SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa: 1 curr_seq: _AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...............(((((......(((...........)))......))))).(((((....(((((....))))))))))....._ nucl1: 28, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 27, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 26, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 19, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 18, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 17, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 16, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 15, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 68, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 67, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 66, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 65, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 64, chain1: 0, <---> nucl2: 77, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 77 nucl1: 59, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 58, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 57, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 56, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 55, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 55, chainIndex_2: 0, nuclIndex_2: 82 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa: 1 curr_seq: _AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...............(((((......(((...........)))......))))).(((((....(((((....))))))))))....._ nucl1: 28, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 27, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 26, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 19, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 18, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 17, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 16, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 15, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 68, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 67, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 66, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 65, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 64, chain1: 0, <---> nucl2: 77, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 77 nucl1: 59, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 58, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 57, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 56, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 55, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 55, chainIndex_2: 0, nuclIndex_2: 82 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa: 1 curr_seq: _AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...............(((((......(((...........)))......))))).(((((....(((((....))))))))))....._ nucl1: 28, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 27, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 26, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 19, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 18, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 17, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 16, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 15, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 68, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 67, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 66, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 65, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 64, chain1: 0, <---> nucl2: 77, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 77 nucl1: 59, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 58, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 57, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 56, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 55, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 55, chainIndex_2: 0, nuclIndex_2: 82 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa: 1 curr_seq: _AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...............(((((......(((...........)))......))))).(((((....(((((....))))))))))....._ nucl1: 28, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 27, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 26, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 19, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 18, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 17, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 16, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 15, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 68, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 67, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 66, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 65, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 64, chain1: 0, <---> nucl2: 77, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 77 nucl1: 59, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 58, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 57, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 56, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 55, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 55, chainIndex_2: 0, nuclIndex_2: 82 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa: 1 curr_seq: _AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...............(((((......(((...........)))......))))).(((((....(((((....))))))))))....._ nucl1: 28, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 27, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 26, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 19, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 18, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 17, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 16, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 15, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 68, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 67, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 66, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 65, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 64, chain1: 0, <---> nucl2: 77, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 77 nucl1: 59, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 58, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 57, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 56, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 55, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 55, chainIndex_2: 0, nuclIndex_2: 82 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa: 1 curr_seq: _AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...............(((((......(((...........)))......))))).(((((....(((((....))))))))))....._ nucl1: 28, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 27, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 26, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 19, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 18, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 17, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 16, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 15, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 68, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 67, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 66, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 65, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 64, chain1: 0, <---> nucl2: 77, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 77 nucl1: 59, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 58, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 57, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 56, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 55, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 55, chainIndex_2: 0, nuclIndex_2: 82 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa: 1 curr_seq: _AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...............(((((......(((...........)))......))))).(((((....(((((....))))))))))