 where: short stacking energy: -201.674 Base-Backbone interact. energy: -1.159 local terms energy: -245.131640 where: bonds (distance) C4'-P energy: -46.625 bonds (distance) P-C4' energy: -60.252 flat angles C4'-P-C4' energy: -52.736 flat angles P-C4'-P energy: -39.835 tors. eta vs tors. theta energy: -45.684 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -771.892292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.892292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.842292 (E_RNA) where: Base-Base interactions energy: -464.865 where: short stacking energy: -189.688 Base-Backbone interact. energy: -0.351 local terms energy: -220.626685 where: bonds (distance) C4'-P energy: -43.452 bonds (distance) P-C4' energy: -56.637 flat angles C4'-P-C4' energy: -50.060 flat angles P-C4'-P energy: -33.760 tors. eta vs tors. theta energy: -36.718 Dist. restrs. and SS energy: -109.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -693.320493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.320493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -625.270493 (E_RNA) where: Base-Base interactions energy: -415.498 where: short stacking energy: -173.835 Base-Backbone interact. energy: 0.983 local terms energy: -210.755269 where: bonds (distance) C4'-P energy: -47.636 bonds (distance) P-C4' energy: -51.870 flat angles C4'-P-C4' energy: -40.340 flat angles P-C4'-P energy: -37.814 tors. eta vs tors. theta energy: -33.096 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -613.133782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.133782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.083782 (E_RNA) where: Base-Base interactions energy: -329.181 where: short stacking energy: -142.867 Base-Backbone interact. energy: -1.023 local terms energy: -214.878877 where: bonds (distance) C4'-P energy: -47.401 bonds (distance) P-C4' energy: -55.307 flat angles C4'-P-C4' energy: -56.155 flat angles P-C4'-P energy: -29.790 tors. eta vs tors. theta energy: -26.225 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -618.547028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.547028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.697028 (E_RNA) where: Base-Base interactions energy: -353.573 where: short stacking energy: -157.622 Base-Backbone interact. energy: 3.314 local terms energy: -198.437963 where: bonds (distance) C4'-P energy: -42.749 bonds (distance) P-C4' energy: -33.140 flat angles C4'-P-C4' energy: -61.122 flat angles P-C4'-P energy: -40.353 tors. eta vs tors. theta energy: -21.074 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -1146.772554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1146.772554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -992.322554 (E_RNA) where: Base-Base interactions energy: -676.991 where: short stacking energy: -280.838 Base-Backbone interact. energy: -1.048 local terms energy: -314.283394 where: bonds (distance) C4'-P energy: -63.288 bonds (distance) P-C4' energy: -55.829 flat angles C4'-P-C4' energy: -69.566 flat angles P-C4'-P energy: -53.475 tors. eta vs tors. theta energy: -72.125 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -1083.809537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.809537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.759537 (E_RNA) where: Base-Base interactions energy: -644.659 where: short stacking energy: -255.469 Base-Backbone interact. energy: -0.880 local terms energy: -307.220864 where: bonds (distance) C4'-P energy: -53.743 bonds (distance) P-C4' energy: -63.639 flat angles C4'-P-C4' energy: -65.853 flat angles P-C4'-P energy: -47.430 tors. eta vs tors. theta energy: -76.556 Dist. restrs. and SS energy: -154.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -997.675196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.675196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.025196 (E_RNA) where: Base-Base interactions energy: -589.275 where: short stacking energy: -243.059 Base-Backbone interact. energy: -3.272 local terms energy: -288.478398 where: bonds (distance) C4'-P energy: -60.459 bonds (distance) P-C4' energy: -66.637 flat angles C4'-P-C4' energy: -62.597 flat angles P-C4'-P energy: -34.761 tors. eta vs tors. theta energy: -64.025 Dist. restrs. and SS energy: -140.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -908.436414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -908.436414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.186414 (E_RNA) where: Base-Base interactions energy: -564.376 where: short stacking energy: -247.472 Base-Backbone interact. energy: -0.654 local terms energy: -295.156820 where: bonds (distance) C4'-P energy: -56.624 bonds (distance) P-C4' energy: -64.429 flat angles C4'-P-C4' energy: -66.563 flat angles P-C4'-P energy: -33.940 tors. eta vs tors. theta energy: -73.601 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -867.298821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -867.298821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -802.848821 (E_RNA) where: Base-Base interactions energy: -543.430 where: short stacking energy: -232.648 Base-Backbone interact. energy: -0.900 local terms energy: -258.519070 where: bonds (distance) C4'-P energy: -48.233 bonds (distance) P-C4' energy: -61.949 flat angles C4'-P-C4' energy: -59.246 flat angles P-C4'-P energy: -32.295 tors. eta vs tors. theta energy: -56.796 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -828.991947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -828.991947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -733.941947 (E_RNA) where: Base-Base interactions energy: -486.081 where: short stacking energy: -214.667 Base-Backbone interact. energy: 1.759 local terms energy: -249.619986 where: bonds (distance) C4'-P energy: -59.681 bonds (distance) P-C4' energy: -49.487 flat angles C4'-P-C4' energy: -61.754 flat angles P-C4'-P energy: -19.102 tors. eta vs tors. theta energy: -59.596 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -736.667050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.667050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.617050 (E_RNA) where: Base-Base interactions energy: -419.628 where: short stacking energy: -181.599 Base-Backbone interact. energy: 4.764 local terms energy: -244.752521 where: bonds (distance) C4'-P energy: -60.486 bonds (distance) P-C4' energy: -46.335 flat angles C4'-P-C4' energy: -61.750 flat angles P-C4'-P energy: -34.662 tors. eta vs tors. theta energy: -41.519 Dist. restrs. and SS energy: -100.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -667.057664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.057664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.007664 (E_RNA) where: Base-Base interactions energy: -376.579 where: short stacking energy: -160.518 Base-Backbone interact. energy: -0.354 local terms energy: -222.075367 where: bonds (distance) C4'-P energy: -43.800 bonds (distance) P-C4' energy: -53.063 flat angles C4'-P-C4' energy: -61.001 flat angles P-C4'-P energy: -36.081 tors. eta vs tors. theta energy: -28.130 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -634.483241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -634.483241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.433241 (E_RNA) where: Base-Base interactions energy: -357.763 where: short stacking energy: -158.562 Base-Backbone interact. energy: -1.797 local terms energy: -206.873842 where: bonds (distance) C4'-P energy: -40.759 bonds (distance) P-C4' energy: -61.279 flat angles C4'-P-C4' energy: -47.641 flat angles P-C4'-P energy: -32.271 tors. eta vs tors. theta energy: -24.925 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -593.529102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.529102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.479102 (E_RNA) where: Base-Base interactions energy: -335.152 where: short stacking energy: -131.983 Base-Backbone interact. energy: -1.714 local terms energy: -188.613007 where: bonds (distance) C4'-P energy: -47.385 bonds (distance) P-C4' energy: -54.156 flat angles C4'-P-C4' energy: -39.737 flat angles P-C4'-P energy: -27.115 tors. eta vs tors. theta energy: -20.221 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -1192.643990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1192.643990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.193990 (E_RNA) where: Base-Base interactions energy: -715.302 where: short stacking energy: -282.953 Base-Backbone interact. energy: -3.303 local terms energy: -319.589021 where: bonds (distance) C4'-P energy: -60.963 bonds (distance) P-C4' energy: -67.690 flat angles C4'-P-C4' energy: -68.400 flat angles P-C4'-P energy: -50.239 tors. eta vs tors. theta energy: -72.297 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -1096.260270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.260270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.010270 (E_RNA) where: Base-Base interactions energy: -661.169 where: short stacking energy: -272.632 Base-Backbone interact. energy: -0.735 local terms energy: -296.106131 where: bonds (distance) C4'-P energy: -59.098 bonds (distance) P-C4' energy: -54.220 flat angles C4'-P-C4' energy: -61.038 flat angles P-C4'-P energy: -46.854 tors. eta vs tors. theta energy: -74.897 Dist. restrs. and SS energy: -162.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -1005.059712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.059712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -875.809712 (E_RNA) where: Base-Base interactions energy: -593.971 where: short stacking energy: -248.083 Base-Backbone interact. energy: -1.074 local terms energy: -280.765013 where: bonds (distance) C4'-P energy: -51.973 bonds (distance) P-C4' energy: -62.357 flat angles C4'-P-C4' energy: -57.975 flat angles P-C4'-P energy: -44.551 tors. eta vs tors. theta energy: -63.908 Dist. restrs. and SS energy: -153.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -912.875965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -912.875965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.825965 (E_RNA) where: Base-Base interactions energy: -567.883 where: short stacking energy: -244.726 Base-Backbone interact. energy: 1.266 local terms energy: -287.209370 where: bonds (distance) C4'-P energy: -54.251 bonds (distance) P-C4' energy: -52.000 flat angles C4'-P-C4' energy: -66.016 flat angles P-C4'-P energy: -48.396 tors. eta vs tors. theta energy: -66.547 Dist. restrs. and SS energy: -82.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -877.349310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.349310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.099310 (E_RNA) where: Base-Base interactions energy: -558.230 where: short stacking energy: -252.190 Base-Backbone interact. energy: 4.933 local terms energy: -275.802195 where: bonds (distance) C4'-P energy: -59.796 bonds (distance) P-C4' energy: -51.949 flat angles C4'-P-C4' energy: -61.760 flat angles P-C4'-P energy: -40.995 tors. eta vs tors. theta energy: -61.303 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -869.352925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.352925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.702925 (E_RNA) where: Base-Base interactions energy: -500.902 where: short stacking energy: -219.447 Base-Backbone interact. energy: 0.704 local terms energy: -270.505093 where: bonds (distance) C4'-P energy: -51.290 bonds (distance) P-C4' energy: -45.025 flat angles C4'-P-C4' energy: -66.285 flat angles P-C4'-P energy: -42.996 tors. eta vs tors. theta energy: -64.909 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -760.170926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -760.170926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.120926 (E_RNA) where: Base-Base interactions energy: -463.044 where: short stacking energy: -166.338 Base-Backbone interact. energy: 0.392 local terms energy: -202.468676 where: bonds (distance) C4'-P energy: -45.452 bonds (distance) P-C4' energy: -46.269 flat angles C4'-P-C4' energy: -48.601 flat angles P-C4'-P energy: -41.053 tors. eta vs tors. theta energy: -21.094 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -650.739284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.739284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.689284 (E_RNA) where: Base-Base interactions energy: -384.500 where: short stacking energy: -170.600 Base-Backbone interact. energy: -1.476 local terms energy: -196.713010 where: bonds (distance) C4'-P energy: -45.841 bonds (distance) P-C4' energy: -53.651 flat angles C4'-P-C4' energy: -48.496 flat angles P-C4'-P energy: -19.811 tors. eta vs tors. theta energy: -28.913 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -713.909712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.909712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.059712 (E_RNA) where: Base-Base interactions energy: -416.009 where: short stacking energy: -171.490 Base-Backbone interact. energy: -0.559 local terms energy: -227.491479 where: bonds (distance) C4'-P energy: -47.967 bonds (distance) P-C4' energy: -46.761 flat angles C4'-P-C4' energy: -57.076 flat angles P-C4'-P energy: -39.721 tors. eta vs tors. theta energy: -35.967 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -569.881672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.881672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.031672 (E_RNA) where: Base-Base interactions energy: -322.778 where: short stacking energy: -137.580 Base-Backbone interact. energy: -1.877 local terms energy: -175.376589 where: bonds (distance) C4'-P energy: -42.331 bonds (distance) P-C4' energy: -45.246 flat angles C4'-P-C4' energy: -41.044 flat angles P-C4'-P energy: -36.654 tors. eta vs tors. theta energy: -10.102 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -1183.779611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1183.779611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1027.529611 (E_RNA) where: Base-Base interactions energy: -726.360 where: short stacking energy: -291.736 Base-Backbone interact. energy: -2.679 local terms energy: -298.490273 where: bonds (distance) C4'-P energy: -64.212 bonds (distance) P-C4' energy: -61.950 flat angles C4'-P-C4' energy: -58.348 flat angles P-C4'-P energy: -45.269 tors. eta vs tors. theta energy: -68.711 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -1085.256478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.256478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -954.206478 (E_RNA) where: Base-Base interactions energy: -671.112 where: short stacking energy: -277.374 Base-Backbone interact. energy: 1.731 local terms energy: -284.825278 where: bonds (distance) C4'-P energy: -55.553 bonds (distance) P-C4' energy: -52.935 flat angles C4'-P-C4' energy: -64.077 flat angles P-C4'-P energy: -40.872 tors. eta vs tors. theta energy: -71.388 Dist. restrs. and SS energy: -154.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -1047.069264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.069264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.019264 (E_RNA) where: Base-Base interactions energy: -620.946 where: short stacking energy: -249.927 Base-Backbone interact. energy: 1.532 local terms energy: -287.605288 where: bonds (distance) C4'-P energy: -59.964 bonds (distance) P-C4' energy: -61.774 flat angles C4'-P-C4' energy: -63.452 flat angles P-C4'-P energy: -35.325 tors. eta vs tors. theta energy: -67.091 Dist. restrs. and SS energy: -163.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -923.060123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -923.060123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -864.010123 (E_RNA) where: Base-Base interactions energy: -608.727 where: short stacking energy: -246.374 Base-Backbone interact. energy: -1.624 local terms energy: -253.658349 where: bonds (distance) C4'-P energy: -55.124 bonds (distance) P-C4' energy: -53.845 flat angles C4'-P-C4' energy: -65.679 flat angles P-C4'-P energy: -25.512 tors. eta vs tors. theta energy: -53.498 Dist. restrs. and SS energy: -82.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -893.019632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.019632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.769632 (E_RNA) where: Base-Base interactions energy: -538.127 where: short stacking energy: -229.761 Base-Backbone interact. energy: -1.589 local terms energy: -260.053252 where: bonds (distance) C4'-P energy: -46.889 bonds (distance) P-C4' energy: -47.250 flat angles C4'-P-C4' energy: -57.155 flat angles P-C4'-P energy: -50.909 tors. eta vs tors. theta energy: -57.851 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -836.941207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.941207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.691207 (E_RNA) where: Base-Base interactions energy: -541.593 where: short stacking energy: -230.899 Base-Backbone interact. energy: -0.670 local terms energy: -246.428156 where: bonds (distance) C4'-P energy: -48.375 bonds (distance) P-C4' energy: -58.296 flat angles C4'-P-C4' energy: -57.818 flat angles P-C4'-P energy: -28.651 tors. eta vs tors. theta energy: -53.288 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -772.714357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.714357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.664357 (E_RNA) where: Base-Base interactions energy: -434.627 where: short stacking energy: -174.638 Base-Backbone interact. energy: -1.938 local terms energy: -241.099327 where: bonds (distance) C4'-P energy: -49.858 bonds (distance) P-C4' energy: -51.139 flat angles C4'-P-C4' energy: -64.452 flat angles P-C4'-P energy: -34.607 tors. eta vs tors. theta energy: -41.043 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -654.261848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.261848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.411848 (E_RNA) where: Base-Base interactions energy: -364.470 where: short stacking energy: -152.110 Base-Backbone interact. energy: -1.742 local terms energy: -218.200044 where: bonds (distance) C4'-P energy: -56.465 bonds (distance) P-C4' energy: -51.612 flat angles C4'-P-C4' energy: -55.111 flat angles P-C4'-P energy: -39.718 tors. eta vs tors. theta energy: -15.295 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -660.959250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.959250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.309250 (E_RNA) where: Base-Base interactions energy: -386.448 where: short stacking energy: -155.837 Base-Backbone interact. energy: 1.958 local terms energy: -213.820039 where: bonds (distance) C4'-P energy: -42.905 bonds (distance) P-C4' energy: -67.866 flat angles C4'-P-C4' energy: -56.797 flat angles P-C4'-P energy: -25.310 tors. eta vs tors. theta energy: -20.942 Dist. restrs. and SS energy: -86.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -563.281671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.281671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.431671 (E_RNA) where: Base-Base interactions energy: -304.246 where: short stacking energy: -124.207 Base-Backbone interact. energy: 3.682 local terms energy: -192.868438 where: bonds (distance) C4'-P energy: -56.242 bonds (distance) P-C4' energy: -54.320 flat angles C4'-P-C4' energy: -39.539 flat angles P-C4'-P energy: -24.084 tors. eta vs tors. theta energy: -18.683 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -1177.901494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1177.901494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.651494 (E_RNA) where: Base-Base interactions energy: -727.416 where: short stacking energy: -299.723 Base-Backbone interact. energy: -2.331 local terms energy: -291.905088 where: bonds (distance) C4'-P energy: -58.832 bonds (distance) P-C4' energy: -49.662 flat angles C4'-P-C4' energy: -71.137 flat angles P-C4'-P energy: -38.945 tors. eta vs tors. theta energy: -73.328 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -1091.286145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.286145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.636145 (E_RNA) where: Base-Base interactions energy: -645.613 where: short stacking energy: -260.246 Base-Backbone interact. energy: -1.331 local terms energy: -309.692568 where: bonds (distance) C4'-P energy: -61.930 bonds (distance) P-C4' energy: -62.868 flat angles C4'-P-C4' energy: -73.305 flat angles P-C4'-P energy: -40.024 tors. eta vs tors. theta energy: -71.565 Dist. restrs. and SS energy: -158.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -1036.974200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1036.974200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -904.124200 (E_RNA) where: Base-Base interactions energy: -633.182 where: short stacking energy: -250.536 Base-Backbone interact. energy: -1.943 local terms energy: -268.999123 where: bonds (distance) C4'-P energy: -47.058 bonds (distance) P-C4' energy: -63.735 flat angles C4'-P-C4' energy: -61.274 flat angles P-C4'-P energy: -29.467 tors. eta vs tors. theta energy: -67.466 Dist. restrs. and SS energy: -156.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -921.079747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.079747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.229747 (E_RNA) where: Base-Base interactions energy: -589.597 where: short stacking energy: -249.029 Base-Backbone interact. energy: -0.713 local terms energy: -269.920393 where: bonds (distance) C4'-P energy: -55.595 bonds (distance) P-C4' energy: -50.880 flat angles C4'-P-C4' energy: -58.466 flat angles P-C4'-P energy: -40.337 tors. eta vs tors. theta energy: -64.643 Dist. restrs. and SS energy: -84.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -879.840781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.840781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.590781 (E_RNA) where: Base-Base interactions energy: -530.468 where: short stacking energy: -224.707 Base-Backbone interact. energy: -3.629 local terms energy: -252.493969 where: bonds (distance) C4'-P energy: -55.917 bonds (distance) P-C4' energy: -53.942 flat angles C4'-P-C4' energy: -58.638 flat angles P-C4'-P energy: -34.675 tors. eta vs tors. theta energy: -49.322 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -829.982414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.982414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.332414 (E_RNA) where: Base-Base interactions energy: -517.688 where: short stacking energy: -219.338 Base-Backbone interact. energy: 0.958 local terms energy: -268.602127 where: bonds (distance) C4'-P energy: -52.074 bonds (distance) P-C4' energy: -53.223 flat angles C4'-P-C4' energy: -62.957 flat angles P-C4'-P energy: -35.713 tors. eta vs tors. theta energy: -64.635 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -775.620936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.620936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.770936 (E_RNA) where: Base-Base interactions energy: -462.878 where: short stacking energy: -194.619 Base-Backbone interact. energy: 2.552 local terms energy: -218.444658 where: bonds (distance) C4'-P energy: -56.210 bonds (distance) P-C4' energy: -50.563 flat angles C4'-P-C4' energy: -47.757 flat angles P-C4'-P energy: -28.902 tors. eta vs tors. theta energy: -35.012 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -681.549155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.549155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.499155 (E_RNA) where: Base-Base interactions energy: -386.603 where: short stacking energy: -167.254 Base-Backbone interact. energy: -1.014 local terms energy: -225.881727 where: bonds (distance) C4'-P energy: -48.321 bonds (distance) P-C4' energy: -45.466 flat angles C4'-P-C4' energy: -56.514 flat angles P-C4'-P energy: -41.737 tors. eta vs tors. theta energy: -33.844 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -636.820689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.820689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.970689 (E_RNA) where: Base-Base interactions energy: -357.471 where: short stacking energy: -167.376 Base-Backbone interact. energy: 0.584 local terms energy: -210.083158 where: bonds (distance) C4'-P energy: -50.022 bonds (distance) P-C4' energy: -50.737 flat angles C4'-P-C4' energy: -48.305 flat angles P-C4'-P energy: -27.802 tors. eta vs tors. theta energy: -33.217 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -579.900170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.900170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.850170 (E_RNA) where: Base-Base interactions energy: -314.187 where: short stacking energy: -128.891 Base-Backbone interact. energy: -2.752 local terms energy: -194.911531 where: bonds (distance) C4'-P energy: -53.206 bonds (distance) P-C4' energy: -59.506 flat angles C4'-P-C4' energy: -36.553 flat angles P-C4'-P energy: -28.820 tors. eta vs tors. theta energy: -16.827 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -1165.355086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1165.355086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1010.905086 (E_RNA) where: Base-Base interactions energy: -694.237 where: short stacking energy: -272.888 Base-Backbone interact. energy: -1.158 local terms energy: -315.510096 where: bonds (distance) C4'-P energy: -58.899 bonds (distance) P-C4' energy: -67.349 flat angles C4'-P-C4' energy: -67.746 flat angles P-C4'-P energy: -46.398 tors. eta vs tors. theta energy: -75.118 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -1075.156148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1075.156148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -936.906148 (E_RNA) where: Base-Base interactions energy: -629.175 where: short stacking energy: -270.466 Base-Backbone interact. energy: -2.694 local terms energy: -305.037520 where: bonds (distance) C4'-P energy: -62.064 bonds (distance) P-C4' energy: -64.753 flat angles C4'-P-C4' energy: -63.562 flat angles P-C4'-P energy: -44.588 tors. eta vs tors. theta energy: -70.072 Dist. restrs. and SS energy: -162.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -1045.633248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.633248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.383248 (E_RNA) where: Base-Base interactions energy: -631.048 where: short stacking energy: -262.190 Base-Backbone interact. energy: -1.868 local terms energy: -274.468100 where: bonds (distance) C4'-P energy: -52.649 bonds (distance) P-C4' energy: -49.603 flat angles C4'-P-C4' energy: -60.837 flat angles P-C4'-P energy: -39.387 tors. eta vs tors. theta energy: -71.992 Dist. restrs. and SS energy: -162.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -909.094658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -909.094658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -844.644658 (E_RNA) where: Base-Base interactions energy: -568.527 where: short stacking energy: -243.729 Base-Backbone interact. energy: -2.295 local terms energy: -273.822662 where: bonds (distance) C4'-P energy: -56.041 bonds (distance) P-C4' energy: -52.850 flat angles C4'-P-C4' energy: -56.792 flat angles P-C4'-P energy: -43.551 tors. eta vs tors. theta energy: -64.588 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -880.393415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.393415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.943415 (E_RNA) where: Base-Base interactions energy: -515.995 where: short stacking energy: -205.420 Base-Backbone interact. energy: 2.169 local terms energy: -257.117830 where: bonds (distance) C4'-P energy: -53.671 bonds (distance) P-C4' energy: -62.103 flat angles C4'-P-C4' energy: -45.447 flat angles P-C4'-P energy: -45.814 tors. eta vs tors. theta energy: -50.083 Dist. restrs. and SS energy: -133.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -831.285238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.285238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.635238 (E_RNA) where: Base-Base interactions energy: -527.217 where: short stacking energy: -236.233 Base-Backbone interact. energy: -2.444 local terms energy: -256.973789 where: bonds (distance) C4'-P energy: -47.157 bonds (distance) P-C4' energy: -54.378 flat angles C4'-P-C4' energy: -60.577 flat angles P-C4'-P energy: -29.058 tors. eta vs tors. theta energy: -65.803 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -840.843828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.843828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -742.193828 (E_RNA) where: Base-Base interactions energy: -499.731 where: short stacking energy: -213.213 Base-Backbone interact. energy: 0.766 local terms energy: -243.229284 where: bonds (distance) C4'-P energy: -52.073 bonds (distance) P-C4' energy: -51.655 flat angles C4'-P-C4' energy: -55.986 flat angles P-C4'-P energy: -35.453 tors. eta vs tors. theta energy: -48.061 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -695.308978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.308978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -627.258978 (E_RNA) where: Base-Base interactions energy: -414.216 where: short stacking energy: -167.356 Base-Backbone interact. energy: -1.412 local terms energy: -211.631202 where: bonds (distance) C4'-P energy: -50.644 bonds (distance) P-C4' energy: -60.083 flat angles C4'-P-C4' energy: -44.777 flat angles P-C4'-P energy: -22.588 tors. eta vs tors. theta energy: -33.539 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -656.295600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.295600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.445600 (E_RNA) where: Base-Base interactions energy: -377.248 where: short stacking energy: -163.026 Base-Backbone interact. energy: -0.904 local terms energy: -217.294425 where: bonds (distance) C4'-P energy: -55.469 bonds (distance) P-C4' energy: -52.600 flat angles C4'-P-C4' energy: -42.745 flat angles P-C4'-P energy: -33.005 tors. eta vs tors. theta energy: -33.475 Dist. restrs. and SS energy: -84.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -573.972894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.972894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.922894 (E_RNA) where: Base-Base interactions energy: -336.951 where: short stacking energy: -153.631 Base-Backbone interact. energy: -0.735 local terms energy: -168.237363 where: bonds (distance) C4'-P energy: -34.576 bonds (distance) P-C4' energy: -59.254 flat angles C4'-P-C4' energy: -39.238 flat angles P-C4'-P energy: -23.708 tors. eta vs tors. theta energy: -11.462 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -1164.501767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1164.501767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.851767 (E_RNA) where: Base-Base interactions energy: -731.252 where: short stacking energy: -290.680 Base-Backbone interact. energy: -2.494 local terms energy: -278.105673 where: bonds (distance) C4'-P energy: -39.913 bonds (distance) P-C4' energy: -59.191 flat angles C4'-P-C4' energy: -63.181 flat angles P-C4'-P energy: -40.055 tors. eta vs tors. theta energy: -75.766 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -1069.170868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.170868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.920868 (E_RNA) where: Base-Base interactions energy: -625.125 where: short stacking energy: -272.546 Base-Backbone interact. energy: -2.769 local terms energy: -303.027465 where: bonds (distance) C4'-P energy: -65.499 bonds (distance) P-C4' energy: -55.854 flat angles C4'-P-C4' energy: -69.405 flat angles P-C4'-P energy: -38.939 tors. eta vs tors. theta energy: -73.330 Dist. restrs. and SS energy: -162.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -1046.986281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1046.986281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -912.336281 (E_RNA) where: Base-Base interactions energy: -638.787 where: short stacking energy: -263.806 Base-Backbone interact. energy: -0.292 local terms energy: -273.257693 where: bonds (distance) C4'-P energy: -48.892 bonds (distance) P-C4' energy: -53.938 flat angles C4'-P-C4' energy: -65.487 flat angles P-C4'-P energy: -39.042 tors. eta vs tors. theta energy: -65.898 Dist. restrs. and SS energy: -158.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -897.925947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.925947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.475947 (E_RNA) where: Base-Base interactions energy: -582.240 where: short stacking energy: -243.453 Base-Backbone interact. energy: -0.890 local terms energy: -250.346299 where: bonds (distance) C4'-P energy: -49.961 bonds (distance) P-C4' energy: -56.455 flat angles C4'-P-C4' energy: -53.925 flat angles P-C4'-P energy: -38.912 tors. eta vs tors. theta energy: -51.094 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -877.221593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.221593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.371593 (E_RNA) where: Base-Base interactions energy: -517.934 where: short stacking energy: -220.113 Base-Backbone interact. energy: -0.944 local terms energy: -261.492941 where: bonds (distance) C4'-P energy: -54.972 bonds (distance) P-C4' energy: -59.633 flat angles C4'-P-C4' energy: -59.641 flat angles P-C4'-P energy: -32.539 tors. eta vs tors. theta energy: -54.708 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -826.901642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.901642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.251642 (E_RNA) where: Base-Base interactions energy: -504.893 where: short stacking energy: -217.004 Base-Backbone interact. energy: 0.439 local terms energy: -277.797615 where: bonds (distance) C4'-P energy: -57.567 bonds (distance) P-C4' energy: -47.677 flat angles C4'-P-C4' energy: -60.970 flat angles P-C4'-P energy: -43.356 tors. eta vs tors. theta energy: -68.227 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -826.122543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.122543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.072543 (E_RNA) where: Base-Base interactions energy: -494.301 where: short stacking energy: -200.579 Base-Backbone interact. energy: 2.236 local terms energy: -239.007720 where: bonds (distance) C4'-P energy: -49.448 bonds (distance) P-C4' energy: -55.556 flat angles C4'-P-C4' energy: -59.657 flat angles P-C4'-P energy: -31.860 tors. eta vs tors. theta energy: -42.488 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -701.305929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.305929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.255929 (E_RNA) where: Base-Base interactions energy: -396.164 where: short stacking energy: -177.838 Base-Backbone interact. energy: -1.115 local terms energy: -235.977234 where: bonds (distance) C4'-P energy: -51.098 bonds (distance) P-C4' energy: -51.261 flat angles C4'-P-C4' energy: -58.900 flat angles P-C4'-P energy: -36.150 tors. eta vs tors. theta energy: -38.569 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -609.615699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -609.615699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.765699 (E_RNA) where: Base-Base interactions energy: -339.421 where: short stacking energy: -151.787 Base-Backbone interact. energy: -1.813 local terms energy: -198.532275 where: bonds (distance) C4'-P energy: -48.083 bonds (distance) P-C4' energy: -52.613 flat angles C4'-P-C4' energy: -42.635 flat angles P-C4'-P energy: -28.271 tors. eta vs tors. theta energy: -26.930 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -575.221868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.221868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.171868 (E_RNA) where: Base-Base interactions energy: -309.331 where: short stacking energy: -123.336 Base-Backbone interact. energy: 1.045 local terms energy: -198.886195 where: bonds (distance) C4'-P energy: -48.505 bonds (distance) P-C4' energy: -58.203 flat angles C4'-P-C4' energy: -44.448 flat angles P-C4'-P energy: -28.978 tors. eta vs tors. theta energy: -18.752 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -1160.447942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1160.447942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1005.997942 (E_RNA) where: Base-Base interactions energy: -674.974 where: short stacking energy: -276.287 Base-Backbone interact. energy: -1.328 local terms energy: -329.695748 where: bonds (distance) C4'-P energy: -64.784 bonds (distance) P-C4' energy: -67.625 flat angles C4'-P-C4' energy: -73.315 flat angles P-C4'-P energy: -49.698 tors. eta vs tors. theta energy: -74.274 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -1074.304207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1074.304207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.854207 (E_RNA) where: Base-Base interactions energy: -645.251 where: short stacking energy: -260.407 Base-Backbone interact. energy: -1.410 local terms energy: -291.193452 where: bonds (distance) C4'-P energy: -59.087 bonds (distance) P-C4' energy: -62.557 flat angles C4'-P-C4' energy: -60.064 flat angles P-C4'-P energy: -40.607 tors. eta vs tors. theta energy: -68.878 Dist. restrs. and SS energy: -160.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -1093.455599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1093.455599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.405599 (E_RNA) where: Base-Base interactions energy: -643.832 where: short stacking energy: -263.239 Base-Backbone interact. energy: -2.719 local terms energy: -306.854422 where: bonds (distance) C4'-P energy: -63.189 bonds (distance) P-C4' energy: -63.385 flat angles C4'-P-C4' energy: -62.711 flat angles P-C4'-P energy: -48.540 tors. eta vs tors. theta energy: -69.029 Dist. restrs. and SS energy: -163.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -926.286938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -926.286938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -863.636938 (E_RNA) where: Base-Base interactions energy: -568.785 where: short stacking energy: -235.082 Base-Backbone interact. energy: -1.039 local terms energy: -293.812460 where: bonds (distance) C4'-P energy: -56.308 bonds (distance) P-C4' energy: -67.772 flat angles C4'-P-C4' energy: -69.629 flat angles P-C4'-P energy: -42.792 tors. eta vs tors. theta energy: -57.312 Dist. restrs. and SS energy: -86.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -893.377696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.377696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.727696 (E_RNA) where: Base-Base interactions energy: -520.199 where: short stacking energy: -240.533 Base-Backbone interact. energy: -2.844 local terms energy: -271.684681 where: bonds (distance) C4'-P energy: -52.828 bonds (distance) P-C4' energy: -63.625 flat angles C4'-P-C4' energy: -60.599 flat angles P-C4'-P energy: -35.732 tors. eta vs tors. theta energy: -58.900 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -798.110322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.110322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.860322 (E_RNA) where: Base-Base interactions energy: -513.706 where: short stacking energy: -210.846 Base-Backbone interact. energy: -0.065 local terms energy: -236.088987 where: bonds (distance) C4'-P energy: -60.279 bonds (distance) P-C4' energy: -41.372 flat angles C4'-P-C4' energy: -53.049 flat angles P-C4'-P energy: -29.818 tors. eta vs tors. theta energy: -51.571 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -861.545415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -861.545415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.295415 (E_RNA) where: Base-Base interactions energy: -520.820 where: short stacking energy: -235.164 Base-Backbone interact. energy: 1.641 local terms energy: -249.115811 where: bonds (distance) C4'-P energy: -37.667 bonds (distance) P-C4' energy: -46.132 flat angles C4'-P-C4' energy: -61.315 flat angles P-C4'-P energy: -42.414 tors. eta vs tors. theta energy: -61.588 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -664.097231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.097231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.847231 (E_RNA) where: Base-Base interactions energy: -365.803 where: short stacking energy: -168.920 Base-Backbone interact. energy: -0.496 local terms energy: -231.547825 where: bonds (distance) C4'-P energy: -54.847 bonds (distance) P-C4' energy: -60.821 flat angles C4'-P-C4' energy: -55.549 flat angles P-C4'-P energy: -25.420 tors. eta vs tors. theta energy: -34.910 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -617.530485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -617.530485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.480485 (E_RNA) where: Base-Base interactions energy: -345.866 where: short stacking energy: -131.282 Base-Backbone interact. energy: 1.424 local terms energy: -205.038560 where: bonds (distance) C4'-P energy: -54.977 bonds (distance) P-C4' energy: -58.994 flat angles C4'-P-C4' energy: -47.480 flat angles P-C4'-P energy: -22.594 tors. eta vs tors. theta energy: -20.994 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -578.159858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.159858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.309858 (E_RNA) where: Base-Base interactions energy: -318.941 where: short stacking energy: -130.065 Base-Backbone interact. energy: -3.879 local terms energy: -185.489792 where: bonds (distance) C4'-P energy: -40.377 bonds (distance) P-C4' energy: -56.922 flat angles C4'-P-C4' energy: -43.785 flat angles P-C4'-P energy: -35.174 tors. eta vs tors. theta energy: -9.231 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -1180.313879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1180.313879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.463879 (E_RNA) where: Base-Base interactions energy: -712.650 where: short stacking energy: -316.489 Base-Backbone interact. energy: 0.056 local terms energy: -307.869536 where: bonds (distance) C4'-P energy: -55.870 bonds (distance) P-C4' energy: -60.651 flat angles C4'-P-C4' energy: -68.278 flat angles P-C4'-P energy: -38.424 tors. eta vs tors. theta energy: -84.647 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -1061.848077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.848077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.798077 (E_RNA) where: Base-Base interactions energy: -626.858 where: short stacking energy: -243.189 Base-Backbone interact. energy: -2.140 local terms energy: -301.799737 where: bonds (distance) C4'-P energy: -60.314 bonds (distance) P-C4' energy: -65.101 flat angles C4'-P-C4' energy: -63.884 flat angles P-C4'-P energy: -41.973 tors. eta vs tors. theta energy: -70.528 Dist. restrs. and SS energy: -154.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -1091.093686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.093686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.843686 (E_RNA) where: Base-Base interactions energy: -644.564 where: short stacking energy: -269.055 Base-Backbone interact. energy: 1.789 local terms energy: -310.068800 where: bonds (distance) C4'-P energy: -65.703 bonds (distance) P-C4' energy: -56.979 flat angles C4'-P-C4' energy: -58.260 flat angles P-C4'-P energy: -54.476 tors. eta vs tors. theta energy: -74.652 Dist. restrs. and SS energy: -162.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -909.195680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -909.195680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -844.745680 (E_RNA) where: Base-Base interactions energy: -594.825 where: short stacking energy: -231.170 Base-Backbone interact. energy: 6.458 local terms energy: -256.378621 where: bonds (distance) C4'-P energy: -50.824 bonds (distance) P-C4' energy: -56.866 flat angles C4'-P-C4' energy: -56.214 flat angles P-C4'-P energy: -36.977 tors. eta vs tors. theta energy: -55.497 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -868.668543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -868.668543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.018543 (E_RNA) where: Base-Base interactions energy: -517.039 where: short stacking energy: -218.026 Base-Backbone interact. energy: 2.357 local terms energy: -255.337038 where: bonds (distance) C4'-P energy: -55.657 bonds (distance) P-C4' energy: -45.698 flat angles C4'-P-C4' energy: -62.187 flat angles P-C4'-P energy: -39.941 tors. eta vs tors. theta energy: -51.854 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -856.623511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.623511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.973511 (E_RNA) where: Base-Base interactions energy: -520.901 where: short stacking energy: -215.216 Base-Backbone interact. energy: -0.869 local terms energy: -245.203403 where: bonds (distance) C4'-P energy: -52.670 bonds (distance) P-C4' energy: -48.612 flat angles C4'-P-C4' energy: -58.108 flat angles P-C4'-P energy: -38.275 tors. eta vs tors. theta energy: -47.538 Dist. restrs. and SS energy: -113.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -802.400743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -802.400743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.150743 (E_RNA) where: Base-Base interactions energy: -513.371 where: short stacking energy: -215.644 Base-Backbone interact. energy: 1.547 local terms energy: -242.326822 where: bonds (distance) C4'-P energy: -56.062 bonds (distance) P-C4' energy: -51.114 flat angles C4'-P-C4' energy: -55.548 flat angles P-C4'-P energy: -34.830 tors. eta vs tors. theta energy: -44.773 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -651.312359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.312359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.462359 (E_RNA) where: Base-Base interactions energy: -361.605 where: short stacking energy: -159.175 Base-Backbone interact. energy: 0.777 local terms energy: -220.634129 where: bonds (distance) C4'-P energy: -49.334 bonds (distance) P-C4' energy: -51.714 flat angles C4'-P-C4' energy: -56.279 flat angles P-C4'-P energy: -33.917 tors. eta vs tors. theta energy: -29.390 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -633.681290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.681290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.431290 (E_RNA) where: Base-Base interactions energy: -370.750 where: short stacking energy: -159.111 Base-Backbone interact. energy: -0.450 local terms energy: -196.230615 where: bonds (distance) C4'-P energy: -54.017 bonds (distance) P-C4' energy: -34.700 flat angles C4'-P-C4' energy: -47.369 flat angles P-C4'-P energy: -33.940 tors. eta vs tors. theta energy: -26.205 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -563.237558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.237558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.387558 (E_RNA) where: Base-Base interactions energy: -310.465 where: short stacking energy: -127.120 Base-Backbone interact. energy: -1.806 local terms energy: -181.116463 where: bonds (distance) C4'-P energy: -54.112 bonds (distance) P-C4' energy: -53.061 flat angles C4'-P-C4' energy: -42.818 flat angles P-C4'-P energy: -28.144 tors. eta vs tors. theta energy: -2.982 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -1179.563979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1179.563979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1016.113979 (E_RNA) where: Base-Base interactions energy: -694.477 where: short stacking energy: -277.958 Base-Backbone interact. energy: 0.190 local terms energy: -321.827044 where: bonds (distance) C4'-P energy: -64.963 bonds (distance) P-C4' energy: -66.090 flat angles C4'-P-C4' energy: -65.704 flat angles P-C4'-P energy: -43.407 tors. eta vs tors. theta energy: -81.663 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -1051.199197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.199197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.149197 (E_RNA) where: Base-Base interactions energy: -618.556 where: short stacking energy: -261.166 Base-Backbone interact. energy: -0.224 local terms energy: -292.369375 where: bonds (distance) C4'-P energy: -58.378 bonds (distance) P-C4' energy: -59.047 flat angles C4'-P-C4' energy: -65.132 flat angles P-C4'-P energy: -40.388 tors. eta vs tors. theta energy: -69.424 Dist. restrs. and SS energy: -163.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -1072.809296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1072.809296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.959296 (E_RNA) where: Base-Base interactions energy: -628.131 where: short stacking energy: -256.002 Base-Backbone interact. energy: -0.845 local terms energy: -310.984018 where: bonds (distance) C4'-P energy: -68.407 bonds (distance) P-C4' energy: -65.079 flat angles C4'-P-C4' energy: -64.835 flat angles P-C4'-P energy: -42.353 tors. eta vs tors. theta energy: -70.310 Dist. restrs. and SS energy: -156.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -902.455878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -902.455878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.005878 (E_RNA) where: Base-Base interactions energy: -583.606 where: short stacking energy: -231.924 Base-Backbone interact. energy: 0.698 local terms energy: -255.097983 where: bonds (distance) C4'-P energy: -56.517 bonds (distance) P-C4' energy: -45.319 flat angles C4'-P-C4' energy: -58.845 flat angles P-C4'-P energy: -35.806 tors. eta vs tors. theta energy: -58.612 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -924.477880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -924.477880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.427880 (E_RNA) where: Base-Base interactions energy: -559.449 where: short stacking energy: -231.217 Base-Backbone interact. energy: -1.884 local terms energy: -268.094816 where: bonds (distance) C4'-P energy: -46.043 bonds (distance) P-C4' energy: -63.197 flat angles C4'-P-C4' energy: -60.076 flat angles P-C4'-P energy: -42.044 tors. eta vs tors. theta energy: -56.734 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -848.035884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.035884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.385884 (E_RNA) where: Base-Base interactions energy: -513.668 where: short stacking energy: -207.751 Base-Backbone interact. energy: -2.116 local terms energy: -233.602247 where: bonds (distance) C4'-P energy: -51.543 bonds (distance) P-C4' energy: -54.826 flat angles C4'-P-C4' energy: -60.878 flat angles P-C4'-P energy: -31.835 tors. eta vs tors. theta energy: -34.522 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -760.126462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -760.126462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.876462 (E_RNA) where: Base-Base interactions energy: -483.774 where: short stacking energy: -218.638 Base-Backbone interact. energy: 0.547 local terms energy: -228.649912 where: bonds (distance) C4'-P energy: -44.262 bonds (distance) P-C4' energy: -40.566 flat angles C4'-P-C4' energy: -66.300 flat angles P-C4'-P energy: -28.486 tors. eta vs tors. theta energy: -49.036 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -649.734475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.734475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.484475 (E_RNA) where: Base-Base interactions energy: -349.172 where: short stacking energy: -160.074 Base-Backbone interact. energy: -0.812 local terms energy: -233.500729 where: bonds (distance) C4'-P energy: -60.483 bonds (distance) P-C4' energy: -58.720 flat angles C4'-P-C4' energy: -46.125 flat angles P-C4'-P energy: -35.264 tors. eta vs tors. theta energy: -32.909 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -601.729303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.729303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.479303 (E_RNA) where: Base-Base interactions energy: -339.993 where: short stacking energy: -153.735 Base-Backbone interact. energy: 0.599 local terms energy: -196.084502 where: bonds (distance) C4'-P energy: -49.099 bonds (distance) P-C4' energy: -49.999 flat angles C4'-P-C4' energy: -40.495 flat angles P-C4'-P energy: -26.498 tors. eta vs tors. theta energy: -29.994 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -630.778332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.778332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.328332 (E_RNA) where: Base-Base interactions energy: -369.514 where: short stacking energy: -162.776 Base-Backbone interact. energy: -1.246 local terms energy: -195.568262 where: bonds (distance) C4'-P energy: -33.033 bonds (distance) P-C4' energy: -48.629 flat angles C4'-P-C4' energy: -54.566 flat angles P-C4'-P energy: -33.975 tors. eta vs tors. theta energy: -25.365 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -1171.604780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1171.604780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.754780 (E_RNA) where: Base-Base interactions energy: -701.921 where: short stacking energy: -295.230 Base-Backbone interact. energy: -2.340 local terms energy: -307.493716 where: bonds (distance) C4'-P energy: -56.276 bonds (distance) P-C4' energy: -57.790 flat angles C4'-P-C4' energy: -66.464 flat angles P-C4'-P energy: -43.939 tors. eta vs tors. theta energy: -83.025 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -1063.719520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.719520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -921.869520 (E_RNA) where: Base-Base interactions energy: -638.266 where: short stacking energy: -246.139 Base-Backbone interact. energy: -2.532 local terms energy: -281.071341 where: bonds (distance) C4'-P energy: -49.557 bonds (distance) P-C4' energy: -64.937 flat angles C4'-P-C4' energy: -59.296 flat angles P-C4'-P energy: -34.748 tors. eta vs tors. theta energy: -72.533 Dist. restrs. and SS energy: -165.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -1060.380677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.380677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.930677 (E_RNA) where: Base-Base interactions energy: -642.869 where: short stacking energy: -274.467 Base-Backbone interact. energy: -0.833 local terms energy: -280.229361 where: bonds (distance) C4'-P energy: -44.734 bonds (distance) P-C4' energy: -48.442 flat angles C4'-P-C4' energy: -65.278 flat angles P-C4'-P energy: -45.339 tors. eta vs tors. theta energy: -76.437 Dist. restrs. and SS energy: -160.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -946.402496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -946.402496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.552496 (E_RNA) where: Base-Base interactions energy: -567.623 where: short stacking energy: -260.861 Base-Backbone interact. energy: -0.626 local terms energy: -281.303546 where: bonds (distance) C4'-P energy: -49.505 bonds (distance) P-C4' energy: -62.177 flat angles C4'-P-C4' energy: -54.573 flat angles P-C4'-P energy: -42.436 tors. eta vs tors. theta energy: -72.613 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -867.091232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -867.091232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.841232 (E_RNA) where: Base-Base interactions energy: -565.685 where: short stacking energy: -229.433 Base-Backbone interact. energy: 7.052 local terms energy: -233.208206 where: bonds (distance) C4'-P energy: -48.232 bonds (distance) P-C4' energy: -51.931 flat angles C4'-P-C4' energy: -45.709 flat angles P-C4'-P energy: -36.980 tors. eta vs tors. theta energy: -50.356 Dist. restrs. and SS energy: -99.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -820.818987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.818987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.768987 (E_RNA) where: Base-Base interactions energy: -473.427 where: short stacking energy: -207.081 Base-Backbone interact. energy: 1.559 local terms energy: -235.901038 where: bonds (distance) C4'-P energy: -50.347 bonds (distance) P-C4' energy: -63.460 flat angles C4'-P-C4' energy: -58.975 flat angles P-C4'-P energy: -30.842 tors. eta vs tors. theta energy: -32.277 Dist. restrs. and SS energy: -136.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -756.619986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.619986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.369986 (E_RNA) where: Base-Base interactions energy: -460.732 where: short stacking energy: -203.472 Base-Backbone interact. energy: 1.170 local terms energy: -248.807662 where: bonds (distance) C4'-P energy: -50.034 bonds (distance) P-C4' energy: -58.758 flat angles C4'-P-C4' energy: -54.529 flat angles P-C4'-P energy: -38.449 tors. eta vs tors. theta energy: -47.038 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -663.832116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.832116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.782116 (E_RNA) where: Base-Base interactions energy: -365.993 where: short stacking energy: -165.395 Base-Backbone interact. energy: -0.346 local terms energy: -229.443739 where: bonds (distance) C4'-P energy: -49.965 bonds (distance) P-C4' energy: -65.467 flat angles C4'-P-C4' energy: -49.886 flat angles P-C4'-P energy: -40.292 tors. eta vs tors. theta energy: -23.834 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -601.877349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.877349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.627349 (E_RNA) where: Base-Base interactions energy: -332.683 where: short stacking energy: -154.517 Base-Backbone interact. energy: -1.791 local terms energy: -201.153385 where: bonds (distance) C4'-P energy: -50.020 bonds (distance) P-C4' energy: -44.230 flat angles C4'-P-C4' energy: -42.054 flat angles P-C4'-P energy: -31.289 tors. eta vs tors. theta energy: -33.561 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -583.374238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.374238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.524238 (E_RNA) where: Base-Base interactions energy: -320.451 where: short stacking energy: -139.415 Base-Backbone interact. energy: 1.336 local terms energy: -194.409026 where: bonds (distance) C4'-P energy: -53.798 bonds (distance) P-C4' energy: -60.342 flat angles C4'-P-C4' energy: -37.843 flat angles P-C4'-P energy: -34.533 tors. eta vs tors. theta energy: -7.893 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -1186.739771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1186.739771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1025.089771 (E_RNA) where: Base-Base interactions energy: -698.976 where: short stacking energy: -309.790 Base-Backbone interact. energy: -2.688 local terms energy: -323.425615 where: bonds (distance) C4'-P energy: -63.226 bonds (distance) P-C4' energy: -61.943 flat angles C4'-P-C4' energy: -71.640 flat angles P-C4'-P energy: -47.923 tors. eta vs tors. theta energy: -78.693 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -1058.042226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.042226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.192226 (E_RNA) where: Base-Base interactions energy: -615.052 where: short stacking energy: -229.531 Base-Backbone interact. energy: -4.287 local terms energy: -287.852936 where: bonds (distance) C4'-P energy: -61.023 bonds (distance) P-C4' energy: -66.310 flat angles C4'-P-C4' energy: -62.866 flat angles P-C4'-P energy: -37.446 tors. eta vs tors. theta energy: -60.210 Dist. restrs. and SS energy: -174.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -1052.092967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.092967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -921.042967 (E_RNA) where: Base-Base interactions energy: -636.515 where: short stacking energy: -268.988 Base-Backbone interact. energy: -0.370 local terms energy: -284.158551 where: bonds (distance) C4'-P energy: -47.014 bonds (distance) P-C4' energy: -61.333 flat angles C4'-P-C4' energy: -63.839 flat angles P-C4'-P energy: -40.604 tors. eta vs tors. theta energy: -71.370 Dist. restrs. and SS energy: -154.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -959.055845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.055845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.405845 (E_RNA) where: Base-Base interactions energy: -587.855 where: short stacking energy: -256.823 Base-Backbone interact. energy: -0.856 local terms energy: -271.694893 where: bonds (distance) C4'-P energy: -52.069 bonds (distance) P-C4' energy: -53.374 flat angles C4'-P-C4' energy: -59.638 flat angles P-C4'-P energy: -43.619 tors. eta vs tors. theta energy: -62.995 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -944.463583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -944.463583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.213583 (E_RNA) where: Base-Base interactions energy: -558.209 where: short stacking energy: -237.708 Base-Backbone interact. energy: -2.443 local terms energy: -263.561353 where: bonds (distance) C4'-P energy: -40.756 bonds (distance) P-C4' energy: -51.629 flat angles C4'-P-C4' energy: -71.000 flat angles P-C4'-P energy: -43.020 tors. eta vs tors. theta energy: -57.157 Dist. restrs. and SS energy: -144.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -850.053966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.053966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.803966 (E_RNA) where: Base-Base interactions energy: -546.565 where: short stacking energy: -217.769 Base-Backbone interact. energy: 5.233 local terms energy: -233.471489 where: bonds (distance) C4'-P energy: -52.087 bonds (distance) P-C4' energy: -59.516 flat angles C4'-P-C4' energy: -52.046 flat angles P-C4'-P energy: -26.340 tors. eta vs tors. theta energy: -43.482 Dist. restrs. and SS energy: -99.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -759.343996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.343996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.893996 (E_RNA) where: Base-Base interactions energy: -454.755 where: short stacking energy: -172.905 Base-Backbone interact. energy: -1.234 local terms energy: -229.904950 where: bonds (distance) C4'-P energy: -53.413 bonds (distance) P-C4' energy: -56.378 flat angles C4'-P-C4' energy: -53.328 flat angles P-C4'-P energy: -32.084 tors. eta vs tors. theta energy: -34.703 Dist. restrs. and SS energy: -97.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -626.028636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.028636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.178636 (E_RNA) where: Base-Base interactions energy: -356.167 where: short stacking energy: -166.583 Base-Backbone interact. energy: -0.844 local terms energy: -199.167813 where: bonds (distance) C4'-P energy: -51.260 bonds (distance) P-C4' energy: -56.602 flat angles C4'-P-C4' energy: -48.846 flat angles P-C4'-P energy: -21.947 tors. eta vs tors. theta energy: -20.513 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -604.861748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.861748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.811748 (E_RNA) where: Base-Base interactions energy: -330.066 where: short stacking energy: -135.746 Base-Backbone interact. energy: 6.205 local terms energy: -212.949910 where: bonds (distance) C4'-P energy: -51.543 bonds (distance) P-C4' energy: -58.699 flat angles C4'-P-C4' energy: -52.840 flat angles P-C4'-P energy: -41.703 tors. eta vs tors. theta energy: -8.165 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -667.860058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.860058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.210058 (E_RNA) where: Base-Base interactions energy: -377.446 where: short stacking energy: -158.774 Base-Backbone interact. energy: -3.030 local terms energy: -197.733521 where: bonds (distance) C4'-P energy: -46.773 bonds (distance) P-C4' energy: -47.238 flat angles C4'-P-C4' energy: -50.362 flat angles P-C4'-P energy: -19.373 tors. eta vs tors. theta energy: -33.988 Dist. restrs. and SS energy: -113.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -1169.311920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1169.311920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.461920 (E_RNA) where: Base-Base interactions energy: -705.043 where: short stacking energy: -297.082 Base-Backbone interact. energy: 0.749 local terms energy: -305.168095 where: bonds (distance) C4'-P energy: -51.539 bonds (distance) P-C4' energy: -52.959 flat angles C4'-P-C4' energy: -71.911 flat angles P-C4'-P energy: -46.557 tors. eta vs tors. theta energy: -82.201 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -1089.567799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.567799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.117799 (E_RNA) where: Base-Base interactions energy: -654.779 where: short stacking energy: -260.873 Base-Backbone interact. energy: -0.773 local terms energy: -297.565552 where: bonds (distance) C4'-P energy: -54.925 bonds (distance) P-C4' energy: -64.937 flat angles C4'-P-C4' energy: -66.622 flat angles P-C4'-P energy: -39.658 tors. eta vs tors. theta energy: -71.423 Dist. restrs. and SS energy: -160.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -1075.288304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1075.288304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.038304 (E_RNA) where: Base-Base interactions energy: -644.184 where: short stacking energy: -259.922 Base-Backbone interact. energy: -2.050 local terms energy: -281.803922 where: bonds (distance) C4'-P energy: -55.835 bonds (distance) P-C4' energy: -51.590 flat angles C4'-P-C4' energy: -59.589 flat angles P-C4'-P energy: -40.404 tors. eta vs tors. theta energy: -74.386 Dist. restrs. and SS energy: -171.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -998.659746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -998.659746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -873.009746 (E_RNA) where: Base-Base interactions energy: -596.549 where: short stacking energy: -237.227 Base-Backbone interact. energy: -2.384 local terms energy: -274.077123 where: bonds (distance) C4'-P energy: -57.163 bonds (distance) P-C4' energy: -53.606 flat angles C4'-P-C4' energy: -60.194 flat angles P-C4'-P energy: -46.292 tors. eta vs tors. theta energy: -56.822 Dist. restrs. and SS energy: -149.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -915.697230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -915.697230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -818.847230 (E_RNA) where: Base-Base interactions energy: -547.336 where: short stacking energy: -238.273 Base-Backbone interact. energy: 0.427 local terms energy: -271.938067 where: bonds (distance) C4'-P energy: -56.915 bonds (distance) P-C4' energy: -65.220 flat angles C4'-P-C4' energy: -55.138 flat angles P-C4'-P energy: -26.313 tors. eta vs tors. theta energy: -68.352 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -845.595067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.595067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -773.945067 (E_RNA) where: Base-Base interactions energy: -566.313 where: short stacking energy: -201.166 Base-Backbone interact. energy: -0.732 local terms energy: -206.900031 where: bonds (distance) C4'-P energy: -34.543 bonds (distance) P-C4' energy: -53.364 flat angles C4'-P-C4' energy: -60.248 flat angles P-C4'-P energy: -26.590 tors. eta vs tors. theta energy: -32.155 Dist. restrs. and SS energy: -95.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -802.122454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -802.122454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.072454 (E_RNA) where: Base-Base interactions energy: -473.985 where: short stacking energy: -180.737 Base-Backbone interact. energy: 0.379 local terms energy: -251.466931 where: bonds (distance) C4'-P energy: -60.168 bonds (distance) P-C4' energy: -54.691 flat angles C4'-P-C4' energy: -61.009 flat angles P-C4'-P energy: -38.406 tors. eta vs tors. theta energy: -37.192 Dist. restrs. and SS energy: -100.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -642.458329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.458329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.608329 (E_RNA) where: Base-Base interactions energy: -352.909 where: short stacking energy: -163.586 Base-Backbone interact. energy: -0.431 local terms energy: -219.268752 where: bonds (distance) C4'-P energy: -55.636 bonds (distance) P-C4' energy: -49.506 flat angles C4'-P-C4' energy: -51.890 flat angles P-C4'-P energy: -35.952 tors. eta vs tors. theta energy: -26.285 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -631.826665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -631.826665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.976665 (E_RNA) where: Base-Base interactions energy: -355.987 where: short stacking energy: -161.240 Base-Backbone interact. energy: 0.612 local terms energy: -206.601927 where: bonds (distance) C4'-P energy: -54.349 bonds (distance) P-C4' energy: -49.325 flat angles C4'-P-C4' energy: -50.737 flat angles P-C4'-P energy: -29.884 tors. eta vs tors. theta energy: -22.307 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -691.355119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.355119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.105119 (E_RNA) where: Base-Base interactions energy: -410.198 where: short stacking energy: -181.144 Base-Backbone interact. energy: 2.029 local terms energy: -198.936204 where: bonds (distance) C4'-P energy: -55.999 bonds (distance) P-C4' energy: -38.182 flat angles C4'-P-C4' energy: -39.141 flat angles P-C4'-P energy: -32.334 tors. eta vs tors. theta energy: -33.280 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -1200.324966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1200.324966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.674966 (E_RNA) where: Base-Base interactions energy: -724.517 where: short stacking energy: -311.403 Base-Backbone interact. energy: 1.052 local terms energy: -315.210375 where: bonds (distance) C4'-P energy: -60.690 bonds (distance) P-C4' energy: -55.804 flat angles C4'-P-C4' energy: -66.230 flat angles P-C4'-P energy: -43.259 tors. eta vs tors. theta energy: -89.228 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -1086.766060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.766060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.116060 (E_RNA) where: Base-Base interactions energy: -654.951 where: short stacking energy: -285.991 Base-Backbone interact. energy: -1.179 local terms energy: -295.986230 where: bonds (distance) C4'-P energy: -47.536 bonds (distance) P-C4' energy: -58.654 flat angles C4'-P-C4' energy: -63.980 flat angles P-C4'-P energy: -45.865 tors. eta vs tors. theta energy: -79.951 Dist. restrs. and SS energy: -158.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -1071.155445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1071.155445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.105445 (E_RNA) where: Base-Base interactions energy: -626.710 where: short stacking energy: -256.554 Base-Backbone interact. energy: -2.383 local terms energy: -293.012558 where: bonds (distance) C4'-P energy: -54.893 bonds (distance) P-C4' energy: -60.948 flat angles C4'-P-C4' energy: -63.084 flat angles P-C4'-P energy: -39.717 tors. eta vs tors. theta energy: -74.370 Dist. restrs. and SS energy: -172.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -974.218546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -974.218546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -848.568546 (E_RNA) where: Base-Base interactions energy: -576.359 where: short stacking energy: -242.513 Base-Backbone interact. energy: -5.540 local terms energy: -266.669931 where: bonds (distance) C4'-P energy: -58.551 bonds (distance) P-C4' energy: -56.427 flat angles C4'-P-C4' energy: -55.450 flat angles P-C4'-P energy: -36.878 tors. eta vs tors. theta energy: -59.364 Dist. restrs. and SS energy: -149.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -954.895198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -954.895198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -852.645198 (E_RNA) where: Base-Base interactions energy: -577.646 where: short stacking energy: -249.199 Base-Backbone interact. energy: -1.593 local terms energy: -273.405973 where: bonds (distance) C4'-P energy: -46.387 bonds (distance) P-C4' energy: -55.411 flat angles C4'-P-C4' energy: -60.438 flat angles P-C4'-P energy: -40.427 tors. eta vs tors. theta energy: -70.743 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -859.465668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -859.465668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.215668 (E_RNA) where: Base-Base interactions energy: -541.998 where: short stacking energy: -224.504 Base-Backbone interact. energy: -1.173 local terms energy: -241.044331 where: bonds (distance) C4'-P energy: -50.263 bonds (distance) P-C4' energy: -55.683 flat angles C4'-P-C4' energy: -59.362 flat angles P-C4'-P energy: -27.831 tors. eta vs tors. theta energy: -47.905 Dist. restrs. and SS energy: -99.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -822.492195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.492195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.842195 (E_RNA) where: Base-Base interactions energy: -501.235 where: short stacking energy: -200.508 Base-Backbone interact. energy: -1.851 local terms energy: -238.756129 where: bonds (distance) C4'-P energy: -47.909 bonds (distance) P-C4' energy: -49.205 flat angles C4'-P-C4' energy: -49.659 flat angles P-C4'-P energy: -45.402 tors. eta vs tors. theta energy: -46.581 Dist. restrs. and SS energy: -104.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -665.188264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.188264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.738264 (E_RNA) where: Base-Base interactions energy: -377.415 where: short stacking energy: -186.459 Base-Backbone interact. energy: -1.973 local terms energy: -221.350555 where: bonds (distance) C4'-P energy: -54.421 bonds (distance) P-C4' energy: -55.299 flat angles C4'-P-C4' energy: -53.195 flat angles P-C4'-P energy: -28.211 tors. eta vs tors. theta energy: -30.224 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -730.832510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.832510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.782510 (E_RNA) where: Base-Base interactions energy: -441.548 where: short stacking energy: -174.832 Base-Backbone interact. energy: 2.072 local terms energy: -196.307086 where: bonds (distance) C4'-P energy: -49.316 bonds (distance) P-C4' energy: -51.464 flat angles C4'-P-C4' energy: -40.779 flat angles P-C4'-P energy: -20.496 tors. eta vs tors. theta energy: -34.253 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -575.080982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.080982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.030982 (E_RNA) where: Base-Base interactions energy: -323.086 where: short stacking energy: -119.074 Base-Backbone interact. energy: 1.520 local terms energy: -185.464666 where: bonds (distance) C4'-P energy: -49.472 bonds (distance) P-C4' energy: -55.172 flat angles C4'-P-C4' energy: -43.685 flat angles P-C4'-P energy: -25.133 tors. eta vs tors. theta energy: -12.003 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -1191.917952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1191.917952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1023.067952 (E_RNA) where: Base-Base interactions energy: -703.772 where: short stacking energy: -305.686 Base-Backbone interact. energy: -2.456 local terms energy: -316.840216 where: bonds (distance) C4'-P energy: -57.485 bonds (distance) P-C4' energy: -60.198 flat angles C4'-P-C4' energy: -65.200 flat angles P-C4'-P energy: -47.447 tors. eta vs tors. theta energy: -86.511 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -1103.506628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1103.506628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.056628 (E_RNA) where: Base-Base interactions energy: -677.961 where: short stacking energy: -270.965 Base-Backbone interact. energy: -1.300 local terms energy: -278.795968 where: bonds (distance) C4'-P energy: -48.352 bonds (distance) P-C4' energy: -63.463 flat angles C4'-P-C4' energy: -55.137 flat angles P-C4'-P energy: -49.095 tors. eta vs tors. theta energy: -62.749 Dist. restrs. and SS energy: -169.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -1083.444285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.444285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -946.994285 (E_RNA) where: Base-Base interactions energy: -655.313 where: short stacking energy: -267.330 Base-Backbone interact. energy: -1.891 local terms energy: -289.790737 where: bonds (distance) C4'-P energy: -57.441 bonds (distance) P-C4' energy: -47.421 flat angles C4'-P-C4' energy: -61.411 flat angles P-C4'-P energy: -42.771 tors. eta vs tors. theta energy: -80.748 Dist. restrs. and SS energy: -160.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -982.060066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.060066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -883.410066 (E_RNA) where: Base-Base interactions energy: -607.411 where: short stacking energy: -260.493 Base-Backbone interact. energy: -0.140 local terms energy: -275.859198 where: bonds (distance) C4'-P energy: -53.942 bonds (distance) P-C4' energy: -49.292 flat angles C4'-P-C4' energy: -67.674 flat angles P-C4'-P energy: -32.252 tors. eta vs tors. theta energy: -72.700 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -949.636190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -949.636190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.386190 (E_RNA) where: Base-Base interactions energy: -567.769 where: short stacking energy: -221.628 Base-Backbone interact. energy: 2.781 local terms energy: -255.398398 where: bonds (distance) C4'-P energy: -40.837 bonds (distance) P-C4' energy: -56.659 flat angles C4'-P-C4' energy: -58.507 flat angles P-C4'-P energy: -40.334 tors. eta vs tors. theta energy: -59.061 Dist. restrs. and SS energy: -153.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -892.629010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -892.629010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -808.379010 (E_RNA) where: Base-Base interactions energy: -556.073 where: short stacking energy: -214.871 Base-Backbone interact. energy: -0.913 local terms energy: -251.393012 where: bonds (distance) C4'-P energy: -64.441 bonds (distance) P-C4' energy: -59.413 flat angles C4'-P-C4' energy: -49.460 flat angles P-C4'-P energy: -31.102 tors. eta vs tors. theta energy: -46.978 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -821.584306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -821.584306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.334306 (E_RNA) where: Base-Base interactions energy: -506.317 where: short stacking energy: -197.795 Base-Backbone interact. energy: 3.398 local terms energy: -234.415235 where: bonds (distance) C4'-P energy: -53.120 bonds (distance) P-C4' energy: -58.334 flat angles C4'-P-C4' energy: -54.342 flat angles P-C4'-P energy: -27.466 tors. eta vs tors. theta energy: -41.153 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -770.428583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.428583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.578583 (E_RNA) where: Base-Base interactions energy: -458.092 where: short stacking energy: -197.863 Base-Backbone interact. energy: -4.155 local terms energy: -211.331239 where: bonds (distance) C4'-P energy: -41.871 bonds (distance) P-C4' energy: -47.161 flat angles C4'-P-C4' energy: -45.235 flat angles P-C4'-P energy: -39.449 tors. eta vs tors. theta energy: -37.616 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -625.683492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -625.683492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.633492 (E_RNA) where: Base-Base interactions energy: -355.785 where: short stacking energy: -151.283 Base-Backbone interact. energy: 1.363 local terms energy: -203.210681 where: bonds (distance) C4'-P energy: -51.067 bonds (distance) P-C4' energy: -54.899 flat angles C4'-P-C4' energy: -42.790 flat angles P-C4'-P energy: -33.068 tors. eta vs tors. theta energy: -21.387 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -590.879049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.879049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.429049 (E_RNA) where: Base-Base interactions energy: -317.038 where: short stacking energy: -140.585 Base-Backbone interact. energy: 2.285 local terms energy: -211.676324 where: bonds (distance) C4'-P energy: -54.515 bonds (distance) P-C4' energy: -51.997 flat angles C4'-P-C4' energy: -49.270 flat angles P-C4'-P energy: -27.939 tors. eta vs tors. theta energy: -27.955 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -1189.124738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1189.124738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1022.074738 (E_RNA) where: Base-Base interactions energy: -709.981 where: short stacking energy: -311.243 Base-Backbone interact. energy: -0.046 local terms energy: -312.047244 where: bonds (distance) C4'-P energy: -48.582 bonds (distance) P-C4' energy: -57.760 flat angles C4'-P-C4' energy: -69.848 flat angles P-C4'-P energy: -50.113 tors. eta vs tors. theta energy: -85.744 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -1092.979102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1092.979102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.729102 (E_RNA) where: Base-Base interactions energy: -658.986 where: short stacking energy: -269.952 Base-Backbone interact. energy: 0.284 local terms energy: -287.026844 where: bonds (distance) C4'-P energy: -46.255 bonds (distance) P-C4' energy: -60.136 flat angles C4'-P-C4' energy: -60.525 flat angles P-C4'-P energy: -46.857 tors. eta vs tors. theta energy: -73.254 Dist. restrs. and SS energy: -171.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -1085.683521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.683521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -954.633521 (E_RNA) where: Base-Base interactions energy: -652.090 where: short stacking energy: -270.863 Base-Backbone interact. energy: 2.257 local terms energy: -304.800876 where: bonds (distance) C4'-P energy: -57.800 bonds (distance) P-C4' energy: -66.873 flat angles C4'-P-C4' energy: -64.233 flat angles P-C4'-P energy: -37.166 tors. eta vs tors. theta energy: -78.728 Dist. restrs. and SS energy: -154.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -957.595783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -957.595783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -858.945783 (E_RNA) where: Base-Base interactions energy: -563.522 where: short stacking energy: -232.268 Base-Backbone interact. energy: -0.523 local terms energy: -294.900568 where: bonds (distance) C4'-P energy: -57.186 bonds (distance) P-C4' energy: -52.514 flat angles C4'-P-C4' energy: -69.084 flat angles P-C4'-P energy: -50.168 tors. eta vs tors. theta energy: -65.949 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -939.891771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -939.891771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.641771 (E_RNA) where: Base-Base interactions energy: -573.528 where: short stacking energy: -239.752 Base-Backbone interact. energy: -0.847 local terms energy: -245.266704 where: bonds (distance) C4'-P energy: -51.068 bonds (distance) P-C4' energy: -55.901 flat angles C4'-P-C4' energy: -45.367 flat angles P-C4'-P energy: -35.947 tors. eta vs tors. theta energy: -56.984 Dist. restrs. and SS energy: -144.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -884.195530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.195530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -803.545530 (E_RNA) where: Base-Base interactions energy: -555.822 where: short stacking energy: -229.700 Base-Backbone interact. energy: -0.901 local terms energy: -246.822340 where: bonds (distance) C4'-P energy: -43.749 bonds (distance) P-C4' energy: -47.733 flat angles C4'-P-C4' energy: -58.424 flat angles P-C4'-P energy: -42.805 tors. eta vs tors. theta energy: -54.111 Dist. restrs. and SS energy: -104.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -810.119127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.119127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.469127 (E_RNA) where: Base-Base interactions energy: -488.248 where: short stacking energy: -186.515 Base-Backbone interact. energy: -4.422 local terms energy: -218.799058 where: bonds (distance) C4'-P energy: -52.044 bonds (distance) P-C4' energy: -52.726 flat angles C4'-P-C4' energy: -52.289 flat angles P-C4'-P energy: -20.133 tors. eta vs tors. theta energy: -41.607 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -836.773655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.773655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.923655 (E_RNA) where: Base-Base interactions energy: -516.148 where: short stacking energy: -224.910 Base-Backbone interact. energy: -1.064 local terms energy: -240.711158 where: bonds (distance) C4'-P energy: -56.851 bonds (distance) P-C4' energy: -47.152 flat angles C4'-P-C4' energy: -47.649 flat angles P-C4'-P energy: -26.042 tors. eta vs tors. theta energy: -63.017 Dist. restrs. and SS energy: -102.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -642.556231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.556231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.306231 (E_RNA) where: Base-Base interactions energy: -349.142 where: short stacking energy: -158.843 Base-Backbone interact. energy: -0.727 local terms energy: -226.437339 where: bonds (distance) C4'-P energy: -52.306 bonds (distance) P-C4' energy: -55.774 flat angles C4'-P-C4' energy: -52.051 flat angles P-C4'-P energy: -34.617 tors. eta vs tors. theta energy: -31.689 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -617.409074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -617.409074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.159074 (E_RNA) where: Base-Base interactions energy: -340.157 where: short stacking energy: -161.141 Base-Backbone interact. energy: 0.320 local terms energy: -211.321672 where: bonds (distance) C4'-P energy: -52.913 bonds (distance) P-C4' energy: -50.759 flat angles C4'-P-C4' energy: -53.391 flat angles P-C4'-P energy: -21.814 tors. eta vs tors. theta energy: -32.444 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -1213.617843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1213.617843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1042.967843 (E_RNA) where: Base-Base interactions energy: -713.972 where: short stacking energy: -307.713 Base-Backbone interact. energy: -2.562 local terms energy: -326.433334 where: bonds (distance) C4'-P energy: -57.761 bonds (distance) P-C4' energy: -61.264 flat angles C4'-P-C4' energy: -71.475 flat angles P-C4'-P energy: -46.113 tors. eta vs tors. theta energy: -89.820 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -1114.847380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1114.847380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -985.597380 (E_RNA) where: Base-Base interactions energy: -678.587 where: short stacking energy: -268.699 Base-Backbone interact. energy: -0.240 local terms energy: -306.770347 where: bonds (distance) C4'-P energy: -63.483 bonds (distance) P-C4' energy: -58.045 flat angles C4'-P-C4' energy: -69.264 flat angles P-C4'-P energy: -40.762 tors. eta vs tors. theta energy: -75.216 Dist. restrs. and SS energy: -153.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -1090.453914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1090.453914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.003914 (E_RNA) where: Base-Base interactions energy: -658.119 where: short stacking energy: -258.968 Base-Backbone interact. energy: -1.553 local terms energy: -285.331708 where: bonds (distance) C4'-P energy: -53.382 bonds (distance) P-C4' energy: -59.371 flat angles C4'-P-C4' energy: -62.674 flat angles P-C4'-P energy: -35.600 tors. eta vs tors. theta energy: -74.304 Dist. restrs. and SS energy: -169.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -975.358699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.358699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -873.108699 (E_RNA) where: Base-Base interactions energy: -573.960 where: short stacking energy: -249.548 Base-Backbone interact. energy: -0.818 local terms energy: -298.330126 where: bonds (distance) C4'-P energy: -58.484 bonds (distance) P-C4' energy: -63.768 flat angles C4'-P-C4' energy: -62.622 flat angles P-C4'-P energy: -44.688 tors. eta vs tors. theta energy: -68.768 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -985.521955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.521955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -865.271955 (E_RNA) where: Base-Base interactions energy: -577.665 where: short stacking energy: -249.269 Base-Backbone interact. energy: -1.406 local terms energy: -286.201256 where: bonds (distance) C4'-P energy: -58.400 bonds (distance) P-C4' energy: -62.983 flat angles C4'-P-C4' energy: -62.016 flat angles P-C4'-P energy: -39.514 tors. eta vs tors. theta energy: -63.288 Dist. restrs. and SS energy: -144.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -907.284648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.284648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.034648 (E_RNA) where: Base-Base interactions energy: -578.856 where: short stacking energy: -213.618 Base-Backbone interact. energy: -2.038 local terms energy: -242.140692 where: bonds (distance) C4'-P energy: -45.073 bonds (distance) P-C4' energy: -58.998 flat angles C4'-P-C4' energy: -47.136 flat angles P-C4'-P energy: -43.664 tors. eta vs tors. theta energy: -47.270 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -820.681639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.681639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.631639 (E_RNA) where: Base-Base interactions energy: -496.912 where: short stacking energy: -216.329 Base-Backbone interact. energy: -0.018 local terms energy: -228.702079 where: bonds (distance) C4'-P energy: -53.120 bonds (distance) P-C4' energy: -59.116 flat angles C4'-P-C4' energy: -53.695 flat angles P-C4'-P energy: -27.336 tors. eta vs tors. theta energy: -35.435 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -807.164593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -807.164593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.114593 (E_RNA) where: Base-Base interactions energy: -501.642 where: short stacking energy: -205.218 Base-Backbone interact. energy: -0.330 local terms energy: -228.142764 where: bonds (distance) C4'-P energy: -37.134 bonds (distance) P-C4' energy: -52.102 flat angles C4'-P-C4' energy: -55.205 flat angles P-C4'-P energy: -35.017 tors. eta vs tors. theta energy: -48.686 Dist. restrs. and SS energy: -100.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -659.576948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.576948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.326948 (E_RNA) where: Base-Base interactions energy: -354.635 where: short stacking energy: -162.045 Base-Backbone interact. energy: 0.937 local terms energy: -239.628655 where: bonds (distance) C4'-P energy: -46.652 bonds (distance) P-C4' energy: -48.922 flat angles C4'-P-C4' energy: -54.603 flat angles P-C4'-P energy: -43.325 tors. eta vs tors. theta energy: -46.126 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -616.997989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -616.997989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.947989 (E_RNA) where: Base-Base interactions energy: -364.171 where: short stacking energy: -150.331 Base-Backbone interact. energy: -1.681 local terms energy: -183.096079 where: bonds (distance) C4'-P energy: -35.433 bonds (distance) P-C4' energy: -54.953 flat angles C4'-P-C4' energy: -40.956 flat angles P-C4'-P energy: -32.808 tors. eta vs tors. theta energy: -18.946 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -1222.462313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1222.462313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1051.812313 (E_RNA) where: Base-Base interactions energy: -725.124 where: short stacking energy: -286.697 Base-Backbone interact. energy: -1.791 local terms energy: -324.897328 where: bonds (distance) C4'-P energy: -55.469 bonds (distance) P-C4' energy: -64.137 flat angles C4'-P-C4' energy: -74.178 flat angles P-C4'-P energy: -46.957 tors. eta vs tors. theta energy: -84.157 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -1139.500059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1139.500059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1008.450059 (E_RNA) where: Base-Base interactions energy: -694.864 where: short stacking energy: -280.622 Base-Backbone interact. energy: -1.933 local terms energy: -311.652569 where: bonds (distance) C4'-P energy: -67.602 bonds (distance) P-C4' energy: -52.189 flat angles C4'-P-C4' energy: -60.829 flat angles P-C4'-P energy: -48.431 tors. eta vs tors. theta energy: -82.601 Dist. restrs. and SS energy: -154.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -1108.124651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1108.124651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.874651 (E_RNA) where: Base-Base interactions energy: -680.099 where: short stacking energy: -258.042 Base-Backbone interact. energy: 0.874 local terms energy: -281.649775 where: bonds (distance) C4'-P energy: -56.217 bonds (distance) P-C4' energy: -54.917 flat angles C4'-P-C4' energy: -59.944 flat angles P-C4'-P energy: -42.075 tors. eta vs tors. theta energy: -68.496 Dist. restrs. and SS energy: -171.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -993.291508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -993.291508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -894.641508 (E_RNA) where: Base-Base interactions energy: -593.027 where: short stacking energy: -263.945 Base-Backbone interact. energy: -0.360 local terms energy: -301.253896 where: bonds (distance) C4'-P energy: -58.894 bonds (distance) P-C4' energy: -55.127 flat angles C4'-P-C4' energy: -68.583 flat angles P-C4'-P energy: -37.847 tors. eta vs tors. theta energy: -80.804 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -987.915430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.915430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.465430 (E_RNA) where: Base-Base interactions energy: -604.591 where: short stacking energy: -234.912 Base-Backbone interact. energy: -2.893 local terms energy: -252.981625 where: bonds (distance) C4'-P energy: -56.662 bonds (distance) P-C4' energy: -45.822 flat angles C4'-P-C4' energy: -52.535 flat angles P-C4'-P energy: -36.114 tors. eta vs tors. theta energy: -61.849 Dist. restrs. and SS energy: -151.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -876.863815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -876.863815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.813815 (E_RNA) where: Base-Base interactions energy: -572.559 where: short stacking energy: -222.178 Base-Backbone interact. energy: -0.072 local terms energy: -218.182468 where: bonds (distance) C4'-P energy: -40.969 bonds (distance) P-C4' energy: -50.303 flat angles C4'-P-C4' energy: -48.479 flat angles P-C4'-P energy: -34.510 tors. eta vs tors. theta energy: -43.922 Dist. restrs. and SS energy: -109.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -846.855482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.855482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.205482 (E_RNA) where: Base-Base interactions energy: -502.638 where: short stacking energy: -187.245 Base-Backbone interact. energy: -0.238 local terms energy: -245.329176 where: bonds (distance) C4'-P energy: -60.001 bonds (distance) P-C4' energy: -53.743 flat angles C4'-P-C4' energy: -56.402 flat angles P-C4'-P energy: -38.460 tors. eta vs tors. theta energy: -36.723 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -789.953093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.953093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.903093 (E_RNA) where: Base-Base interactions energy: -476.452 where: short stacking energy: -188.089 Base-Backbone interact. energy: 2.978 local terms energy: -239.429033 where: bonds (distance) C4'-P energy: -54.043 bonds (distance) P-C4' energy: -51.477 flat angles C4'-P-C4' energy: -52.372 flat angles P-C4'-P energy: -41.051 tors. eta vs tors. theta energy: -40.487 Dist. restrs. and SS energy: -100.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -609.490915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -609.490915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.440915 (E_RNA) where: Base-Base interactions energy: -353.341 where: short stacking energy: -139.056 Base-Backbone interact. energy: 0.091 local terms energy: -197.190655 where: bonds (distance) C4'-P energy: -44.413 bonds (distance) P-C4' energy: -38.110 flat angles C4'-P-C4' energy: -53.347 flat angles P-C4'-P energy: -37.767 tors. eta vs tors. theta energy: -23.554 Dist. restrs. and SS energy: -82.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -608.543583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.543583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.093583 (E_RNA) where: Base-Base interactions energy: -336.054 where: short stacking energy: -163.869 Base-Backbone interact. energy: -1.914 local terms energy: -206.125819 where: bonds (distance) C4'-P energy: -45.481 bonds (distance) P-C4' energy: -34.967 flat angles C4'-P-C4' energy: -58.291 flat angles P-C4'-P energy: -36.646 tors. eta vs tors. theta energy: -30.741 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -1205.737556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1205.737556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.687556 (E_RNA) where: Base-Base interactions energy: -710.494 where: short stacking energy: -294.587 Base-Backbone interact. energy: -2.198 local terms energy: -325.995160 where: bonds (distance) C4'-P energy: -63.018 bonds (distance) P-C4' energy: -59.842 flat angles C4'-P-C4' energy: -69.929 flat angles P-C4'-P energy: -50.165 tors. eta vs tors. theta energy: -83.042 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -1145.083253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1145.083253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -994.233253 (E_RNA) where: Base-Base interactions energy: -683.296 where: short stacking energy: -277.190 Base-Backbone interact. energy: -1.594 local terms energy: -309.342756 where: bonds (distance) C4'-P energy: -54.079 bonds (distance) P-C4' energy: -67.914 flat angles C4'-P-C4' energy: -59.697 flat angles P-C4'-P energy: -48.370 tors. eta vs tors. theta energy: -79.283 Dist. restrs. and SS energy: -174.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -1108.832285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1108.832285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.182285 (E_RNA) where: Base-Base interactions energy: -669.077 where: short stacking energy: -280.141 Base-Backbone interact. energy: -3.359 local terms energy: -310.745887 where: bonds (distance) C4'-P energy: -51.109 bonds (distance) P-C4' energy: -63.816 flat angles C4'-P-C4' energy: -66.528 flat angles P-C4'-P energy: -53.436 tors. eta vs tors. theta energy: -75.857 Dist. restrs. and SS energy: -149.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -996.488249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.488249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.238249 (E_RNA) where: Base-Base interactions energy: -601.073 where: short stacking energy: -236.114 Base-Backbone interact. energy: -0.572 local terms energy: -274.593040 where: bonds (distance) C4'-P energy: -57.650 bonds (distance) P-C4' energy: -55.040 flat angles C4'-P-C4' energy: -58.605 flat angles P-C4'-P energy: -40.222 tors. eta vs tors. theta energy: -63.075 Dist. restrs. and SS energy: -144.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -980.537298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.537298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -880.087298 (E_RNA) where: Base-Base interactions energy: -596.557 where: short stacking energy: -251.834 Base-Backbone interact. energy: -1.716 local terms energy: -281.814658 where: bonds (distance) C4'-P energy: -58.309 bonds (distance) P-C4' energy: -56.425 flat angles C4'-P-C4' energy: -60.778 flat angles P-C4'-P energy: -34.929 tors. eta vs tors. theta energy: -71.374 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -881.553844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -881.553844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -802.703844 (E_RNA) where: Base-Base interactions energy: -572.934 where: short stacking energy: -207.937 Base-Backbone interact. energy: 0.802 local terms energy: -230.572306 where: bonds (distance) C4'-P energy: -48.027 bonds (distance) P-C4' energy: -54.330 flat angles C4'-P-C4' energy: -46.693 flat angles P-C4'-P energy: -36.216 tors. eta vs tors. theta energy: -45.306 Dist. restrs. and SS energy: -102.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -842.549498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -842.549498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.899498 (E_RNA) where: Base-Base interactions energy: -505.842 where: short stacking energy: -197.938 Base-Backbone interact. energy: 0.148 local terms energy: -238.205134 where: bonds (distance) C4'-P energy: -48.327 bonds (distance) P-C4' energy: -66.787 flat angles C4'-P-C4' energy: -43.631 flat angles P-C4'-P energy: -39.178 tors. eta vs tors. theta energy: -40.281 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -805.738040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -805.738040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.288040 (E_RNA) where: Base-Base interactions energy: -491.521 where: short stacking energy: -196.139 Base-Backbone interact. energy: 0.349 local terms energy: -232.116418 where: bonds (distance) C4'-P energy: -59.947 bonds (distance) P-C4' energy: -47.972 flat angles C4'-P-C4' energy: -46.489 flat angles P-C4'-P energy: -34.862 tors. eta vs tors. theta energy: -42.847 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -634.444218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -634.444218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.194218 (E_RNA) where: Base-Base interactions energy: -364.876 where: short stacking energy: -166.879 Base-Backbone interact. energy: 0.999 local terms energy: -204.318049 where: bonds (distance) C4'-P energy: -40.700 bonds (distance) P-C4' energy: -59.524 flat angles C4'-P-C4' energy: -48.598 flat angles P-C4'-P energy: -25.437 tors. eta vs tors. theta energy: -30.059 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -617.893814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -617.893814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.643814 (E_RNA) where: Base-Base interactions energy: -349.845 where: short stacking energy: -162.327 Base-Backbone interact. energy: 2.329 local terms energy: -204.128272 where: bonds (distance) C4'-P energy: -47.963 bonds (distance) P-C4' energy: -53.041 flat angles C4'-P-C4' energy: -42.331 flat angles P-C4'-P energy: -30.191 tors. eta vs tors. theta energy: -30.601 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -1227.819138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1227.819138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1058.969138 (E_RNA) where: Base-Base interactions energy: -735.120 where: short stacking energy: -314.950 Base-Backbone interact. energy: -1.814 local terms energy: -322.035740 where: bonds (distance) C4'-P energy: -60.286 bonds (distance) P-C4' energy: -54.888 flat angles C4'-P-C4' energy: -69.491 flat angles P-C4'-P energy: -47.425 tors. eta vs tors. theta energy: -89.945 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -1141.690254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1141.690254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -994.440254 (E_RNA) where: Base-Base interactions energy: -698.050 where: short stacking energy: -279.987 Base-Backbone interact. energy: 1.769 local terms energy: -298.159441 where: bonds (distance) C4'-P energy: -66.159 bonds (distance) P-C4' energy: -56.193 flat angles C4'-P-C4' energy: -58.871 flat angles P-C4'-P energy: -41.446 tors. eta vs tors. theta energy: -75.491 Dist. restrs. and SS energy: -171.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -1087.390694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.390694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.740694 (E_RNA) where: Base-Base interactions energy: -659.776 where: short stacking energy: -265.311 Base-Backbone interact. energy: -0.812 local terms energy: -292.152882 where: bonds (distance) C4'-P energy: -53.502 bonds (distance) P-C4' energy: -55.066 flat angles C4'-P-C4' energy: -59.401 flat angles P-C4'-P energy: -46.977 tors. eta vs tors. theta energy: -77.207 Dist. restrs. and SS energy: -158.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -1009.080674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.080674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.230674 (E_RNA) where: Base-Base interactions energy: -607.382 where: short stacking energy: -241.068 Base-Backbone interact. energy: -2.960 local terms energy: -274.888459 where: bonds (distance) C4'-P energy: -54.895 bonds (distance) P-C4' energy: -55.926 flat angles C4'-P-C4' energy: -60.685 flat angles P-C4'-P energy: -39.558 tors. eta vs tors. theta energy: -63.825 Dist. restrs. and SS energy: -147.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -945.883607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.883607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.633607 (E_RNA) where: Base-Base interactions energy: -557.436 where: short stacking energy: -221.793 Base-Backbone interact. energy: 0.681 local terms energy: -286.878601 where: bonds (distance) C4'-P energy: -54.051 bonds (distance) P-C4' energy: -52.255 flat angles C4'-P-C4' energy: -67.399 flat angles P-C4'-P energy: -41.652 tors. eta vs tors. theta energy: -71.521 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -884.215581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.215581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -803.565581 (E_RNA) where: Base-Base interactions energy: -570.229 where: short stacking energy: -217.816 Base-Backbone interact. energy: -1.605 local terms energy: -231.731072 where: bonds (distance) C4'-P energy: -37.398 bonds (distance) P-C4' energy: -56.524 flat angles C4'-P-C4' energy: -55.269 flat angles P-C4'-P energy: -34.381 tors. eta vs tors. theta energy: -48.160 Dist. restrs. and SS energy: -104.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -844.110898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -844.110898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.460898 (E_RNA) where: Base-Base interactions energy: -516.644 where: short stacking energy: -198.090 Base-Backbone interact. energy: 1.966 local terms energy: -248.782847 where: bonds (distance) C4'-P energy: -49.936 bonds (distance) P-C4' energy: -49.765 flat angles C4'-P-C4' energy: -54.766 flat angles P-C4'-P energy: -44.105 tors. eta vs tors. theta energy: -50.211 Dist. restrs. and SS energy: -104.