....._ nucl1: 28, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 27, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 26, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 19, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 18, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 17, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 16, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 15, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 68, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 67, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 66, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 65, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 64, chain1: 0, <---> nucl2: 77, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 77 nucl1: 59, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 58, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 57, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 56, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 55, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 55, chainIndex_2: 0, nuclIndex_2: 82 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa: 1 curr_seq: _AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...............(((((......(((...........)))......))))).(((((....(((((....))))))))))....._ nucl1: 28, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 27, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 26, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 19, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 18, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 17, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 16, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 15, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 68, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 67, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 66, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 65, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 64, chain1: 0, <---> nucl2: 77, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 77 nucl1: 59, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 58, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 57, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 56, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 55, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 55, chainIndex_2: 0, nuclIndex_2: 82 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa: 1 curr_seq: _AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...............(((((......(((...........)))......))))).(((((....(((((....))))))))))....._ nucl1: 28, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 27, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 26, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 19, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 18, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 17, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 16, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 15, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 68, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 67, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 66, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 65, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 64, chain1: 0, <---> nucl2: 77, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 77 nucl1: 59, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 58, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 57, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 56, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 55, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 55, chainIndex_2: 0, nuclIndex_2: 82 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/VHL_HX5-6a8f7586/inputs/seq.fa: 1 curr_seq: _AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUACCAGCUUAUUCAAUUUCCGCCGUUUGAUUCUCAUGUACAAGUUCCAGAAAUCGCGCUAAUGUACUGCAGAUAGUAAGUGCAAUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...............(((((......(((...........)))......))))).(((((....(((((....))))))))))....._ nucl1: 28, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 27, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 26, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 19, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 18, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 17, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 16, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 15, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 68, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 67, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 66, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 65, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 76 nucl1: 64, chain1: 0, <---> nucl2: 77, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 77 nucl1: 59, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 59, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 58, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 58, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 57, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 57, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 56, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 56, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 55, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 55, chainIndex_2: 0, nuclIndex_2: 82 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -352.686400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.686400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.686400 (E_RNA) where: Base-Base interactions energy: -9.920 where: short stacking energy: -9.920 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -352.686400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.686400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.686400 (E_RNA) where: Base-Base interactions energy: -9.920 where: short stacking energy: -9.920 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -352.686400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.686400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.686400 (E_RNA) where: Base-Base interactions energy: -9.920 where: short stacking energy: -9.920 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -352.686400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.686400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.686400 (E_RNA) where: Base-Base interactions energy: -9.920 where: short stacking energy: -9.920 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -352.686400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.686400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.686400 (E_RNA) where: Base-Base interactions energy: -9.920 where: short stacking energy: -9.920 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -352.686400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.686400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.686400 (E_RNA) where: Base-Base interactions energy: -9.920 where: short stacking energy: -9.920 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -352.686400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.686400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.686400 (E_RNA) where: Base-Base interactions energy: -9.920 where: short stacking energy: -9.920 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -352.686400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.686400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.686400 (E_RNA) where: Base-Base interactions energy: -9.920 where: short stacking energy: -9.920 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -352.686400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.686400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.686400 (E_RNA) where: Base-Base interactions energy: -9.920 where: short stacking energy: -9.920 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -352.686400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.686400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.686400 (E_RNA) where: Base-Base interactions energy: -9.920 where: short stacking energy: -9.920 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -444.869893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.869893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.869893 (E_RNA) where: Base-Base interactions energy: -190.912 where: short stacking energy: -161.400 Base-Backbone interact. energy: 0.603 local terms energy: -254.561662 where: bonds (distance) C4'-P energy: -67.778 bonds (distance) P-C4' energy: -54.938 flat angles C4'-P-C4' energy: -51.271 flat angles P-C4'-P energy: -43.345 tors. eta vs tors. theta energy: -37.