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -854.065709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -854.065709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.415709 (E_RNA) where: Base-Base interactions energy: -525.280 where: short stacking energy: -196.374 Base-Backbone interact. energy: -1.012 local terms energy: -220.122928 where: bonds (distance) C4'-P energy: -41.628 bonds (distance) P-C4' energy: -55.879 flat angles C4'-P-C4' energy: -49.635 flat angles P-C4'-P energy: -38.242 tors. eta vs tors. theta energy: -34.740 Dist. restrs. and SS energy: -131.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -632.614684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -632.614684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.564684 (E_RNA) where: Base-Base interactions energy: -344.157 where: short stacking energy: -169.608 Base-Backbone interact. energy: 2.261 local terms energy: -222.668133 where: bonds (distance) C4'-P energy: -49.890 bonds (distance) P-C4' energy: -50.714 flat angles C4'-P-C4' energy: -53.423 flat angles P-C4'-P energy: -37.216 tors. eta vs tors. theta energy: -31.425 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -612.895140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.895140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.045140 (E_RNA) where: Base-Base interactions energy: -351.331 where: short stacking energy: -145.257 Base-Backbone interact. energy: -3.709 local terms energy: -188.005215 where: bonds (distance) C4'-P energy: -48.581 bonds (distance) P-C4' energy: -45.885 flat angles C4'-P-C4' energy: -39.349 flat angles P-C4'-P energy: -32.378 tors. eta vs tors. theta energy: -21.811 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -1201.252444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1201.252444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1034.202444 (E_RNA) where: Base-Base interactions energy: -708.659 where: short stacking energy: -293.683 Base-Backbone interact. energy: -1.923 local terms energy: -323.620525 where: bonds (distance) C4'-P energy: -58.032 bonds (distance) P-C4' energy: -62.866 flat angles C4'-P-C4' energy: -63.102 flat angles P-C4'-P energy: -55.814 tors. eta vs tors. theta energy: -83.806 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -1152.456324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1152.456324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -999.806324 (E_RNA) where: Base-Base interactions energy: -690.085 where: short stacking energy: -293.156 Base-Backbone interact. energy: -3.113 local terms energy: -306.607601 where: bonds (distance) C4'-P energy: -52.294 bonds (distance) P-C4' energy: -58.010 flat angles C4'-P-C4' energy: -69.899 flat angles P-C4'-P energy: -41.679 tors. eta vs tors. theta energy: -84.726 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -1075.584590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1075.584590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.134590 (E_RNA) where: Base-Base interactions energy: -659.421 where: short stacking energy: -269.658 Base-Backbone interact. energy: -1.278 local terms energy: -278.436275 where: bonds (distance) C4'-P energy: -54.942 bonds (distance) P-C4' energy: -46.169 flat angles C4'-P-C4' energy: -61.159 flat angles P-C4'-P energy: -37.837 tors. eta vs tors. theta energy: -78.329 Dist. restrs. and SS energy: -160.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -932.902896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -932.902896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.452896 (E_RNA) where: Base-Base interactions energy: -559.745 where: short stacking energy: -255.226 Base-Backbone interact. energy: -2.435 local terms energy: -270.272233 where: bonds (distance) C4'-P energy: -49.511 bonds (distance) P-C4' energy: -53.365 flat angles C4'-P-C4' energy: -64.556 flat angles P-C4'-P energy: -41.561 tors. eta vs tors. theta energy: -61.279 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -1042.092240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1042.092240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -893.042240 (E_RNA) where: Base-Base interactions energy: -604.507 where: short stacking energy: -247.548 Base-Backbone interact. energy: -3.068 local terms energy: -285.467742 where: bonds (distance) C4'-P energy: -62.436 bonds (distance) P-C4' energy: -60.800 flat angles C4'-P-C4' energy: -61.127 flat angles P-C4'-P energy: -32.939 tors. eta vs tors. theta energy: -68.166 Dist. restrs. and SS energy: -172.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -879.543805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.543805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -807.893805 (E_RNA) where: Base-Base interactions energy: -561.375 where: short stacking energy: -208.418 Base-Backbone interact. energy: -0.946 local terms energy: -245.573144 where: bonds (distance) C4'-P energy: -63.265 bonds (distance) P-C4' energy: -49.947 flat angles C4'-P-C4' energy: -51.182 flat angles P-C4'-P energy: -31.964 tors. eta vs tors. theta energy: -49.216 Dist. restrs. and SS energy: -95.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -804.624939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -804.624939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.974939 (E_RNA) where: Base-Base interactions energy: -512.366 where: short stacking energy: -220.146 Base-Backbone interact. energy: 0.655 local terms energy: -212.263083 where: bonds (distance) C4'-P energy: -35.853 bonds (distance) P-C4' energy: -55.832 flat angles C4'-P-C4' energy: -41.639 flat angles P-C4'-P energy: -28.438 tors. eta vs tors. theta energy: -50.501 Dist. restrs. and SS energy: -104.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -862.215489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.215489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.565489 (E_RNA) where: Base-Base interactions energy: -536.901 where: short stacking energy: -200.415 Base-Backbone interact. energy: 1.194 local terms energy: -218.858475 where: bonds (distance) C4'-P energy: -46.520 bonds (distance) P-C4' energy: -62.830 flat angles C4'-P-C4' energy: -51.024 flat angles P-C4'-P energy: -20.918 tors. eta vs tors. theta energy: -37.567 Dist. restrs. and SS energy: -131.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -651.442188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.442188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.192188 (E_RNA) where: Base-Base interactions energy: -362.374 where: short stacking energy: -175.950 Base-Backbone interact. energy: -0.484 local terms energy: -222.334525 where: bonds (distance) C4'-P energy: -56.189 bonds (distance) P-C4' energy: -51.373 flat angles C4'-P-C4' energy: -48.358 flat angles P-C4'-P energy: -25.089 tors. eta vs tors. theta energy: -41.326 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -606.530656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.530656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.280656 (E_RNA) where: Base-Base interactions energy: -345.581 where: short stacking energy: -150.624 Base-Backbone interact. energy: 0.963 local terms energy: -195.662337 where: bonds (distance) C4'-P energy: -52.365 bonds (distance) P-C4' energy: -44.440 flat angles C4'-P-C4' energy: -44.903 flat angles P-C4'-P energy: -29.822 tors. eta vs tors. theta energy: -24.133 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -1201.735103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1201.735103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1031.085103 (E_RNA) where: Base-Base interactions energy: -727.405 where: short stacking energy: -299.600 Base-Backbone interact. energy: -0.257 local terms energy: -303.422705 where: bonds (distance) C4'-P energy: -55.419 bonds (distance) P-C4' energy: -50.227 flat angles C4'-P-C4' energy: -67.688 flat angles P-C4'-P energy: -45.798 tors. eta vs tors. theta energy: -84.290 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -1136.061714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1136.061714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -987.011714 (E_RNA) where: Base-Base interactions energy: -678.133 where: short stacking energy: -272.992 Base-Backbone interact. energy: -1.680 local terms energy: -307.198193 where: bonds (distance) C4'-P energy: -57.808 bonds (distance) P-C4' energy: -61.399 flat angles C4'-P-C4' energy: -62.091 flat angles P-C4'-P energy: -46.962 tors. eta vs tors. theta energy: -78.938 Dist. restrs. and SS energy: -172.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -1085.461225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.461225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -950.811225 (E_RNA) where: Base-Base interactions energy: -658.924 where: short stacking energy: -279.454 Base-Backbone interact. energy: -1.498 local terms energy: -290.389873 where: bonds (distance) C4'-P energy: -49.210 bonds (distance) P-C4' energy: -49.048 flat angles C4'-P-C4' energy: -68.210 flat angles P-C4'-P energy: -43.810 tors. eta vs tors. theta energy: -80.112 Dist. restrs. and SS energy: -158.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -950.780928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -950.780928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.730928 (E_RNA) where: Base-Base interactions energy: -578.885 where: short stacking energy: -252.176 Base-Backbone interact. energy: 0.382 local terms energy: -277.227927 where: bonds (distance) C4'-P energy: -50.642 bonds (distance) P-C4' energy: -54.765 flat angles C4'-P-C4' energy: -62.104 flat angles P-C4'-P energy: -38.647 tors. eta vs tors. theta energy: -71.069 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -1083.938416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.938416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.288416 (E_RNA) where: Base-Base interactions energy: -650.223 where: short stacking energy: -280.394 Base-Backbone interact. energy: 0.451 local terms energy: -281.517049 where: bonds (distance) C4'-P energy: -55.539 bonds (distance) P-C4' energy: -57.749 flat angles C4'-P-C4' energy: -65.001 flat angles P-C4'-P energy: -32.377 tors. eta vs tors. theta energy: -70.851 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -858.839892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.839892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.189892 (E_RNA) where: Base-Base interactions energy: -522.619 where: short stacking energy: -204.621 Base-Backbone interact. energy: 0.303 local terms energy: -264.873431 where: bonds (distance) C4'-P energy: -51.970 bonds (distance) P-C4' energy: -60.977 flat angles C4'-P-C4' energy: -68.615 flat angles P-C4'-P energy: -34.148 tors. eta vs tors. theta energy: -49.163 Dist. restrs. and SS energy: -95.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -918.402211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -918.402211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.952211 (E_RNA) where: Base-Base interactions energy: -556.573 where: short stacking energy: -209.498 Base-Backbone interact. energy: -2.067 local terms energy: -241.312488 where: bonds (distance) C4'-P energy: -57.738 bonds (distance) P-C4' energy: -48.582 flat angles C4'-P-C4' energy: -57.999 flat angles P-C4'-P energy: -38.391 tors. eta vs tors. theta energy: -38.602 Dist. restrs. and SS energy: -142.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -775.243054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.243054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.993054 (E_RNA) where: Base-Base interactions energy: -475.950 where: short stacking energy: -206.946 Base-Backbone interact. energy: -1.382 local terms energy: -213.661105 where: bonds (distance) C4'-P energy: -37.877 bonds (distance) P-C4' energy: -43.589 flat angles C4'-P-C4' energy: -57.082 flat angles P-C4'-P energy: -30.151 tors. eta vs tors. theta energy: -44.962 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -648.298565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.298565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.448565 (E_RNA) where: Base-Base interactions energy: -362.743 where: short stacking energy: -154.822 Base-Backbone interact. energy: -2.622 local terms energy: -213.083520 where: bonds (distance) C4'-P energy: -57.059 bonds (distance) P-C4' energy: -46.007 flat angles C4'-P-C4' energy: -52.116 flat angles P-C4'-P energy: -32.345 tors. eta vs tors. theta energy: -25.558 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -601.965557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.965557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.915557 (E_RNA) where: Base-Base interactions energy: -341.080 where: short stacking energy: -158.525 Base-Backbone interact. energy: 0.982 local terms energy: -193.817935 where: bonds (distance) C4'-P energy: -42.926 bonds (distance) P-C4' energy: -47.330 flat angles C4'-P-C4' energy: -57.208 flat angles P-C4'-P energy: -18.376 tors. eta vs tors. theta energy: -27.977 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -1209.489179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1209.489179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.639179 (E_RNA) where: Base-Base interactions energy: -718.066 where: short stacking energy: -280.488 Base-Backbone interact. energy: -1.441 local terms energy: -321.132219 where: bonds (distance) C4'-P energy: -55.110 bonds (distance) P-C4' energy: -62.210 flat angles C4'-P-C4' energy: -65.197 flat angles P-C4'-P energy: -56.378 tors. eta vs tors. theta energy: -82.237 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -1142.083820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1142.083820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -989.433820 (E_RNA) where: Base-Base interactions energy: -689.111 where: short stacking energy: -288.532 Base-Backbone interact. energy: -1.176 local terms energy: -299.147332 where: bonds (distance) C4'-P energy: -53.902 bonds (distance) P-C4' energy: -57.720 flat angles C4'-P-C4' energy: -65.260 flat angles P-C4'-P energy: -40.916 tors. eta vs tors. theta energy: -81.349 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -1072.240020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1072.240020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -950.190020 (E_RNA) where: Base-Base interactions energy: -648.513 where: short stacking energy: -251.314 Base-Backbone interact. energy: 0.204 local terms energy: -301.881075 where: bonds (distance) C4'-P energy: -61.555 bonds (distance) P-C4' energy: -62.704 flat angles C4'-P-C4' energy: -67.359 flat angles P-C4'-P energy: -34.972 tors. eta vs tors. theta energy: -75.291 Dist. restrs. and SS energy: -145.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -1095.663143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.663143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -941.213143 (E_RNA) where: Base-Base interactions energy: -640.758 where: short stacking energy: -273.026 Base-Backbone interact. energy: 0.017 local terms energy: -300.472948 where: bonds (distance) C4'-P energy: -52.767 bonds (distance) P-C4' energy: -57.906 flat angles C4'-P-C4' energy: -59.972 flat angles P-C4'-P energy: -49.618 tors. eta vs tors. theta energy: -80.210 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -956.645840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -956.645840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -854.395840 (E_RNA) where: Base-Base interactions energy: -582.347 where: short stacking energy: -252.350 Base-Backbone interact. energy: -0.809 local terms energy: -271.239533 where: bonds (distance) C4'-P energy: -48.964 bonds (distance) P-C4' energy: -48.766 flat angles C4'-P-C4' energy: -56.707 flat angles P-C4'-P energy: -42.089 tors. eta vs tors. theta energy: -74.714 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -939.058108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -939.058108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -818.808108 (E_RNA) where: Base-Base interactions energy: -579.815 where: short stacking energy: -221.046 Base-Backbone interact. energy: 0.914 local terms energy: -239.907818 where: bonds (distance) C4'-P energy: -34.368 bonds (distance) P-C4' energy: -59.752 flat angles C4'-P-C4' energy: -59.463 flat angles P-C4'-P energy: -44.289 tors. eta vs tors. theta energy: -42.036 Dist. restrs. and SS energy: -144.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -812.451843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.451843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.001843 (E_RNA) where: Base-Base interactions energy: -502.959 where: short stacking energy: -195.814 Base-Backbone interact. energy: -2.818 local terms energy: -233.224810 where: bonds (distance) C4'-P energy: -45.262 bonds (distance) P-C4' energy: -62.654 flat angles C4'-P-C4' energy: -50.410 flat angles P-C4'-P energy: -33.276 tors. eta vs tors. theta energy: -41.623 Dist. restrs. and SS energy: -97.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -793.361385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -793.361385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.111385 (E_RNA) where: Base-Base interactions energy: -481.877 where: short stacking energy: -196.406 Base-Backbone interact. energy: 4.243 local terms energy: -231.476609 where: bonds (distance) C4'-P energy: -56.020 bonds (distance) P-C4' energy: -52.128 flat angles C4'-P-C4' energy: -46.550 flat angles P-C4'-P energy: -36.959 tors. eta vs tors. theta energy: -39.819 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -614.983531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.983531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.733531 (E_RNA) where: Base-Base interactions energy: -345.468 where: short stacking energy: -159.732 Base-Backbone interact. energy: -0.926 local terms energy: -202.339762 where: bonds (distance) C4'-P energy: -46.610 bonds (distance) P-C4' energy: -44.009 flat angles C4'-P-C4' energy: -53.619 flat angles P-C4'-P energy: -33.036 tors. eta vs tors. theta energy: -25.066 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -585.895590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.895590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.645590 (E_RNA) where: Base-Base interactions energy: -322.005 where: short stacking energy: -138.681 Base-Backbone interact. energy: 8.926 local terms energy: -206.566888 where: bonds (distance) C4'-P energy: -42.138 bonds (distance) P-C4' energy: -48.367 flat angles C4'-P-C4' energy: -48.027 flat angles P-C4'-P energy: -40.790 tors. eta vs tors. theta energy: -27.244 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -1206.608467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.608467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1035.958467 (E_RNA) where: Base-Base interactions energy: -738.840 where: short stacking energy: -305.087 Base-Backbone interact. energy: 0.587 local terms energy: -297.706214 where: bonds (distance) C4'-P energy: -51.534 bonds (distance) P-C4' energy: -52.030 flat angles C4'-P-C4' energy: -61.711 flat angles P-C4'-P energy: -49.388 tors. eta vs tors. theta energy: -83.042 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -1139.564695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1139.564695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -988.714695 (E_RNA) where: Base-Base interactions energy: -675.979 where: short stacking energy: -286.425 Base-Backbone interact. energy: 1.352 local terms energy: -314.087670 where: bonds (distance) C4'-P energy: -60.945 bonds (distance) P-C4' energy: -67.080 flat angles C4'-P-C4' energy: -62.829 flat angles P-C4'-P energy: -44.744 tors. eta vs tors. theta energy: -78.490 Dist. restrs. and SS energy: -174.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -1152.183905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1152.183905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -997.733905 (E_RNA) where: Base-Base interactions energy: -695.115 where: short stacking energy: -282.290 Base-Backbone interact. energy: -0.955 local terms energy: -301.664656 where: bonds (distance) C4'-P energy: -63.898 bonds (distance) P-C4' energy: -53.978 flat angles C4'-P-C4' energy: -61.425 flat angles P-C4'-P energy: -44.316 tors. eta vs tors. theta energy: -78.048 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -1050.416809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1050.416809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -921.166809 (E_RNA) where: Base-Base interactions energy: -640.714 where: short stacking energy: -265.630 Base-Backbone interact. energy: -1.733 local terms energy: -278.719638 where: bonds (distance) C4'-P energy: -48.506 bonds (distance) P-C4' energy: -49.329 flat angles C4'-P-C4' energy: -64.015 flat angles P-C4'-P energy: -38.668 tors. eta vs tors. theta energy: -78.202 Dist. restrs. and SS energy: -153.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -945.622856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.622856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -825.372856 (E_RNA) where: Base-Base interactions energy: -572.191 where: short stacking energy: -232.475 Base-Backbone interact. energy: -1.597 local terms energy: -251.584853 where: bonds (distance) C4'-P energy: -53.213 bonds (distance) P-C4' energy: -56.238 flat angles C4'-P-C4' energy: -56.613 flat angles P-C4'-P energy: -35.385 tors. eta vs tors. theta energy: -50.136 Dist. restrs. and SS energy: -144.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -911.104561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -911.104561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -810.654561 (E_RNA) where: Base-Base interactions energy: -552.240 where: short stacking energy: -229.192 Base-Backbone interact. energy: 1.477 local terms energy: -259.891550 where: bonds (distance) C4'-P energy: -54.961 bonds (distance) P-C4' energy: -53.998 flat angles C4'-P-C4' energy: -55.264 flat angles P-C4'-P energy: -32.372 tors. eta vs tors. theta energy: -63.296 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -769.323728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.323728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.873728 (E_RNA) where: Base-Base interactions energy: -483.100 where: short stacking energy: -182.553 Base-Backbone interact. energy: -2.307 local terms energy: -219.466077 where: bonds (distance) C4'-P energy: -51.256 bonds (distance) P-C4' energy: -55.497 flat angles C4'-P-C4' energy: -53.101 flat angles P-C4'-P energy: -22.948 tors. eta vs tors. theta energy: -36.664 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -754.661636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -754.661636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.411636 (E_RNA) where: Base-Base interactions energy: -436.009 where: short stacking energy: -169.392 Base-Backbone interact. energy: 0.855 local terms energy: -235.258202 where: bonds (distance) C4'-P energy: -45.837 bonds (distance) P-C4' energy: -64.967 flat angles C4'-P-C4' energy: -45.573 flat angles P-C4'-P energy: -43.514 tors. eta vs tors. theta energy: -35.367 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -625.377893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -625.377893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.327893 (E_RNA) where: Base-Base interactions energy: -346.307 where: short stacking energy: -139.275 Base-Backbone interact. energy: 2.151 local terms energy: -213.172196 where: bonds (distance) C4'-P energy: -59.988 bonds (distance) P-C4' energy: -59.350 flat angles C4'-P-C4' energy: -47.251 flat angles P-C4'-P energy: -31.031 tors. eta vs tors. theta energy: -15.553 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -604.493257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.493257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.243257 (E_RNA) where: Base-Base interactions energy: -346.932 where: short stacking energy: -145.578 Base-Backbone interact. energy: -2.311 local terms energy: -189.000004 where: bonds (distance) C4'-P energy: -43.675 bonds (distance) P-C4' energy: -50.935 flat angles C4'-P-C4' energy: -53.370 flat angles P-C4'-P energy: -24.458 tors. eta vs tors. theta energy: -16.563 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -1235.923207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1235.923207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1067.073207 (E_RNA) where: Base-Base interactions energy: -736.206 where: short stacking energy: -312.243 Base-Backbone interact. energy: -2.375 local terms energy: -328.492032 where: bonds (distance) C4'-P energy: -56.763 bonds (distance) P-C4' energy: -56.196 flat angles C4'-P-C4' energy: -72.304 flat angles P-C4'-P energy: -51.811 tors. eta vs tors. theta energy: -91.418 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -1192.597753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1192.597753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.147753 (E_RNA) where: Base-Base interactions energy: -715.288 where: short stacking energy: -270.112 Base-Backbone interact. energy: -2.594 local terms energy: -320.266271 where: bonds (distance) C4'-P energy: -53.547 bonds (distance) P-C4' energy: -62.509 flat angles C4'-P-C4' energy: -69.411 flat angles P-C4'-P energy: -44.624 tors. eta vs tors. theta energy: -90.176 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -1094.280824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1094.280824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -941.630824 (E_RNA) where: Base-Base interactions energy: -648.082 where: short stacking energy: -285.098 Base-Backbone interact. energy: -2.721 local terms energy: -290.827937 where: bonds (distance) C4'-P energy: -49.912 bonds (distance) P-C4' energy: -65.900 flat angles C4'-P-C4' energy: -63.258 flat angles P-C4'-P energy: -38.406 tors. eta vs tors. theta energy: -73.352 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -1067.536083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.536083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -932.886083 (E_RNA) where: Base-Base interactions energy: -632.127 where: short stacking energy: -265.128 Base-Backbone interact. energy: -0.839 local terms energy: -299.920437 where: bonds (distance) C4'-P energy: -59.484 bonds (distance) P-C4' energy: -60.002 flat angles C4'-P-C4' energy: -64.967 flat angles P-C4'-P energy: -43.004 tors. eta vs tors. theta energy: -72.463 Dist. restrs. and SS energy: -158.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -979.992205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -979.992205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -854.342205 (E_RNA) where: Base-Base interactions energy: -602.041 where: short stacking energy: -219.337 Base-Backbone interact. energy: 2.394 local terms energy: -254.694996 where: bonds (distance) C4'-P energy: -55.379 bonds (distance) P-C4' energy: -63.388 flat angles C4'-P-C4' energy: -50.486 flat angles P-C4'-P energy: -31.608 tors. eta vs tors. theta energy: -53.835 Dist. restrs. and SS energy: -149.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -922.007811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.007811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -828.757811 (E_RNA) where: Base-Base interactions energy: -582.697 where: short stacking energy: -247.967 Base-Backbone interact. energy: -1.786 local terms energy: -244.274234 where: bonds (distance) C4'-P energy: -46.812 bonds (distance) P-C4' energy: -56.103 flat angles C4'-P-C4' energy: -48.083 flat angles P-C4'-P energy: -27.688 tors. eta vs tors. theta energy: -65.588 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -741.918001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -741.918001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.068001 (E_RNA) where: Base-Base interactions energy: -456.580 where: short stacking energy: -159.537 Base-Backbone interact. energy: -0.824 local terms energy: -214.663951 where: bonds (distance) C4'-P energy: -53.644 bonds (distance) P-C4' energy: -49.429 flat angles C4'-P-C4' energy: -50.758 flat angles P-C4'-P energy: -38.303 tors. eta vs tors. theta energy: -22.531 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -767.845031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.845031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.595031 (E_RNA) where: Base-Base interactions energy: -468.615 where: short stacking energy: -186.961 Base-Backbone interact. energy: -1.091 local terms energy: -213.888699 where: bonds (distance) C4'-P energy: -39.866 bonds (distance) P-C4' energy: -49.037 flat angles C4'-P-C4' energy: -48.837 flat angles P-C4'-P energy: -32.424 tors. eta vs tors. theta energy: -43.726 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -605.096657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.096657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.246657 (E_RNA) where: Base-Base interactions energy: -335.092 where: short stacking energy: -130.886 Base-Backbone interact. energy: -1.216 local terms energy: -198.939072 where: bonds (distance) C4'-P energy: -56.027 bonds (distance) P-C4' energy: -54.301 flat angles C4'-P-C4' energy: -40.680 flat angles P-C4'-P energy: -34.838 tors. eta vs tors. theta energy: -13.093 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -600.560131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.560131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.310131 (E_RNA) where: Base-Base interactions energy: -339.815 where: short stacking energy: -148.224 Base-Backbone interact. energy: -1.938 local terms energy: -192.557921 where: bonds (distance) C4'-P energy: -48.494 bonds (distance) P-C4' energy: -51.812 flat angles C4'-P-C4' energy: -45.209 flat angles P-C4'-P energy: -30.232 tors. eta vs tors. theta energy: -16.811 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -1209.548429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1209.548429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1053.298429 (E_RNA) where: Base-Base interactions energy: -737.124 where: short stacking energy: -303.640 Base-Backbone interact. energy: -1.853 local terms energy: -314.321828 where: bonds (distance) C4'-P energy: -59.032 bonds (distance) P-C4' energy: -53.823 flat angles C4'-P-C4' energy: -65.250 flat angles P-C4'-P energy: -48.676 tors. eta vs tors. theta energy: -87.541 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -1190.695789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1190.695789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.845789 (E_RNA) where: Base-Base interactions energy: -703.049 where: short stacking energy: -308.498 Base-Backbone interact. energy: -1.470 local terms energy: -317.327650 where: bonds (distance) C4'-P energy: -56.472 bonds (distance) P-C4' energy: -65.514 flat angles C4'-P-C4' energy: -68.044 flat angles P-C4'-P energy: -47.933 tors. eta vs tors. theta energy: -79.365 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -1108.224908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1108.224908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.574908 (E_RNA) where: Base-Base interactions energy: -671.744 where: short stacking energy: -277.240 Base-Backbone interact. energy: -3.110 local terms energy: -280.720418 where: bonds (distance) C4'-P energy: -49.093 bonds (distance) P-C4' energy: -60.858 flat angles C4'-P-C4' energy: -55.790 flat angles P-C4'-P energy: -37.708 tors. eta vs tors. theta energy: -77.270 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -1054.331674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1054.331674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -921.481674 (E_RNA) where: Base-Base interactions energy: -625.377 where: short stacking energy: -247.778 Base-Backbone interact. energy: -1.504 local terms energy: -294.600481 where: bonds (distance) C4'-P energy: -55.666 bonds (distance) P-C4' energy: -63.166 flat angles C4'-P-C4' energy: -68.398 flat angles P-C4'-P energy: -40.321 tors. eta vs tors. theta energy: -67.050 Dist. restrs. and SS energy: -156.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -979.550088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -979.550088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.300088 (E_RNA) where: Base-Base interactions energy: -592.963 where: short stacking energy: -225.090 Base-Backbone interact. energy: -0.811 local terms energy: -265.526534 where: bonds (distance) C4'-P energy: -58.100 bonds (distance) P-C4' energy: -49.080 flat angles C4'-P-C4' energy: -67.089 flat angles P-C4'-P energy: -40.582 tors. eta vs tors. theta energy: -50.676 Dist. restrs. and SS energy: -144.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -913.434551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -913.434551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.784551 (E_RNA) where: Base-Base interactions energy: -555.456 where: short stacking energy: -218.414 Base-Backbone interact. energy: 1.506 local terms energy: -260.834777 where: bonds (distance) C4'-P energy: -60.865 bonds (distance) P-C4' energy: -55.685 flat angles C4'-P-C4' energy: -48.230 flat angles P-C4'-P energy: -45.069 tors. eta vs tors. theta energy: -50.987 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -779.864897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.864897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.414897 (E_RNA) where: Base-Base interactions energy: -452.537 where: short stacking energy: -188.558 Base-Backbone interact. energy: -1.580 local terms energy: -243.298696 where: bonds (distance) C4'-P energy: -40.379 bonds (distance) P-C4' energy: -57.613 flat angles C4'-P-C4' energy: -57.913 flat angles P-C4'-P energy: -40.729 tors. eta vs tors. theta energy: -46.664 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -739.297445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -739.297445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.247445 (E_RNA) where: Base-Base interactions energy: -452.536 where: short stacking energy: -181.357 Base-Backbone interact. energy: -1.145 local terms energy: -217.566344 where: bonds (distance) C4'-P energy: -57.785 bonds (distance) P-C4' energy: -50.686 flat angles C4'-P-C4' energy: -47.061 flat angles P-C4'-P energy: -24.909 tors. eta vs tors. theta energy: -37.125 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -634.390438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -634.390438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.940438 (E_RNA) where: Base-Base interactions energy: -357.603 where: short stacking energy: -159.985 Base-Backbone interact. energy: 1.751 local terms energy: -205.088182 where: bonds (distance) C4'-P energy: -54.175 bonds (distance) P-C4' energy: -46.098 flat angles C4'-P-C4' energy: -60.497 flat angles P-C4'-P energy: -23.020 tors. eta vs tors. theta energy: -21.298 Dist. restrs. and SS energy: -97.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -648.127074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.127074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.077074 (E_RNA) where: Base-Base interactions energy: -387.152 where: short stacking energy: -157.369 Base-Backbone interact. energy: 1.352 local terms energy: -194.276693 where: bonds (distance) C4'-P energy: -43.323 bonds (distance) P-C4' energy: -50.909 flat angles C4'-P-C4' energy: -52.225 flat angles P-C4'-P energy: -21.836 tors. eta vs tors. theta energy: -25.984 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -1210.805530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1210.805530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1054.555530 (E_RNA) where: Base-Base interactions energy: -736.361 where: short stacking energy: -305.206 Base-Backbone interact. energy: -0.771 local terms energy: -317.422985 where: bonds (distance) C4'-P energy: -58.559 bonds (distance) P-C4' energy: -53.466 flat angles C4'-P-C4' energy: -64.654 flat angles P-C4'-P energy: -53.265 tors. eta vs tors. theta energy: -87.479 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -1196.833363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.833363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1026.183363 (E_RNA) where: Base-Base interactions energy: -710.455 where: short stacking energy: -288.832 Base-Backbone interact. energy: -1.288 local terms energy: -314.440408 where: bonds (distance) C4'-P energy: -55.014 bonds (distance) P-C4' energy: -52.919 flat angles C4'-P-C4' energy: -70.310 flat angles P-C4'-P energy: -50.461 tors. eta vs tors. theta energy: -85.736 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -1110.600683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1110.600683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.550683 (E_RNA) where: Base-Base interactions energy: -665.718 where: short stacking energy: -268.749 Base-Backbone interact. energy: -3.217 local terms energy: -292.616334 where: bonds (distance) C4'-P energy: -47.581 bonds (distance) P-C4' energy: -57.359 flat angles C4'-P-C4' energy: -69.957 flat angles P-C4'-P energy: -41.405 tors. eta vs tors. theta energy: -76.315 Dist. restrs. and SS energy: -172.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -1084.563148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1084.563148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.913148 (E_RNA) where: Base-Base interactions energy: -665.906 where: short stacking energy: -281.693 Base-Backbone interact. energy: -0.822 local terms energy: -283.185785 where: bonds (distance) C4'-P energy: -52.846 bonds (distance) P-C4' energy: -55.270 flat angles C4'-P-C4' energy: -55.512 flat angles P-C4'-P energy: -41.891 tors. eta vs tors. theta energy: -77.666 Dist. restrs. and SS energy: -158.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -986.588827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -986.588827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -864.538827 (E_RNA) where: Base-Base interactions energy: -616.527 where: short stacking energy: -233.029 Base-Backbone interact. energy: -0.421 local terms energy: -247.590780 where: bonds (distance) C4'-P energy: -53.308 bonds (distance) P-C4' energy: -55.032 flat angles C4'-P-C4' energy: -55.647 flat angles P-C4'-P energy: -36.181 tors. eta vs tors. theta energy: -47.422 Dist. restrs. and SS energy: -145.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -955.636028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -955.636028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -846.186028 (E_RNA) where: Base-Base interactions energy: -580.081 where: short stacking energy: -256.050 Base-Backbone interact. energy: -1.042 local terms energy: -265.063325 where: bonds (distance) C4'-P energy: -53.296 bonds (distance) P-C4' energy: -45.313 flat angles C4'-P-C4' energy: -53.909 flat angles P-C4'-P energy: -42.213 tors. eta vs tors. theta energy: -70.332 Dist. restrs. and SS energy: -133.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -813.711931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.711931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.861931 (E_RNA) where: Base-Base interactions energy: -475.393 where: short stacking energy: -181.702 Base-Backbone interact. energy: -2.347 local terms energy: -221.122529 where: bonds (distance) C4'-P energy: -56.297 bonds (distance) P-C4' energy: -55.275 flat angles C4'-P-C4' energy: -47.565 flat angles P-C4'-P energy: -26.518 tors. eta vs tors. theta energy: -35.466 Dist. restrs. and SS energy: -138.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -722.325483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.325483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.075483 (E_RNA) where: Base-Base interactions energy: -429.913 where: short stacking energy: -179.613 Base-Backbone interact. energy: 4.842 local terms energy: -231.003858 where: bonds (distance) C4'-P energy: -48.051 bonds (distance) P-C4' energy: -57.316 flat angles C4'-P-C4' energy: -47.031 flat angles P-C4'-P energy: -35.061 tors. eta vs tors. theta energy: -43.545 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -619.417902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.417902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.767902 (E_RNA) where: Base-Base interactions energy: -354.145 where: short stacking energy: -140.763 Base-Backbone interact. energy: 3.378 local terms energy: -179.000694 where: bonds (distance) C4'-P energy: -42.049 bonds (distance) P-C4' energy: -52.099 flat angles C4'-P-C4' energy: -43.287 flat angles P-C4'-P energy: -23.801 tors. eta vs tors. theta energy: -17.765 Dist. restrs. and SS energy: -113.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -605.410424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.410424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.360424 (E_RNA) where: Base-Base interactions energy: -323.021 where: short stacking energy: -139.624 Base-Backbone interact. energy: -1.805 local terms energy: -212.534547 where: bonds (distance) C4'-P energy: -37.420 bonds (distance) P-C4' energy: -57.297 flat angles C4'-P-C4' energy: -51.526 flat angles P-C4'-P energy: -32.919 tors. eta vs tors. theta energy: -33.372 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -1188.255722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1188.255722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1032.005722 (E_RNA) where: Base-Base interactions energy: -725.902 where: short stacking energy: -300.542 Base-Backbone interact. energy: -1.950 local terms energy: -304.153604 where: bonds (distance) C4'-P energy: -61.729 bonds (distance) P-C4' energy: -52.820 flat angles C4'-P-C4' energy: -58.307 flat angles P-C4'-P energy: -43.368 tors. eta vs tors. theta energy: -87.930 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -1201.729732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1201.729732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1034.679732 (E_RNA) where: Base-Base interactions energy: -723.599 where: short stacking energy: -295.524 Base-Backbone interact. energy: -0.341 local terms energy: -310.739404 where: bonds (distance) C4'-P energy: -55.732 bonds (distance) P-C4' energy: -63.254 flat angles C4'-P-C4' energy: -64.734 flat angles P-C4'-P energy: -44.642 tors. eta vs tors. theta energy: -82.378 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -1120.943188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1120.943188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -971.893188 (E_RNA) where: Base-Base interactions energy: -651.880 where: short stacking energy: -260.626 Base-Backbone interact. energy: 0.886 local terms energy: -320.899967 where: bonds (distance) C4'-P energy: -66.257 bonds (distance) P-C4' energy: -66.804 flat angles C4'-P-C4' energy: -66.743 flat angles P-C4'-P energy: -47.295 tors. eta vs tors. theta energy: -73.801 Dist. restrs. and SS energy: -172.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -1060.650895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.650895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.000895 (E_RNA) where: Base-Base interactions energy: -632.744 where: short stacking energy: -266.176 Base-Backbone interact. energy: 0.345 local terms energy: -293.602152 where: bonds (distance) C4'-P energy: -53.674 bonds (distance) P-C4' energy: -48.533 flat angles C4'-P-C4' energy: -69.178 flat angles P-C4'-P energy: -43.576 tors. eta vs tors. theta energy: -78.641 Dist. restrs. and SS energy: -158.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -977.562068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.562068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -851.912068 (E_RNA) where: Base-Base interactions energy: -612.005 where: short stacking energy: -242.825 Base-Backbone interact. energy: 3.735 local terms energy: -243.641791 where: bonds (distance) C4'-P energy: -47.005 bonds (distance) P-C4' energy: -47.659 flat angles C4'-P-C4' energy: -57.400 flat angles P-C4'-P energy: -39.566 tors. eta vs tors. theta energy: -52.012 Dist. restrs. and SS energy: -149.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -888.757400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -888.757400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.707400 (E_RNA) where: Base-Base interactions energy: -517.598 where: short stacking energy: -216.669 Base-Backbone interact. energy: -2.006 local terms energy: -274.103485 where: bonds (distance) C4'-P energy: -56.719 bonds (distance) P-C4' energy: -54.146 flat angles C4'-P-C4' energy: -56.902 flat angles P-C4'-P energy: -46.065 tors. eta vs tors. theta energy: -60.272 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -875.586632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.586632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.136632 (E_RNA) where: Base-Base interactions energy: -528.571 where: short stacking energy: -221.190 Base-Backbone interact. energy: 2.389 local terms energy: -230.955233 where: bonds (distance) C4'-P energy: -46.847 bonds (distance) P-C4' energy: -40.777 flat angles C4'-P-C4' energy: -59.701 flat angles P-C4'-P energy: -36.140 tors. eta vs tors. theta energy: -47.491 Dist. restrs. and SS energy: -142.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -734.766762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.766762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.716762 (E_RNA) where: Base-Base interactions energy: -469.747 where: short stacking energy: -198.063 Base-Backbone interact. energy: 0.027 local terms energy: -196.997270 where: bonds (distance) C4'-P energy: -37.036 bonds (distance) P-C4' energy: -51.535 flat angles C4'-P-C4' energy: -48.575 flat angles P-C4'-P energy: -29.312 tors. eta vs tors. theta energy: -30.539 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -586.655079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.655079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.005079 (E_RNA) where: Base-Base interactions energy: -311.307 where: short stacking energy: -130.633 Base-Backbone interact. energy: -0.612 local terms energy: -203.085823 where: bonds (distance) C4'-P energy: -53.895 bonds (distance) P-C4' energy: -56.390 flat angles C4'-P-C4' energy: -54.775 flat angles P-C4'-P energy: -24.689 tors. eta vs tors. theta energy: -13.337 Dist. restrs. and SS energy: -95.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -629.422457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.422457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.372457 (E_RNA) where: Base-Base interactions energy: -354.129 where: short stacking energy: -159.785 Base-Backbone interact. energy: 0.146 local terms energy: -207.389517 where: bonds (distance) C4'-P energy: -53.062 bonds (distance) P-C4' energy: -39.958 flat angles C4'-P-C4' energy: -49.822 flat angles P-C4'-P energy: -33.467 tors. eta vs tors. theta energy: -31.081 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -1228.297413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1228.297413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.847413 (E_RNA) where: Base-Base interactions energy: -732.908 where: short stacking energy: -299.909 Base-Backbone interact. energy: -3.751 local terms energy: -337.188617 where: bonds (distance) C4'-P energy: -62.803 bonds (distance) P-C4' energy: -59.195 flat angles C4'-P-C4' energy: -69.025 flat angles P-C4'-P energy: -50.146 tors. eta vs tors. theta energy: -96.021 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -1172.767970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1172.767970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1002.117970 (E_RNA) where: Base-Base interactions energy: -689.147 where: short stacking energy: -295.221 Base-Backbone interact. energy: -1.257 local terms energy: -311.713498 where: bonds (distance) C4'-P energy: -50.598 bonds (distance) P-C4' energy: -64.711 flat angles C4'-P-C4' energy: -67.765 flat angles P-C4'-P energy: -44.188 tors. eta vs tors. theta energy: -84.450 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -1110.501235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1110.501235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -957.851235 (E_RNA) where: Base-Base interactions energy: -660.068 where: short stacking energy: -254.580 Base-Backbone interact. energy: -1.721 local terms energy: -296.062182 where: bonds (distance) C4'-P energy: -64.326 bonds (distance) P-C4' energy: -49.079 flat angles C4'-P-C4' energy: -67.501 flat angles P-C4'-P energy: -46.256 tors. eta vs tors. theta energy: -68.901 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -1062.366136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1062.366136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -929.516136 (E_RNA) where: Base-Base interactions energy: -654.849 where: short stacking energy: -252.008 Base-Backbone interact. energy: 1.306 local terms energy: -275.973613 where: bonds (distance) C4'-P energy: -46.094 bonds (distance) P-C4' energy: -67.063 flat angles C4'-P-C4' energy: -52.088 flat angles P-C4'-P energy: -39.501 tors. eta vs tors. theta energy: -71.227 Dist. restrs. and SS energy: -156.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -987.426820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.426820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -861.776820 (E_RNA) where: Base-Base interactions energy: -590.438 where: short stacking energy: -236.763 Base-Backbone interact. energy: -2.314 local terms energy: -269.025413 where: bonds (distance) C4'-P energy: -61.837 bonds (distance) P-C4' energy: -59.688 flat angles C4'-P-C4' energy: -59.280 flat angles P-C4'-P energy: -39.341 tors. eta vs tors. theta energy: -48.879 Dist. restrs. and SS energy: -149.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -903.672918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -903.672918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -805.022918 (E_RNA) where: Base-Base interactions energy: -547.036 where: short stacking energy: -235.976 Base-Backbone interact. energy: -0.968 local terms energy: -257.019446 where: bonds (distance) C4'-P energy: -49.430 bonds (distance) P-C4' energy: -52.315 flat angles C4'-P-C4' energy: -56.731 flat angles P-C4'-P energy: -37.678 tors. eta vs tors. theta energy: -60.865 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -896.681517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.681517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.631517 (E_RNA) where: Base-Base interactions energy: -522.103 where: short stacking energy: -206.748 Base-Backbone interact. energy: -0.787 local terms energy: -224.741880 where: bonds (distance) C4'-P energy: -41.008 bonds (distance) P-C4' energy: -49.613 flat angles C4'-P-C4' energy: -60.265 flat angles P-C4'-P energy: -30.502 tors. eta vs tors. theta energy: -43.354 Dist. restrs. and SS energy: -172.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -747.794772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.794772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.744772 (E_RNA) where: Base-Base interactions energy: -463.709 where: short stacking energy: -186.192 Base-Backbone interact. energy: -0.163 local terms energy: -215.872121 where: bonds (distance) C4'-P energy: -41.300 bonds (distance) P-C4' energy: -53.220 flat angles C4'-P-C4' energy: -50.258 flat angles P-C4'-P energy: -24.060 tors. eta vs tors. theta energy: -47.034 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -698.552328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.552328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.702328 (E_RNA) where: Base-Base interactions energy: -382.717 where: short stacking energy: -152.247 Base-Backbone interact. energy: -1.703 local terms energy: -217.282964 where: bonds (distance) C4'-P energy: -56.886 bonds (distance) P-C4' energy: -56.308 flat angles C4'-P-C4' energy: -52.843 flat angles P-C4'-P energy: -26.048 tors. eta vs tors. theta energy: -25.198 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -603.500019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.500019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.050019 (E_RNA) where: Base-Base interactions energy: -329.421 where: short stacking energy: -140.957 Base-Backbone interact. energy: 0.933 local terms energy: -201.562266 where: bonds (distance) C4'-P energy: -56.425 bonds (distance) P-C4' energy: -55.685 flat angles C4'-P-C4' energy: -45.009 flat angles P-C4'-P energy: -27.185 tors. eta vs tors. theta energy: -17.258 Dist. restrs. and SS energy: -97.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -1226.047900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.047900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1071.597900 (E_RNA) where: Base-Base interactions energy: -731.695 where: short stacking energy: -297.426 Base-Backbone interact. energy: 0.726 local terms energy: -340.628651 where: bonds (distance) C4'-P energy: -67.945 bonds (distance) P-C4' energy: -59.203 flat angles C4'-P-C4' energy: -71.290 flat angles P-C4'-P energy: -50.782 tors. eta vs tors. theta energy: -91.407 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -1180.782756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1180.782756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1013.732756 (E_RNA) where: Base-Base interactions energy: -694.087 where: short stacking energy: -313.981 Base-Backbone interact. energy: 2.761 local terms energy: -322.407203 where: bonds (distance) C4'-P energy: -60.148 bonds (distance) P-C4' energy: -56.951 flat angles C4'-P-C4' energy: -66.001 flat angles P-C4'-P energy: -44.367 tors. eta vs tors. theta energy: -94.941 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -1114.113701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1114.113701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -959.663701 (E_RNA) where: Base-Base interactions energy: -664.845 where: short stacking energy: -260.205 Base-Backbone interact. energy: -1.800 local terms energy: -293.018880 where: bonds (distance) C4'-P energy: -49.175 bonds (distance) P-C4' energy: -58.683 flat angles C4'-P-C4' energy: -67.381 flat angles P-C4'-P energy: -45.073 tors. eta vs tors. theta energy: -72.707 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -1058.521613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.521613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -925.671613 (E_RNA) where: Base-Base interactions energy: -636.344 where: short stacking energy: -264.232 Base-Backbone interact. energy: -0.088 local terms energy: -289.240262 where: bonds (distance) C4'-P energy: -61.275 bonds (distance) P-C4' energy: -61.382 flat angles C4'-P-C4' energy: -60.234 flat angles P-C4'-P energy: -41.606 tors. eta vs tors. theta energy: -64.744 Dist. restrs. and SS energy: -156.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -1003.689490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1003.689490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.239490 (E_RNA) where: Base-Base interactions energy: -612.403 where: short stacking energy: -239.473 Base-Backbone interact. energy: 10.049 local terms energy: -282.885393 where: bonds (distance) C4'-P energy: -48.574 bonds (distance) P-C4' energy: -59.081 flat angles C4'-P-C4' energy: -66.692 flat angles P-C4'-P energy: -43.780 tors. eta vs tors. theta energy: -64.759 Dist. restrs. and SS energy: -142.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -881.388305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -881.388305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.338305 (E_RNA) where: Base-Base interactions energy: -515.093 where: short stacking energy: -219.533 Base-Backbone interact. energy: -0.223 local terms energy: -271.022410 where: bonds (distance) C4'-P energy: -53.230 bonds (distance) P-C4' energy: -49.081 flat angles C4'-P-C4' energy: -68.162 flat angles P-C4'-P energy: -33.389 tors. eta vs tors. theta energy: -67.160 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -951.687307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -951.687307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -808.037307 (E_RNA) where: Base-Base interactions energy: -547.071 where: short stacking energy: -218.890 Base-Backbone interact. energy: -2.427 local terms energy: -258.539249 where: bonds (distance) C4'-P energy: -48.395 bonds (distance) P-C4' energy: -55.820 flat angles C4'-P-C4' energy: -63.311 flat angles P-C4'-P energy: -37.874 tors. eta vs tors. theta energy: -53.140 Dist. restrs. and SS energy: -167.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -724.683235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.683235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.833235 (E_RNA) where: Base-Base interactions energy: -449.823 where: short stacking energy: -183.481 Base-Backbone interact. energy: 3.070 local terms energy: -208.080922 where: bonds (distance) C4'-P energy: -40.135 bonds (distance) P-C4' energy: -55.948 flat angles C4'-P-C4' energy: -57.409 flat angles P-C4'-P energy: -19.798 tors. eta vs tors. theta energy: -34.791 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -708.181014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.181014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.331014 (E_RNA) where: Base-Base interactions energy: -402.045 where: short stacking energy: -163.559 Base-Backbone interact. energy: 1.093 local terms energy: -210.379302 where: bonds (distance) C4'-P energy: -56.373 bonds (distance) P-C4' energy: -50.627 flat angles C4'-P-C4' energy: -45.981 flat angles P-C4'-P energy: -45.507 tors. eta vs tors. theta energy: -11.891 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -604.609047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.609047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.759047 (E_RNA) where: Base-Base interactions energy: -351.495 where: short stacking energy: -145.807 Base-Backbone interact. energy: 3.727 local terms energy: -186.990476 where: bonds (distance) C4'-P energy: -42.574 bonds (distance) P-C4' energy: -54.925 flat angles C4'-P-C4' energy: -45.068 flat angles P-C4'-P energy: -20.632 tors. eta vs tors. theta energy: -23.792 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -1221.107311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1221.107311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1068.457311 (E_RNA) where: Base-Base interactions energy: -728.726 where: short stacking energy: -297.176 Base-Backbone interact. energy: -2.668 local terms energy: -337.064118 where: bonds (distance) C4'-P energy: -61.921 bonds (distance) P-C4' energy: -57.436 flat angles C4'-P-C4' energy: -73.535 flat angles P-C4'-P energy: -54.449 tors. eta vs tors. theta energy: -89.722 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -1188.928937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1188.928937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.078937 (E_RNA) where: Base-Base interactions energy: -695.018 where: short stacking energy: -289.635 Base-Backbone interact. energy: -2.218 local terms energy: -322.843460 where: bonds (distance) C4'-P energy: -60.054 bonds (distance) P-C4' energy: -59.140 flat angles C4'-P-C4' energy: -70.981 flat angles P-C4'-P energy: -49.551 tors. eta vs tors. theta energy: -83.118 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -1141.309100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1141.309100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -990.459100 (E_RNA) where: Base-Base interactions energy: -706.470 where: short stacking energy: -284.649 Base-Backbone interact. energy: 0.318 local terms energy: -284.307291 where: bonds (distance) C4'-P energy: -50.567 bonds (distance) P-C4' energy: -57.809 flat angles C4'-P-C4' energy: -53.509 flat angles P-C4'-P energy: -42.864 tors. eta vs tors. theta energy: -79.559 Dist. restrs. and SS energy: -174.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -1069.631176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.631176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -929.581176 (E_RNA) where: Base-Base interactions energy: -639.816 where: short stacking energy: -286.727 Base-Backbone interact. energy: -0.953 local terms energy: -288.812107 where: bonds (distance) C4'-P energy: -63.658 bonds (distance) P-C4' energy: -47.052 flat angles C4'-P-C4' energy: -57.748 flat angles P-C4'-P energy: -37.045 tors. eta vs tors. theta energy: -83.310 Dist. restrs. and SS energy: -163.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -1005.072450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.072450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -877.622450 (E_RNA) where: Base-Base interactions energy: -594.328 where: short stacking energy: -233.691 Base-Backbone interact. energy: -1.916 local terms energy: -281.378331 where: bonds (distance) C4'-P energy: -56.808 bonds (distance) P-C4' energy: -59.573 flat angles C4'-P-C4' energy: -60.050 flat angles P-C4'-P energy: -45.510 tors. eta vs tors. theta energy: -59.438 Dist. restrs. and SS energy: -151.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -990.579379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -990.579379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.129379 (E_RNA) where: Base-Base interactions energy: -589.184 where: short stacking energy: -251.728 Base-Backbone interact. energy: 1.046 local terms energy: -256.991119 where: bonds (distance) C4'-P energy: -48.632 bonds (distance) P-C4' energy: -54.326 flat angles C4'-P-C4' energy: -57.203 flat angles P-C4'-P energy: -33.604 tors. eta vs tors. theta energy: -63.226 Dist. restrs. and SS energy: -169.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -883.723689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -883.723689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.873689 (E_RNA) where: Base-Base interactions energy: -523.529 where: short stacking energy: -219.176 Base-Backbone interact. energy: -1.626 local terms energy: -261.718750 where: bonds (distance) C4'-P energy: -56.320 bonds (distance) P-C4' energy: -49.834 flat angles C4'-P-C4' energy: -59.335 flat angles P-C4'-P energy: -35.597 tors. eta vs tors. theta energy: -60.633 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -726.588033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.588033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.738033 (E_RNA) where: Base-Base interactions energy: -407.856 where: short stacking energy: -154.859 Base-Backbone interact. energy: -1.509 local terms energy: -220.372936 where: bonds (distance) C4'-P energy: -50.038 bonds (distance) P-C4' energy: -59.508 flat angles C4'-P-C4' energy: -57.461 flat angles P-C4'-P energy: -35.178 tors. eta vs tors. theta energy: -18.188 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -671.966850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.966850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.316850 (E_RNA) where: Base-Base interactions energy: -390.474 where: short stacking energy: -156.786 Base-Backbone interact. energy: -2.921 local terms energy: -215.922010 where: bonds (distance) C4'-P energy: -43.585 bonds (distance) P-C4' energy: -60.326 flat angles C4'-P-C4' energy: -55.490 flat angles P-C4'-P energy: -23.798 tors. eta vs tors. theta energy: -32.723 Dist. restrs. and SS energy: -86.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -596.143796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.143796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.693796 (E_RNA) where: Base-Base interactions energy: -331.467 where: short stacking energy: -150.605 Base-Backbone interact. energy: 0.822 local terms energy: -201.049700 where: bonds (distance) C4'-P energy: -40.524 bonds (distance) P-C4' energy: -62.227 flat angles C4'-P-C4' energy: -48.274 flat angles P-C4'-P energy: -26.863 tors. eta vs tors. theta energy: -23.162 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -1221.002989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1221.002989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1066.552989 (E_RNA) where: Base-Base interactions energy: -743.945 where: short stacking energy: -302.758 Base-Backbone interact. energy: -4.294 local terms energy: -318.314043 where: bonds (distance) C4'-P energy: -51.848 bonds (distance) P-C4' energy: -64.655 flat angles C4'-P-C4' energy: -70.011 flat angles P-C4'-P energy: -40.527 tors. eta vs tors. theta energy: -91.274 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -1195.858898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1195.858898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1028.808898 (E_RNA) where: Base-Base interactions energy: -714.394 where: short stacking energy: -294.231 Base-Backbone interact. energy: -2.359 local terms energy: -312.056069 where: bonds (distance) C4'-P energy: -56.956 bonds (distance) P-C4' energy: -53.134 flat angles C4'-P-C4' energy: -63.583 flat angles P-C4'-P energy: -42.483 tors. eta vs tors. theta energy: -95.901 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -1116.783576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1116.783576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -967.733576 (E_RNA) where: Base-Base interactions energy: -675.822 where: short stacking energy: -280.855 Base-Backbone interact. energy: -0.750 local terms energy: -291.161232 where: bonds (distance) C4'-P energy: -54.474 bonds (distance) P-C4' energy: -56.714 flat angles C4'-P-C4' energy: -58.568 flat angles P-C4'-P energy: -42.869 tors. eta vs tors. theta energy: -78.537 Dist. restrs. and SS energy: -172.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -1076.998407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.998407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -935.148407 (E_RNA) where: Base-Base interactions energy: -639.803 where: short stacking energy: -284.515 Base-Backbone interact. energy: -1.834 local terms energy: -293.511135 where: bonds (distance) C4'-P energy: -55.265 bonds (distance) P-C4' energy: -51.541 flat angles C4'-P-C4' energy: -71.521 flat angles P-C4'-P energy: -43.395 tors. eta vs tors. theta energy: -71.789 Dist. restrs. and SS energy: -165.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -1007.880337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1007.880337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.230337 (E_RNA) where: Base-Base interactions energy: -606.797 where: short stacking energy: -247.358 Base-Backbone interact. energy: -2.832 local terms energy: -272.600703 where: bonds (distance) C4'-P energy: -57.120 bonds (distance) P-C4' energy: -61.955 flat angles C4'-P-C4' energy: -62.877 flat angles P-C4'-P energy: -34.352 tors. eta vs tors. theta energy: -56.297 Dist. restrs. and SS energy: -149.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -968.645027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -968.645027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.995027 (E_RNA) where: Base-Base interactions energy: -559.774 where: short stacking energy: -253.771 Base-Backbone interact. energy: -0.743 local terms energy: -264.478067 where: bonds (distance) C4'-P energy: -60.346 bonds (distance) P-C4' energy: -54.598 flat angles C4'-P-C4' energy: -53.966 flat angles P-C4'-P energy: -35.340 tors. eta vs tors. theta energy: -60.227 Dist. restrs. and SS energy: -167.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -798.737210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.737210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.087210 (E_RNA) where: Base-Base interactions energy: -477.147 where: short stacking energy: -194.741 Base-Backbone interact. energy: 3.026 local terms energy: -225.967056 where: bonds (distance) C4'-P energy: -48.575 bonds (distance) P-C4' energy: -57.398 flat angles C4'-P-C4' energy: -45.860 flat angles P-C4'-P energy: -33.180 tors. eta vs tors. theta energy: -40.954 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -725.061097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.061097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.011097 (E_RNA) where: Base-Base interactions energy: -410.080 where: short stacking energy: -163.691 Base-Backbone interact. energy: 5.218 local terms energy: -216.149248 where: bonds (distance) C4'-P energy: -48.950 bonds (distance) P-C4' energy: -53.714 flat angles C4'-P-C4' energy: -55.981 flat angles P-C4'-P energy: -32.503 tors. eta vs tors. theta energy: -25.002 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -630.419623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.419623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.169623 (E_RNA) where: Base-Base interactions energy: -358.551 where: short stacking energy: -160.960 Base-Backbone interact. energy: -0.806 local terms energy: -204.812495 where: bonds (distance) C4'-P energy: -41.299 bonds (distance) P-C4' energy: -52.251 flat angles C4'-P-C4' energy: -52.033 flat angles P-C4'-P energy: -28.618 tors. eta vs tors. theta energy: -30.611 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -635.382366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.382366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.332366 (E_RNA) where: Base-Base interactions energy: -354.616 where: short stacking energy: -157.366 Base-Backbone interact. energy: 0.390 local terms energy: -213.106272 where: bonds (distance) C4'-P energy: -53.552 bonds (distance) P-C4' energy: -45.367 flat angles C4'-P-C4' energy: -52.263 flat angles P-C4'-P energy: -27.400 tors. eta vs tors. theta energy: -34.524 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -1201.941633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1201.941633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1045.691633 (E_RNA) where: Base-Base interactions energy: -734.151 where: short stacking energy: -309.704 Base-Backbone interact. energy: -1.078 local terms energy: -310.462312 where: bonds (distance) C4'-P energy: -49.635 bonds (distance) P-C4' energy: -61.512 flat angles C4'-P-C4' energy: -67.170 flat angles P-C4'-P energy: -47.817 tors. eta vs tors. theta energy: -84.329 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -1176.083970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1176.083970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1005.433970 (E_RNA) where: Base-Base interactions energy: -687.941 where: short stacking energy: -303.391 Base-Backbone interact. energy: -1.024 local terms energy: -316.468758 where: bonds (distance) C4'-P energy: -63.061 bonds (distance) P-C4' energy: -60.641 flat angles C4'-P-C4' energy: -62.108 flat angles P-C4'-P energy: -40.461 tors. eta vs tors. theta energy: -90.196 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -1114.675223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1114.675223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.025223 (E_RNA) where: Base-Base interactions energy: -659.746 where: short stacking energy: -267.888 Base-Backbone interact. energy: 0.208 local terms energy: -302.487153 where: bonds (distance) C4'-P energy: -55.780 bonds (distance) P-C4' energy: -60.200 flat angles C4'-P-C4' energy: -67.111 flat angles P-C4'-P energy: -35.708 tors. eta vs tors. theta energy: -83.689 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -1068.978909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.978909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.128909 (E_RNA) where: Base-Base interactions energy: -643.146 where: short stacking energy: -253.393 Base-Backbone interact. energy: -2.827 local terms energy: -281.156084 where: bonds (distance) C4'-P energy: -56.895 bonds (distance) P-C4' energy: -45.396 flat angles C4'-P-C4' energy: -65.565 flat angles P-C4'-P energy: -45.743 tors. eta vs tors. theta energy: -67.557 Dist. restrs. and SS energy: -165.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -1030.339812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1030.339812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -906.489812 (E_RNA) where: Base-Base interactions energy: -641.743 where: short stacking energy: -241.736 Base-Backbone interact. energy: -0.512 local terms energy: -264.234505 where: bonds (distance) C4'-P energy: -57.046 bonds (distance) P-C4' energy: -49.454 flat angles C4'-P-C4' energy: -59.698 flat angles P-C4'-P energy: -26.937 tors. eta vs tors. theta energy: -71.099 Dist. restrs. and SS energy: -147.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -979.408873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -979.408873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -830.358873 (E_RNA) where: Base-Base interactions energy: -575.036 where: short stacking energy: -226.880 Base-Backbone interact. energy: -1.594 local terms energy: -253.728869 where: bonds (distance) C4'-P energy: -56.677 bonds (distance) P-C4' energy: -55.181 flat angles C4'-P-C4' energy: -58.521 flat angles P-C4'-P energy: -24.891 tors. eta vs tors. theta energy: -58.459 Dist. restrs. and SS energy: -172.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -843.485710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.485710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.435710 (E_RNA) where: Base-Base interactions energy: -498.792 where: short stacking energy: -213.556 Base-Backbone interact. energy: 0.595 local terms energy: -250.238474 where: bonds (distance) C4'-P energy: -46.961 bonds (distance) P-C4' energy: -50.769 flat angles C4'-P-C4' energy: -59.402 flat angles P-C4'-P energy: -40.143 tors. eta vs tors. theta energy: -52.963 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -803.213844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.213844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.163844 (E_RNA) where: Base-Base interactions energy: -464.070 where: short stacking energy: -186.678 Base-Backbone interact. energy: 0.631 local terms energy: -235.724278 where: bonds (distance) C4'-P energy: -53.842 bonds (distance) P-C4' energy: -58.097 flat angles C4'-P-C4' energy: -45.155 flat angles P-C4'-P energy: -47.582 tors. eta vs tors. theta energy: -31.049 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -616.503992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -616.503992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.453992 (E_RNA) where: Base-Base interactions energy: -368.639 where: short stacking energy: -159.428 Base-Backbone interact. energy: -0.196 local terms energy: -179.619403 where: bonds (distance) C4'-P energy: -42.567 bonds (distance) P-C4' energy: -43.024 flat angles C4'-P-C4' energy: -39.457 flat angles P-C4'-P energy: -27.483 tors. eta vs tors. theta energy: -27.089 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -614.186723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.186723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.336723 (E_RNA) where: Base-Base interactions energy: -329.373 where: short stacking energy: -153.630 Base-Backbone interact. energy: -1.204 local terms energy: -213.759427 where: bonds (distance) C4'-P energy: -40.383 bonds (distance) P-C4' energy: -49.844 flat angles C4'-P-C4' energy: -55.524 flat angles P-C4'-P energy: -36.769 tors. eta vs tors. theta energy: -31.240 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -1216.416745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1216.416745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.966745 (E_RNA) where: Base-Base interactions energy: -733.599 where: short stacking energy: -305.367 Base-Backbone interact. energy: -1.546 local terms energy: -326.821488 where: bonds (distance) C4'-P energy: -58.028 bonds (distance) P-C4' energy: -63.627 flat angles C4'-P-C4' energy: -65.332 flat angles P-C4'-P energy: -47.455 tors. eta vs tors. theta energy: -92.379 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -1181.551514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1181.551514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1012.701514 (E_RNA) where: Base-Base interactions energy: -694.979 where: short stacking energy: -309.774 Base-Backbone interact. energy: -2.486 local terms energy: -315.236534 where: bonds (distance) C4'-P energy: -57.626 bonds (distance) P-C4' energy: -56.413 flat angles C4'-P-C4' energy: -69.424 flat angles P-C4'-P energy: -42.662 tors. eta vs tors. theta energy: -89.112 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -1073.220183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.220183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -933.170183 (E_RNA) where: Base-Base interactions energy: -658.553 where: short stacking energy: -265.748 Base-Backbone interact. energy: -0.308 local terms energy: -274.309720 where: bonds (distance) C4'-P energy: -55.436 bonds (distance) P-C4' energy: -61.464 flat angles C4'-P-C4' energy: -60.219 flat angles P-C4'-P energy: -31.136 tors. eta vs tors. theta energy: -66.054 Dist. restrs. and SS energy: -163.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -1083.548344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.548344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -925.498344 (E_RNA) where: Base-Base interactions energy: -648.820 where: short stacking energy: -240.795 Base-Backbone interact. energy: -1.382 local terms energy: -275.296652 where: bonds (distance) C4'-P energy: -52.991 bonds (distance) P-C4' energy: -49.279 flat angles C4'-P-C4' energy: -62.300 flat angles P-C4'-P energy: -44.632 tors. eta vs tors. theta energy: -66.094 Dist. restrs. and SS energy: -181.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -1047.774807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.774807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.524807 (E_RNA) where: Base-Base interactions energy: -629.512 where: short stacking energy: -256.303 Base-Backbone interact. energy: -1.705 local terms energy: -296.307127 where: bonds (distance) C4'-P energy: -51.704 bonds (distance) P-C4' energy: -64.212 flat angles C4'-P-C4' energy: -68.038 flat angles P-C4'-P energy: -44.493 tors. eta vs tors. theta energy: -67.860 Dist. restrs. and SS energy: -144.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -1036.225926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1036.225926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.375926 (E_RNA) where: Base-Base interactions energy: -619.704 where: short stacking energy: -243.783 Base-Backbone interact. energy: 0.007 local terms energy: -265.679374 where: bonds (distance) C4'-P energy: -35.635 bonds (distance) P-C4' energy: -50.733 flat angles C4'-P-C4' energy: -66.468 flat angles P-C4'-P energy: -47.043 tors. eta vs tors. theta energy: -65.801 Dist. restrs. and SS energy: -174.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -797.557260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.557260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.907260 (E_RNA) where: Base-Base interactions energy: -454.373 where: short stacking energy: -189.892 Base-Backbone interact. energy: 0.412 local terms energy: -235.946276 where: bonds (distance) C4'-P energy: -53.708 bonds (distance) P-C4' energy: -64.365 flat angles C4'-P-C4' energy: -55.615 flat angles P-C4'-P energy: -26.045 tors. eta vs tors. theta energy: -36.213 Dist. restrs. and SS energy: -131.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -768.093828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.093828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.043828 (E_RNA) where: Base-Base interactions energy: -445.500 where: short stacking energy: -189.799 Base-Backbone interact. energy: -0.945 local terms energy: -226.599191 where: bonds (distance) C4'-P energy: -50.313 bonds (distance) P-C4' energy: -52.968 flat angles C4'-P-C4' energy: -50.784 flat angles P-C4'-P energy: -24.727 tors. eta vs tors. theta energy: -47.807 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -659.165474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.165474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.115474 (E_RNA) where: Base-Base interactions energy: -391.475 where: short stacking energy: -159.684 Base-Backbone interact. energy: 2.204 local terms energy: -201.843958 where: bonds (distance) C4'-P energy: -37.774 bonds (distance) P-C4' energy: -50.440 flat angles C4'-P-C4' energy: -44.567 flat angles P-C4'-P energy: -36.184 tors. eta vs tors. theta energy: -32.879 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -613.950550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.950550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.500550 (E_RNA) where: Base-Base interactions energy: -344.196 where: short stacking energy: -142.929 Base-Backbone interact. energy: 1.520 local terms energy: -206.824734 where: bonds (distance) C4'-P energy: -41.857 bonds (distance) P-C4' energy: -55.138 flat angles C4'-P-C4' energy: -47.647 flat angles P-C4'-P energy: -29.954 tors. eta vs tors. theta energy: -32.230 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -1229.324236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1229.324236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.074236 (E_RNA) where: Base-Base interactions energy: -727.243 where: short stacking energy: -301.101 Base-Backbone interact. energy: -2.483 local terms energy: -343.347682 where: bonds (distance) C4'-P energy: -65.771 bonds (distance) P-C4' energy: -63.013 flat angles C4'-P-C4' energy: -75.818 flat angles P-C4'-P energy: -52.098 tors. eta vs tors. theta energy: -86.648 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -1186.913995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1186.913995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1016.263995 (E_RNA) where: Base-Base interactions energy: -702.915 where: short stacking energy: -310.982 Base-Backbone interact. energy: -2.134 local terms energy: -311.214968 where: bonds (distance) C4'-P energy: -63.384 bonds (distance) P-C4' energy: -49.380 flat angles C4'-P-C4' energy: -58.389 flat angles P-C4'-P energy: -50.533 tors. eta vs tors. theta energy: -89.529 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -1084.864465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1084.864465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -946.614465 (E_RNA) where: Base-Base interactions energy: -664.684 where: short stacking energy: -265.064 Base-Backbone interact. energy: -0.101 local terms energy: -281.829697 where: bonds (distance) C4'-P energy: -55.316 bonds (distance) P-C4' energy: -60.787 flat angles C4'-P-C4' energy: -58.809 flat angles P-C4'-P energy: -36.708 tors. eta vs tors. theta energy: -70.210 Dist. restrs. and SS energy: -162.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -1087.521708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.521708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -936.671708 (E_RNA) where: Base-Base interactions energy: -657.664 where: short stacking energy: -260.297 Base-Backbone interact. energy: -0.854 local terms energy: -278.153384 where: bonds (distance) C4'-P energy: -56.747 bonds (distance) P-C4' energy: -58.962 flat angles C4'-P-C4' energy: -53.406 flat angles P-C4'-P energy: -39.015 tors. eta vs tors. theta energy: -70.023 Dist. restrs. and SS energy: -174.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -1012.587729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1012.587729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.137729 (E_RNA) where: Base-Base interactions energy: -608.288 where: short stacking energy: -228.912 Base-Backbone interact. energy: -3.650 local terms energy: -273.199489 where: bonds (distance) C4'-P energy: -52.424 bonds (distance) P-C4' energy: -55.534 flat angles C4'-P-C4' energy: -66.133 flat angles P-C4'-P energy: -41.420 tors. eta vs tors. theta energy: -57.688 Dist. restrs. and SS energy: -151.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -1033.539741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1033.539741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.289741 (E_RNA) where: Base-Base interactions energy: -610.575 where: short stacking energy: -242.063 Base-Backbone interact. energy: -0.985 local terms energy: -274.729990 where: bonds (distance) C4'-P energy: -54.060 bonds (distance) P-C4' energy: -51.919 flat angles C4'-P-C4' energy: -62.324 flat angles P-C4'-P energy: -42.216 tors. eta vs tors. theta energy: -64.212 Dist. restrs. and SS energy: -171.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -838.721006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.721006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.471006 (E_RNA) where: Base-Base interactions energy: -496.988 where: short stacking energy: -203.251 Base-Backbone interact. energy: -0.097 local terms energy: -221.386122 where: bonds (distance) C4'-P energy: -58.981 bonds (distance) P-C4' energy: -44.986 flat angles C4'-P-C4' energy: -53.245 flat angles P-C4'-P energy: -25.836 tors. eta vs tors. theta energy: -38.339 Dist. restrs. and SS energy: -144.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -791.472454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.472454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.422454 (E_RNA) where: Base-Base interactions energy: -459.763 where: short stacking energy: -190.087 Base-Backbone interact. energy: -0.788 local terms energy: -226.871437 where: bonds (distance) C4'-P energy: -41.395 bonds (distance) P-C4' energy: -50.540 flat angles C4'-P-C4' energy: -53.223 flat angles P-C4'-P energy: -36.874 tors. eta vs tors. theta energy: -44.839 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -628.000397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.000397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.950397 (E_RNA) where: Base-Base interactions energy: -351.671 where: short stacking energy: -145.009 Base-Backbone interact. energy: -2.198 local terms energy: -206.081272 where: bonds (distance) C4'-P energy: -36.628 bonds (distance) P-C4' energy: -54.870 flat angles C4'-P-C4' energy: -58.374 flat angles P-C4'-P energy: -31.372 tors. eta vs tors. theta energy: -24.837 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -651.118911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.118911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.668911 (E_RNA) where: Base-Base interactions energy: -374.909 where: short stacking energy: -139.182 Base-Backbone interact. energy: 0.694 local terms energy: -185.453200 where: bonds (distance) C4'-P energy: -45.082 bonds (distance) P-C4' energy: -58.649 flat angles C4'-P-C4' energy: -38.805 flat angles P-C4'-P energy: -21.763 tors. eta vs tors. theta energy: -21.155 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -1194.745824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1194.745824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1024.095824 (E_RNA) where: Base-Base interactions energy: -710.019 where: short stacking energy: -303.235 Base-Backbone interact. energy: 1.014 local terms energy: -315.090796 where: bonds (distance) C4'-P energy: -59.078 bonds (distance) P-C4' energy: -56.550 flat angles C4'-P-C4' energy: -74.672 flat angles P-C4'-P energy: -41.492 tors. eta vs tors. theta energy: -83.299 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -1195.051962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1195.051962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.801962 (E_RNA) where: Base-Base interactions energy: -729.698 where: short stacking energy: -303.762 Base-Backbone interact. energy: -1.355 local terms energy: -307.748450 where: bonds (distance) C4'-P energy: -57.813 bonds (distance) P-C4' energy: -57.470 flat angles C4'-P-C4' energy: -59.808 flat angles P-C4'-P energy: -43.541 tors. eta vs tors. theta energy: -89.117 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -1079.954767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1079.954767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.304767 (E_RNA) where: Base-Base interactions energy: -649.097 where: short stacking energy: -255.501 Base-Backbone interact. energy: -0.512 local terms energy: -295.696462 where: bonds (distance) C4'-P energy: -59.970 bonds (distance) P-C4' energy: -55.134 flat angles C4'-P-C4' energy: -59.771 flat angles P-C4'-P energy: -48.077 tors. eta vs tors. theta energy: -72.744 Dist. restrs. and SS energy: -158.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -1094.959469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1094.959469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.509469 (E_RNA) where: Base-Base interactions energy: -659.801 where: short stacking energy: -248.265 Base-Backbone interact. energy: -0.002 local terms energy: -280.706539 where: bonds (distance) C4'-P energy: -44.371 bonds (distance) P-C4' energy: -51.220 flat angles C4'-P-C4' energy: -65.888 flat angles P-C4'-P energy: -48.145 tors. eta vs tors. theta energy: -71.082 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -1057.230170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.230170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -909.980170 (E_RNA) where: Base-Base interactions energy: -632.637 where: short stacking energy: -244.306 Base-Backbone interact. energy: -1.685 local terms energy: -275.658250 where: bonds (distance) C4'-P energy: -48.566 bonds (distance) P-C4' energy: -54.764 flat angles C4'-P-C4' energy: -64.016 flat angles P-C4'-P energy: -39.137 tors. eta vs tors. theta energy: -69.175 Dist. restrs. and SS energy: -171.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -986.423616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -986.423616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -862.573616 (E_RNA) where: Base-Base interactions energy: -594.580 where: short stacking energy: -229.947 Base-Backbone interact. energy: 0.431 local terms energy: -268.423899 where: bonds (distance) C4'-P energy: -51.219 bonds (distance) P-C4' energy: -47.830 flat angles C4'-P-C4' energy: -62.098 flat angles P-C4'-P energy: -41.986 tors. eta vs tors. theta energy: -65.291 Dist. restrs. and SS energy: -147.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -871.280696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.280696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.430696 (E_RNA) where: Base-Base interactions energy: -524.331 where: short stacking energy: -191.986 Base-Backbone interact. energy: -1.900 local terms energy: -212.199820 where: bonds (distance) C4'-P energy: -42.432 bonds (distance) P-C4' energy: -46.865 flat angles C4'-P-C4' energy: -48.375 flat angles P-C4'-P energy: -32.962 tors. eta vs tors. theta energy: -41.564 Dist. restrs. and SS energy: -156.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -780.833213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -780.833213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.383213 (E_RNA) where: Base-Base interactions energy: -447.782 where: short stacking energy: -184.744 Base-Backbone interact. energy: 0.198 local terms energy: -214.798788 where: bonds (distance) C4'-P energy: -42.381 bonds (distance) P-C4' energy: -57.613 flat angles C4'-P-C4' energy: -44.478 flat angles P-C4'-P energy: -36.921 tors. eta vs tors. theta energy: -33.406 Dist. restrs. and SS energy: -142.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -679.167547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.167547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.117547 (E_RNA) where: Base-Base interactions energy: -391.913 where: short stacking energy: -153.730 Base-Backbone interact. energy: 0.433 local terms energy: -183.637508 where: bonds (distance) C4'-P energy: -42.432 bonds (distance) P-C4' energy: -31.400 flat angles C4'-P-C4' energy: -51.894 flat angles P-C4'-P energy: -29.871 tors. eta vs tors. theta energy: -28.041 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -615.121978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.121978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.071978 (E_RNA) where: Base-Base interactions energy: -373.271 where: short stacking energy: -146.109 Base-Backbone interact. energy: -0.037 local terms energy: -173.764564 where: bonds (distance) C4'-P energy: -44.801 bonds (distance) P-C4' energy: -33.527 flat angles C4'-P-C4' energy: -52.982 flat angles P-C4'-P energy: -26.110 tors. eta vs tors. theta energy: -16.345 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -1196.479472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.479472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1029.429472 (E_RNA) where: Base-Base interactions energy: -706.851 where: short stacking energy: -310.653 Base-Backbone interact. energy: -0.564 local terms energy: -322.014245 where: bonds (distance) C4'-P energy: -55.301 bonds (distance) P-C4' energy: -55.788 flat angles C4'-P-C4' energy: -73.443 flat angles P-C4'-P energy: -47.642 tors. eta vs tors. theta energy: -89.840 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -1174.602709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1174.602709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1018.352709 (E_RNA) where: Base-Base interactions energy: -714.385 where: short stacking energy: -298.125 Base-Backbone interact. energy: -1.589 local terms energy: -302.378801 where: bonds (distance) C4'-P energy: -40.590 bonds (distance) P-C4' energy: -62.965 flat angles C4'-P-C4' energy: -65.900 flat angles P-C4'-P energy: -45.346 tors. eta vs tors. theta energy: -87.578 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -1092.834197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1092.834197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.784197 (E_RNA) where: Base-Base interactions energy: -677.526 where: short stacking energy: -260.136 Base-Backbone interact. energy: 0.246 local terms energy: -275.504205 where: bonds (distance) C4'-P energy: -48.115 bonds (distance) P-C4' energy: -62.386 flat angles C4'-P-C4' energy: -58.801 flat angles P-C4'-P energy: -40.679 tors. eta vs tors. theta energy: -65.524 Dist. restrs. and SS energy: -163.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -1111.735787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1111.735787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.485787 (E_RNA) where: Base-Base interactions energy: -663.468 where: short stacking energy: -249.873 Base-Backbone interact. energy: -0.744 local terms energy: -291.274089 where: bonds (distance) C4'-P energy: -65.513 bonds (distance) P-C4' energy: -59.537 flat angles C4'-P-C4' energy: -62.054 flat angles P-C4'-P energy: -31.821 tors. eta vs tors. theta energy: -72.349 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -1064.113483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.113483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -909.663483 (E_RNA) where: Base-Base interactions energy: -630.441 where: short stacking energy: -245.321 Base-Backbone interact. energy: -3.562 local terms energy: -275.659887 where: bonds (distance) C4'-P energy: -53.839 bonds (distance) P-C4' energy: -59.015 flat angles C4'-P-C4' energy: -53.961 flat angles P-C4'-P energy: -37.252 tors. eta vs tors. theta energy: -71.592 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -1012.666125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1012.666125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.216125 (E_RNA) where: Base-Base interactions energy: -626.750 where: short stacking energy: -251.609 Base-Backbone interact. energy: -1.813 local terms energy: -256.652220 where: bonds (distance) C4'-P energy: -54.994 bonds (distance) P-C4' energy: -54.037 flat angles C4'-P-C4' energy: -50.996 flat angles P-C4'-P energy: -36.321 tors. eta vs tors. theta energy: -60.304 Dist. restrs. and SS energy: -151.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -880.639985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.639985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -733.389985 (E_RNA) where: Base-Base interactions energy: -511.869 where: short stacking energy: -203.348 Base-Backbone interact. energy: -0.836 local terms energy: -220.685394 where: bonds (distance) C4'-P energy: -43.334 bonds (distance) P-C4' energy: -57.363 flat angles C4'-P-C4' energy: -47.751 flat angles P-C4'-P energy: -26.611 tors. eta vs tors. theta energy: -45.627 Dist. restrs. and SS energy: -171.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -802.829933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -802.829933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.379933 (E_RNA) where: Base-Base interactions energy: -448.328 where: short stacking energy: -189.922 Base-Backbone interact. energy: 7.376 local terms energy: -243.427933 where: bonds (distance) C4'-P energy: -61.297 bonds (distance) P-C4' energy: -58.684 flat angles C4'-P-C4' energy: -56.101 flat angles P-C4'-P energy: -29.315 tors. eta vs tors. theta energy: -38.031 Dist. restrs. and SS energy: -142.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -776.299461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.299461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.049461 (E_RNA) where: Base-Base interactions energy: -428.738 where: short stacking energy: -176.487 Base-Backbone interact. energy: -0.741 local terms energy: -226.570751 where: bonds (distance) C4'-P energy: -56.103 bonds (distance) P-C4' energy: -49.469 flat angles C4'-P-C4' energy: -59.642 flat angles P-C4'-P energy: -29.603 tors. eta vs tors. theta energy: -31.753 Dist. restrs. and SS energy: -144.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -606.899288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.899288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.649288 (E_RNA) where: Base-Base interactions energy: -368.924 where: short stacking energy: -146.818 Base-Backbone interact. energy: -1.037 local terms energy: -170.687770 where: bonds (distance) C4'-P energy: -30.429 bonds (distance) P-C4' energy: -50.993 flat angles C4'-P-C4' energy: -41.823 flat angles P-C4'-P energy: -31.116 tors. eta vs tors. theta energy: -16.326 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -1219.327195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1219.327195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1052.277195 (E_RNA) where: Base-Base interactions energy: -735.811 where: short stacking energy: -331.153 Base-Backbone interact. energy: -0.683 local terms energy: -315.783619 where: bonds (distance) C4'-P energy: -56.898 bonds (distance) P-C4' energy: -55.512 flat angles C4'-P-C4' energy: -67.746 flat angles P-C4'-P energy: -41.473 tors. eta vs tors. theta energy: -94.154 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -1172.216227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1172.216227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1019.566227 (E_RNA) where: Base-Base interactions energy: -698.816 where: short stacking energy: -302.605 Base-Backbone interact. energy: -1.743 local terms energy: -319.007233 where: bonds (distance) C4'-P energy: -61.538 bonds (distance) P-C4' energy: -55.772 flat angles C4'-P-C4' energy: -70.090 flat angles P-C4'-P energy: -45.292 tors. eta vs tors. theta energy: -86.315 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -1102.440351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.440351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.190351 (E_RNA) where: Base-Base interactions energy: -667.451 where: short stacking energy: -271.732 Base-Backbone interact. energy: -1.604 local terms energy: -295.135181 where: bonds (distance) C4'-P energy: -58.361 bonds (distance) P-C4' energy: -56.839 flat angles C4'-P-C4' energy: -63.955 flat angles P-C4'-P energy: -41.101 tors. eta vs tors. theta energy: -74.879 Dist. restrs. and SS energy: -162.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -1087.550626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.550626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.300626 (E_RNA) where: Base-Base interactions energy: -664.906 where: short stacking energy: -263.268 Base-Backbone interact. energy: -1.909 local terms energy: -273.485441 where: bonds (distance) C4'-P energy: -53.349 bonds (distance) P-C4' energy: -54.731 flat angles C4'-P-C4' energy: -59.779 flat angles P-C4'-P energy: -38.270 tors. eta vs tors. theta energy: -67.355 Dist. restrs. and SS energy: -171.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -1052.304600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.304600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.854600 (E_RNA) where: Base-Base interactions energy: -613.847 where: short stacking energy: -256.718 Base-Backbone interact. energy: -0.368 local terms energy: -283.639603 where: bonds (distance) C4'-P energy: -45.081 bonds (distance) P-C4' energy: -57.683 flat angles C4'-P-C4' energy: -67.047 flat angles P-C4'-P energy: -48.789 tors. eta vs tors. theta energy: -65.040 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -974.796518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -974.796518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.546518 (E_RNA) where: Base-Base interactions energy: -593.652 where: short stacking energy: -236.964 Base-Backbone interact. energy: -1.440 local terms energy: -250.453984 where: bonds (distance) C4'-P energy: -32.405 bonds (distance) P-C4' energy: -50.644 flat angles C4'-P-C4' energy: -62.825 flat angles P-C4'-P energy: -41.409 tors. eta vs tors. theta energy: -63.171 Dist. restrs. and SS energy: -153.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -936.371559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -936.371559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.521559 (E_RNA) where: Base-Base interactions energy: -546.101 where: short stacking energy: -222.641 Base-Backbone interact. energy: -1.950 local terms energy: -237.470585 where: bonds (distance) C4'-P energy: -38.018 bonds (distance) P-C4' energy: -53.485 flat angles C4'-P-C4' energy: -61.034 flat angles P-C4'-P energy: -33.693 tors. eta vs tors. theta energy: -51.241 Dist. restrs. and SS energy: -174.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -812.952208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.952208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.302208 (E_RNA) where: Base-Base interactions energy: -458.151 where: short stacking energy: -202.053 Base-Backbone interact. energy: 5.181 local terms energy: -243.332351 where: bonds (distance) C4'-P energy: -53.805 bonds (distance) P-C4' energy: -63.320 flat angles C4'-P-C4' energy: -44.410 flat angles P-C4'-P energy: -27.635 tors. eta vs tors. theta energy: -54.163 Dist. restrs. and SS energy: -140.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -790.362660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -790.362660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.912660 (E_RNA) where: Base-Base interactions energy: -447.786 where: short stacking energy: -192.974 Base-Backbone interact. energy: 0.094 local terms energy: -224.220630 where: bonds (distance) C4'-P energy: -52.533 bonds (distance) P-C4' energy: -51.279 flat angles C4'-P-C4' energy: -51.058 flat angles P-C4'-P energy: -26.791 tors. eta vs tors. theta energy: -42.560 Dist. restrs. and SS energy: -142.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -590.622453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.622453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.772453 (E_RNA) where: Base-Base interactions energy: -324.273 where: short stacking energy: -139.012 Base-Backbone interact. energy: -1.181 local terms energy: -195.318255 where: bonds (distance) C4'-P energy: -55.336 bonds (distance) P-C4' energy: -43.631 flat angles C4'-P-C4' energy: -49.474 flat angles P-C4'-P energy: -34.520 tors. eta vs tors. theta energy: -12.356 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -1230.460576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1230.460576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1063.410576 (E_RNA) where: Base-Base interactions energy: -721.349 where: short stacking energy: -323.334 Base-Backbone interact. energy: -1.979 local terms energy: -340.082321 where: bonds (distance) C4'-P energy: -59.059 bonds (distance) P-C4' energy: -60.692 flat angles C4'-P-C4' energy: -68.593 flat angles P-C4'-P energy: -53.593 tors. eta vs tors. theta energy: -98.146 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -1173.773795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1173.773795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1019.323795 (E_RNA) where: Base-Base interactions energy: -702.725 where: short stacking energy: -282.716 Base-Backbone interact. energy: -0.374 local terms energy: -316.223986 where: bonds (distance) C4'-P energy: -62.257 bonds (distance) P-C4' energy: -63.199 flat angles C4'-P-C4' energy: -62.325 flat angles P-C4'-P energy: -48.347 tors. eta vs tors. theta energy: -80.096 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -1128.114327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1128.114327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -995.264327 (E_RNA) where: Base-Base interactions energy: -690.925 where: short stacking energy: -260.160 Base-Backbone interact. energy: -2.375 local terms energy: -301.964470 where: bonds (distance) C4'-P energy: -57.650 bonds (distance) P-C4' energy: -66.470 flat angles C4'-P-C4' energy: -60.748 flat angles P-C4'-P energy: -42.282 tors. eta vs tors. theta energy: -74.815 Dist. restrs. and SS energy: -156.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -1057.079754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.079754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.829754 (E_RNA) where: Base-Base interactions energy: -614.741 where: short stacking energy: -237.686 Base-Backbone interact. energy: -0.508 local terms energy: -285.581088 where: bonds (distance) C4'-P energy: -54.708 bonds (distance) P-C4' energy: -55.689 flat angles C4'-P-C4' energy: -70.353 flat angles P-C4'-P energy: -45.760 tors. eta vs tors. theta energy: -59.072 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -1058.951597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.951597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -899.101597 (E_RNA) where: Base-Base interactions energy: -627.518 where: short stacking energy: -254.756 Base-Backbone interact. energy: -2.366 local terms energy: -269.217202 where: bonds (distance) C4'-P energy: -43.243 bonds (distance) P-C4' energy: -54.385 flat angles C4'-P-C4' energy: -60.263 flat angles P-C4'-P energy: -40.991 tors. eta vs tors. theta energy: -70.335 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -981.886412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -981.886412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -861.636412 (E_RNA) where: Base-Base interactions energy: -613.425 where: short stacking energy: -231.182 Base-Backbone interact. energy: -2.045 local terms energy: -246.166283 where: bonds (distance) C4'-P energy: -46.004 bonds (distance) P-C4' energy: -50.116 flat angles C4'-P-C4' energy: -59.345 flat angles P-C4'-P energy: -32.393 tors. eta vs tors. theta energy: -58.309 Dist. restrs. and SS energy: -144.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -957.381207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -957.381207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -804.731207 (E_RNA) where: Base-Base interactions energy: -574.703 where: short stacking energy: -217.562 Base-Backbone interact. energy: 1.172 local terms energy: -231.199957 where: bonds (distance) C4'-P energy: -49.540 bonds (distance) P-C4' energy: -39.486 flat angles C4'-P-C4' energy: -53.659 flat angles P-C4'-P energy: -39.518 tors. eta vs tors. theta energy: -48.997 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -828.597926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -828.597926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.947926 (E_RNA) where: Base-Base interactions energy: -470.862 where: short stacking energy: -188.344 Base-Backbone interact. energy: -0.661 local terms energy: -240.425655 where: bonds (distance) C4'-P energy: -56.687 bonds (distance) P-C4' energy: -56.631 flat angles C4'-P-C4' energy: -54.915 flat angles P-C4'-P energy: -28.242 tors. eta vs tors. theta energy: -43.951 Dist. restrs. and SS energy: -140.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -827.157777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.157777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.107777 (E_RNA) where: Base-Base interactions energy: -483.695 where: short stacking energy: -206.549 Base-Backbone interact. energy: -2.458 local terms energy: -209.955534 where: bonds (distance) C4'-P energy: -40.850 bonds (distance) P-C4' energy: -45.065 flat angles C4'-P-C4' energy: -47.175 flat angles P-C4'-P energy: -38.093 tors. eta vs tors. theta energy: -38.774 Dist. restrs. and SS energy: -154.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -627.399212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -627.399212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.349212 (E_RNA) where: Base-Base interactions energy: -357.734 where: short stacking energy: -145.391 Base-Backbone interact. energy: -3.360 local terms energy: -189.254833 where: bonds (distance) C4'-P energy: -44.336 bonds (distance) P-C4' energy: -45.546 flat angles C4'-P-C4' energy: -54.002 flat angles P-C4'-P energy: -20.518 tors. eta vs tors. theta energy: -24.852 Dist. restrs. and SS energy: -100.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -1211.790010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1211.790010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1041.140010 (E_RNA) where: Base-Base interactions energy: -702.806 where: short stacking energy: -307.072 Base-Backbone interact. energy: -0.815 local terms energy: -337.518522 where: bonds (distance) C4'-P energy: -58.539 bonds (distance) P-C4' energy: -63.551 flat angles C4'-P-C4' energy: -71.383 flat angles P-C4'-P energy: -49.608 tors. eta vs tors. theta energy: -94.437 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -1192.780002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1192.780002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.130002 (E_RNA) where: Base-Base interactions energy: -714.466 where: short stacking energy: -309.069 Base-Backbone interact. energy: -0.427 local terms energy: -325.237159 where: bonds (distance) C4'-P energy: -57.798 bonds (distance) P-C4' energy: -57.892 flat angles C4'-P-C4' energy: -65.005 flat angles P-C4'-P energy: -47.511 tors. eta vs tors. theta energy: -97.031 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -1124.648851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1124.648851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -986.398851 (E_RNA) where: Base-Base interactions energy: -680.615 where: short stacking energy: -280.031 Base-Backbone interact. energy: -2.463 local terms energy: -303.321243 where: bonds (distance) C4'-P energy: -59.693 bonds (distance) P-C4' energy: -59.351 flat angles C4'-P-C4' energy: -65.305 flat angles P-C4'-P energy: -37.854 tors. eta vs tors. theta energy: -81.118 Dist. restrs. and SS energy: -162.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -1076.742153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.742153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.092153 (E_RNA) where: Base-Base interactions energy: -638.137 where: short stacking energy: -275.707 Base-Backbone interact. energy: -1.230 local terms energy: -284.724398 where: bonds (distance) C4'-P energy: -53.390 bonds (distance) P-C4' energy: -50.252 flat angles C4'-P-C4' energy: -64.402 flat angles P-C4'-P energy: -42.241 tors. eta vs tors. theta energy: -74.440 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -1057.637172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.637172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -892.387172 (E_RNA) where: Base-Base interactions energy: -607.507 where: short stacking energy: -245.797 Base-Backbone interact. energy: 0.111 local terms energy: -284.991432 where: bonds (distance) C4'-P energy: -53.295 bonds (distance) P-C4' energy: -55.919 flat angles C4'-P-C4' energy: -64.013 flat angles P-C4'-P energy: -39.582 tors. eta vs tors. theta energy: -72.182 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -1014.616897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.616897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.366897 (E_RNA) where: Base-Base interactions energy: -622.112 where: short stacking energy: -242.193 Base-Backbone interact. energy: -0.104 local terms energy: -263.151276 where: bonds (distance) C4'-P energy: -43.867 bonds (distance) P-C4' energy: -50.484 flat angles C4'-P-C4' energy: -52.439 flat angles P-C4'-P energy: -45.596 tors. eta vs tors. theta energy: -70.766 Dist. restrs. and SS energy: -153.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -988.640113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -988.640113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.390113 (E_RNA) where: Base-Base interactions energy: -569.447 where: short stacking energy: -222.998 Base-Backbone interact. energy: -0.981 local terms energy: -261.962697 where: bonds (distance) C4'-P energy: -48.689 bonds (distance) P-C4' energy: -56.527 flat angles C4'-P-C4' energy: -58.682 flat angles P-C4'-P energy: -33.779 tors. eta vs tors. theta energy: -64.286 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -821.998328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -821.998328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.548328 (E_RNA) where: Base-Base interactions energy: -476.533 where: short stacking energy: -200.455 Base-Backbone interact. energy: 0.566 local terms energy: -227.581086 where: bonds (distance) C4'-P energy: -37.659 bonds (distance) P-C4' energy: -46.169 flat angles C4'-P-C4' energy: -60.308 flat angles P-C4'-P energy: -36.010 tors. eta vs tors. theta energy: -47.434 Dist. restrs. and SS energy: -142.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -818.127071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.127071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.277071 (E_RNA) where: Base-Base interactions energy: -480.590 where: short stacking energy: -184.348 Base-Backbone interact. energy: 1.373 local terms energy: -206.059421 where: bonds (distance) C4'-P energy: -41.953 bonds (distance) P-C4' energy: -52.527 flat angles C4'-P-C4' energy: -39.437 flat angles P-C4'-P energy: -30.719 tors. eta vs tors. theta energy: -41.423 Dist. restrs. and SS energy: -156.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -717.036627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.036627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.786627 (E_RNA) where: Base-Base interactions energy: -414.128 where: short stacking energy: -162.862 Base-Backbone interact. energy: 0.891 local terms energy: -201.549815 where: bonds (distance) C4'-P energy: -45.990 bonds (distance) P-C4' energy: -54.970 flat angles C4'-P-C4' energy: -49.150 flat angles P-C4'-P energy: -16.395 tors. eta vs tors. theta energy: -35.045 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -1211.125640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1211.125640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.475640 (E_RNA) where: Base-Base interactions energy: -694.064 where: short stacking energy: -292.655 Base-Backbone interact. energy: -0.443 local terms energy: -345.968992 where: bonds (distance) C4'-P energy: -63.878 bonds (distance) P-C4' energy: -67.568 flat angles C4'-P-C4' energy: -78.009 flat angles P-C4'-P energy: -50.998 tors. eta vs tors. theta energy: -85.516 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -1161.206381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1161.206381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1006.756381 (E_RNA) where: Base-Base interactions energy: -694.058 where: short stacking energy: -266.459 Base-Backbone interact. energy: -2.799 local terms energy: -309.899297 where: bonds (distance) C4'-P energy: -57.799 bonds (distance) P-C4' energy: -62.188 flat angles C4'-P-C4' energy: -60.390 flat angles P-C4'-P energy: -48.413 tors. eta vs tors. theta energy: -81.110 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -1108.728556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1108.728556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.278556 (E_RNA) where: Base-Base interactions energy: -656.384 where: short stacking energy: -280.952 Base-Backbone interact. energy: -2.663 local terms energy: -313.232210 where: bonds (distance) C4'-P energy: -54.665 bonds (distance) P-C4' energy: -62.228 flat angles C4'-P-C4' energy: -64.764 flat angles P-C4'-P energy: -48.944 tors. eta vs tors. theta energy: -82.631 Dist. restrs. and SS energy: -160.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -1072.574920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1072.574920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -918.124920 (E_RNA) where: Base-Base interactions energy: -639.432 where: short stacking energy: -262.275 Base-Backbone interact. energy: -2.181 local terms energy: -276.511476 where: bonds (distance) C4'-P energy: -54.026 bonds (distance) P-C4' energy: -50.802 flat angles C4'-P-C4' energy: -64.161 flat angles P-C4'-P energy: -38.885 tors. eta vs tors. theta energy: -68.638 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -1057.481574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.481574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -903.031574 (E_RNA) where: Base-Base interactions energy: -644.310 where: short stacking energy: -233.608 Base-Backbone interact. energy: -2.326 local terms energy: -256.395145 where: bonds (distance) C4'-P energy: -50.839 bonds (distance) P-C4' energy: -52.736 flat angles C4'-P-C4' energy: -59.797 flat angles P-C4'-P energy: -29.855 tors. eta vs tors. theta energy: -63.169 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -995.111690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -995.111690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -865.861690 (E_RNA) where: Base-Base interactions energy: -610.463 where: short stacking energy: -232.497 Base-Backbone interact. energy: -0.300 local terms energy: -255.098706 where: bonds (distance) C4'-P energy: -45.206 bonds (distance) P-C4' energy: -49.653 flat angles C4'-P-C4' energy: -58.419 flat angles P-C4'-P energy: -37.081 tors. eta vs tors. theta energy: -64.740 Dist. restrs. and SS energy: -153.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -970.812562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -970.812562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.162562 (E_RNA) where: Base-Base interactions energy: -573.856 where: short stacking energy: -215.542 Base-Backbone interact. energy: -1.664 local terms energy: -233.642665 where: bonds (distance) C4'-P energy: -46.952 bonds (distance) P-C4' energy: -61.948 flat angles C4'-P-C4' energy: -50.964 flat angles P-C4'-P energy: -30.569 tors. eta vs tors. theta energy: -43.209 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -818.304602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.304602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.654602 (E_RNA) where: Base-Base interactions energy: -465.392 where: short stacking energy: -183.970 Base-Backbone interact. energy: -0.056 local terms energy: -236.206813 where: bonds (distance) C4'-P energy: -44.850 bonds (distance) P-C4' energy: -51.832 flat angles C4'-P-C4' energy: -63.195 flat angles P-C4'-P energy: -28.266 tors. eta vs tors. theta energy: -48.064 Dist. restrs. and SS energy: -140.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -838.558778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.558778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.508778 (E_RNA) where: Base-Base interactions energy: -484.761 where: short stacking energy: -193.708 Base-Backbone interact. energy: -1.429 local terms energy: -230.317994 where: bonds (distance) C4'-P energy: -49.571 bonds (distance) P-C4' energy: -52.920 flat angles C4'-P-C4' energy: -46.467 flat angles P-C4'-P energy: -38.121 tors. eta vs tors. theta energy: -43.240 Dist. restrs. and SS energy: -145.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -737.236021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.236021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.586021 (E_RNA) where: Base-Base interactions energy: -432.905 where: short stacking energy: -164.541 Base-Backbone interact. energy: 2.042 local terms energy: -189.722973 where: bonds (distance) C4'-P energy: -44.257 bonds (distance) P-C4' energy: -37.986 flat angles C4'-P-C4' energy: -47.840 flat angles P-C4'-P energy: -25.507 tors. eta vs tors. theta energy: -34.132 Dist. restrs. and SS energy: -140.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -1226.550856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.550856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1055.900856 (E_RNA) where: Base-Base interactions energy: -712.122 where: short stacking energy: -303.056 Base-Backbone interact. energy: 0.329 local terms energy: -344.107932 where: bonds (distance) C4'-P energy: -66.422 bonds (distance) P-C4' energy: -63.864 flat angles C4'-P-C4' energy: -70.758 flat angles P-C4'-P energy: -52.489 tors. eta vs tors. theta energy: -90.574 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -1197.400813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1197.400813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1044.750813 (E_RNA) where: Base-Base interactions energy: -722.341 where: short stacking energy: -294.115 Base-Backbone interact. energy: -2.718 local terms energy: -319.690897 where: bonds (distance) C4'-P energy: -60.667 bonds (distance) P-C4' energy: -62.713 flat angles C4'-P-C4' energy: -67.587 flat angles P-C4'-P energy: -46.291 tors. eta vs tors. theta energy: -82.434 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -1082.652410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1082.652410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.802410 (E_RNA) where: Base-Base interactions energy: -653.579 where: short stacking energy: -259.396 Base-Backbone interact. energy: -2.328 local terms energy: -293.894934 where: bonds (distance) C4'-P energy: -63.906 bonds (distance) P-C4' energy: -65.092 flat angles C4'-P-C4' energy: -59.417 flat angles P-C4'-P energy: -36.987 tors. eta vs tors. theta energy: -68.492 Dist. restrs. and SS energy: -156.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -1058.276274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.276274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.426274 (E_RNA) where: Base-Base interactions energy: -626.510 where: short stacking energy: -262.112 Base-Backbone interact. energy: -3.791 local terms energy: -277.124658 where: bonds (distance) C4'-P energy: -47.042 bonds (distance) P-C4' energy: -54.961 flat angles C4'-P-C4' energy: -68.977 flat angles P-C4'-P energy: -41.697 tors. eta vs tors. theta energy: -64.448 Dist. restrs. and SS energy: -174.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -1075.579850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1075.579850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.929850 (E_RNA) where: Base-Base interactions energy: -651.715 where: short stacking energy: -258.156 Base-Backbone interact. energy: -0.683 local terms energy: -261.531311 where: bonds (distance) C4'-P energy: -49.217 bonds (distance) P-C4' energy: -49.873 flat angles C4'-P-C4' energy: -58.775 flat angles P-C4'-P energy: -36.201 tors. eta vs tors. theta energy: -67.466 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -1007.593368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1007.593368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.943368 (E_RNA) where: Base-Base interactions energy: -609.853 where: short stacking energy: -235.262 Base-Backbone interact. energy: -2.706 local terms energy: -269.384472 where: bonds (distance) C4'-P energy: -52.879 bonds (distance) P-C4' energy: -52.765 flat angles C4'-P-C4' energy: -59.299 flat angles P-C4'-P energy: -39.362 tors. eta vs tors. theta energy: -65.079 Dist. restrs. and SS energy: -149.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -1007.058848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1007.058848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.608848 (E_RNA) where: Base-Base interactions energy: -583.486 where: short stacking energy: -229.435 Base-Backbone interact. energy: -0.525 local terms energy: -259.597388 where: bonds (distance) C4'-P energy: -50.271 bonds (distance) P-C4' energy: -48.962 flat angles C4'-P-C4' energy: -61.237 flat angles P-C4'-P energy: -41.058 tors. eta vs tors. theta energy: -58.069 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -879.278687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.278687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.228687 (E_RNA) where: Base-Base interactions energy: -502.240 where: short stacking energy: -186.964 Base-Backbone interact. energy: -0.389 local terms energy: -227.599243 where: bonds (distance) C4'-P energy: -47.497 bonds (distance) P-C4' energy: -53.688 flat angles C4'-P-C4' energy: -48.529 flat angles P-C4'-P energy: -33.941 tors. eta vs tors. theta energy: -43.945 Dist. restrs. and SS energy: -172.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -856.197592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.197592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.147592 (E_RNA) where: Base-Base interactions energy: -481.716 where: short stacking energy: -195.060 Base-Backbone interact. energy: 0.858 local terms energy: -226.289496 where: bonds (distance) C4'-P energy: -53.057 bonds (distance) P-C4' energy: -37.487 flat angles C4'-P-C4' energy: -54.697 flat angles P-C4'-P energy: -40.941 tors. eta vs tors. theta energy: -40.108 Dist. restrs. and SS energy: -172.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -745.890428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.890428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.840428 (E_RNA) where: Base-Base interactions energy: -434.652 where: short stacking energy: -167.803 Base-Backbone interact. energy: -1.224 local terms energy: -196.964831 where: bonds (distance) C4'-P energy: -52.134 bonds (distance) P-C4' energy: -45.540 flat angles C4'-P-C4' energy: -45.932 flat angles P-C4'-P energy: -22.142 tors. eta vs tors. theta energy: -31.216 Dist. restrs. and SS energy: -136.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -1236.939729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1236.939729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1066.289729 (E_RNA) where: Base-Base interactions energy: -736.456 where: short stacking energy: -304.628 Base-Backbone interact. energy: -1.279 local terms energy: -328.555030 where: bonds (distance) C4'-P energy: -68.084 bonds (distance) P-C4' energy: -60.266 flat angles C4'-P-C4' energy: -65.244 flat angles P-C4'-P energy: -45.194 tors. eta vs tors. theta energy: -89.767 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -1187.655968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1187.655968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1036.805968 (E_RNA) where: Base-Base interactions energy: -717.787 where: short stacking energy: -281.840 Base-Backbone interact. energy: -0.864 local terms energy: -318.155220 where: bonds (distance) C4'-P energy: -60.868 bonds (distance) P-C4' energy: -59.788 flat angles C4'-P-C4' energy: -61.042 flat angles P-C4'-P energy: -52.806 tors. eta vs tors. theta energy: -83.650 Dist. restrs. and SS energy: -174.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -1108.516420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1108.516420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -968.466420 (E_RNA) where: Base-Base interactions energy: -678.675 where: short stacking energy: -269.304 Base-Backbone interact. energy: -2.360 local terms energy: -287.431021 where: bonds (distance) C4'-P energy: -50.654 bonds (distance) P-C4' energy: -55.249 flat angles C4'-P-C4' energy: -73.755 flat angles P-C4'-P energy: -36.400 tors. eta vs tors. theta energy: -71.373 Dist. restrs. and SS energy: -163.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -1078.830929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.830929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.180929 (E_RNA) where: Base-Base interactions energy: -626.945 where: short stacking energy: -252.404 Base-Backbone interact. energy: -1.919 local terms energy: -297.317045 where: bonds (distance) C4'-P energy: -58.680 bonds (distance) P-C4' energy: -60.739 flat angles C4'-P-C4' energy: -59.377 flat angles P-C4'-P energy: -44.437 tors. eta vs tors. theta energy: -74.085 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -1055.909006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.909006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -908.659006 (E_RNA) where: Base-Base interactions energy: -638.794 where: short stacking energy: -242.410 Base-Backbone interact. energy: -1.555 local terms energy: -268.309928 where: bonds (distance) C4'-P energy: -45.896 bonds (distance) P-C4' energy: -49.536 flat angles C4'-P-C4' energy: -60.281 flat angles P-C4'-P energy: -45.006 tors. eta vs tors. theta energy: -67.591 Dist. restrs. and SS energy: -171.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -1032.736184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1032.736184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -865.686184 (E_RNA) where: Base-Base interactions energy: -591.608 where: short stacking energy: -232.768 Base-Backbone interact. energy: -1.375 local terms energy: -272.703240 where: bonds (distance) C4'-P energy: -50.575 bonds (distance) P-C4' energy: -54.561 flat angles C4'-P-C4' energy: -57.499 flat angles P-C4'-P energy: -41.613 tors. eta vs tors. theta energy: -68.456 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -985.349154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.349154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -856.099154 (E_RNA) where: Base-Base interactions energy: -598.052 where: short stacking energy: -235.554 Base-Backbone interact. energy: -1.431 local terms energy: -256.615731 where: bonds (distance) C4'-P energy: -58.411 bonds (distance) P-C4' energy: -50.841 flat angles C4'-P-C4' energy: -54.477 flat angles P-C4'-P energy: -31.980 tors. eta vs tors. theta energy: -60.907 Dist. restrs. and SS energy: -153.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -907.272953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.272953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.422953 (E_RNA) where: Base-Base interactions energy: -536.785 where: short stacking energy: -213.679 Base-Backbone interact. energy: 0.525 local terms energy: -229.163239 where: bonds (distance) C4'-P energy: -48.893 bonds (distance) P-C4' energy: -47.747 flat angles C4'-P-C4' energy: -53.179 flat angles P-C4'-P energy: -28.664 tors. eta vs tors. theta energy: -50.681 Dist. restrs. and SS energy: -165.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -906.191304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -906.191304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.541304 (E_RNA) where: Base-Base interactions energy: -523.680 where: short stacking energy: -203.911 Base-Backbone interact. energy: -0.330 local terms energy: -229.531477 where: bonds (distance) C4'-P energy: -51.968 bonds (distance) P-C4' energy: -48.410 flat angles C4'-P-C4' energy: -42.502 flat angles P-C4'-P energy: -38.418 tors. eta vs tors. theta energy: -48.233 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -781.111604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.111604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.661604 (E_RNA) where: Base-Base interactions energy: -441.611 where: short stacking energy: -178.556 Base-Backbone interact. energy: 0.182 local terms energy: -212.233144 where: bonds (distance) C4'-P energy: -48.146 bonds (distance) P-C4' energy: -48.659 flat angles C4'-P-C4' energy: -54.596 flat angles P-C4'-P energy: -21.232 tors. eta vs tors. theta energy: -39.600 Dist. restrs. and SS energy: -151.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -1250.973930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1250.973930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1082.123930 (E_RNA) where: Base-Base interactions energy: -764.873 where: short stacking energy: -316.388 Base-Backbone interact. energy: 0.243 local terms energy: -317.493044 where: bonds (distance) C4'-P energy: -47.163 bonds (distance) P-C4' energy: -60.223 flat angles C4'-P-C4' energy: -67.379 flat angles P-C4'-P energy: -47.141 tors. eta vs tors. theta energy: -95.587 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -1210.680572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1210.680572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1058.030572 (E_RNA) where: Base-Base interactions energy: -746.995 where: short stacking energy: -297.191 Base-Backbone interact. energy: -1.909 local terms energy: -309.126590 where: bonds (distance) C4'-P energy: -58.731 bonds (distance) P-C4' energy: -63.658 flat angles C4'-P-C4' energy: -54.604 flat angles P-C4'-P energy: -47.506 tors. eta vs tors. theta energy: -84.628 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -1119.536361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1119.536361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -957.886361 (E_RNA) where: Base-Base interactions energy: -671.710 where: short stacking energy: -274.652 Base-Backbone interact. energy: -0.177 local terms energy: -285.998928 where: bonds (distance) C4'-P energy: -60.273 bonds (distance) P-C4' energy: -55.766 flat angles C4'-P-C4' energy: -57.547 flat angles P-C4'-P energy: -42.840 tors. eta vs tors. theta energy: -69.572 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -1094.902473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1094.902473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.052473 (E_RNA) where: Base-Base interactions energy: -650.661 where: short stacking energy: -278.805 Base-Backbone interact. energy: -1.360 local terms energy: -301.031706 where: bonds (distance) C4'-P energy: -56.734 bonds (distance) P-C4' energy: -58.816 flat angles C4'-P-C4' energy: -66.192 flat angles P-C4'-P energy: -44.754 tors. eta vs tors. theta energy: -74.535 Dist. restrs. and SS energy: -165.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -1049.924972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1049.924972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -899.074972 (E_RNA) where: Base-Base interactions energy: -623.764 where: short stacking energy: -245.894 Base-Backbone interact. energy: -1.168 local terms energy: -274.143390 where: bonds (distance) C4'-P energy: -47.911 bonds (distance) P-C4' energy: -51.853 flat angles C4'-P-C4' energy: -63.927 flat angles P-C4'-P energy: -38.544 tors. eta vs tors. theta energy: -71.908 Dist. restrs. and SS energy: -174.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -1014.894177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.894177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -847.844177 (E_RNA) where: Base-Base interactions energy: -596.240 where: short stacking energy: -213.653 Base-Backbone interact. energy: -1.548 local terms energy: -250.056078 where: bonds (distance) C4'-P energy: -53.219 bonds (distance) P-C4' energy: -68.346 flat angles C4'-P-C4' energy: -37.038 flat angles P-C4'-P energy: -36.556 tors. eta vs tors. theta energy: -54.896 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -961.730586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -961.730586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.280586 (E_RNA) where: Base-Base interactions energy: -572.848 where: short stacking energy: -222.128 Base-Backbone interact. energy: -2.326 local terms energy: -259.105776 where: bonds (distance) C4'-P energy: -57.613 bonds (distance) P-C4' energy: -54.016 flat angles C4'-P-C4' energy: -51.328 flat angles P-C4'-P energy: -31.038 tors. eta vs tors. theta energy: -65.110 Dist. restrs. and SS energy: -151.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -958.513159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -958.513159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.463159 (E_RNA) where: Base-Base interactions energy: -569.349 where: short stacking energy: -222.461 Base-Backbone interact. energy: 1.789 local terms energy: -232.903145 where: bonds (distance) C4'-P energy: -47.403 bonds (distance) P-C4' energy: -45.875 flat angles C4'-P-C4' energy: -60.561 flat angles P-C4'-P energy: -28.356 tors. eta vs tors. theta energy: -50.709 Dist. restrs. and SS energy: -181.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -967.284894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -967.284894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -796.634894 (E_RNA) where: Base-Base interactions energy: -559.711 where: short stacking energy: -208.317 Base-Backbone interact. energy: -0.868 local terms energy: -236.055455 where: bonds (distance) C4'-P energy: -55.725 bonds (distance) P-C4' energy: -44.247 flat angles C4'-P-C4' energy: -54.654 flat angles P-C4'-P energy: -23.748 tors. eta vs tors. theta energy: -57.681 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -810.463394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.463394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.213394 (E_RNA) where: Base-Base interactions energy: -451.732 where: short stacking energy: -173.038 Base-Backbone interact. energy: -0.578 local terms energy: -228.903115 where: bonds (distance) C4'-P energy: -55.824 bonds (distance) P-C4' energy: -52.624 flat angles C4'-P-C4' energy: -54.771 flat angles P-C4'-P energy: -39.916 tors. eta vs tors. theta energy: -25.768 Dist. restrs. and SS energy: -153.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -1257.764943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1257.764943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1088.914943 (E_RNA) where: Base-Base interactions energy: -758.508 where: short stacking energy: -312.581 Base-Backbone interact. energy: 0.918 local terms energy: -331.325111 where: bonds (distance) C4'-P energy: -55.610 bonds (distance) P-C4' energy: -65.800 flat angles C4'-P-C4' energy: -70.501 flat angles P-C4'-P energy: -46.168 tors. eta vs tors. theta energy: -93.247 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -1189.598628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1189.598628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1036.948628 (E_RNA) where: Base-Base interactions energy: -723.153 where: short stacking energy: -292.816 Base-Backbone interact. energy: -1.581 local terms energy: -312.214690 where: bonds (distance) C4'-P energy: -61.910 bonds (distance) P-C4' energy: -57.588 flat angles C4'-P-C4' energy: -56.421 flat angles P-C4'-P energy: -49.475 tors. eta vs tors. theta energy: -86.821 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -1121.019936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1121.019936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.969936 (E_RNA) where: Base-Base interactions energy: -669.035 where: short stacking energy: -268.589 Base-Backbone interact. energy: -1.674 local terms energy: -292.260414 where: bonds (distance) C4'-P energy: -55.860 bonds (distance) P-C4' energy: -56.634 flat angles C4'-P-C4' energy: -63.483 flat angles P-C4'-P energy: -41.602 tors. eta vs tors. theta energy: -74.681 Dist. restrs. and SS energy: -181.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -1090.601336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1090.601336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -950.551336 (E_RNA) where: Base-Base interactions energy: -665.845 where: short stacking energy: -279.227 Base-Backbone interact. energy: -0.174 local terms energy: -284.532258 where: bonds (distance) C4'-P energy: -55.775 bonds (distance) P-C4' energy: -51.951 flat angles C4'-P-C4' energy: -58.938 flat angles P-C4'-P energy: -38.177 tors. eta vs tors. theta energy: -79.691 Dist. restrs. and SS energy: -163.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -1068.994316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.994316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.944316 (E_RNA) where: Base-Base interactions energy: -631.564 where: short stacking energy: -244.077 Base-Backbone interact. energy: -1.273 local terms energy: -278.107160 where: bonds (distance) C4'-P energy: -50.265 bonds (distance) P-C4' energy: -54.374 flat angles C4'-P-C4' energy: -60.248 flat angles P-C4'-P energy: -41.241 tors. eta vs tors. theta energy: -71.978 Dist. restrs. and SS energy: -181.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -1014.347686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.347686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.097686 (E_RNA) where: Base-Base interactions energy: -587.333 where: short stacking energy: -239.044 Base-Backbone interact. energy: -0.502 local terms energy: -261.263152 where: bonds (distance) C4'-P energy: -41.186 bonds (distance) P-C4' energy: -63.837 flat angles C4'-P-C4' energy: -61.828 flat angles P-C4'-P energy: -37.096 tors. eta vs tors. theta energy: -57.315 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -968.297664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -968.297664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -839.047664 (E_RNA) where: Base-Base interactions energy: -566.444 where: short stacking energy: -216.851 Base-Backbone interact. energy: -2.757 local terms energy: -269.847114 where: bonds (distance) C4'-P energy: -55.569 bonds (distance) P-C4' energy: -60.935 flat angles C4'-P-C4' energy: -57.235 flat angles P-C4'-P energy: -35.986 tors. eta vs tors. theta energy: -60.122 Dist. restrs. and SS energy: -153.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -1022.136045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1022.136045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.286045 (E_RNA) where: Base-Base interactions energy: -586.885 where: short stacking energy: -219.869 Base-Backbone interact. energy: -0.749 local terms energy: -265.651837 where: bonds (distance) C4'-P energy: -56.607 bonds (distance) P-C4' energy: -52.192 flat angles C4'-P-C4' energy: -54.482 flat angles P-C4'-P energy: -41.258 tors. eta vs tors. theta energy: -61.113 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -963.151193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.151193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.901193 (E_RNA) where: Base-Base interactions energy: -568.700 where: short stacking energy: -214.509 Base-Backbone interact. energy: -2.885 local terms energy: -226.316367 where: bonds (distance) C4'-P energy: -30.701 bonds (distance) P-C4' energy: -53.870 flat angles C4'-P-C4' energy: -55.237 flat angles P-C4'-P energy: -39.843 tors. eta vs tors. theta energy: -46.665 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -832.122526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.122526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.472526 (E_RNA) where: Base-Base interactions energy: -473.233 where: short stacking energy: -184.464 Base-Backbone interact. energy: 1.185 local terms energy: -225.424946 where: bonds (distance) C4'-P energy: -51.928 bonds (distance) P-C4' energy: -47.496 flat angles C4'-P-C4' energy: -52.534 flat angles P-C4'-P energy: -40.009 tors. eta vs tors. theta energy: -33.458 Dist. restrs. and SS energy: -158.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -1246.322508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1246.322508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1077.472508 (E_RNA) where: Base-Base interactions energy: -743.579 where: short stacking energy: -315.262 Base-Backbone interact. energy: -1.873 local terms energy: -332.020310 where: bonds (distance) C4'-P energy: -59.281 bonds (distance) P-C4' energy: -65.557 flat angles C4'-P-C4' energy: -65.588 flat angles P-C4'-P energy: -48.252 tors. eta vs tors. theta energy: -93.342 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -1194.067285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1194.067285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1041.417285 (E_RNA) where: Base-Base interactions energy: -713.339 where: short stacking energy: -293.485 Base-Backbone interact. energy: -1.466 local terms energy: -326.611879 where: bonds (distance) C4'-P energy: -62.450 bonds (distance) P-C4' energy: -60.618 flat angles C4'-P-C4' energy: -71.764 flat angles P-C4'-P energy: -47.767 tors. eta vs tors. theta energy: -84.014 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -1131.244346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1131.244346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -967.794346 (E_RNA) where: Base-Base interactions energy: -691.203 where: short stacking energy: -255.325 Base-Backbone interact. energy: -3.037 local terms energy: -273.554782 where: bonds (distance) C4'-P energy: -59.351 bonds (distance) P-C4' energy: -52.958 flat angles C4'-P-C4' energy: -53.945 flat angles P-C4'-P energy: -41.865 tors. eta vs tors. theta energy: -65.436 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -1089.529150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.529150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.079150 (E_RNA) where: Base-Base interactions energy: -675.454 where: short stacking energy: -307.919 Base-Backbone interact. energy: -1.328 local terms energy: -276.296566 where: bonds (distance) C4'-P energy: -33.250 bonds (distance) P-C4' energy: -53.782 flat angles C4'-P-C4' energy: -65.726 flat angles P-C4'-P energy: -37.743 tors. eta vs tors. theta energy: -85.795 Dist. restrs. and SS energy: -160.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -1041.471908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.471908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -896.021908 (E_RNA) where: Base-Base interactions energy: -618.080 where: short stacking energy: -265.219 Base-Backbone interact. energy: -1.160 local terms energy: -276.781861 where: bonds (distance) C4'-P energy: -55.681 bonds (distance) P-C4' energy: -51.282 flat angles C4'-P-C4' energy: -60.328 flat angles P-C4'-P energy: -38.065 tors. eta vs tors. theta energy: -71.426 Dist. restrs. and SS energy: -169.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -1005.206618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.206618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -847.156618 (E_RNA) where: Base-Base interactions energy: -587.386 where: short stacking energy: -228.690 Base-Backbone interact. energy: -0.455 local terms energy: -259.315014 where: bonds (distance) C4'-P energy: -37.463 bonds (distance) P-C4' energy: -58.680 flat angles C4'-P-C4' energy: -66.921 flat angles P-C4'-P energy: -38.986 tors. eta vs tors. theta energy: -57.265 Dist. restrs. and SS energy: -181.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -1014.966137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.966137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -846.116137 (E_RNA) where: Base-Base interactions energy: -587.100 where: short stacking energy: -227.616 Base-Backbone interact. energy: -0.969 local terms energy: -258.047101 where: bonds (distance) C4'-P energy: -47.922 bonds (distance) P-C4' energy: -54.583 flat angles C4'-P-C4' energy: -57.199 flat angles P-C4'-P energy: -41.738 tors. eta vs tors. theta energy: -56.605 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -922.580711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.580711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.530711 (E_RNA) where: Base-Base interactions energy: -529.486 where: short stacking energy: -228.683 Base-Backbone interact. energy: -1.284 local terms energy: -260.760204 where: bonds (distance) C4'-P energy: -48.098 bonds (distance) P-C4' energy: -57.993 flat angles C4'-P-C4' energy: -58.306 flat angles P-C4'-P energy: -33.401 tors. eta vs tors. theta energy: -62.962 Dist. restrs. and SS energy: -154.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -940.398054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -940.398054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.548054 (E_RNA) where: Base-Base interactions energy: -542.928 where: short stacking energy: -201.136 Base-Backbone interact. energy: 0.330 local terms energy: -237.949641 where: bonds (distance) C4'-P energy: -30.976 bonds (distance) P-C4' energy: -66.008 flat angles C4'-P-C4' energy: -51.841 flat angles P-C4'-P energy: -38.513 tors. eta vs tors. theta energy: -50.611 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -920.154424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.154424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.304424 (E_RNA) where: Base-Base interactions energy: -535.659 where: short stacking energy: -213.244 Base-Backbone interact. energy: 1.076 local terms energy: -225.721342 where: bonds (distance) C4'-P energy: -41.999 bonds (distance) P-C4' energy: -48.840 flat angles C4'-P-C4' energy: -51.288 flat angles P-C4'-P energy: -41.317 tors. eta vs tors. theta energy: -42.276 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -1243.281348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1243.281348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1074.431348 (E_RNA) where: Base-Base interactions energy: -740.007 where: short stacking energy: -312.151 Base-Backbone interact. energy: -1.870 local terms energy: -332.554486 where: bonds (distance) C4'-P energy: -54.244 bonds (distance) P-C4' energy: -64.327 flat angles C4'-P-C4' energy: -69.796 flat angles P-C4'-P energy: -51.563 tors. eta vs tors. theta energy: -92.625 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -1156.401280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1156.401280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -994.751280 (E_RNA) where: Base-Base interactions energy: -694.907 where: short stacking energy: -275.410 Base-Backbone interact. energy: -1.683 local terms energy: -298.161399 where: bonds (distance) C4'-P energy: -51.490 bonds (distance) P-C4' energy: -59.506 flat angles C4'-P-C4' energy: -59.590 flat angles P-C4'-P energy: -48.557 tors. eta vs tors. theta energy: -79.019 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -1144.885260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1144.885260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -988.635260 (E_RNA) where: Base-Base interactions energy: -675.927 where: short stacking energy: -295.536 Base-Backbone interact. energy: -2.305 local terms energy: -310.404032 where: bonds (distance) C4'-P energy: -51.743 bonds (distance) P-C4' energy: -60.453 flat angles C4'-P-C4' energy: -63.275 flat angles P-C4'-P energy: -51.794 tors. eta vs tors. theta energy: -83.139 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -1110.258479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1110.258479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.008479 (E_RNA) where: Base-Base interactions energy: -668.085 where: short stacking energy: -291.270 Base-Backbone interact. energy: -2.231 local terms energy: -301.692200 where: bonds (distance) C4'-P energy: -50.419 bonds (distance) P-C4' energy: -58.203 flat angles C4'-P-C4' energy: -65.604 flat angles P-C4'-P energy: -40.268 tors. eta vs tors. theta energy: -87.198 Dist. restrs. and SS energy: -162.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -1054.816582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1054.816582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.566582 (E_RNA) where: Base-Base interactions energy: -625.403 where: short stacking energy: -239.310 Base-Backbone interact. energy: -1.376 local terms energy: -262.787778 where: bonds (distance) C4'-P energy: -48.180 bonds (distance) P-C4' energy: -41.745 flat angles C4'-P-C4' energy: -61.948 flat angles P-C4'-P energy: -41.934 tors. eta vs tors. theta energy: -68.981 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -1033.503633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1033.503633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -870.053633 (E_RNA) where: Base-Base interactions energy: -581.940 where: short stacking energy: -220.805 Base-Backbone interact. energy: -1.762 local terms energy: -286.352038 where: bonds (distance) C4'-P energy: -63.259 bonds (distance) P-C4' energy: -63.051 flat angles C4'-P-C4' energy: -61.356 flat angles P-C4'-P energy: -45.094 tors. eta vs tors. theta energy: -53.592 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -1004.016089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.016089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.966089 (E_RNA) where: Base-Base interactions energy: -578.417 where: short stacking energy: -212.968 Base-Backbone interact. energy: -1.098 local terms energy: -257.450862 where: bonds (distance) C4'-P energy: -46.892 bonds (distance) P-C4' energy: -47.999 flat angles C4'-P-C4' energy: -58.356 flat angles P-C4'-P energy: -41.749 tors. eta vs tors. theta energy: -62.454 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -1009.900525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.900525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.050525 (E_RNA) where: Base-Base interactions energy: -597.734 where: short stacking energy: -224.406 Base-Backbone interact. energy: -1.658 local terms energy: -241.659358 where: bonds (distance) C4'-P energy: -37.138 bonds (distance) P-C4' energy: -59.176 flat angles C4'-P-C4' energy: -52.741 flat angles P-C4'-P energy: -34.058 tors. eta vs tors. theta energy: -58.547 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -903.726523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -903.726523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.876523 (E_RNA) where: Base-Base interactions energy: -544.725 where: short stacking energy: -204.153 Base-Backbone interact. energy: 3.059 local terms energy: -238.210242 where: bonds (distance) C4'-P energy: -51.779 bonds (distance) P-C4' energy: -53.474 flat angles C4'-P-C4' energy: -44.558 flat angles P-C4'-P energy: -31.079 tors. eta vs tors. theta energy: -57.320 Dist. restrs. and SS energy: -147.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -914.783415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -914.783415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.133415 (E_RNA) where: Base-Base interactions energy: -517.245 where: short stacking energy: -185.909 Base-Backbone interact. energy: -1.333 local terms energy: -225.555543 where: bonds (distance) C4'-P energy: -47.443 bonds (distance) P-C4' energy: -50.954 flat angles C4'-P-C4' energy: -53.911 flat angles P-C4'-P energy: -31.740 tors. eta vs tors. theta energy: -41.509 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -1232.744987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1232.744987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1062.094987 (E_RNA) where: Base-Base interactions energy: -752.690 where: short stacking energy: -314.566 Base-Backbone interact. energy: -0.397 local terms energy: -309.008643 where: bonds (distance) C4'-P energy: -48.999 bonds (distance) P-C4' energy: -52.892 flat angles C4'-P-C4' energy: -69.165 flat angles P-C4'-P energy: -41.950 tors. eta vs tors. theta energy: -96.003 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -1151.633076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1151.633076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -988.183076 (E_RNA) where: Base-Base interactions energy: -686.507 where: short stacking energy: -285.518 Base-Backbone interact. energy: -0.907 local terms energy: -300.768437 where: bonds (distance) C4'-P energy: -57.422 bonds (distance) P-C4' energy: -61.458 flat angles C4'-P-C4' energy: -68.258 flat angles P-C4'-P energy: -40.141 tors. eta vs tors. theta energy: -73.490 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -1157.095618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1157.095618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.845618 (E_RNA) where: Base-Base interactions energy: -690.770 where: short stacking energy: -271.522 Base-Backbone interact. energy: -0.687 local terms energy: -309.388633 where: bonds (distance) C4'-P energy: -62.037 bonds (distance) P-C4' energy: -56.053 flat angles C4'-P-C4' energy: -56.750 flat angles P-C4'-P energy: -45.388 tors. eta vs tors. theta energy: -89.160 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -1078.164006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.164006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -936.314006 (E_RNA) where: Base-Base interactions energy: -628.087 where: short stacking energy: -270.656 Base-Backbone interact. energy: 0.263 local terms energy: -308.489953 where: bonds (distance) C4'-P energy: -58.200 bonds (distance) P-C4' energy: -59.316 flat angles C4'-P-C4' energy: -61.585 flat angles P-C4'-P energy: -47.570 tors. eta vs tors. theta energy: -81.819 Dist. restrs. and SS energy: -165.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -1071.960201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1071.960201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -915.710201 (E_RNA) where: Base-Base interactions energy: -623.710 where: short stacking energy: -244.606 Base-Backbone interact. energy: -0.746 local terms energy: -291.254529 where: bonds (distance) C4'-P energy: -51.543 bonds (distance) P-C4' energy: -64.016 flat angles C4'-P-C4' energy: -62.279 flat angles P-C4'-P energy: -41.837 tors. eta vs tors. theta energy: -71.580 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -1067.751846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.751846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.701846 (E_RNA) where: Base-Base interactions energy: -634.696 where: short stacking energy: -243.578 Base-Backbone interact. energy: 0.340 local terms energy: -266.346120 where: bonds (distance) C4'-P energy: -38.979 bonds (distance) P-C4' energy: -57.944 flat angles C4'-P-C4' energy: -62.681 flat angles P-C4'-P energy: -37.561 tors. eta vs tors. theta energy: -69.180 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -1003.920655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1003.920655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.270655 (E_RNA) where: Base-Base interactions energy: -586.019 where: short stacking energy: -219.331 Base-Backbone interact. energy: -0.939 local terms energy: -246.312922 where: bonds (distance) C4'-P energy: -44.655 bonds (distance) P-C4' energy: -50.337 flat angles C4'-P-C4' energy: -70.678 flat angles P-C4'-P energy: -31.504 tors. eta vs tors. theta energy: -49.138 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -994.775672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.775672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.125672 (E_RNA) where: Base-Base interactions energy: -575.471 where: short stacking energy: -230.404 Base-Backbone interact. energy: -0.079 local terms energy: -257.575405 where: bonds (distance) C4'-P energy: -51.239 bonds (distance) P-C4' energy: -44.942 flat angles C4'-P-C4' energy: -55.677 flat angles P-C4'-P energy: -40.206 tors. eta vs tors. theta energy: -65.512 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -941.151846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -941.151846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.901846 (E_RNA) where: Base-Base interactions energy: -552.267 where: short stacking energy: -208.186 Base-Backbone interact. energy: -3.944 local terms energy: -228.690190 where: bonds (distance) C4'-P energy: -36.797 bonds (distance) P-C4' energy: -41.882 flat angles C4'-P-C4' energy: -57.797 flat angles P-C4'-P energy: -38.536 tors. eta vs tors. theta energy: -53.679 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -885.217595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -885.217595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.767595 (E_RNA) where: Base-Base interactions energy: -512.766 where: short stacking energy: -193.343 Base-Backbone interact. energy: -0.760 local terms energy: -253.241180 where: bonds (distance) C4'-P energy: -51.635 bonds (distance) P-C4' energy: -60.716 flat angles C4'-P-C4' energy: -56.017 flat angles P-C4'-P energy: -26.641 tors. eta vs tors. theta energy: -58.232 Dist. restrs. and SS energy: -142.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -1228.105985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1228.105985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.255985 (E_RNA) where: Base-Base interactions energy: -722.732 where: short stacking energy: -306.985 Base-Backbone interact. energy: 1.079 local terms energy: -337.602391 where: bonds (distance) C4'-P energy: -62.845 bonds (distance) P-C4' energy: -63.917 flat angles C4'-P-C4' energy: -70.484 flat angles P-C4'-P energy: -51.670 tors. eta vs tors. theta energy: -88.686 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -1157.927957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1157.927957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -994.477957 (E_RNA) where: Base-Base interactions energy: -695.029 where: short stacking energy: -290.230 Base-Backbone interact. energy: -1.604 local terms energy: -297.845537 where: bonds (distance) C4'-P energy: -57.572 bonds (distance) P-C4' energy: -54.636 flat angles C4'-P-C4' energy: -64.457 flat angles P-C4'-P energy: -42.080 tors. eta vs tors. theta energy: -79.100 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -1158.497574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1158.497574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1004.047574 (E_RNA) where: Base-Base interactions energy: -694.854 where: short stacking energy: -287.108 Base-Backbone interact. energy: 0.050 local terms energy: -309.243687 where: bonds (distance) C4'-P energy: -56.754 bonds (distance) P-C4' energy: -61.047 flat angles C4'-P-C4' energy: -67.747 flat angles P-C4'-P energy: -42.605 tors. eta vs tors. theta energy: -81.092 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -1093.863112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1093.863112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.813112 (E_RNA) where: Base-Base interactions energy: -667.366 where: short stacking energy: -284.440 Base-Backbone interact. energy: -2.242 local terms energy: -284.204464 where: bonds (distance) C4'-P energy: -38.989 bonds (distance) P-C4' energy: -57.451 flat angles C4'-P-C4' energy: -61.323 flat angles P-C4'-P energy: -45.715 tors. eta vs tors. theta energy: -80.727 Dist. restrs. and SS energy: -163.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -1061.689851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.689851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.039851 (E_RNA) where: Base-Base interactions energy: -623.951 where: short stacking energy: -245.695 Base-Backbone interact. energy: -0.208 local terms energy: -275.881708 where: bonds (distance) C4'-P energy: -56.412 bonds (distance) P-C4' energy: -53.631 flat angles C4'-P-C4' energy: -51.996 flat angles P-C4'-P energy: -46.757 tors. eta vs tors. theta energy: -67.086 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -1052.221487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.221487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -892.371487 (E_RNA) where: Base-Base interactions energy: -620.472 where: short stacking energy: -239.677 Base-Backbone interact. energy: -1.431 local terms energy: -270.467760 where: bonds (distance) C4'-P energy: -60.316 bonds (distance) P-C4' energy: -46.879 flat angles C4'-P-C4' energy: -51.662 flat angles P-C4'-P energy: -40.468 tors. eta vs tors. theta energy: -71.142 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -1064.681883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.681883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.231883 (E_RNA) where: Base-Base interactions energy: -634.222 where: short stacking energy: -256.868 Base-Backbone interact. energy: -0.285 local terms energy: -266.724966 where: bonds (distance) C4'-P energy: -51.124 bonds (distance) P-C4' energy: -43.302 flat angles C4'-P-C4' energy: -68.332 flat angles P-C4'-P energy: -35.097 tors. eta vs tors. theta energy: -68.870 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -982.105082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.105082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.055082 (E_RNA) where: Base-Base interactions energy: -574.843 where: short stacking energy: -213.657 Base-Backbone interact. energy: 2.623 local terms energy: -242.835062 where: bonds (distance) C4'-P energy: -48.721 bonds (distance) P-C4' energy: -58.848 flat angles C4'-P-C4' energy: -51.874 flat angles P-C4'-P energy: -37.516 tors. eta vs tors. theta energy: -45.876 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -969.583244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -969.583244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.733244 (E_RNA) where: Base-Base interactions energy: -573.870 where: short stacking energy: -215.980 Base-Backbone interact. energy: -1.820 local terms energy: -225.042880 where: bonds (distance) C4'-P energy: -29.450 bonds (distance) P-C4' energy: -57.844 flat angles C4'-P-C4' energy: -57.114 flat angles P-C4'-P energy: -23.088 tors. eta vs tors. theta energy: -57.546 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -926.098327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -926.098327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -802.248327 (E_RNA) where: Base-Base interactions energy: -565.777 where: short stacking energy: -237.593 Base-Backbone interact. energy: -1.081 local terms energy: -235.390648 where: bonds (distance) C4'-P energy: -45.838 bonds (distance) P-C4' energy: -47.225 flat angles C4'-P-C4' energy: -53.204 flat angles P-C4'-P energy: -31.813 tors. eta vs tors. theta energy: -57.311 Dist. restrs. and SS energy: -147.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -1233.289461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1233.289461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1064.439461 (E_RNA) where: Base-Base interactions energy: -734.635 where: short stacking energy: -305.336 Base-Backbone interact. energy: -1.408 local terms energy: -328.397017 where: bonds (distance) C4'-P energy: -54.223 bonds (distance) P-C4' energy: -59.282 flat angles C4'-P-C4' energy: -73.969 flat angles P-C4'-P energy: -48.752 tors. eta vs tors. theta energy: -92.172 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -1155.008908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1155.008908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -993.358908 (E_RNA) where: Base-Base interactions energy: -691.436 where: short stacking energy: -279.256 Base-Backbone interact. energy: -0.699 local terms energy: -301.223664 where: bonds (distance) C4'-P energy: -47.170 bonds (distance) P-C4' energy: -60.690 flat angles C4'-P-C4' energy: -67.449 flat angles P-C4'-P energy: -44.324 tors. eta vs tors. theta energy: -81.591 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -1157.743989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1157.743989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1001.493989 (E_RNA) where: Base-Base interactions energy: -696.952 where: short stacking energy: -288.398 Base-Backbone interact. energy: -0.409 local terms energy: -304.132929 where: bonds (distance) C4'-P energy: -55.258 bonds (distance) P-C4' energy: -55.700 flat angles C4'-P-C4' energy: -68.702 flat angles P-C4'-P energy: -47.821 tors. eta vs tors. theta energy: -76.652 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -1069.989156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.989156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.739156 (E_RNA) where: Base-Base interactions energy: -624.985 where: short stacking energy: -244.402 Base-Backbone interact. energy: -1.107 local terms energy: -305.647730 where: bonds (distance) C4'-P energy: -57.976 bonds (distance) P-C4' energy: -65.581 flat angles C4'-P-C4' energy: -62.275 flat angles P-C4'-P energy: -49.319 tors. eta vs tors. theta energy: -70.497 Dist. restrs. and SS energy: -162.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -1076.632075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.632075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.382075 (E_RNA) where: Base-Base interactions energy: -632.190 where: short stacking energy: -257.590 Base-Backbone interact. energy: -0.674 local terms energy: -278.518461 where: bonds (distance) C4'-P energy: -55.764 bonds (distance) P-C4' energy: -57.133 flat angles C4'-P-C4' energy: -58.291 flat angles P-C4'-P energy: -40.176 tors. eta vs tors. theta energy: -67.154 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -1031.322796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.322796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.072796 (E_RNA) where: Base-Base interactions energy: -594.129 where: short stacking energy: -227.329 Base-Backbone interact. energy: 0.935 local terms energy: -272.878160 where: bonds (distance) C4'-P energy: -50.718 bonds (distance) P-C4' energy: -49.113 flat angles C4'-P-C4' energy: -59.298 flat angles P-C4'-P energy: -44.691 tors. eta vs tors. theta energy: -69.058 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -1010.972936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.972936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.722936 (E_RNA) where: Base-Base interactions energy: -596.326 where: short stacking energy: -236.317 Base-Backbone interact. energy: -0.895 local terms energy: -248.502480 where: bonds (distance) C4'-P energy: -48.647 bonds (distance) P-C4' energy: -33.279 flat angles C4'-P-C4' energy: -57.624 flat angles P-C4'-P energy: -42.524 tors. eta vs tors. theta energy: -66.428 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -1025.199127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.199127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.149127 (E_RNA) where: Base-Base interactions energy: -590.666 where: short stacking energy: -245.449 Base-Backbone interact. energy: -1.040 local terms energy: -275.443249 where: bonds (distance) C4'-P energy: -51.178 bonds (distance) P-C4' energy: -55.305 flat angles C4'-P-C4' energy: -61.639 flat angles P-C4'-P energy: -36.493 tors. eta vs tors. theta energy: -70.829 Dist. restrs. and SS energy: -181.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -963.604070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.604070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -801.954070 (E_RNA) where: Base-Base interactions energy: -571.351 where: short stacking energy: -229.511 Base-Backbone interact. energy: 4.417 local terms energy: -235.019537 where: bonds (distance) C4'-P energy: -44.819 bonds (distance) P-C4' energy: -43.783 flat angles C4'-P-C4' energy: -56.482 flat angles P-C4'-P energy: -26.372 tors. eta vs tors. theta energy: -63.562 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -905.546659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -905.546659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.296659 (E_RNA) where: Base-Base interactions energy: -550.877 where: short stacking energy: -210.933 Base-Backbone interact. energy: -2.082 local terms energy: -223.337740 where: bonds (distance) C4'-P energy: -40.233 bonds (distance) P-C4' energy: -48.011 flat angles C4'-P-C4' energy: -53.687 flat angles P-C4'-P energy: -28.791 tors. eta vs tors. theta energy: -52.616 Dist. restrs. and SS energy: -153.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -1234.269370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1234.269370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1063.619370 (E_RNA) where: Base-Base interactions energy: -721.556 where: short stacking energy: -305.734 Base-Backbone interact. energy: -5.868 local terms energy: -336.195757 where: bonds (distance) C4'-P energy: -58.823 bonds (distance) P-C4' energy: -62.629 flat angles C4'-P-C4' energy: -74.349 flat angles P-C4'-P energy: -49.200 tors. eta vs tors. theta energy: -91.194 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -1168.408608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1168.408608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1017.558608 (E_RNA) where: Base-Base interactions energy: -690.802 where: short stacking energy: -282.118 Base-Backbone interact. energy: -1.698 local terms energy: -325.058156 where: bonds (distance) C4'-P energy: -61.278 bonds (distance) P-C4' energy: -64.993 flat angles C4'-P-C4' energy: -62.077 flat angles P-C4'-P energy: -49.701 tors. eta vs tors. theta energy: -87.009 Dist. restrs. and SS energy: -174.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -1166.942406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1166.942406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1007.092406 (E_RNA) where: Base-Base interactions energy: -705.906 where: short stacking energy: -269.054 Base-Backbone interact. energy: -0.266 local terms energy: -300.920175 where: bonds (distance) C4'-P energy: -43.458 bonds (distance) P-C4' energy: -66.107 flat angles C4'-P-C4' energy: -69.506 flat angles P-C4'-P energy: -49.740 tors. eta vs tors. theta energy: -72.109 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -1079.162613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1079.162613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -912.112613 (E_RNA) where: Base-Base interactions energy: -604.709 where: short stacking energy: -247.954 Base-Backbone interact. energy: 1.070 local terms energy: -308.473431 where: bonds (distance) C4'-P energy: -54.402 bonds (distance) P-C4' energy: -64.229 flat angles C4'-P-C4' energy: -61.481 flat angles P-C4'-P energy: -55.866 tors. eta vs tors. theta energy: -72.495 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -1023.147496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.147496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.297496 (E_RNA) where: Base-Base interactions energy: -604.653 where: short stacking energy: -237.916 Base-Backbone interact. energy: -1.152 local terms energy: -275.492234 where: bonds (distance) C4'-P energy: -51.912 bonds (distance) P-C4' energy: -54.026 flat angles C4'-P-C4' energy: -53.852 flat angles P-C4'-P energy: -37.728 tors. eta vs tors. theta energy: -77.974 Dist. restrs. and SS energy: -165.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -1044.218638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1044.218638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -884.368638 (E_RNA) where: Base-Base interactions energy: -613.092 where: short stacking energy: -230.883 Base-Backbone interact. energy: -1.831 local terms energy: -269.445212 where: bonds (distance) C4'-P energy: -54.468 bonds (distance) P-C4' energy: -57.219 flat angles C4'-P-C4' energy: -54.077 flat angles P-C4'-P energy: -47.306 tors. eta vs tors. theta energy: -56.375 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -1038.353309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.353309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -873.103309 (E_RNA) where: Base-Base interactions energy: -634.752 where: short stacking energy: -254.000 Base-Backbone interact. energy: 2.478 local terms energy: -240.829110 where: bonds (distance) C4'-P energy: -50.955 bonds (distance) P-C4' energy: -50.065 flat angles C4'-P-C4' energy: -51.725 flat angles P-C4'-P energy: -27.931 tors. eta vs tors. theta energy: -60.153 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -1020.390600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.390600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -856.940600 (E_RNA) where: Base-Base interactions energy: -602.430 where: short stacking energy: -242.463 Base-Backbone interact. energy: -0.191 local terms energy: -254.319511 where: bonds (distance) C4'-P energy: -40.085 bonds (distance) P-C4' energy: -58.078 flat angles C4'-P-C4' energy: -58.809 flat angles P-C4'-P energy: -34.712 tors. eta vs tors. theta energy: -62.635 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -1011.489323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.489323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -844.439323 (E_RNA) where: Base-Base interactions energy: -587.640 where: short stacking energy: -227.339 Base-Backbone interact. energy: -0.241 local terms energy: -256.557701 where: bonds (distance) C4'-P energy: -51.180 bonds (distance) P-C4' energy: -45.411 flat angles C4'-P-C4' energy: -61.327 flat angles P-C4'-P energy: -37.979 tors. eta vs tors. theta energy: -60.660 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -875.342512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.342512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.892512 (E_RNA) where: Base-Base interactions energy: -507.646 where: short stacking energy: -192.624 Base-Backbone interact. energy: -1.807 local terms energy: -238.439073 where: bonds (distance) C4'-P energy: -47.997 bonds (distance) P-C4' energy: -60.091 flat angles C4'-P-C4' energy: -49.691 flat angles P-C4'-P energy: -34.712 tors. eta vs tors. theta energy: -45.948 Dist. restrs. and SS energy: -151.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -1227.182817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1227.182817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1072.732817 (E_RNA) where: Base-Base interactions energy: -751.660 where: short stacking energy: -321.678 Base-Backbone interact. energy: -1.503 local terms energy: -319.569968 where: bonds (distance) C4'-P energy: -40.163 bonds (distance) P-C4' energy: -62.275 flat angles C4'-P-C4' energy: -70.576 flat angles P-C4'-P energy: -53.458 tors. eta vs tors. theta energy: -93.099 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -1217.062895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1217.062895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1046.412895 (E_RNA) where: Base-Base interactions energy: -724.599 where: short stacking energy: -314.470 Base-Backbone interact. energy: 0.677 local terms energy: -322.490374 where: bonds (distance) C4'-P energy: -59.282 bonds (distance) P-C4' energy: -51.609 flat angles C4'-P-C4' energy: -67.482 flat angles P-C4'-P energy: -49.889 tors. eta vs tors. theta energy: -94.228 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -1156.002677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1156.002677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -997.952677 (E_RNA) where: Base-Base interactions energy: -707.992 where: short stacking energy: -263.050 Base-Backbone interact. energy: -1.781 local terms energy: -288.179639 where: bonds (distance) C4'-P energy: -59.357 bonds (distance) P-C4' energy: -53.290 flat angles C4'-P-C4' energy: -67.491 flat angles P-C4'-P energy: -41.194 tors. eta vs tors. theta energy: -66.847 Dist. restrs. and SS energy: -181.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -1102.703663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.703663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.453663 (E_RNA) where: Base-Base interactions energy: -657.323 where: short stacking energy: -266.675 Base-Backbone interact. energy: 1.711 local terms energy: -281.841668 where: bonds (distance) C4'-P energy: -38.240 bonds (distance) P-C4' energy: -52.635 flat angles C4'-P-C4' energy: -70.042 flat angles P-C4'-P energy: -46.590 tors. eta vs tors. theta energy: -74.335 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -1083.494965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.494965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -920.044965 (E_RNA) where: Base-Base interactions energy: -633.101 where: short stacking energy: -247.977 Base-Backbone interact. energy: -0.948 local terms energy: -285.996562 where: bonds (distance) C4'-P energy: -50.975 bonds (distance) P-C4' energy: -58.970 flat angles C4'-P-C4' energy: -65.511 flat angles P-C4'-P energy: -38.606 tors. eta vs tors. theta energy: -71.934 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -1014.169802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.169802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.119802 (E_RNA) where: Base-Base interactions energy: -605.663 where: short stacking energy: -240.539 Base-Backbone interact. energy: 0.352 local terms energy: -268.808413 where: bonds (distance) C4'-P energy: -48.928 bonds (distance) P-C4' energy: -53.878 flat angles C4'-P-C4' energy: -59.056 flat angles P-C4'-P energy: -39.681 tors. eta vs tors. theta energy: -67.266 Dist. restrs. and SS energy: -163.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -1054.789419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1054.789419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.939419 (E_RNA) where: Base-Base interactions energy: -618.435 where: short stacking energy: -215.209 Base-Backbone interact. energy: 1.328 local terms energy: -268.832114 where: bonds (distance) C4'-P energy: -55.639 bonds (distance) P-C4' energy: -64.892 flat angles C4'-P-C4' energy: -50.282 flat angles P-C4'-P energy: -42.413 tors. eta vs tors. theta energy: -55.607 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -999.524676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.524676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -830.674676 (E_RNA) where: Base-Base interactions energy: -592.787 where: short stacking energy: -224.252 Base-Backbone interact. energy: -0.556 local terms energy: -237.331700 where: bonds (distance) C4'-P energy: -40.291 bonds (distance) P-C4' energy: -43.282 flat angles C4'-P-C4' energy: -52.492 flat angles P-C4'-P energy: -39.490 tors. eta vs tors. theta energy: -61.777 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -1001.315943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.315943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.865943 (E_RNA) where: Base-Base interactions energy: -586.644 where: short stacking energy: -233.400 Base-Backbone interact. energy: -0.237 local terms energy: -250.985310 where: bonds (distance) C4'-P energy: -50.553 bonds (distance) P-C4' energy: -48.223 flat angles C4'-P-C4' energy: -55.777 flat angles P-C4'-P energy: -31.463 tors. eta vs tors. theta energy: -64.970 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -868.076757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -868.076757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.226757 (E_RNA) where: Base-Base interactions energy: -560.316 where: short stacking energy: -204.658 Base-Backbone interact. energy: -1.550 local terms energy: -191.360714 where: bonds (distance) C4'-P energy: -37.047 bonds (distance) P-C4' energy: -39.840 flat angles C4'-P-C4' energy: -47.588 flat angles P-C4'-P energy: -26.912 tors. eta vs tors. theta energy: -39.973 Dist. restrs. and SS energy: -138.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -1222.248378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1222.248378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1067.798378 (E_RNA) where: Base-Base interactions energy: -731.819 where: short stacking energy: -306.680 Base-Backbone interact. energy: -1.145 local terms energy: -334.834303 where: bonds (distance) C4'-P energy: -62.442 bonds (distance) P-C4' energy: -66.390 flat angles C4'-P-C4' energy: -64.792 flat angles P-C4'-P energy: -50.203 tors. eta vs tors. theta energy: -91.008 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -1222.558282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1222.558282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1051.908282 (E_RNA) where: Base-Base interactions energy: -742.504 where: short stacking energy: -313.665 Base-Backbone interact. energy: -1.346 local terms energy: -308.058092 where: bonds (distance) C4'-P energy: -56.396 bonds (distance) P-C4' energy: -48.592 flat angles C4'-P-C4' energy: -68.726 flat angles P-C4'-P energy: -41.769 tors. eta vs tors. theta energy: -92.575 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -1149.114969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1149.114969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -991.064969 (E_RNA) where: Base-Base interactions energy: -692.756 where: short stacking energy: -273.702 Base-Backbone interact. energy: -0.195 local terms energy: -298.114384 where: bonds (distance) C4'-P energy: -58.618 bonds (distance) P-C4' energy: -54.204 flat angles C4'-P-C4' energy: -64.792 flat angles P-C4'-P energy: -42.892 tors. eta vs tors. theta energy: -77.608 Dist. restrs. and SS energy: -181.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -1092.867030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1092.867030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.617030 (E_RNA) where: Base-Base interactions energy: -651.968 where: short stacking energy: -260.732 Base-Backbone interact. energy: -0.738 local terms energy: -274.910473 where: bonds (distance) C4'-P energy: -52.151 bonds (distance) P-C4' energy: -56.978 flat angles C4'-P-C4' energy: -59.398 flat angles P-C4'-P energy: -36.388 tors. eta vs tors. theta energy: -69.995 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -1074.003256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1074.003256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -917.753256 (E_RNA) where: Base-Base interactions energy: -626.779 where: short stacking energy: -269.007 Base-Backbone interact. energy: -0.466 local terms energy: -290.508535 where: bonds (distance) C4'-P energy: -62.988 bonds (distance) P-C4' energy: -50.737 flat angles C4'-P-C4' energy: -65.866 flat angles P-C4'-P energy: -35.348 tors. eta vs tors. theta energy: -75.570 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -1063.704827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.704827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -902.054827 (E_RNA) where: Base-Base interactions energy: -618.155 where: short stacking energy: -240.671 Base-Backbone interact. energy: -2.184 local terms energy: -281.716589 where: bonds (distance) C4'-P energy: -58.970 bonds (distance) P-C4' energy: -59.108 flat angles C4'-P-C4' energy: -65.218 flat angles P-C4'-P energy: -36.493 tors. eta vs tors. theta energy: -61.927 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -1004.895102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.895102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.645102 (E_RNA) where: Base-Base interactions energy: -612.315 where: short stacking energy: -242.184 Base-Backbone interact. energy: -0.941 local terms energy: -253.389443 where: bonds (distance) C4'-P energy: -61.275 bonds (distance) P-C4' energy: -45.786 flat angles C4'-P-C4' energy: -54.089 flat angles P-C4'-P energy: -25.208 tors. eta vs tors. theta energy: -67.031 Dist. restrs. and SS energy: -162.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -978.586089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.586089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -816.936089 (E_RNA) where: Base-Base interactions energy: -575.015 where: short stacking energy: -205.086 Base-Backbone interact. energy: 3.708 local terms energy: -245.628661 where: bonds (distance) C4'-P energy: -45.634 bonds (distance) P-C4' energy: -58.108 flat angles C4'-P-C4' energy: -57.387 flat angles P-C4'-P energy: -28.886 tors. eta vs tors. theta energy: -55.613 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -964.627831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.627831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.377831 (E_RNA) where: Base-Base interactions energy: -591.884 where: short stacking energy: -232.872 Base-Backbone interact. energy: 0.655 local terms energy: -208.148970 where: bonds (distance) C4'-P energy: -37.445 bonds (distance) P-C4' energy: -38.457 flat angles C4'-P-C4' energy: -38.806 flat angles P-C4'-P energy: -36.361 tors. eta vs tors. theta energy: -57.080 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -839.181353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -839.181353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.531353 (E_RNA) where: Base-Base interactions energy: -508.301 where: short stacking energy: -195.222 Base-Backbone interact. energy: 2.442 local terms energy: -207.672210 where: bonds (distance) C4'-P energy: -46.909 bonds (distance) P-C4' energy: -39.558 flat angles C4'-P-C4' energy: -41.795 flat angles P-C4'-P energy: -31.365 tors. eta vs tors. theta energy: -48.045 Dist. restrs. and SS energy: -149.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -1249.741303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1249.741303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1079.091303 (E_RNA) where: Base-Base interactions energy: -744.587 where: short stacking energy: -312.995 Base-Backbone interact. energy: -1.415 local terms energy: -333.089745 where: bonds (distance) C4'-P energy: -61.489 bonds (distance) P-C4' energy: -56.519 flat angles C4'-P-C4' energy: -69.451 flat angles P-C4'-P energy: -51.722 tors. eta vs tors. theta energy: -93.910 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -1166.071864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1166.071864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1013.421864 (E_RNA) where: Base-Base interactions energy: -677.757 where: short stacking energy: -305.157 Base-Backbone interact. energy: -1.605 local terms energy: -334.060574 where: bonds (distance) C4'-P energy: -61.114 bonds (distance) P-C4' energy: -65.962 flat angles C4'-P-C4' energy: -71.124 flat angles P-C4'-P energy: -48.309 tors. eta vs tors. theta energy: -87.552 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -1128.888229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1128.888229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.038229 (E_RNA) where: Base-Base interactions energy: -665.948 where: short stacking energy: -270.242 Base-Backbone interact. energy: -2.062 local terms energy: -292.027795 where: bonds (distance) C4'-P energy: -59.891 bonds (distance) P-C4' energy: -63.073 flat angles C4'-P-C4' energy: -62.430 flat angles P-C4'-P energy: -35.396 tors. eta vs tors. theta energy: -71.238 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -1096.511869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.511869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -933.061869 (E_RNA) where: Base-Base interactions energy: -654.475 where: short stacking energy: -254.407 Base-Backbone interact. energy: -2.288 local terms energy: -276.299486 where: bonds (distance) C4'-P energy: -53.160 bonds (distance) P-C4' energy: -44.379 flat angles C4'-P-C4' energy: -66.701 flat angles P-C4'-P energy: -41.211 tors. eta vs tors. theta energy: -70.848 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -1076.099269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.099269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -909.049269 (E_RNA) where: Base-Base interactions energy: -626.565 where: short stacking energy: -259.083 Base-Backbone interact. energy: -1.456 local terms energy: -281.027938 where: bonds (distance) C4'-P energy: -57.862 bonds (distance) P-C4' energy: -46.436 flat angles C4'-P-C4' energy: -60.260 flat angles P-C4'-P energy: -46.817 tors. eta vs tors. theta energy: -69.653 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -1064.975256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.975256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.525256 (E_RNA) where: Base-Base interactions energy: -640.678 where: short stacking energy: -252.433 Base-Backbone interact. energy: -1.122 local terms energy: -259.724575 where: bonds (distance) C4'-P energy: -47.350 bonds (distance) P-C4' energy: -51.118 flat angles C4'-P-C4' energy: -66.124 flat angles P-C4'-P energy: -32.857 tors. eta vs tors. theta energy: -62.275 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -1006.369331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.369331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -839.319331 (E_RNA) where: Base-Base interactions energy: -591.279 where: short stacking energy: -232.377 Base-Backbone interact. energy: 1.176 local terms energy: -249.216917 where: bonds (distance) C4'-P energy: -41.284 bonds (distance) P-C4' energy: -51.292 flat angles C4'-P-C4' energy: -58.026 flat angles P-C4'-P energy: -33.854 tors. eta vs tors. theta energy: -64.761 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -950.344942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -950.344942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -808.494942 (E_RNA) where: Base-Base interactions energy: -550.893 where: short stacking energy: -219.210 Base-Backbone interact. energy: -0.451 local terms energy: -257.150553 where: bonds (distance) C4'-P energy: -44.048 bonds (distance) P-C4' energy: -59.232 flat angles C4'-P-C4' energy: -60.389 flat angles P-C4'-P energy: -27.671 tors. eta vs tors. theta energy: -65.810 Dist. restrs. and SS energy: -165.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -1002.914415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1002.914415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.064415 (E_RNA) where: Base-Base interactions energy: -594.748 where: short stacking energy: -208.714 Base-Backbone interact. energy: -4.386 local terms energy: -234.930419 where: bonds (distance) C4'-P energy: -57.717 bonds (distance) P-C4' energy: -44.900 flat angles C4'-P-C4' energy: -46.439 flat angles P-C4'-P energy: -37.649 tors. eta vs tors. theta energy: -48.225 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -834.522364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.522364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.872364 (E_RNA) where: Base-Base interactions energy: -517.074 where: short stacking energy: -188.533 Base-Backbone interact. energy: -0.638 local terms energy: -200.160356 where: bonds (distance) C4'-P energy: -46.360 bonds (distance) P-C4' energy: -58.509 flat angles C4'-P-C4' energy: -38.361 flat angles P-C4'-P energy: -15.883 tors. eta vs tors. theta energy: -41.048 Dist. restrs. and SS energy: -140.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -1239.767747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1239.767747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1072.717747 (E_RNA) where: Base-Base interactions energy: -746.613 where: short stacking energy: -314.670 Base-Backbone interact. energy: 0.539 local terms energy: -326.643264 where: bonds (distance) C4'-P energy: -57.299 bonds (distance) P-C4' energy: -53.036 flat angles C4'-P-C4' energy: -65.306 flat angles P-C4'-P energy: -55.059 tors. eta vs tors. theta energy: -95.943 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -1195.204078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1195.204078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.754078 (E_RNA) where: Base-Base interactions energy: -723.435 where: short stacking energy: -312.120 Base-Backbone interact. energy: -1.956 local terms energy: -315.363109 where: bonds (distance) C4'-P energy: -50.599 bonds (distance) P-C4' energy: -59.400 flat angles C4'-P-C4' energy: -66.679 flat angles P-C4'-P energy: -47.193 tors. eta vs tors. theta energy: -91.491 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -1136.533062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1136.533062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -971.283062 (E_RNA) where: Base-Base interactions energy: -664.159 where: short stacking energy: -266.565 Base-Backbone interact. energy: 1.060 local terms energy: -308.183261 where: bonds (distance) C4'-P energy: -58.180 bonds (distance) P-C4' energy: -67.318 flat angles C4'-P-C4' energy: -55.665 flat angles P-C4'-P energy: -46.879 tors. eta vs tors. theta energy: -80.141 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -1127.718317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1127.718317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.668317 (E_RNA) where: Base-Base interactions energy: -662.576 where: short stacking energy: -273.582 Base-Backbone interact. energy: 3.591 local terms energy: -301.683026 where: bonds (distance) C4'-P energy: -60.835 bonds (distance) P-C4' energy: -58.508 flat angles C4'-P-C4' energy: -60.185 flat angles P-C4'-P energy: -46.024 tors. eta vs tors. theta energy: -76.132 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -1078.966588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.966588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -917.316588 (E_RNA) where: Base-Base interactions energy: -637.863 where: short stacking energy: -252.556 Base-Backbone interact. energy: -0.808 local terms energy: -278.646173 where: bonds (distance) C4'-P energy: -61.441 bonds (distance) P-C4' energy: -52.452 flat angles C4'-P-C4' energy: -63.716 flat angles P-C4'-P energy: -34.824 tors. eta vs tors. theta energy: -66.213 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -1056.267157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1056.267157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.217157 (E_RNA) where: Base-Base interactions energy: -623.323 where: short stacking energy: -247.418 Base-Backbone interact. energy: 0.391 local terms energy: -266.285133 where: bonds (distance) C4'-P energy: -52.688 bonds (distance) P-C4' energy: -47.073 flat angles C4'-P-C4' energy: -53.710 flat angles P-C4'-P energy: -42.970 tors. eta vs tors. theta energy: -69.845 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -1009.799461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.799461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -846.349461 (E_RNA) where: Base-Base interactions energy: -581.723 where: short stacking energy: -229.585 Base-Backbone interact. energy: -0.865 local terms energy: -263.760702 where: bonds (distance) C4'-P energy: -53.324 bonds (distance) P-C4' energy: -45.483 flat angles C4'-P-C4' energy: -59.376 flat angles P-C4'-P energy: -38.747 tors. eta vs tors. theta energy: -66.830 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -1005.957753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.957753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -844.307753 (E_RNA) where: Base-Base interactions energy: -595.352 where: short stacking energy: -227.487 Base-Backbone interact. energy: 0.700 local terms energy: -249.655546 where: bonds (distance) C4'-P energy: -49.257 bonds (distance) P-C4' energy: -49.708 flat angles C4'-P-C4' energy: -57.809 flat angles P-C4'-P energy: -40.931 tors. eta vs tors. theta energy: -51.950 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -930.890038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -930.890038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.440038 (E_RNA) where: Base-Base interactions energy: -557.182 where: short stacking energy: -226.639 Base-Backbone interact. energy: -0.096 local terms energy: -237.162233 where: bonds (distance) C4'-P energy: -41.144 bonds (distance) P-C4' energy: -37.411 flat angles C4'-P-C4' energy: -58.187 flat angles P-C4'-P energy: -48.331 tors. eta vs tors. theta energy: -52.089 Dist. restrs. and SS energy: -160.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -794.537050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.537050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.287050 (E_RNA) where: Base-Base interactions energy: -464.136 where: short stacking energy: -180.720 Base-Backbone interact. energy: -1.592 local terms energy: -217.559294 where: bonds (distance) C4'-P energy: -41.216 bonds (distance) P-C4' energy: -49.905 flat angles C4'-P-C4' energy: -51.749 flat angles P-C4'-P energy: -37.398 tors. eta vs tors. theta energy: -37.290 Dist. restrs. and SS energy: -135.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -1271.684557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1271.684557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.634557 (E_RNA) where: Base-Base interactions energy: -771.466 where: short stacking energy: -313.776 Base-Backbone interact. energy: -2.478 local terms energy: -330.690322 where: bonds (distance) C4'-P energy: -58.426 bonds (distance) P-C4' energy: -59.355 flat angles C4'-P-C4' energy: -70.551 flat angles P-C4'-P energy: -51.314 tors. eta vs tors. theta energy: -91.044 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -1204.571846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1204.571846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1051.921846 (E_RNA) where: Base-Base interactions energy: -730.242 where: short stacking energy: -294.885 Base-Backbone interact. energy: -1.638 local terms energy: -320.042085 where: bonds (distance) C4'-P energy: -58.578 bonds (distance) P-C4' energy: -58.821 flat angles C4'-P-C4' energy: -63.691 flat angles P-C4'-P energy: -51.547 tors. eta vs tors. theta energy: -87.404 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -1148.702289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1148.702289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -985.252289 (E_RNA) where: Base-Base interactions energy: -671.810 where: short stacking energy: -274.095 Base-Backbone interact. energy: -2.319 local terms energy: -311.122469 where: bonds (distance) C4'-P energy: -59.852 bonds (distance) P-C4' energy: -54.542 flat angles C4'-P-C4' energy: -64.945 flat angles P-C4'-P energy: -51.915 tors. eta vs tors. theta energy: -79.869 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -1122.699579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1122.699579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.049579 (E_RNA) where: Base-Base interactions energy: -648.249 where: short stacking energy: -266.708 Base-Backbone interact. energy: -0.320 local terms energy: -303.480386 where: bonds (distance) C4'-P energy: -47.713 bonds (distance) P-C4' energy: -65.978 flat angles C4'-P-C4' energy: -66.482 flat angles P-C4'-P energy: -46.963 tors. eta vs tors. theta energy: -76.344 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -1074.092235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1074.092235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.642235 (E_RNA) where: Base-Base interactions energy: -630.142 where: short stacking energy: -262.369 Base-Backbone interact. energy: -1.339 local terms energy: -279.161101 where: bonds (distance) C4'-P energy: -51.468 bonds (distance) P-C4' energy: -56.862 flat angles C4'-P-C4' energy: -61.963 flat angles P-C4'-P energy: -37.044 tors. eta vs tors. theta energy: -71.825 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -1074.626286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1074.626286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.576286 (E_RNA) where: Base-Base interactions energy: -644.161 where: short stacking energy: -266.201 Base-Backbone interact. energy: 2.423 local terms energy: -265.838024 where: bonds (distance) C4'-P energy: -40.670 bonds (distance) P-C4' energy: -58.295 flat angles C4'-P-C4' energy: -58.182 flat angles P-C4'-P energy: -32.323 tors. eta vs tors. theta energy: -76.367 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -1035.929778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.929778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -870.679778 (E_RNA) where: Base-Base interactions energy: -588.946 where: short stacking energy: -231.801 Base-Backbone interact. energy: 2.398 local terms energy: -284.131568 where: bonds (distance) C4'-P energy: -60.065 bonds (distance) P-C4' energy: -60.657 flat angles C4'-P-C4' energy: -58.639 flat angles P-C4'-P energy: -42.587 tors. eta vs tors. theta energy: -62.183 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -959.526451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.526451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.876451 (E_RNA) where: Base-Base interactions energy: -560.495 where: short stacking energy: -212.820 Base-Backbone interact. energy: -2.623 local terms energy: -234.758303 where: bonds (distance) C4'-P energy: -36.165 bonds (distance) P-C4' energy: -59.206 flat angles C4'-P-C4' energy: -55.132 flat angles P-C4'-P energy: -33.332 tors. eta vs tors. theta energy: -50.924 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -904.824911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.824911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.374911 (E_RNA) where: Base-Base interactions energy: -528.831 where: short stacking energy: -209.723 Base-Backbone interact. energy: -1.699 local terms energy: -237.845163 where: bonds (distance) C4'-P energy: -41.376 bonds (distance) P-C4' energy: -42.357 flat angles C4'-P-C4' energy: -60.020 flat angles P-C4'-P energy: -38.097 tors. eta vs tors. theta energy: -55.995 Dist. restrs. and SS energy: -160.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -775.533492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.533492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.883492 (E_RNA) where: Base-Base interactions energy: -477.459 where: short stacking energy: -181.600 Base-Backbone interact. energy: 3.689 local terms energy: -203.113771 where: bonds (distance) C4'-P energy: -36.136 bonds (distance) P-C4' energy: -43.017 flat angles C4'-P-C4' energy: -44.562 flat angles P-C4'-P energy: -33.908 tors. eta vs tors. theta energy: -45.490 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -1241.831477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1241.831477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1072.981477 (E_RNA) where: Base-Base interactions energy: -730.237 where: short stacking energy: -296.962 Base-Backbone interact. energy: -2.703 local terms energy: -340.041444 where: bonds (distance) C4'-P energy: -64.910 bonds (distance) P-C4' energy: -66.200 flat angles C4'-P-C4' energy: -72.522 flat angles P-C4'-P energy: -44.492 tors. eta vs tors. theta energy: -91.916 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -1209.650758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1209.650758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1055.200758 (E_RNA) where: Base-Base interactions energy: -743.372 where: short stacking energy: -313.563 Base-Backbone interact. energy: -1.529 local terms energy: -310.299826 where: bonds (distance) C4'-P energy: -50.547 bonds (distance) P-C4' energy: -65.136 flat angles C4'-P-C4' energy: -62.641 flat angles P-C4'-P energy: -47.659 tors. eta vs tors. theta energy: -84.316 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -1107.149384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1107.149384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.099384 (E_RNA) where: Base-Base interactions energy: -649.920 where: short stacking energy: -269.426 Base-Backbone interact. energy: -2.057 local terms energy: -288.122449 where: bonds (distance) C4'-P energy: -53.182 bonds (distance) P-C4' energy: -65.039 flat angles C4'-P-C4' energy: -64.376 flat angles P-C4'-P energy: -33.835 tors. eta vs tors. theta energy: -71.690 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -1107.218077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1107.218077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.168077 (E_RNA) where: Base-Base interactions energy: -635.212 where: short stacking energy: -251.267 Base-Backbone interact. energy: -1.016 local terms energy: -303.940941 where: bonds (distance) C4'-P energy: -55.337 bonds (distance) P-C4' energy: -64.023 flat angles C4'-P-C4' energy: -61.162 flat angles P-C4'-P energy: -48.193 tors. eta vs tors. theta energy: -75.225 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -1068.430033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.430033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -906.780033 (E_RNA) where: Base-Base interactions energy: -614.806 where: short stacking energy: -268.396 Base-Backbone interact. energy: -0.545 local terms energy: -291.429100 where: bonds (distance) C4'-P energy: -57.245 bonds (distance) P-C4' energy: -60.665 flat angles C4'-P-C4' energy: -59.726 flat angles P-C4'-P energy: -43.637 tors. eta vs tors. theta energy: -70.156 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -1060.020681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.020681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -891.170681 (E_RNA) where: Base-Base interactions energy: -619.812 where: short stacking energy: -245.637 Base-Backbone interact. energy: -0.773 local terms energy: -270.585933 where: bonds (distance) C4'-P energy: -59.567 bonds (distance) P-C4' energy: -51.489 flat angles C4'-P-C4' energy: -59.877 flat angles P-C4'-P energy: -34.925 tors. eta vs tors. theta energy: -64.729 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -1037.514168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.514168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -875.864168 (E_RNA) where: Base-Base interactions energy: -629.739 where: short stacking energy: -232.588 Base-Backbone interact. energy: 0.663 local terms energy: -246.788156 where: bonds (distance) C4'-P energy: -51.891 bonds (distance) P-C4' energy: -59.011 flat angles C4'-P-C4' energy: -41.911 flat angles P-C4'-P energy: -30.067 tors. eta vs tors. theta energy: -63.907 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -984.813269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.813269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -828.563269 (E_RNA) where: Base-Base interactions energy: -579.120 where: short stacking energy: -216.039 Base-Backbone interact. energy: -1.942 local terms energy: -247.501938 where: bonds (distance) C4'-P energy: -41.417 bonds (distance) P-C4' energy: -56.198 flat angles C4'-P-C4' energy: -56.293 flat angles P-C4'-P energy: -42.728 tors. eta vs tors. theta energy: -50.866 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -922.098502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.098502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.648502 (E_RNA) where: Base-Base interactions energy: -535.467 where: short stacking energy: -222.586 Base-Backbone interact. energy: 2.775 local terms energy: -252.956577 where: bonds (distance) C4'-P energy: -49.395 bonds (distance) P-C4' energy: -55.598 flat angles C4'-P-C4' energy: -53.151 flat angles P-C4'-P energy: -30.787 tors. eta vs tors. theta energy: -64.026 Dist. restrs. and SS energy: -160.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -779.782366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.782366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.932366 (E_RNA) where: Base-Base interactions energy: -467.417 where: short stacking energy: -177.063 Base-Backbone interact. energy: -1.579 local terms energy: -213.937001 where: bonds (distance) C4'-P energy: -50.651 bonds (distance) P-C4' energy: -57.675 flat angles C4'-P-C4' energy: -38.060 flat angles P-C4'-P energy: -30.509 tors. eta vs tors. theta energy: -37.041 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -1237.513185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1237.513185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1066.863185 (E_RNA) where: Base-Base interactions energy: -736.168 where: short stacking energy: -292.987 Base-Backbone interact. energy: -1.571 local terms energy: -329.124076 where: bonds (distance) C4'-P energy: -57.696 bonds (distance) P-C4' energy: -61.963 flat angles C4'-P-C4' energy: -70.051 flat angles P-C4'-P energy: -49.353 tors. eta vs tors. theta energy: -90.061 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -1184.987717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1184.987717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1032.337717 (E_RNA) where: Base-Base interactions energy: -718.853 where: short stacking energy: -282.604 Base-Backbone interact. energy: 0.482 local terms energy: -313.966580 where: bonds (distance) C4'-P energy: -55.893 bonds (distance) P-C4' energy: -61.565 flat angles C4'-P-C4' energy: -60.063 flat angles P-C4'-P energy: -43.206 tors. eta vs tors. theta energy: -93.240 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -1133.641700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1133.641700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.791700 (E_RNA) where: Base-Base interactions energy: -672.441 where: short stacking energy: -280.818 Base-Backbone interact. energy: -1.350 local terms energy: -291.000780 where: bonds (distance) C4'-P energy: -56.646 bonds (distance) P-C4' energy: -49.811 flat angles C4'-P-C4' energy: -60.042 flat angles P-C4'-P energy: -43.762 tors. eta vs tors. theta energy: -80.740 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -1102.253418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.253418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -933.403418 (E_RNA) where: Base-Base interactions energy: -645.682 where: short stacking energy: -260.782 Base-Backbone interact. energy: -1.193 local terms energy: -286.528358 where: bonds (distance) C4'-P energy: -52.063 bonds (distance) P-C4' energy: -58.429 flat angles C4'-P-C4' energy: -56.851 flat angles P-C4'-P energy: -40.176 tors. eta vs tors. theta energy: -79.009 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -1078.936437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.936437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.086437 (E_RNA) where: Base-Base interactions energy: -622.732 where: short stacking energy: -259.759 Base-Backbone interact. energy: -0.390 local terms energy: -295.964999 where: bonds (distance) C4'-P energy: -56.160 bonds (distance) P-C4' energy: -60.511 flat angles C4'-P-C4' energy: -63.920 flat angles P-C4'-P energy: -41.145 tors. eta vs tors. theta energy: -74.229 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -1056.996288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1056.996288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.346288 (E_RNA) where: Base-Base interactions energy: -619.188 where: short stacking energy: -255.613 Base-Backbone interact. energy: -0.887 local terms energy: -266.271546 where: bonds (distance) C4'-P energy: -50.356 bonds (distance) P-C4' energy: -54.006 flat angles C4'-P-C4' energy: -60.204 flat angles P-C4'-P energy: -37.386 tors. eta vs tors. theta energy: -64.320 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -1061.536701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.536701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -892.686701 (E_RNA) where: Base-Base interactions energy: -641.129 where: short stacking energy: -239.851 Base-Backbone interact. energy: 0.310 local terms energy: -251.867770 where: bonds (distance) C4'-P energy: -54.504 bonds (distance) P-C4' energy: -52.618 flat angles C4'-P-C4' energy: -53.577 flat angles P-C4'-P energy: -32.676 tors. eta vs tors. theta energy: -58.492 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -973.965378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -973.965378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -817.715378 (E_RNA) where: Base-Base interactions energy: -577.244 where: short stacking energy: -210.429 Base-Backbone interact. energy: -2.547 local terms energy: -237.924612 where: bonds (distance) C4'-P energy: -37.214 bonds (distance) P-C4' energy: -45.272 flat angles C4'-P-C4' energy: -62.142 flat angles P-C4'-P energy: -42.593 tors. eta vs tors. theta energy: -50.704 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -951.522382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -951.522382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.672382 (E_RNA) where: Base-Base interactions energy: -544.525 where: short stacking energy: -221.437 Base-Backbone interact. energy: -1.139 local terms energy: -246.008376 where: bonds (distance) C4'-P energy: -55.769 bonds (distance) P-C4' energy: -53.635 flat angles C4'-P-C4' energy: -49.552 flat angles P-C4'-P energy: -23.323 tors. eta vs tors. theta energy: -63.729 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -777.439022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.439022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.589022 (E_RNA) where: Base-Base interactions energy: -462.472 where: short stacking energy: -170.064 Base-Backbone interact. energy: -1.272 local terms energy: -216.845511 where: bonds (distance) C4'-P energy: -41.573 bonds (distance) P-C4' energy: -63.232 flat angles C4'-P-C4' energy: -44.088 flat angles P-C4'-P energy: -31.768 tors. eta vs tors. theta energy: -36.184 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -1237.026968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1237.026968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1066.376968 (E_RNA) where: Base-Base interactions energy: -725.358 where: short stacking energy: -304.274 Base-Backbone interact. energy: -0.182 local terms energy: -340.837038 where: bonds (distance) C4'-P energy: -66.665 bonds (distance) P-C4' energy: -60.549 flat angles C4'-P-C4' energy: -76.431 flat angles P-C4'-P energy: -43.410 tors. eta vs tors. theta energy: -93.782 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -1171.390090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1171.390090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1015.140090 (E_RNA) where: Base-Base interactions energy: -724.002 where: short stacking energy: -286.407 Base-Backbone interact. energy: -0.302 local terms energy: -290.836662 where: bonds (distance) C4'-P energy: -55.699 bonds (distance) P-C4' energy: -66.919 flat angles C4'-P-C4' energy: -42.604 flat angles P-C4'-P energy: -41.978 tors. eta vs tors. theta energy: -83.637 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -1143.561027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1143.561027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.911027 (E_RNA) where: Base-Base interactions energy: -682.368 where: short stacking energy: -264.447 Base-Backbone interact. energy: -0.811 local terms energy: -289.731877 where: bonds (distance) C4'-P energy: -59.697 bonds (distance) P-C4' energy: -56.586 flat angles C4'-P-C4' energy: -61.441 flat angles P-C4'-P energy: -41.994 tors. eta vs tors. theta energy: -70.014 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -1112.418524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1112.418524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -954.368524 (E_RNA) where: Base-Base interactions energy: -688.852 where: short stacking energy: -271.837 Base-Backbone interact. energy: 2.769 local terms energy: -268.285672 where: bonds (distance) C4'-P energy: -52.675 bonds (distance) P-C4' energy: -52.410 flat angles C4'-P-C4' energy: -57.313 flat angles P-C4'-P energy: -29.458 tors. eta vs tors. theta energy: -76.430 Dist. restrs. and SS energy: -181.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -1077.328514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1077.328514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.278514 (E_RNA) where: Base-Base interactions energy: -618.819 where: short stacking energy: -247.605 Base-Backbone interact. energy: -1.064 local terms energy: -290.394916 where: bonds (distance) C4'-P energy: -51.502 bonds (distance) P-C4' energy: -66.019 flat angles C4'-P-C4' energy: -55.739 flat angles P-C4'-P energy: -41.958 tors. eta vs tors. theta energy: -75.176 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -1038.614401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.614401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.564401 (E_RNA) where: Base-Base interactions energy: -611.818 where: short stacking energy: -239.533 Base-Backbone interact. energy: 0.181 local terms energy: -259.927850 where: bonds (distance) C4'-P energy: -50.140 bonds (distance) P-C4' energy: -49.910 flat angles C4'-P-C4' energy: -50.403 flat angles P-C4'-P energy: -40.504 tors. eta vs tors. theta energy: -68.971 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -1045.123118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.123118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -878.073118 (E_RNA) where: Base-Base interactions energy: -630.602 where: short stacking energy: -235.125 Base-Backbone interact. energy: -2.025 local terms energy: -245.445840 where: bonds (distance) C4'-P energy: -40.050 bonds (distance) P-C4' energy: -54.781 flat angles C4'-P-C4' energy: -64.372 flat angles P-C4'-P energy: -34.103 tors. eta vs tors. theta energy: -52.140 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -977.848088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.848088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.398088 (E_RNA) where: Base-Base interactions energy: -581.513 where: short stacking energy: -222.734 Base-Backbone interact. energy: -2.339 local terms energy: -239.546640 where: bonds (distance) C4'-P energy: -46.796 bonds (distance) P-C4' energy: -50.697 flat angles C4'-P-C4' energy: -56.619 flat angles P-C4'-P energy: -39.670 tors. eta vs tors. theta energy: -45.765 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -949.572014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -949.572014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.922014 (E_RNA) where: Base-Base interactions energy: -566.158 where: short stacking energy: -215.253 Base-Backbone interact. energy: 2.169 local terms energy: -223.932476 where: bonds (distance) C4'-P energy: -42.686 bonds (distance) P-C4' energy: -49.843 flat angles C4'-P-C4' energy: -44.311 flat angles P-C4'-P energy: -30.595 tors. eta vs tors. theta energy: -56.497 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -779.005139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.005139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.955139 (E_RNA) where: Base-Base interactions energy: -461.057 where: short stacking energy: -197.758 Base-Backbone interact. energy: -2.328 local terms energy: -220.569526 where: bonds (distance) C4'-P energy: -49.964 bonds (distance) P-C4' energy: -39.953 flat angles C4'-P-C4' energy: -58.784 flat angles P-C4'-P energy: -29.240 tors. eta vs tors. theta energy: -42.629 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -1227.372492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1227.372492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1060.322492 (E_RNA) where: Base-Base interactions energy: -739.273 where: short stacking energy: -301.244 Base-Backbone interact. energy: -6.270 local terms energy: -314.779742 where: bonds (distance) C4'-P energy: -49.143 bonds (distance) P-C4' energy: -65.324 flat angles C4'-P-C4' energy: -68.100 flat angles P-C4'-P energy: -46.491 tors. eta vs tors. theta energy: -85.721 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -1201.495043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1201.495043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1045.245043 (E_RNA) where: Base-Base interactions energy: -735.968 where: short stacking energy: -289.447 Base-Backbone interact. energy: -1.444 local terms energy: -307.832893 where: bonds (distance) C4'-P energy: -57.673 bonds (distance) P-C4' energy: -55.679 flat angles C4'-P-C4' energy: -66.783 flat angles P-C4'-P energy: -43.605 tors. eta vs tors. theta energy: -84.094 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -1137.238270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1137.238270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -973.788270 (E_RNA) where: Base-Base interactions energy: -673.649 where: short stacking energy: -282.177 Base-Backbone interact. energy: 0.268 local terms energy: -300.406549 where: bonds (distance) C4'-P energy: -50.404 bonds (distance) P-C4' energy: -60.168 flat angles C4'-P-C4' energy: -65.908 flat angles P-C4'-P energy: -48.485 tors. eta vs tors. theta energy: -75.442 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -1120.114022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1120.114022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.464022 (E_RNA) where: Base-Base interactions energy: -658.916 where: short stacking energy: -263.502 Base-Backbone interact. energy: -0.624 local terms energy: -289.923874 where: bonds (distance) C4'-P energy: -48.836 bonds (distance) P-C4' energy: -52.412 flat angles C4'-P-C4' energy: -70.588 flat angles P-C4'-P energy: -42.872 tors. eta vs tors. theta energy: -75.216 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -1109.445916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1109.445916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -938.795916 (E_RNA) where: Base-Base interactions energy: -661.905 where: short stacking energy: -277.211 Base-Backbone interact. energy: 1.735 local terms energy: -278.625645 where: bonds (distance) C4'-P energy: -54.913 bonds (distance) P-C4' energy: -54.896 flat angles C4'-P-C4' energy: -51.687 flat angles P-C4'-P energy: -38.074 tors. eta vs tors. theta energy: -79.055 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -1068.798730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.798730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.748730 (E_RNA) where: Base-Base interactions energy: -610.123 where: short stacking energy: -264.775 Base-Backbone interact. energy: -1.051 local terms energy: -290.574956 where: bonds (distance) C4'-P energy: -54.894 bonds (distance) P-C4' energy: -51.278 flat angles C4'-P-C4' energy: -61.435 flat angles P-C4'-P energy: -42.068 tors. eta vs tors. theta energy: -80.899 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -1045.326097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.326097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.676097 (E_RNA) where: Base-Base interactions energy: -599.414 where: short stacking energy: -233.230 Base-Backbone interact. energy: -1.491 local terms energy: -273.771001 where: bonds (distance) C4'-P energy: -49.959 bonds (distance) P-C4' energy: -60.679 flat angles C4'-P-C4' energy: -62.261 flat angles P-C4'-P energy: -42.477 tors. eta vs tors. theta energy: -58.395 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -965.103524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.103524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -808.853524 (E_RNA) where: Base-Base interactions energy: -574.730 where: short stacking energy: -200.984 Base-Backbone interact. energy: 3.192 local terms energy: -237.316405 where: bonds (distance) C4'-P energy: -49.657 bonds (distance) P-C4' energy: -46.845 flat angles C4'-P-C4' energy: -52.989 flat angles P-C4'-P energy: -28.555 tors. eta vs tors. theta energy: -59.270 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -921.102713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.102713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.252713 (E_RNA) where: Base-Base interactions energy: -541.230 where: short stacking energy: -200.099 Base-Backbone interact. energy: -1.856 local terms energy: -218.166180 where: bonds (distance) C4'-P energy: -43.769 bonds (distance) P-C4' energy: -41.417 flat angles C4'-P-C4' energy: -53.185 flat angles P-C4'-P energy: -33.704 tors. eta vs tors. theta energy: -46.091 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -758.471447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.471447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.621447 (E_RNA) where: Base-Base interactions energy: -473.628 where: short stacking energy: -184.366 Base-Backbone interact. energy: 1.189 local terms energy: -189.182205 where: bonds (distance) C4'-P energy: -31.019 bonds (distance) P-C4' energy: -32.091 flat angles C4'-P-C4' energy: -61.353 flat angles P-C4'-P energy: -25.899 tors. eta vs tors. theta energy: -38.819 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -1220.327615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1220.327615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1049.677615 (E_RNA) where: Base-Base interactions energy: -731.232 where: short stacking energy: -310.820 Base-Backbone interact. energy: 0.683 local terms energy: -319.128669 where: bonds (distance) C4'-P energy: -60.137 bonds (distance) P-C4' energy: -57.351 flat angles C4'-P-C4' energy: -66.492 flat angles P-C4'-P energy: -46.172 tors. eta vs tors. theta energy: -88.977 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -1190.129166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1190.129166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1037.479166 (E_RNA) where: Base-Base interactions energy: -728.448 where: short stacking energy: -296.567 Base-Backbone interact. energy: -2.793 local terms energy: -306.237554 where: bonds (distance) C4'-P energy: -58.401 bonds (distance) P-C4' energy: -56.591 flat angles C4'-P-C4' energy: -64.593 flat angles P-C4'-P energy: -46.296 tors. eta vs tors. theta energy: -80.356 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -1134.906932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.906932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -973.256932 (E_RNA) where: Base-Base interactions energy: -670.618 where: short stacking energy: -277.171 Base-Backbone interact. energy: -1.085 local terms energy: -301.554448 where: bonds (distance) C4'-P energy: -47.626 bonds (distance) P-C4' energy: -66.261 flat angles C4'-P-C4' energy: -62.566 flat angles P-C4'-P energy: -49.632 tors. eta vs tors. theta energy: -75.469 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -1117.795676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1117.795676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -947.145676 (E_RNA) where: Base-Base interactions energy: -653.526 where: short stacking energy: -260.064 Base-Backbone interact. energy: 2.014 local terms energy: -295.633205 where: bonds (distance) C4'-P energy: -61.017 bonds (distance) P-C4' energy: -53.271 flat angles C4'-P-C4' energy: -69.605 flat angles P-C4'-P energy: -44.315 tors. eta vs tors. theta energy: -67.426 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -1097.977597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1097.977597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.327597 (E_RNA) where: Base-Base interactions energy: -636.954 where: short stacking energy: -257.143 Base-Backbone interact. energy: -2.617 local terms energy: -287.756676 where: bonds (distance) C4'-P energy: -54.135 bonds (distance) P-C4' energy: -56.397 flat angles C4'-P-C4' energy: -62.225 flat angles P-C4'-P energy: -45.112 tors. eta vs tors. theta energy: -69.888 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -1067.464373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.464373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -904.014373 (E_RNA) where: Base-Base interactions energy: -637.019 where: short stacking energy: -256.811 Base-Backbone interact. energy: -2.027 local terms energy: -264.968075 where: bonds (distance) C4'-P energy: -54.010 bonds (distance) P-C4' energy: -49.413 flat angles C4'-P-C4' energy: -58.563 flat angles P-C4'-P energy: -43.011 tors. eta vs tors. theta energy: -59.971 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -1045.559718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.559718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.709718 (E_RNA) where: Base-Base interactions energy: -628.984 where: short stacking energy: -248.660 Base-Backbone interact. energy: -1.860 local terms energy: -245.865687 where: bonds (distance) C4'-P energy: -40.301 bonds (distance) P-C4' energy: -44.328 flat angles C4'-P-C4' energy: -58.436 flat angles P-C4'-P energy: -34.939 tors. eta vs tors. theta energy: -67.861 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -984.402080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.402080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.752080 (E_RNA) where: Base-Base interactions energy: -615.045 where: short stacking energy: -238.023 Base-Backbone interact. energy: 5.949 local terms energy: -222.655669 where: bonds (distance) C4'-P energy: -35.393 bonds (distance) P-C4' energy: -49.323 flat angles C4'-P-C4' energy: -54.929 flat angles P-C4'-P energy: -34.066 tors. eta vs tors. theta energy: -48.945 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -947.855967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -947.855967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.005967 (E_RNA) where: Base-Base interactions energy: -546.720 where: short stacking energy: -220.206 Base-Backbone interact. energy: -0.060 local terms energy: -241.225634 where: bonds (distance) C4'-P energy: -50.405 bonds (distance) P-C4' energy: -52.637 flat angles C4'-P-C4' energy: -52.566 flat angles P-C4'-P energy: -33.037 tors. eta vs tors. theta energy: -52.581 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -747.454291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.454291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.604291 (E_RNA) where: Base-Base interactions energy: -443.732 where: short stacking energy: -164.008 Base-Backbone interact. energy: -0.893 local terms energy: -205.979073 where: bonds (distance) C4'-P energy: -39.743 bonds (distance) P-C4' energy: -43.740 flat angles C4'-P-C4' energy: -53.009 flat angles P-C4'-P energy: -33.111 tors. eta vs tors. theta energy: -36.375 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -1206.575880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.575880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1044.925880 (E_RNA) where: Base-Base interactions energy: -729.293 where: short stacking energy: -300.448 Base-Backbone interact. energy: -2.346 local terms energy: -313.287123 where: bonds (distance) C4'-P energy: -59.056 bonds (distance) P-C4' energy: -60.691 flat angles C4'-P-C4' energy: -68.690 flat angles P-C4'-P energy: -40.809 tors. eta vs tors. theta energy: -84.041 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -1208.341396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1208.341396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1039.491396 (E_RNA) where: Base-Base interactions energy: -726.088 where: short stacking energy: -288.518 Base-Backbone interact. energy: -1.776 local terms energy: -311.627584 where: bonds (distance) C4'-P energy: -59.414 bonds (distance) P-C4' energy: -60.477 flat angles C4'-P-C4' energy: -64.130 flat angles P-C4'-P energy: -45.051 tors. eta vs tors. theta energy: -82.556 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -1125.808316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1125.808316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.158316 (E_RNA) where: Base-Base interactions energy: -663.223 where: short stacking energy: -259.548 Base-Backbone interact. energy: -1.702 local terms energy: -290.233172 where: bonds (distance) C4'-P energy: -55.135 bonds (distance) P-C4' energy: -62.243 flat angles C4'-P-C4' energy: -67.123 flat angles P-C4'-P energy: -38.162 tors. eta vs tors. theta energy: -67.571 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -1117.425870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1117.425870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.775870 (E_RNA) where: Base-Base interactions energy: -654.502 where: short stacking energy: -276.520 Base-Backbone interact. energy: -0.412 local terms energy: -300.862616 where: bonds (distance) C4'-P energy: -51.433 bonds (distance) P-C4' energy: -56.096 flat angles C4'-P-C4' energy: -67.115 flat angles P-C4'-P energy: -50.887 tors. eta vs tors. theta energy: -75.331 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -1101.124928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1101.124928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -932.274928 (E_RNA) where: Base-Base interactions energy: -646.041 where: short stacking energy: -263.008 Base-Backbone interact. energy: -0.919 local terms energy: -285.314770 where: bonds (distance) C4'-P energy: -56.479 bonds (distance) P-C4' energy: -43.758 flat angles C4'-P-C4' energy: -67.349 flat angles P-C4'-P energy: -43.865 tors. eta vs tors. theta energy: -73.864 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -1089.410424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.410424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.160424 (E_RNA) where: Base-Base interactions energy: -626.216 where: short stacking energy: -230.741 Base-Backbone interact. energy: -1.552 local terms energy: -296.392126 where: bonds (distance) C4'-P energy: -58.148 bonds (distance) P-C4' energy: -67.177 flat angles C4'-P-C4' energy: -61.677 flat angles P-C4'-P energy: -41.323 tors. eta vs tors. theta energy: -68.067 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -989.557733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.557733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.707733 (E_RNA) where: Base-Base interactions energy: -584.098 where: short stacking energy: -208.278 Base-Backbone interact. energy: 8.062 local terms energy: -253.671601 where: bonds (distance) C4'-P energy: -51.235 bonds (distance) P-C4' energy: -51.523 flat angles C4'-P-C4' energy: -63.070 flat angles P-C4'-P energy: -38.999 tors. eta vs tors. theta energy: -48.845 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -993.027520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -993.027520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -827.777520 (E_RNA) where: Base-Base interactions energy: -571.979 where: short stacking energy: -227.189 Base-Backbone interact. energy: 4.911 local terms energy: -260.709249 where: bonds (distance) C4'-P energy: -46.389 bonds (distance) P-C4' energy: -54.022 flat angles C4'-P-C4' energy: -63.568 flat angles P-C4'-P energy: -38.210 tors. eta vs tors. theta energy: -58.521 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -933.728505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -933.728505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.678505 (E_RNA) where: Base-Base interactions energy: -544.054 where: short stacking energy: -202.399 Base-Backbone interact. energy: 3.422 local terms energy: -235.046036 where: bonds (distance) C4'-P energy: -52.320 bonds (distance) P-C4' energy: -55.658 flat angles C4'-P-C4' energy: -46.518 flat angles P-C4'-P energy: -32.377 tors. eta vs tors. theta energy: -48.172 Dist. restrs. and SS energy: -181.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -727.658043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.658043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.808043 (E_RNA) where: Base-Base interactions energy: -438.776 where: short stacking energy: -178.153 Base-Backbone interact. energy: 0.482 local terms energy: -192.514212 where: bonds (distance) C4'-P energy: -51.040 bonds (distance) P-C4' energy: -53.419 flat angles C4'-P-C4' energy: -36.256 flat angles P-C4'-P energy: -22.106 tors. eta vs tors. theta energy: -29.693 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -1208.966510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1208.966510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1049.116510 (E_RNA) where: Base-Base interactions energy: -714.924 where: short stacking energy: -306.213 Base-Backbone interact. energy: -1.058 local terms energy: -333.134160 where: bonds (distance) C4'-P energy: -64.496 bonds (distance) P-C4' energy: -58.637 flat angles C4'-P-C4' energy: -69.663 flat angles P-C4'-P energy: -49.749 tors. eta vs tors. theta energy: -90.589 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -1226.807746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.807746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1056.157746 (E_RNA) where: Base-Base interactions energy: -743.232 where: short stacking energy: -310.792 Base-Backbone interact. energy: -0.828 local terms energy: -312.098083 where: bonds (distance) C4'-P energy: -54.129 bonds (distance) P-C4' energy: -57.107 flat angles C4'-P-C4' energy: -69.032 flat angles P-C4'-P energy: -42.946 tors. eta vs tors. theta energy: -88.885 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -1131.974799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1131.974799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.924799 (E_RNA) where: Base-Base interactions energy: -668.859 where: short stacking energy: -271.231 Base-Backbone interact. energy: -0.491 local terms energy: -295.574950 where: bonds (distance) C4'-P energy: -56.875 bonds (distance) P-C4' energy: -52.178 flat angles C4'-P-C4' energy: -68.329 flat angles P-C4'-P energy: -39.022 tors. eta vs tors. theta energy: -79.171 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -1131.226664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1131.226664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.576664 (E_RNA) where: Base-Base interactions energy: -650.768 where: short stacking energy: -271.130 Base-Backbone interact. energy: -1.920 local terms energy: -307.888322 where: bonds (distance) C4'-P energy: -65.035 bonds (distance) P-C4' energy: -60.724 flat angles C4'-P-C4' energy: -64.020 flat angles P-C4'-P energy: -41.908 tors. eta vs tors. theta energy: -76.201 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -1092.409720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1092.409720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.959720 (E_RNA) where: Base-Base interactions energy: -638.525 where: short stacking energy: -265.667 Base-Backbone interact. energy: -2.032 local terms energy: -288.403143 where: bonds (distance) C4'-P energy: -57.782 bonds (distance) P-C4' energy: -51.039 flat angles C4'-P-C4' energy: -62.470 flat angles P-C4'-P energy: -44.417 tors. eta vs tors. theta energy: -72.696 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -1072.704987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1072.704987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.454987 (E_RNA) where: Base-Base interactions energy: -639.885 where: short stacking energy: -247.175 Base-Backbone interact. energy: 0.368 local terms energy: -267.937993 where: bonds (distance) C4'-P energy: -54.336 bonds (distance) P-C4' energy: -53.850 flat angles C4'-P-C4' energy: -44.603 flat angles P-C4'-P energy: -42.402 tors. eta vs tors. theta energy: -72.748 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -973.788627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -973.788627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.738627 (E_RNA) where: Base-Base interactions energy: -587.589 where: short stacking energy: -226.817 Base-Backbone interact. energy: -1.963 local terms energy: -226.186656 where: bonds (distance) C4'-P energy: -39.932 bonds (distance) P-C4' energy: -41.137 flat angles C4'-P-C4' energy: -59.217 flat angles P-C4'-P energy: -23.100 tors. eta vs tors. theta energy: -62.801 Dist. restrs. and SS energy: -181.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -1001.583458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.583458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.733458 (E_RNA) where: Base-Base interactions energy: -595.798 where: short stacking energy: -234.602 Base-Backbone interact. energy: 0.388 local terms energy: -237.324027 where: bonds (distance) C4'-P energy: -49.803 bonds (distance) P-C4' energy: -48.158 flat angles C4'-P-C4' energy: -55.852 flat angles P-C4'-P energy: -28.410 tors. eta vs tors. theta energy: -55.101 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -925.334826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -925.334826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.484826 (E_RNA) where: Base-Base interactions energy: -524.976 where: short stacking energy: -181.344 Base-Backbone interact. energy: -1.788 local terms energy: -238.720956 where: bonds (distance) C4'-P energy: -44.004 bonds (distance) P-C4' energy: -52.207 flat angles C4'-P-C4' energy: -43.754 flat angles P-C4'-P energy: -40.464 tors. eta vs tors. theta energy: -58.291 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -695.645912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.645912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.995912 (E_RNA) where: Base-Base interactions energy: -403.693 where: short stacking energy: -141.594 Base-Backbone interact. energy: 3.894 local terms energy: -197.196930 where: bonds (distance) C4'-P energy: -39.688 bonds (distance) P-C4' energy: -57.644 flat angles C4'-P-C4' energy: -42.749 flat angles P-C4'-P energy: -31.940 tors. eta vs tors. theta energy: -25.176 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -1241.556684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1241.556684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1072.706684 (E_RNA) where: Base-Base interactions energy: -745.426 where: short stacking energy: -299.528 Base-Backbone interact. energy: -1.492 local terms energy: -325.788871 where: bonds (distance) C4'-P energy: -60.419 bonds (distance) P-C4' energy: -63.554 flat angles C4'-P-C4' energy: -70.795 flat angles P-C4'-P energy: -45.030 tors. eta vs tors. theta energy: -85.991 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -1196.452789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.452789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1025.802789 (E_RNA) where: Base-Base interactions energy: -715.466 where: short stacking energy: -294.488 Base-Backbone interact. energy: -1.615 local terms energy: -308.721473 where: bonds (distance) C4'-P energy: -49.477 bonds (distance) P-C4' energy: -54.250 flat angles C4'-P-C4' energy: -70.145 flat angles P-C4'-P energy: -45.428 tors. eta vs tors. theta energy: -89.422 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -1140.691363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1140.691363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -970.041363 (E_RNA) where: Base-Base interactions energy: -669.749 where: short stacking energy: -279.088 Base-Backbone interact. energy: -0.982 local terms energy: -299.310229 where: bonds (distance) C4'-P energy: -59.362 bonds (distance) P-C4' energy: -54.432 flat angles C4'-P-C4' energy: -61.284 flat angles P-C4'-P energy: -40.875 tors. eta vs tors. theta energy: -83.357 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -1125.811925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1125.811925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.961925 (E_RNA) where: Base-Base interactions energy: -668.150 where: short stacking energy: -268.239 Base-Backbone interact. energy: -1.974 local terms energy: -286.837470 where: bonds (distance) C4'-P energy: -54.187 bonds (distance) P-C4' energy: -56.914 flat angles C4'-P-C4' energy: -59.249 flat angles P-C4'-P energy: -42.766 tors. eta vs tors. theta energy: -73.722 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -1076.361676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.361676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -920.111676 (E_RNA) where: Base-Base interactions energy: -646.504 where: short stacking energy: -283.052 Base-Backbone interact. energy: 1.366 local terms energy: -274.973804 where: bonds (distance) C4'-P energy: -47.272 bonds (distance) P-C4' energy: -55.836 flat angles C4'-P-C4' energy: -63.989 flat angles P-C4'-P energy: -30.382 tors. eta vs tors. theta energy: -77.495 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -1096.644564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.644564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -929.594564 (E_RNA) where: Base-Base interactions energy: -663.138 where: short stacking energy: -254.552 Base-Backbone interact. energy: -0.555 local terms energy: -265.901240 where: bonds (distance) C4'-P energy: -50.026 bonds (distance) P-C4' energy: -42.543 flat angles C4'-P-C4' energy: -68.908 flat angles P-C4'-P energy: -40.182 tors. eta vs tors. theta energy: -64.243 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -1028.848469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1028.848469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -865.398469 (E_RNA) where: Base-Base interactions energy: -589.145 where: short stacking energy: -237.911 Base-Backbone interact. energy: 1.531 local terms energy: -277.784636 where: bonds (distance) C4'-P energy: -51.881 bonds (distance) P-C4' energy: -61.283 flat angles C4'-P-C4' energy: -64.757 flat angles P-C4'-P energy: -41.097 tors. eta vs tors. theta energy: -58.766 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -971.828350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -971.828350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.178350 (E_RNA) where: Base-Base interactions energy: -577.624 where: short stacking energy: -224.743 Base-Backbone interact. energy: 0.038 local terms energy: -241.592250 where: bonds (distance) C4'-P energy: -46.075 bonds (distance) P-C4' energy: -44.951 flat angles C4'-P-C4' energy: -52.616 flat angles P-C4'-P energy: -36.280 tors. eta vs tors. theta energy: -61.671 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -964.143608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.143608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.693608 (E_RNA) where: Base-Base interactions energy: -568.015 where: short stacking energy: -220.174 Base-Backbone interact. energy: -1.758 local terms energy: -239.920680 where: bonds (distance) C4'-P energy: -51.831 bonds (distance) P-C4' energy: -44.599 flat angles C4'-P-C4' energy: -54.706 flat angles P-C4'-P energy: -37.109 tors. eta vs tors. theta energy: -51.676 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -706.802144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.802144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.152144 (E_RNA) where: Base-Base interactions energy: -400.046 where: short stacking energy: -145.869 Base-Backbone interact. energy: -1.511 local terms energy: -206.595624 where: bonds (distance) C4'-P energy: -45.466 bonds (distance) P-C4' energy: -56.593 flat angles C4'-P-C4' energy: -49.536 flat angles P-C4'-P energy: -31.657 tors. eta vs tors. theta energy: -23.344 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -1251.058342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1251.058342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1080.408342 (E_RNA) where: Base-Base interactions energy: -755.061 where: short stacking energy: -303.139 Base-Backbone interact. energy: -0.564 local terms energy: -324.782404 where: bonds (distance) C4'-P energy: -52.768 bonds (distance) P-C4' energy: -59.857 flat angles C4'-P-C4' energy: -75.101 flat angles P-C4'-P energy: -48.115 tors. eta vs tors. theta energy: -88.942 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -1184.936429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1184.936429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1017.886429 (E_RNA) where: Base-Base interactions energy: -712.526 where: short stacking energy: -301.576 Base-Backbone interact. energy: 0.040 local terms energy: -305.399707 where: bonds (distance) C4'-P energy: -54.753 bonds (distance) P-C4' energy: -56.542 flat angles C4'-P-C4' energy: -69.328 flat angles P-C4'-P energy: -40.071 tors. eta vs tors. theta energy: -84.705 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -1154.920149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1154.920149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -986.070149 (E_RNA) where: Base-Base interactions energy: -689.926 where: short stacking energy: -290.501 Base-Backbone interact. energy: -0.631 local terms energy: -295.513409 where: bonds (distance) C4'-P energy: -52.219 bonds (distance) P-C4' energy: -60.095 flat angles C4'-P-C4' energy: -57.272 flat angles P-C4'-P energy: -47.668 tors. eta vs tors. theta energy: -78.259 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -1146.060815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1146.060815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.410815 (E_RNA) where: Base-Base interactions energy: -686.470 where: short stacking energy: -261.495 Base-Backbone interact. energy: -2.481 local terms energy: -286.459574 where: bonds (distance) C4'-P energy: -51.331 bonds (distance) P-C4' energy: -55.873 flat angles C4'-P-C4' energy: -65.235 flat angles P-C4'-P energy: -42.739 tors. eta vs tors. theta energy: -71.282 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -1089.463913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.463913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.213913 (E_RNA) where: Base-Base interactions energy: -639.056 where: short stacking energy: -247.224 Base-Backbone interact. energy: -0.666 local terms energy: -284.491583 where: bonds (distance) C4'-P energy: -56.644 bonds (distance) P-C4' energy: -53.718 flat angles C4'-P-C4' energy: -67.351 flat angles P-C4'-P energy: -39.341 tors. eta vs tors. theta energy: -67.438 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -1056.436489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1056.436489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -894.786489 (E_RNA) where: Base-Base interactions energy: -625.877 where: short stacking energy: -239.126 Base-Backbone interact. energy: -3.428 local terms energy: -265.481022 where: bonds (distance) C4'-P energy: -62.409 bonds (distance) P-C4' energy: -50.227 flat angles C4'-P-C4' energy: -48.439 flat angles P-C4'-P energy: -42.808 tors. eta vs tors. theta energy: -61.598 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -1006.479241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.479241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.629241 (E_RNA) where: Base-Base interactions energy: -578.066 where: short stacking energy: -232.633 Base-Backbone interact. energy: -2.628 local terms energy: -256.934757 where: bonds (distance) C4'-P energy: -46.759 bonds (distance) P-C4' energy: -50.394 flat angles C4'-P-C4' energy: -65.027 flat angles P-C4'-P energy: -37.053 tors. eta vs tors. theta energy: -57.701 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -962.989700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -962.989700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -808.539700 (E_RNA) where: Base-Base interactions energy: -595.572 where: short stacking energy: -226.618 Base-Backbone interact. energy: 8.940 local terms energy: -221.907730 where: bonds (distance) C4'-P energy: -36.240 bonds (distance) P-C4' energy: -45.474 flat angles C4'-P-C4' energy: -63.528 flat angles P-C4'-P energy: -26.297 tors. eta vs tors. theta energy: -50.368 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -933.361153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -933.361153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -773.511153 (E_RNA) where: Base-Base interactions energy: -553.236 where: short stacking energy: -212.390 Base-Backbone interact. energy: 0.279 local terms energy: -220.554860 where: bonds (distance) C4'-P energy: -52.863 bonds (distance) P-C4' energy: -54.834 flat angles C4'-P-C4' energy: -43.029 flat angles P-C4'-P energy: -28.031 tors. eta vs tors. theta energy: -41.797 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -722.504101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.504101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.254101 (E_RNA) where: Base-Base interactions energy: -426.630 where: short stacking energy: -170.634 Base-Backbone interact. energy: 11.316 local terms energy: -213.939986 where: bonds (distance) C4'-P energy: -51.666 bonds (distance) P-C4' energy: -46.374 flat angles C4'-P-C4' energy: -53.531 flat angles P-C4'-P energy: -34.227 tors. eta vs tors. theta energy: -28.142 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -1243.967069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1243.967069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.317069 (E_RNA) where: Base-Base interactions energy: -742.586 where: short stacking energy: -291.850 Base-Backbone interact. energy: -1.192 local terms energy: -329.538679 where: bonds (distance) C4'-P energy: -63.243 bonds (distance) P-C4' energy: -63.792 flat angles C4'-P-C4' energy: -71.684 flat angles P-C4'-P energy: -48.008 tors. eta vs tors. theta energy: -82.812 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -1180.560455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1180.560455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1017.110455 (E_RNA) where: Base-Base interactions energy: -697.511 where: short stacking energy: -300.189 Base-Backbone interact. energy: -0.519 local terms energy: -319.080035 where: bonds (distance) C4'-P energy: -57.665 bonds (distance) P-C4' energy: -60.255 flat angles C4'-P-C4' energy: -62.213 flat angles P-C4'-P energy: -50.590 tors. eta vs tors. theta energy: -88.357 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -1168.897431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1168.897431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1001.847431 (E_RNA) where: Base-Base interactions energy: -677.492 where: short stacking energy: -284.359 Base-Backbone interact. energy: 0.590 local terms energy: -324.945883 where: bonds (distance) C4'-P energy: -61.063 bonds (distance) P-C4' energy: -69.562 flat angles C4'-P-C4' energy: -68.414 flat angles P-C4'-P energy: -44.528 tors. eta vs tors. theta energy: -81.379 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -1132.780664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1132.780664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.930664 (E_RNA) where: Base-Base interactions energy: -685.752 where: short stacking energy: -274.613 Base-Backbone interact. energy: -1.393 local terms energy: -276.785132 where: bonds (distance) C4'-P energy: -47.987 bonds (distance) P-C4' energy: -51.284 flat angles C4'-P-C4' energy: -65.335 flat angles P-C4'-P energy: -38.626 tors. eta vs tors. theta energy: -73.554 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -1076.120444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.120444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -912.670444 (E_RNA) where: Base-Base interactions energy: -660.518 where: short stacking energy: -254.136 Base-Backbone interact. energy: -1.023 local terms energy: -251.129912 where: bonds (distance) C4'-P energy: -44.833 bonds (distance) P-C4' energy: -46.745 flat angles C4'-P-C4' energy: -60.882 flat angles P-C4'-P energy: -33.340 tors. eta vs tors. theta energy: -65.331 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -1047.155148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.155148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.505148 (E_RNA) where: Base-Base interactions energy: -634.037 where: short stacking energy: -253.689 Base-Backbone interact. energy: -0.800 local terms energy: -241.667784 where: bonds (distance) C4'-P energy: -40.912 bonds (distance) P-C4' energy: -45.066 flat angles C4'-P-C4' energy: -54.651 flat angles P-C4'-P energy: -40.725 tors. eta vs tors. theta energy: -60.314 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -998.565983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -998.565983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.715983 (E_RNA) where: Base-Base interactions energy: -570.977 where: short stacking energy: -231.614 Base-Backbone interact. energy: -0.567 local terms energy: -258.171287 where: bonds (distance) C4'-P energy: -51.498 bonds (distance) P-C4' energy: -59.147 flat angles C4'-P-C4' energy: -53.495 flat angles P-C4'-P energy: -31.383 tors. eta vs tors. theta energy: -62.648 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -960.140447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.140447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -798.490447 (E_RNA) where: Base-Base interactions energy: -559.748 where: short stacking energy: -232.859 Base-Backbone interact. energy: -1.044 local terms energy: -237.698095 where: bonds (distance) C4'-P energy: -38.872 bonds (distance) P-C4' energy: -56.417 flat angles C4'-P-C4' energy: -45.234 flat angles P-C4'-P energy: -27.498 tors. eta vs tors. theta energy: -69.677 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -937.090227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.090227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.840227 (E_RNA) where: Base-Base interactions energy: -552.025 where: short stacking energy: -218.105 Base-Backbone interact. energy: 0.045 local terms energy: -228.859592 where: bonds (distance) C4'-P energy: -41.192 bonds (distance) P-C4' energy: -38.785 flat angles C4'-P-C4' energy: -60.018 flat angles P-C4'-P energy: -37.830 tors. eta vs tors. theta energy: -51.034 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -695.608711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.608711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.958711 (E_RNA) where: Base-Base interactions energy: -408.711 where: short stacking energy: -180.906 Base-Backbone interact. energy: -0.954 local terms energy: -196.293112 where: bonds (distance) C4'-P energy: -48.218 bonds (distance) P-C4' energy: -41.464 flat angles C4'-P-C4' energy: -39.791 flat angles P-C4'-P energy: -31.697 tors. eta vs tors. theta energy: -35.123 Dist. restrs. and SS energy: -113.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -1236.928630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1236.928630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1066.278630 (E_RNA) where: Base-Base interactions energy: -744.739 where: short stacking energy: -304.616 Base-Backbone interact. energy: -1.468 local terms energy: -320.071623 where: bonds (distance) C4'-P energy: -61.878 bonds (distance) P-C4' energy: -52.646 flat angles C4'-P-C4' energy: -65.297 flat angles P-C4'-P energy: -55.773 tors. eta vs tors. theta energy: -84.477 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -1178.898218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1178.898218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1008.248218 (E_RNA) where: Base-Base interactions energy: -683.178 where: short stacking energy: -288.135 Base-Backbone interact. energy: -1.743 local terms energy: -323.327255 where: bonds (distance) C4'-P energy: -57.293 bonds (distance) P-C4' energy: -65.241 flat angles C4'-P-C4' energy: -63.762 flat angles P-C4'-P energy: -52.311 tors. eta vs tors. theta energy: -84.720 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -1164.187319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1164.187319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -993.537319 (E_RNA) where: Base-Base interactions energy: -688.042 where: short stacking energy: -268.486 Base-Backbone interact. energy: -0.314 local terms energy: -305.180860 where: bonds (distance) C4'-P energy: -56.260 bonds (distance) P-C4' energy: -54.809 flat angles C4'-P-C4' energy: -60.054 flat angles P-C4'-P energy: -49.574 tors. eta vs tors. theta energy: -84.483 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -1146.583064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1146.583064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -979.533064 (E_RNA) where: Base-Base interactions energy: -684.399 where: short stacking energy: -270.225 Base-Backbone interact. energy: -1.744 local terms energy: -293.389607 where: bonds (distance) C4'-P energy: -50.997 bonds (distance) P-C4' energy: -60.922 flat angles C4'-P-C4' energy: -57.897 flat angles P-C4'-P energy: -44.732 tors. eta vs tors. theta energy: -78.842 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -1070.351910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1070.351910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.501910 (E_RNA) where: Base-Base interactions energy: -629.137 where: short stacking energy: -247.294 Base-Backbone interact. energy: -1.451 local terms energy: -270.913605 where: bonds (distance) C4'-P energy: -59.634 bonds (distance) P-C4' energy: -59.356 flat angles C4'-P-C4' energy: -55.761 flat angles P-C4'-P energy: -26.866 tors. eta vs tors. theta energy: -69.298 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -1064.235478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.235478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -895.385478 (E_RNA) where: Base-Base interactions energy: -637.002 where: short stacking energy: -240.876 Base-Backbone interact. energy: -1.695 local terms energy: -256.687560 where: bonds (distance) C4'-P energy: -46.963 bonds (distance) P-C4' energy: -52.817 flat angles C4'-P-C4' energy: -58.460 flat angles P-C4'-P energy: -43.793 tors. eta vs tors. theta energy: -54.654 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -1022.976993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1022.976993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -854.126993 (E_RNA) where: Base-Base interactions energy: -587.112 where: short stacking energy: -226.926 Base-Backbone interact. energy: -1.098 local terms energy: -265.916339 where: bonds (distance) C4'-P energy: -47.874 bonds (distance) P-C4' energy: -54.343 flat angles C4'-P-C4' energy: -58.704 flat angles P-C4'-P energy: -44.289 tors. eta vs tors. theta energy: -60.706 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -964.827758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.827758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.177758 (E_RNA) where: Base-Base interactions energy: -551.260 where: short stacking energy: -226.952 Base-Backbone interact. energy: -0.157 local terms energy: -260.760144 where: bonds (distance) C4'-P energy: -47.270 bonds (distance) P-C4' energy: -55.379 flat angles C4'-P-C4' energy: -55.002 flat angles P-C4'-P energy: -37.548 tors. eta vs tors. theta energy: -65.561 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -937.948886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.948886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.298886 (E_RNA) where: Base-Base interactions energy: -552.715 where: short stacking energy: -204.440 Base-Backbone interact. energy: -0.855 local terms energy: -231.728091 where: bonds (distance) C4'-P energy: -39.812 bonds (distance) P-C4' energy: -48.847 flat angles C4'-P-C4' energy: -56.642 flat angles P-C4'-P energy: -29.951 tors. eta vs tors. theta energy: -56.475 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -721.132081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.132081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.482081 (E_RNA) where: Base-Base interactions energy: -406.071 where: short stacking energy: -174.312 Base-Backbone interact. energy: -0.175 local terms energy: -216.235970 where: bonds (distance) C4'-P energy: -49.682 bonds (distance) P-C4' energy: -54.515 flat angles C4'-P-C4' energy: -45.676 flat angles P-C4'-P energy: -34.181 tors. eta vs tors. theta energy: -32.183 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -1239.406955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1239.406955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1068.756955 (E_RNA) where: Base-Base interactions energy: -758.098 where: short stacking energy: -306.931 Base-Backbone interact. energy: -3.756 local terms energy: -306.902938 where: bonds (distance) C4'-P energy: -59.466 bonds (distance) P-C4' energy: -64.033 flat angles C4'-P-C4' energy: -58.636 flat angles P-C4'-P energy: -39.460 tors. eta vs tors. theta energy: -85.308 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -1196.183238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.183238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1029.133238 (E_RNA) where: Base-Base interactions energy: -712.851 where: short stacking energy: -299.887 Base-Backbone interact. energy: -0.535 local terms energy: -315.747564 where: bonds (distance) C4'-P energy: -63.305 bonds (distance) P-C4' energy: -67.001 flat angles C4'-P-C4' energy: -59.743 flat angles P-C4'-P energy: -48.747 tors. eta vs tors. theta energy: -76.951 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -1179.434788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1179.434788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1008.784788 (E_RNA) where: Base-Base interactions energy: -708.065 where: short stacking energy: -274.863 Base-Backbone interact. energy: -0.897 local terms energy: -299.823031 where: bonds (distance) C4'-P energy: -54.966 bonds (distance) P-C4' energy: -50.712 flat angles C4'-P-C4' energy: -57.818 flat angles P-C4'-P energy: -50.813 tors. eta vs tors. theta energy: -85.514 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -1127.866959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1127.866959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.616959 (E_RNA) where: Base-Base interactions energy: -667.350 where: short stacking energy: -279.951 Base-Backbone interact. energy: -1.666 local terms energy: -293.600077 where: bonds (distance) C4'-P energy: -56.969 bonds (distance) P-C4' energy: -57.740 flat angles C4'-P-C4' energy: -59.684 flat angles P-C4'-P energy: -41.323 tors. eta vs tors. theta energy: -77.884 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -1066.910503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1066.910503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -898.060503 (E_RNA) where: Base-Base interactions energy: -639.012 where: short stacking energy: -244.500 Base-Backbone interact. energy: -2.782 local terms energy: -256.267079 where: bonds (distance) C4'-P energy: -58.067 bonds (distance) P-C4' energy: -45.303 flat angles C4'-P-C4' energy: -49.202 flat angles P-C4'-P energy: -40.033 tors. eta vs tors. theta energy: -63.661 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -1041.597432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.597432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.947432 (E_RNA) where: Base-Base interactions energy: -627.757 where: short stacking energy: -237.620 Base-Backbone interact. energy: -3.268 local terms energy: -248.922901 where: bonds (distance) C4'-P energy: -37.097 bonds (distance) P-C4' energy: -60.651 flat angles C4'-P-C4' energy: -63.613 flat angles P-C4'-P energy: -36.826 tors. eta vs tors. theta energy: -50.736 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -983.075564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -983.075564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.225564 (E_RNA) where: Base-Base interactions energy: -584.244 where: short stacking energy: -223.988 Base-Backbone interact. energy: -0.276 local terms energy: -229.705490 where: bonds (distance) C4'-P energy: -47.561 bonds (distance) P-C4' energy: -51.461 flat angles C4'-P-C4' energy: -40.426 flat angles P-C4'-P energy: -32.963 tors. eta vs tors. theta energy: -57.294 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -947.443775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -947.443775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.193775 (E_RNA) where: Base-Base interactions energy: -554.676 where: short stacking energy: -221.554 Base-Backbone interact. energy: -0.143 local terms energy: -236.374311 where: bonds (distance) C4'-P energy: -51.231 bonds (distance) P-C4' energy: -49.684 flat angles C4'-P-C4' energy: -47.016 flat angles P-C4'-P energy: -32.048 tors. eta vs tors. theta energy: -56.395 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -927.427153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.427153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.577153 (E_RNA) where: Base-Base interactions energy: -539.069 where: short stacking energy: -196.110 Base-Backbone interact. energy: -2.470 local terms energy: -226.037819 where: bonds (distance) C4'-P energy: -47.948 bonds (distance) P-C4' energy: -48.470 flat angles C4'-P-C4' energy: -58.957 flat angles P-C4'-P energy: -32.837 tors. eta vs tors. theta energy: -37.826 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -705.050387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.050387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.000387 (E_RNA) where: Base-Base interactions energy: -421.402 where: short stacking energy: -156.772 Base-Backbone interact. energy: -0.672 local terms energy: -187.926831 where: bonds (distance) C4'-P energy: -44.880 bonds (distance) P-C4' energy: -45.403 flat angles C4'-P-C4' energy: -43.802 flat angles P-C4'-P energy: -36.801 tors. eta vs tors. theta energy: -17.040 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -1232.189657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1232.189657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1063.339657 (E_RNA) where: Base-Base interactions energy: -734.229 where: short stacking energy: -294.202 Base-Backbone interact. energy: -1.693 local terms energy: -327.417865 where: bonds (distance) C4'-P energy: -62.842 bonds (distance) P-C4' energy: -70.132 flat angles C4'-P-C4' energy: -69.105 flat angles P-C4'-P energy: -45.227 tors. eta vs tors. theta energy: -80.112 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -1182.798685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1182.798685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1017.548685 (E_RNA) where: Base-Base interactions energy: -711.968 where: short stacking energy: -280.337 Base-Backbone interact. energy: -0.448 local terms energy: -305.132532 where: bonds (distance) C4'-P energy: -59.075 bonds (distance) P-C4' energy: -64.284 flat angles C4'-P-C4' energy: -60.625 flat angles P-C4'-P energy: -44.807 tors. eta vs tors. theta energy: -76.342 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -1166.753021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1166.753021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -999.703021 (E_RNA) where: Base-Base interactions energy: -686.211 where: short stacking energy: -289.181 Base-Backbone interact. energy: -1.267 local terms energy: -312.224655 where: bonds (distance) C4'-P energy: -52.203 bonds (distance) P-C4' energy: -54.901 flat angles C4'-P-C4' energy: -63.745 flat angles P-C4'-P energy: -57.160 tors. eta vs tors. theta energy: -84.215 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -1154.683346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1154.683346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -987.633346 (E_RNA) where: Base-Base interactions energy: -692.075 where: short stacking energy: -290.887 Base-Backbone interact. energy: -0.969 local terms energy: -294.589452 where: bonds (distance) C4'-P energy: -56.192 bonds (distance) P-C4' energy: -61.487 flat angles C4'-P-C4' energy: -60.257 flat angles P-C4'-P energy: -40.749 tors. eta vs tors. theta energy: -75.905 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -1053.137847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.137847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.087847 (E_RNA) where: Base-Base interactions energy: -618.802 where: short stacking energy: -237.937 Base-Backbone interact. energy: 0.199 local terms energy: -267.484989 where: bonds (distance) C4'-P energy: -51.299 bonds (distance) P-C4' energy: -54.993 flat angles C4'-P-C4' energy: -58.307 flat angles P-C4'-P energy: -42.034 tors. eta vs tors. theta energy: -60.851 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -1029.772258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1029.772258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -862.722258 (E_RNA) where: Base-Base interactions energy: -591.250 where: short stacking energy: -242.506 Base-Backbone interact. energy: 1.069 local terms energy: -272.540734 where: bonds (distance) C4'-P energy: -59.033 bonds (distance) P-C4' energy: -57.359 flat angles C4'-P-C4' energy: -53.316 flat angles P-C4'-P energy: -45.850 tors. eta vs tors. theta energy: -56.983 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -1029.766239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1029.766239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -869.916239 (E_RNA) where: Base-Base interactions energy: -596.967 where: short stacking energy: -258.993 Base-Backbone interact. energy: 0.939 local terms energy: -273.888627 where: bonds (distance) C4'-P energy: -56.116 bonds (distance) P-C4' energy: -54.933 flat angles C4'-P-C4' energy: -64.620 flat angles P-C4'-P energy: -34.023 tors. eta vs tors. theta energy: -64.197 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -963.624644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.624644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.174644 (E_RNA) where: Base-Base interactions energy: -569.888 where: short stacking energy: -215.909 Base-Backbone interact. energy: -1.590 local terms energy: -237.696757 where: bonds (distance) C4'-P energy: -47.386 bonds (distance) P-C4' energy: -52.532 flat angles C4'-P-C4' energy: -45.947 flat angles P-C4'-P energy: -38.103 tors. eta vs tors. theta energy: -53.729 Dist. restrs. and SS energy: -178.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -921.604721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.604721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.354721 (E_RNA) where: Base-Base interactions energy: -543.060 where: short stacking energy: -205.625 Base-Backbone interact. energy: -3.200 local terms energy: -219.094543 where: bonds (distance) C4'-P energy: -36.408 bonds (distance) P-C4' energy: -50.029 flat angles C4'-P-C4' energy: -54.607 flat angles P-C4'-P energy: -35.801 tors. eta vs tors. theta energy: -42.249 Dist. restrs. and SS energy: -180.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -686.239878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.239878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.589878 (E_RNA) where: Base-Base interactions energy: -370.893 where: short stacking energy: -129.535 Base-Backbone interact. energy: -1.833 local terms energy: -214.863690 where: bonds (distance) C4'-P energy: -50.489 bonds (distance) P-C4' energy: -53.629 flat angles C4'-P-C4' energy: -46.961 flat angles P-C4'-P energy: -41.998 tors. eta vs tors. theta energy: -21.787 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -1203.838263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1203.838263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1033.188263 (E_RNA) where: Base-Base interactions energy: -719.796 where: short stacking energy: -274.891 Base-Backbone interact. energy: -1.344 local terms energy: -312.048417 where: bonds (distance) C4'-P energy: -64.202 bonds (distance) P-C4' energy: -57.414 flat angles C4'-P-C4' energy: -62.938 flat angles P-C4'-P energy: -45.887 tors. eta vs tors. theta energy: -81.607 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -1214.644184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1214.644184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1047.594184 (E_RNA) where: Base-Base interactions energy: -718.168 where: short stacking energy: -300.513 Base-Backbone interact. energy: -2.137 local terms energy: -327.289097 where: bonds (distance) C4'-P energy: -61.180 bonds (distance) P-C4' energy: -63.312 flat angles C4'-P-C4' energy: -68.047 flat angles P-C4'-P energy: -47.360 tors. eta vs tors. theta energy: -87.390 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -1164.144180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1164.144180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -995.294180 (E_RNA) where: Base-Base interactions energy: -689.835 where: short stacking energy: -279.505 Base-Backbone interact. energy: -0.209 local terms energy: -305.250876 where: bonds (distance) C4'-P energy: -54.030 bonds (distance) P-C4' energy: -59.965 flat angles C4'-P-C4' energy: -72.946 flat angles P-C4'-P energy: -44.911 tors. eta vs tors. theta energy: -73.398 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -1107.527380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1107.527380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.477380 (E_RNA) where: Base-Base interactions energy: -657.345 where: short stacking energy: -255.351 Base-Backbone interact. energy: -1.106 local terms energy: -282.027002 where: bonds (distance) C4'-P energy: -55.970 bonds (distance) P-C4' energy: -49.762 flat angles C4'-P-C4' energy: -63.958 flat angles P-C4'-P energy: -42.463 tors. eta vs tors. theta energy: -69.874 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -1053.560440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.560440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.910440 (E_RNA) where: Base-Base interactions energy: -615.989 where: short stacking energy: -242.053 Base-Backbone interact. energy: -1.548 local terms energy: -265.373452 where: bonds (distance) C4'-P energy: -46.779 bonds (distance) P-C4' energy: -59.818 flat angles C4'-P-C4' energy: -59.484 flat angles P-C4'-P energy: -41.022 tors. eta vs tors. theta energy: -58.271 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -1052.436555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.436555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -888.986555 (E_RNA) where: Base-Base interactions energy: -618.825 where: short stacking energy: -245.636 Base-Backbone interact. energy: -2.364 local terms energy: -267.797714 where: bonds (distance) C4'-P energy: -44.188 bonds (distance) P-C4' energy: -56.427 flat angles C4'-P-C4' energy: -57.921 flat angles P-C4'-P energy: -43.263 tors. eta vs tors. theta energy: -65.998 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -996.067214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.067214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -830.817214 (E_RNA) where: Base-Base interactions energy: -582.480 where: short stacking energy: -225.286 Base-Backbone interact. energy: -1.259 local terms energy: -247.077992 where: bonds (distance) C4'-P energy: -50.025 bonds (distance) P-C4' energy: -49.383 flat angles C4'-P-C4' energy: -54.408 flat angles P-C4'-P energy: -36.105 tors. eta vs tors. theta energy: -57.158 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -982.086808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.086808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -822.236808 (E_RNA) where: Base-Base interactions energy: -558.506 where: short stacking energy: -212.851 Base-Backbone interact. energy: -0.394 local terms energy: -263.336475 where: bonds (distance) C4'-P energy: -56.124 bonds (distance) P-C4' energy: -48.404 flat angles C4'-P-C4' energy: -59.470 flat angles P-C4'-P energy: -40.166 tors. eta vs tors. theta energy: -59.173 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -934.316395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -934.316395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.266395 (E_RNA) where: Base-Base interactions energy: -543.675 where: short stacking energy: -199.226 Base-Backbone interact. energy: -1.308 local terms energy: -222.283677 where: bonds (distance) C4'-P energy: -56.631 bonds (distance) P-C4' energy: -39.261 flat angles C4'-P-C4' energy: -50.401 flat angles P-C4'-P energy: -31.159 tors. eta vs tors. theta energy: -44.832 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -712.978026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.978026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.328026 (E_RNA) where: Base-Base interactions energy: -417.778 where: short stacking energy: -161.021 Base-Backbone interact. energy: -3.424 local terms energy: -193.125354 where: bonds (distance) C4'-P energy: -45.997 bonds (distance) P-C4' energy: -44.046 flat angles C4'-P-C4' energy: -47.677 flat angles P-C4'-P energy: -26.504 tors. eta vs tors. theta energy: -28.901 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -1207.238050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1207.238050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.388050 (E_RNA) where: Base-Base interactions energy: -729.105 where: short stacking energy: -281.889 Base-Backbone interact. energy: -0.885 local terms energy: -308.398233 where: bonds (distance) C4'-P energy: -57.034 bonds (distance) P-C4' energy: -53.798 flat angles C4'-P-C4' energy: -70.521 flat angles P-C4'-P energy: -40.892 tors. eta vs tors. theta energy: -86.153 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -1199.092410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1199.092410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1028.442410 (E_RNA) where: Base-Base interactions energy: -705.001 where: short stacking energy: -298.238 Base-Backbone interact. energy: -1.186 local terms energy: -322.255581 where: bonds (distance) C4'-P energy: -62.959 bonds (distance) P-C4' energy: -60.320 flat angles C4'-P-C4' energy: -65.020 flat angles P-C4'-P energy: -47.178 tors. eta vs tors. theta energy: -86.780 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -1154.995421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1154.995421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -987.945421 (E_RNA) where: Base-Base interactions energy: -694.907 where: short stacking energy: -278.339 Base-Backbone interact. energy: 0.187 local terms energy: -293.225149 where: bonds (distance) C4'-P energy: -58.923 bonds (distance) P-C4' energy: -61.732 flat angles C4'-P-C4' energy: -54.712 flat angles P-C4'-P energy: -42.483 tors. eta vs tors. theta energy: -75.375 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -1080.092799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1080.092799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.042799 (E_RNA) where: Base-Base interactions energy: -630.187 where: short stacking energy: -250.640 Base-Backbone interact. energy: -1.481 local terms energy: -281.375400 where: bonds (distance) C4'-P energy: -51.886 bonds (distance) P-C4' energy: -55.650 flat angles C4'-P-C4' energy: -67.515 flat angles P-C4'-P energy: -44.846 tors. eta vs tors. theta energy: -61.479 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -1091.877668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.877668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -921.227668 (E_RNA) where: Base-Base interactions energy: -636.043 where: short stacking energy: -258.830 Base-Backbone interact. energy: -4.390 local terms energy: -280.794192 where: bonds (distance) C4'-P energy: -49.948 bonds (distance) P-C4' energy: -53.257 flat angles C4'-P-C4' energy: -64.918 flat angles P-C4'-P energy: -40.485 tors. eta vs tors. theta energy: -72.186 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -1054.383976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1054.383976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.533976 (E_RNA) where: Base-Base interactions energy: -602.424 where: short stacking energy: -231.825 Base-Backbone interact. energy: -1.268 local terms energy: -281.842148 where: bonds (distance) C4'-P energy: -48.521 bonds (distance) P-C4' energy: -58.042 flat angles C4'-P-C4' energy: -65.411 flat angles P-C4'-P energy: -45.297 tors. eta vs tors. theta energy: -64.571 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -1039.429572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.429572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -870.579572 (E_RNA) where: Base-Base interactions energy: -610.521 where: short stacking energy: -237.773 Base-Backbone interact. energy: -1.277 local terms energy: -258.781586 where: bonds (distance) C4'-P energy: -62.447 bonds (distance) P-C4' energy: -47.115 flat angles C4'-P-C4' energy: -48.711 flat angles P-C4'-P energy: -33.191 tors. eta vs tors. theta energy: -67.318 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -945.497484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.497484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.647484 (E_RNA) where: Base-Base interactions energy: -549.028 where: short stacking energy: -197.744 Base-Backbone interact. energy: 1.646 local terms energy: -229.264995 where: bonds (distance) C4'-P energy: -52.906 bonds (distance) P-C4' energy: -35.460 flat angles C4'-P-C4' energy: -56.604 flat angles P-C4'-P energy: -41.630 tors. eta vs tors. theta energy: -42.666 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -939.010620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -939.010620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.360620 (E_RNA) where: Base-Base interactions energy: -550.118 where: short stacking energy: -197.321 Base-Backbone interact. energy: 0.503 local terms energy: -236.745651 where: bonds (distance) C4'-P energy: -45.600 bonds (distance) P-C4' energy: -59.217 flat angles C4'-P-C4' energy: -54.811 flat angles P-C4'-P energy: -34.170 tors. eta vs tors. theta energy: -42.947 Dist. restrs. and SS energy: -176.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -718.418263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.418263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.568263 (E_RNA) where: Base-Base interactions energy: -427.278 where: short stacking energy: -175.333 Base-Backbone interact. energy: 0.033 local terms energy: -194.323095 where: bonds (distance) C4'-P energy: -40.308 bonds (distance) P-C4' energy: -48.756 flat angles C4'-P-C4' energy: -45.157 flat angles P-C4'-P energy: -30.498 tors. eta vs tors. theta energy: -29.605 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -1227.987856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1227.987856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1064.537856 (E_RNA) where: Base-Base interactions energy: -739.811 where: short stacking energy: -314.181 Base-Backbone interact. energy: -0.083 local terms energy: -324.644157 where: bonds (distance) C4'-P energy: -58.002 bonds (distance) P-C4' energy: -59.140 flat angles C4'-P-C4' energy: -74.345 flat angles P-C4'-P energy: -39.264 tors. eta vs tors. theta energy: -93.894 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -1191.969237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1191.969237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1023.119237 (E_RNA) where: Base-Base interactions energy: -707.634 where: short stacking energy: -279.769 Base-Backbone interact. energy: -1.809 local terms energy: -313.675802 where: bonds (distance) C4'-P energy: -66.122 bonds (distance) P-C4' energy: -61.540 flat angles C4'-P-C4' energy: -56.654 flat angles P-C4'-P energy: -42.818 tors. eta vs tors. theta energy: -86.542 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -1158.971923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1158.971923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -991.921923 (E_RNA) where: Base-Base interactions energy: -689.560 where: short stacking energy: -291.888 Base-Backbone interact. energy: 0.035 local terms energy: -302.396892 where: bonds (distance) C4'-P energy: -50.070 bonds (distance) P-C4' energy: -60.359 flat angles C4'-P-C4' energy: -61.405 flat angles P-C4'-P energy: -52.135 tors. eta vs tors. theta energy: -78.428 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -1096.670055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.670055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.020055 (E_RNA) where: Base-Base interactions energy: -641.010 where: short stacking energy: -258.127 Base-Backbone interact. energy: 0.568 local terms energy: -285.577910 where: bonds (distance) C4'-P energy: -58.015 bonds (distance) P-C4' energy: -58.259 flat angles C4'-P-C4' energy: -59.949 flat angles P-C4'-P energy: -42.863 tors. eta vs tors. theta energy: -66.492 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -1081.190666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1081.190666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.540666 (E_RNA) where: Base-Base interactions energy: -643.895 where: short stacking energy: -243.267 Base-Backbone interact. energy: -1.621 local terms energy: -265.024498 where: bonds (distance) C4'-P energy: -51.209 bonds (distance) P-C4' energy: -55.346 flat angles C4'-P-C4' energy: -61.129 flat angles P-C4'-P energy: -33.849 tors. eta vs tors. theta energy: -63.492 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -1023.683391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.683391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -856.633391 (E_RNA) where: Base-Base interactions energy: -614.128 where: short stacking energy: -250.906 Base-Backbone interact. energy: 2.123 local terms energy: -244.628475 where: bonds (distance) C4'-P energy: -49.244 bonds (distance) P-C4' energy: -52.871 flat angles C4'-P-C4' energy: -49.514 flat angles P-C4'-P energy: -22.667 tors. eta vs tors. theta energy: -70.332 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -1033.662601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1033.662601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -863.012601 (E_RNA) where: Base-Base interactions energy: -604.671 where: short stacking energy: -252.219 Base-Backbone interact. energy: 1.223 local terms energy: -259.564244 where: bonds (distance) C4'-P energy: -52.141 bonds (distance) P-C4' energy: -56.547 flat angles C4'-P-C4' energy: -46.062 flat angles P-C4'-P energy: -37.191 tors. eta vs tors. theta energy: -67.623 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -979.600652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -979.600652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -817.950652 (E_RNA) where: Base-Base interactions energy: -587.357 where: short stacking energy: -227.890 Base-Backbone interact. energy: -1.633 local terms energy: -228.960508 where: bonds (distance) C4'-P energy: -52.062 bonds (distance) P-C4' energy: -47.262 flat angles C4'-P-C4' energy: -45.710 flat angles P-C4'-P energy: -34.298 tors. eta vs tors. theta energy: -49.627 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -965.254902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.254902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -805.404902 (E_RNA) where: Base-Base interactions energy: -576.367 where: short stacking energy: -223.687 Base-Backbone interact. energy: -0.915 local terms energy: -228.123202 where: bonds (distance) C4'-P energy: -46.386 bonds (distance) P-C4' energy: -40.476 flat angles C4'-P-C4' energy: -63.601 flat angles P-C4'-P energy: -26.566 tors. eta vs tors. theta energy: -51.094 Dist. restrs. and SS energy: -183.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -727.038740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.038740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.788740 (E_RNA) where: Base-Base interactions energy: -411.709 where: short stacking energy: -175.540 Base-Backbone interact. energy: -1.108 local terms energy: -220.971763 where: bonds (distance) C4'-P energy: -49.007 bonds (distance) P-C4' energy: -48.524 flat angles C4'-P-C4' energy: -55.497 flat angles P-C4'-P energy: -34.123 tors. eta vs tors. theta energy: -33.820 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -1233.796688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1233.796688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1064.946688 (E_RNA) where: Base-Base interactions energy: -730.432 where: short stacking energy: -315.152 Base-Backbone interact. energy: 0.113 local terms energy: -334.626906 where: bonds (distance) C4'-P energy: -60.854 bonds (distance) P-C4' energy: -69.806 flat angles C4'-P-C4' energy: -62.021 flat angles P-C4'-P energy: -50.491 tors. eta vs tors. theta energy: -91.456 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -1162.030825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1162.030825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -991.380825 (E_RNA) where: Base-Base interactions energy: -692.983 where: short stacking energy: -284.776 Base-Backbone interact. energy: -1.991 local terms energy: -296.406441 where: bonds (distance) C4'-P energy: -48.450 bonds (distance) P-C4' energy: -53.200 flat angles C4'-P-C4' energy: -72.037 flat angles P-C4'-P energy: -45.146 tors. eta vs tors. theta energy: -77.574 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -1153.185720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1153.185720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -986.135720 (E_RNA) where: Base-Base interactions energy: -691.335 where: short stacking energy: -274.862 Base-Backbone interact. energy: -1.386 local terms energy: -293.415249 where: bonds (distance) C4'-P energy: -57.390 bonds (distance) P-C4' energy: -63.367 flat angles C4'-P-C4' energy: -61.295 flat angles P-C4'-P energy: -32.110 tors. eta vs tors. theta energy: -79.254 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -1111.776184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1111.776184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -944.726184 (E_RNA) where: Base-Base interactions energy: -675.325 where: short stacking energy: -251.233 Base-Backbone interact. energy: -1.289 local terms energy: -268.111878 where: bonds (distance) C4'-P energy: -54.428 bonds (distance) P-C4' energy: -57.229 flat angles C4'-P-C4' energy: -52.474 flat angles P-C4'-P energy: -40.270 tors. eta vs tors. theta energy: -63.710 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -1109.861463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1109.861463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.211463 (E_RNA) where: Base-Base interactions energy: -651.559 where: short stacking energy: -264.321 Base-Backbone interact. energy: -1.560 local terms energy: -286.092000 where: bonds (distance) C4'-P energy: -48.705 bonds (distance) P-C4' energy: -60.030 flat angles C4'-P-C4' energy: -61.600 flat angles P-C4'-P energy: -45.013 tors. eta vs tors. theta energy: -70.744 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -1058.191969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.191969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.341969 (E_RNA) where: Base-Base interactions energy: -623.016 where: short stacking energy: -249.756 Base-Backbone interact. energy: -2.145 local terms energy: -264.180638 where: bonds (distance) C4'-P energy: -51.630 bonds (distance) P-C4' energy: -50.960 flat angles C4'-P-C4' energy: -60.306 flat angles P-C4'-P energy: -34.029 tors. eta vs tors. theta energy: -67.255 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -1021.855440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.855440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -854.805440 (E_RNA) where: Base-Base interactions energy: -588.373 where: short stacking energy: -238.804 Base-Backbone interact. energy: -0.454 local terms energy: -265.978301 where: bonds (distance) C4'-P energy: -50.639 bonds (distance) P-C4' energy: -62.751 flat angles C4'-P-C4' energy: -54.635 flat angles P-C4'-P energy: -37.154 tors. eta vs tors. theta energy: -60.799 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -965.111069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.111069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.861069 (E_RNA) where: Base-Base interactions energy: -556.387 where: short stacking energy: -213.282 Base-Backbone interact. energy: -0.376 local terms energy: -243.098059 where: bonds (distance) C4'-P energy: -48.725 bonds (distance) P-C4' energy: -46.553 flat angles C4'-P-C4' energy: -48.267 flat angles P-C4'-P energy: -46.862 tors. eta vs tors. theta energy: -52.692 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -933.852966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -933.852966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.802966 (E_RNA) where: Base-Base interactions energy: -543.104 where: short stacking energy: -202.547 Base-Backbone interact. energy: -0.593 local terms energy: -232.106333 where: bonds (distance) C4'-P energy: -37.831 bonds (distance) P-C4' energy: -54.107 flat angles C4'-P-C4' energy: -51.225 flat angles P-C4'-P energy: -36.392 tors. eta vs tors. theta energy: -52.551 Dist. restrs. and SS energy: -181.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -680.566731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.566731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.516731 (E_RNA) where: Base-Base interactions energy: -404.924 where: short stacking energy: -154.463 Base-Backbone interact. energy: -0.387 local terms energy: -180.206441 where: bonds (distance) C4'-P energy: -40.459 bonds (distance) P-C4' energy: -39.488 flat angles C4'-P-C4' energy: -47.387 flat angles P-C4'-P energy: -26.308 tors. eta vs tors. theta energy: -26.564 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -1227.743379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1227.743379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1057.093379 (E_RNA) where: Base-Base interactions energy: -719.085 where: short stacking energy: -320.090 Base-Backbone interact. energy: -0.293 local terms energy: -337.715788 where: bonds (distance) C4'-P energy: -59.214 bonds (distance) P-C4' energy: -64.910 flat angles C4'-P-C4' energy: -73.394 flat angles P-C4'-P energy: -50.479 tors. eta vs tors. theta energy: -89.719 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -1166.684359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1166.684359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -996.034359 (E_RNA) where: Base-Base interactions energy: -690.627 where: short stacking energy: -285.489 Base-Backbone interact. energy: 0.658 local terms energy: -306.065104 where: bonds (distance) C4'-P energy: -58.749 bonds (distance) P-C4' energy: -63.106 flat angles C4'-P-C4' energy: -56.372 flat angles P-C4'-P energy: -44.154 tors. eta vs tors. theta energy: -83.683 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -1153.718141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1153.718141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.068141 (E_RNA) where: Base-Base interactions energy: -684.995 where: short stacking energy: -271.452 Base-Backbone interact. energy: -2.344 local terms energy: -295.728356 where: bonds (distance) C4'-P energy: -44.811 bonds (distance) P-C4' energy: -59.698 flat angles C4'-P-C4' energy: -67.383 flat angles P-C4'-P energy: -49.977 tors. eta vs tors. theta energy: -73.859 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -1139.817204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1139.817204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -969.167204 (E_RNA) where: Base-Base interactions energy: -689.955 where: short stacking energy: -281.579 Base-Backbone interact. energy: 0.390 local terms energy: -279.602339 where: bonds (distance) C4'-P energy: -48.269 bonds (distance) P-C4' energy: -57.978 flat angles C4'-P-C4' energy: -58.892 flat angles P-C4'-P energy: -35.608 tors. eta vs tors. theta energy: -78.855 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -1108.783769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1108.783769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.933769 (E_RNA) where: Base-Base interactions energy: -648.190 where: short stacking energy: -276.454 Base-Backbone interact. energy: -0.463 local terms energy: -291.281081 where: bonds (distance) C4'-P energy: -55.951 bonds (distance) P-C4' energy: -56.535 flat angles C4'-P-C4' energy: -60.306 flat angles P-C4'-P energy: -48.074 tors. eta vs tors. theta energy: -70.415 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -1076.100181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.100181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.850181 (E_RNA) where: Base-Base interactions energy: -652.944 where: short stacking energy: -252.506 Base-Backbone interact. energy: 0.371 local terms energy: -258.276859 where: bonds (distance) C4'-P energy: -42.063 bonds (distance) P-C4' energy: -52.149 flat angles C4'-P-C4' energy: -59.616 flat angles P-C4'-P energy: -42.907 tors. eta vs tors. theta energy: -61.542 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -1030.906688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1030.906688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -862.056688 (E_RNA) where: Base-Base interactions energy: -624.023 where: short stacking energy: -246.799 Base-Backbone interact. energy: -1.143 local terms energy: -236.890628 where: bonds (distance) C4'-P energy: -48.943 bonds (distance) P-C4' energy: -45.971 flat angles C4'-P-C4' energy: -46.562 flat angles P-C4'-P energy: -36.555 tors. eta vs tors. theta energy: -58.859 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -973.896722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -973.896722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -808.646722 (E_RNA) where: Base-Base interactions energy: -561.395 where: short stacking energy: -216.984 Base-Backbone interact. energy: -1.710 local terms energy: -245.541258 where: bonds (distance) C4'-P energy: -52.719 bonds (distance) P-C4' energy: -41.646 flat angles C4'-P-C4' energy: -63.602 flat angles P-C4'-P energy: -39.880 tors. eta vs tors. theta energy: -47.695 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -937.908190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.908190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.258190 (E_RNA) where: Base-Base interactions energy: -525.730 where: short stacking energy: -185.648 Base-Backbone interact. energy: -2.567 local terms energy: -247.960475 where: bonds (distance) C4'-P energy: -55.352 bonds (distance) P-C4' energy: -48.247 flat angles C4'-P-C4' energy: -58.864 flat angles P-C4'-P energy: -39.735 tors. eta vs tors. theta energy: -45.762 Dist. restrs. and SS energy: -185.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -671.808020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.808020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.958020 (E_RNA) where: Base-Base interactions energy: -366.651 where: short stacking energy: -141.708 Base-Backbone interact. energy: -1.694 local terms energy: -206.613418 where: bonds (distance) C4'-P energy: -52.941 bonds (distance) P-C4' energy: -47.780 flat angles C4'-P-C4' energy: -44.078 flat angles P-C4'-P energy: -40.890 tors. eta vs tors. theta energy: -20.924 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -1225.108476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1225.108476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1054.458476 (E_RNA) where: Base-Base interactions energy: -728.354 where: short stacking energy: -296.433 Base-Backbone interact. energy: -1.845 local terms energy: -324.260023 where: bonds (distance) C4'-P energy: -58.971 bonds (distance) P-C4' energy: -64.841 flat angles C4'-P-C4' energy: -60.085 flat angles P-C4'-P energy: -52.213 tors. eta vs tors. theta energy: -88.149 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -1187.716787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1187.716787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1017.066787 (E_RNA) where: Base-Base interactions energy: -718.680 where: short stacking energy: -287.753 Base-Backbone interact. energy: -2.186 local terms energy: -296.201109 where: bonds (distance) C4'-P energy: -55.280 bonds (distance) P-C4' energy: -54.499 flat angles C4'-P-C4' energy: -65.157 flat angles P-C4'-P energy: -42.289 tors. eta vs tors. theta energy: -78.975 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -1156.092344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1156.092344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -985.442344 (E_RNA) where: Base-Base interactions energy: -683.624 where: short stacking energy: -271.591 Base-Backbone interact. energy: 0.011 local terms energy: -301.829549 where: bonds (distance) C4'-P energy: -48.828 bonds (distance) P-C4' energy: -61.856 flat angles C4'-P-C4' energy: -64.797 flat angles P-C4'-P energy: -52.773 tors. eta vs tors. theta energy: -73.575 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -1140.361320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1140.361320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -973.311320 (E_RNA) where: Base-Base interactions energy: -680.024 where: short stacking energy: -292.391 Base-Backbone interact. energy: -1.661 local terms energy: -291.627061 where: bonds (distance) C4'-P energy: -50.289 bonds (distance) P-C4' energy: -52.281 flat angles C4'-P-C4' energy: -63.666 flat angles P-C4'-P energy: -44.144 tors. eta vs tors. theta energy: -81.247 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -1107.477014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1107.477014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -944.027014 (E_RNA) where: Base-Base interactions energy: -674.203 where: short stacking energy: -285.579 Base-Backbone interact. energy: -2.774 local terms energy: -267.049590 where: bonds (distance) C4'-P energy: -49.146 bonds (distance) P-C4' energy: -59.620 flat angles C4'-P-C4' energy: -56.648 flat angles P-C4'-P energy: -25.904 tors. eta vs tors. theta energy: -75.731 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -1039.649033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.649033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.199033 (E_RNA) where: Base-Base interactions energy: -611.504 where: short stacking energy: -246.986 Base-Backbone interact. energy: -1.563 local terms energy: -263.131497 where: bonds (distance) C4'-P energy: -56.643 bonds (distance) P-C4' energy: -52.412 flat angles C4'-P-C4' energy: -62.544 flat angles P-C4'-P energy: -27.928 tors. eta vs tors. theta energy: -63.604 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -1019.259549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.259549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -848.609549 (E_RNA) where: Base-Base interactions energy: -577.618 where: short stacking energy: -234.629 Base-Backbone interact. energy: -0.749 local terms energy: -270.242559 where: bonds (distance) C4'-P energy: -50.406 bonds (distance) P-C4' energy: -57.472 flat angles C4'-P-C4' energy: -55.033 flat angles P-C4'-P energy: -44.944 tors. eta vs tors. theta energy: -62.387 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -943.159363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -943.159363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.109363 (E_RNA) where: Base-Base interactions energy: -552.910 where: short stacking energy: -213.690 Base-Backbone interact. energy: -2.025 local terms energy: -230.174669 where: bonds (distance) C4'-P energy: -51.875 bonds (distance) P-C4' energy: -45.212 flat angles C4'-P-C4' energy: -51.937 flat angles P-C4'-P energy: -22.852 tors. eta vs tors. theta energy: -58.299 Dist. restrs. and SS energy: -181.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -945.285954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.285954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.035954 (E_RNA) where: Base-Base interactions energy: -565.054 where: short stacking energy: -219.389 Base-Backbone interact. energy: 0.008 local terms energy: -214.989921 where: bonds (distance) C4'-P energy: -38.739 bonds (distance) P-C4' energy: -49.656 flat angles C4'-P-C4' energy: -55.617 flat angles P-C4'-P energy: -26.369 tors. eta vs tors. theta energy: -44.609 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -688.319757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.319757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.469757 (E_RNA) where: Base-Base interactions energy: -406.605 where: short stacking energy: -173.202 Base-Backbone interact. energy: 0.218 local terms energy: -185.082747 where: bonds (distance) C4'-P energy: -43.879 bonds (distance) P-C4' energy: -51.605 flat angles C4'-P-C4' energy: -50.849 flat angles P-C4'-P energy: -18.798 tors. eta vs tors. theta energy: -19.952 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -1224.164961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1224.164961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1055.314961 (E_RNA) where: Base-Base interactions energy: -729.052 where: short stacking energy: -323.611 Base-Backbone interact. energy: -0.746 local terms energy: -325.516808 where: bonds (distance) C4'-P energy: -52.658 bonds (distance) P-C4' energy: -59.299 flat angles C4'-P-C4' energy: -67.730 flat angles P-C4'-P energy: -49.360 tors. eta vs tors. theta energy: -96.470 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -1157.619705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1157.619705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -988.769705 (E_RNA) where: Base-Base interactions energy: -695.928 where: short stacking energy: -267.284 Base-Backbone interact. energy: -1.212 local terms energy: -291.629926 where: bonds (distance) C4'-P energy: -53.620 bonds (distance) P-C4' energy: -59.276 flat angles C4'-P-C4' energy: -65.236 flat angles P-C4'-P energy: -42.368 tors. eta vs tors. theta energy: -71.129 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -1166.137825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1166.137825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -997.287825 (E_RNA) where: Base-Base interactions energy: -690.925 where: short stacking energy: -281.230 Base-Backbone interact. energy: -0.006 local terms energy: -306.356434 where: bonds (distance) C4'-P energy: -53.743 bonds (distance) P-C4' energy: -65.809 flat angles C4'-P-C4' energy: -67.626 flat angles P-C4'-P energy: -37.930 tors. eta vs tors. theta energy: -81.248 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -1161.977660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1161.977660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -994.927660 (E_RNA) where: Base-Base interactions energy: -692.712 where: short stacking energy: -287.309 Base-Backbone interact. energy: -2.280 local terms energy: -299.935369 where: bonds (distance) C4'-P energy: -58.565 bonds (distance) P-C4' energy: -55.569 flat angles C4'-P-C4' energy: -60.112 flat angles P-C4'-P energy: -41.862 tors. eta vs tors. theta energy: -83.828 Dist. restrs. and SS energy: -190.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -1108.340190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1108.340190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -943.090190 (E_RNA) where: Base-Base interactions energy: -665.291 where: short stacking energy: -250.855 Base-Backbone interact. energy: -2.047 local terms energy: -275.752096 where: bonds (distance) C4'-P energy: -49.047 bonds (distance) P-C4' energy: -55.733 flat angles C4'-P-C4' energy: -62.319 flat angles P-C4'-P energy: -34.682 tors. eta vs tors. theta energy: -73.971 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -1022.180462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1022.180462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -858.730462 (E_RNA) where: Base-Base interactions energy: -593.819 where: short stacking energy: -244.593 Base-Backbone interact. energy: 1.493 local terms energy: -266.404538 where: bonds (distance) C4'-P energy: -47.415 bonds (distance) P-C4' energy: -53.849 flat angles C4'-P-C4' energy: -58.455 flat angles P-C4'-P energy: -43.461 tors. eta vs tors. theta energy: -63.224 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -1011.342154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.342154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -846.092154 (E_RNA) where: Base-Base interactions energy: -573.445 where: short stacking energy: -219.025 Base-Backbone interact. energy: -1.345 local terms energy: -271.302154 where: bonds (distance) C4'-P energy: -50.465 bonds (distance) P-C4' energy: -54.725 flat angles C4'-P-C4' energy: -64.979 flat angles P-C4'-P energy: -41.209 tors. eta vs tors. theta energy: -59.924 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -945.029317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.029317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.979317 (E_RNA) where: Base-Base interactions energy: -548.252 where: short stacking energy: -207.929 Base-Backbone interact. energy: 0.151 local terms energy: -238.878570 where: bonds (distance) C4'-P energy: -44.257 bonds (distance) P-C4' energy: -52.172 flat angles C4'-P-C4' energy: -51.623 flat angles P-C4'-P energy: -34.411 tors. eta vs tors. theta energy: -56.416 Dist. restrs. and SS energy: -181.800 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -940.334083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -940.334083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.884083 (E_RNA) where: Base-Base interactions energy: -563.495 where: short stacking energy: -212.897 Base-Backbone interact. energy: -1.348 local terms energy: -212.041358 where: bonds (distance) C4'-P energy: -45.786 bonds (distance) P-C4' energy: -41.845 flat angles C4'-P-C4' energy: -50.070 flat angles P-C4'-P energy: -29.568 tors. eta vs tors. theta energy: -44.772 Dist. restrs. and SS energy: -187.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -696.148159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.148159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.698159 (E_RNA) where: Base-Base interactions energy: -404.218 where: short stacking energy: -167.234 Base-Backbone interact. energy: 0.307 local terms energy: -191.786938 where: bonds (distance) C4'-P energy: -56.683 bonds (distance) P-C4' energy: -42.113 flat angles C4'-P-C4' energy: -45.619 flat angles P-C4'-P energy: -28.761 tors. eta vs tors. theta energy: -18.610 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -1213.951537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1213.951537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1045.101537 (E_RNA) where: Base-Base interactions energy: -715.989 where: short stacking energy: -302.816 Base-Backbone interact. energy: -2.272 local terms energy: -326.840545 where: bonds (distance) C4'-P energy: -65.986 bonds (distance) P-C4' energy: -58.928 flat angles C4'-P-C4' energy: -61.524 flat angles P-C4'-P energy: -51.006 tors. eta vs tors. theta energy: -89.397 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -1154.945810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1154.945810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.295810 (E_RNA) where: Base-Base interactions energy: -680.341 where: short stacking energy: -282.460 Base-Backbone interact. energy: -0.932 local terms energy: -303.023219 where: bonds (distance) C4'-P energy: -55.235 bonds (distance) P-C4' energy: -53.569 flat angles C4'-P-C4' energy: -65.210 flat angles P-C4'-P energy: -49.344 tors. eta vs tors. theta energy: -79.666 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -1183.096959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1183.096959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1012.446959 (E_RNA) where: Base-Base interactions energy: -707.633 where: short stacking energy: -308.578 Base-Backbone interact. energy: -3.225 local terms energy: -301.588367 where: bonds (distance) C4'-P energy: -57.354 bonds (distance) P-C4' energy: -51.314 flat angles C4'-P-C4' energy: -70.489 flat angles P-C4'-P energy: -42.154 tors. eta vs tors. theta energy: -80.278 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -1149.103876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1149.103876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.453876 (E_RNA) where: Base-Base interactions energy: -683.889 where: short stacking energy: -281.679 Base-Backbone interact. energy: -1.017 local terms energy: -293.547887 where: bonds (distance) C4'-P energy: -58.233 bonds (distance) P-C4' energy: -63.437 flat angles C4'-P-C4' energy: -60.103 flat angles P-C4'-P energy: -35.711 tors. eta vs tors. theta energy: -76.064 Dist. restrs. and SS energy: -194.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -1110.564544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1110.564544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -941.714544 (E_RNA) where: Base-Base interactions energy: -659.409 where: short stacking energy: -255.469 Base-Backbone interact. energy: 0.136 local terms energy: -282.440822 where: bonds (distance) C4'-P energy: -47.424 bonds (distance) P-C4' energy: -52.277 flat angles C4'-P-C4' energy: -66.051 flat angles P-C4'-P energy: -42.263 tors. eta vs tors. theta energy: -74.426 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -1024.167264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1024.167264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.317264 (E_RNA) where: Base-Base interactions energy: -598.597 where: short stacking energy: -226.092 Base-Backbone interact. energy: -1.371 local terms energy: -255.349543 where: bonds (distance) C4'-P energy: -50.322 bonds (distance) P-C4' energy: -56.165 flat angles C4'-P-C4' energy: -58.732 flat angles P-C4'-P energy: -35.072 tors. eta vs tors. theta energy: -55.058 Dist. restrs. and SS energy: -192.600 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -1006.918243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.918243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.668243 (E_RNA) where: Base-Base interactions energy: -594.903 where: short stacking energy: -232.273 Base-Backbone interact. energy: 2.481 local terms energy: -249.246795 where: bonds (distance) C4'-P energy: -38.085 bonds (distance) P-C4' energy: -44.094 flat angles C4'-P-C4' energy: -63.072 flat angles P-C4'-P energy: -42.294 tors. eta vs tors. theta energy: -61.701 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -970.153795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -970.153795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -804.903795 (E_RNA) where: Base-Base interactions energy: -548.202 where: short stacking energy: -229.805 Base-Backbone interact. energy: -1.031 local terms energy: -255.670656 where: bonds (distance) C4'-P energy: -49.008 bonds (distance) P-C4' energy: -61.568 flat angles C4'-P-C4' energy: -56.259 flat angles P-C4'-P energy: -34.658 tors. eta vs tors. theta energy: -54.177 Dist. restrs. and SS energy: -189.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -923.131256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -923.131256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.881256 (E_RNA) where: Base-Base interactions energy: -529.577 where: short stacking energy: -198.848 Base-Backbone interact. energy: -1.445 local terms energy: -244.858583 where: bonds (distance) C4'-P energy: -52.975 bonds (distance) P-C4' energy: -59.580 flat angles C4'-P-C4' energy: -57.085 flat angles P-C4'-P energy: -30.149 tors. eta vs tors. theta energy: -45.070 Dist. restrs. and SS energy: -171.000 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -684.624213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.624213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.974213 (E_RNA) where: Base-Base interactions energy: -395.115 where: short stacking energy: -156.826 Base-Backbone interact. energy: -0.459 local terms energy: -190.400638 where: bonds (distance) C4'-P energy: -42.745 bonds (distance) P-C4' energy: -51.817 flat angles C4'-P-C4' energy: -54.036 flat angles P-C4'-P energy: -18.314 tors. eta vs tors. theta energy: -23.489 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 23.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 8 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 9346254 moves confirmed later: 10258344 all moves confirmed: 19604598 percent of confirmed moves: 12.252874 current total energy: -1176.947465 recalc. total energy: -1176.947465 replica 1 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 13737414 moves confirmed later: 16101958 all moves confirmed: 29839372 percent of confirmed moves: 18.649607 current total energy: -1086.031227 recalc. total energy: -1086.031227 replica 2 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 11532183 moves confirmed later: 13014003 all moves confirmed: 24546186 percent of confirmed moves: 15.341366 current total energy: -1106.476044 recalc. total energy: -1106.476044 replica 4 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 10766717 moves confirmed later: 12065248 all moves confirmed: 22831965 percent of confirmed moves: 14.269978 current total energy: -1058.324276 recalc. total energy: -1058.324276 replica 6 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 11440163 moves confirmed later: 12994139 all moves confirmed: 24434302 percent of confirmed moves: 15.271439 current total energy: -988.309955 recalc. total energy: -988.309955 replica 5 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 10840621 moves confirmed later: 12228617 all moves confirmed: 23069238 percent of confirmed moves: 14.418274 current total energy: -997.422384 recalc. total energy: -997.422384 replica 3 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 14310340 moves confirmed later: 16831178 all moves confirmed: 31141518 percent of confirmed moves: 19.463449 current total energy: -906.203367 recalc. total energy: -906.203367 replica 7 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 10789732 moves confirmed later: 12158151 all moves confirmed: 22947883 percent of confirmed moves: 14.342427 current total energy: -881.557363 recalc. total energy: -881.557363 replica 10 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 10766334 moves confirmed later: 12122728 all moves confirmed: 22889062 percent of confirmed moves: 14.305664 current total energy: -868.710219 recalc. total energy: -868.710219 replica 9 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 14060505 moves confirmed later: 16506056 all moves confirmed: 30566561 percent of confirmed moves: 19.104101 current total energy: -577.791590 recalc. total energy: -577.791590 out arg RESULTS//1/chem_pro_restr-129ce529_01 Time of doing 1600000 iterations: 26382.671 seconds