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -418.778299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.778299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.778299 (E_RNA) where: Base-Base interactions energy: -176.658 where: short stacking energy: -148.834 Base-Backbone interact. energy: -0.177 local terms energy: -241.943254 where: bonds (distance) C4'-P energy: -48.953 bonds (distance) P-C4' energy: -62.698 flat angles C4'-P-C4' energy: -64.732 flat angles P-C4'-P energy: -36.662 tors. eta vs tors. theta energy: -28.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -393.588967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.588967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.588967 (E_RNA) where: Base-Base interactions energy: -175.326 where: short stacking energy: -141.790 Base-Backbone interact. energy: -0.202 local terms energy: -218.061042 where: bonds (distance) C4'-P energy: -42.901 bonds (distance) P-C4' energy: -58.168 flat angles C4'-P-C4' energy: -65.001 flat angles P-C4'-P energy: -37.318 tors. eta vs tors. theta energy: -14.673 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -371.507321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.507321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.507321 (E_RNA) where: Base-Base interactions energy: -161.910 where: short stacking energy: -159.856 Base-Backbone interact. energy: 0.309 local terms energy: -209.906361 where: bonds (distance) C4'-P energy: -56.004 bonds (distance) P-C4' energy: -47.028 flat angles C4'-P-C4' energy: -49.259 flat angles P-C4'-P energy: -27.452 tors. eta vs tors. theta energy: -30.163 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -356.819026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.819026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.819026 (E_RNA) where: Base-Base interactions energy: -137.655 where: short stacking energy: -107.934 Base-Backbone interact. energy: -0.655 local terms energy: -218.508597 where: bonds (distance) C4'-P energy: -60.611 bonds (distance) P-C4' energy: -48.946 flat angles C4'-P-C4' energy: -54.616 flat angles P-C4'-P energy: -38.369 tors. eta vs tors. theta energy: -15.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -359.351296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.351296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.351296 (E_RNA) where: Base-Base interactions energy: -150.483 where: short stacking energy: -129.707 Base-Backbone interact. energy: -0.078 local terms energy: -208.790276 where: bonds (distance) C4'-P energy: -54.552 bonds (distance) P-C4' energy: -53.877 flat angles C4'-P-C4' energy: -49.679 flat angles P-C4'-P energy: -28.495 tors. eta vs tors. theta energy: -22.187 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -354.006221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.006221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.006221 (E_RNA) where: Base-Base interactions energy: -22.984 where: short stacking energy: -22.984 Base-Backbone interact. energy: -0.000 local terms energy: -331.021805 where: bonds (distance) C4'-P energy: -82.129 bonds (distance) P-C4' energy: -73.692 flat angles C4'-P-C4' energy: -63.931 flat angles P-C4'-P energy: -72.447 tors. eta vs tors. theta energy: -38.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -352.537892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.537892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.537892 (E_RNA) where: Base-Base interactions energy: -12.122 where: short stacking energy: -12.122 Base-Backbone interact. energy: -0.000 local terms energy: -340.415638 where: bonds (distance) C4'-P energy: -84.294 bonds (distance) P-C4' energy: -79.363 flat angles C4'-P-C4' energy: -63.884 flat angles P-C4'-P energy: -73.787 tors. eta vs tors. theta energy: -39.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -352.851524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.851524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.851524 (E_RNA) where: Base-Base interactions energy: -20.799 where: short stacking energy: -20.799 Base-Backbone interact. energy: -0.000 local terms energy: -332.052621 where: bonds (distance) C4'-P energy: -83.276 bonds (distance) P-C4' energy: -73.456 flat angles C4'-P-C4' energy: -63.579 flat angles P-C4'-P energy: -72.668 tors. eta vs tors. theta energy: -39.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -352.223565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.223565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.223565 (E_RNA) where: Base-Base interactions energy: -12.865 where: short stacking energy: -12.865 Base-Backbone interact. energy: -0.000 local terms energy: -339.358834 where: bonds (distance) C4'-P energy: -83.561 bonds (distance) P-C4' energy: -79.363 flat angles C4'-P-C4' energy: -63.561 flat angles P-C4'-P energy: -73.787 tors. eta vs tors. theta energy: -39.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -479.102804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.102804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.102804 (E_RNA) where: Base-Base interactions energy: -222.196 where: short stacking energy: -172.725 Base-Backbone interact. energy: 0.360 local terms energy: -257.266423 where: bonds (distance) C4'-P energy: -54.158 bonds (distance) P-C4' energy: -53.306 flat angles C4'-P-C4' energy: -61.353 flat angles P-C4'-P energy: -40.439 tors. eta vs tors. theta energy: -48.011 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -489.407641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.407641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.607641 (E_RNA) where: Base-Base interactions energy: -217.453 where: short stacking energy: -197.707 Base-Backbone interact. energy: -0.236 local terms energy: -269.918622 where: bonds (distance) C4'-P energy: -57.283 bonds (distance) P-C4' energy: -55.943 flat angles C4'-P-C4' energy: -61.534 flat angles P-C4'-P energy: -43.586 tors. eta vs tors. theta energy: -51.572 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -454.110980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.110980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.710980 (E_RNA) where: Base-Base interactions energy: -208.696 where: short stacking energy: -155.965 Base-Backbone interact. energy: -0.302 local terms energy: -230.712293 where: bonds (distance) C4'-P energy: -58.741 bonds (distance) P-C4' energy: -53.881 flat angles C4'-P-C4' energy: -46.125 flat angles P-C4'-P energy: -35.927 tors. eta vs tors. theta energy: -36.037 Dist. restrs. and SS energy: -14.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -370.745532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.745532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.745532 (E_RNA) where: Base-Base interactions energy: -150.231 where: short stacking energy: -116.750 Base-Backbone interact. energy: -1.209 local terms energy: -219.305140 where: bonds (distance) C4'-P energy: -54.104 bonds (distance) P-C4' energy: -57.811 flat angles C4'-P-C4' energy: -56.572 flat angles P-C4'-P energy: -33.358 tors. eta vs tors. theta energy: -17.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -389.385689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.385689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.185689 (E_RNA) where: Base-Base interactions energy: -180.356 where: short stacking energy: -124.313 Base-Backbone interact. energy: -1.937 local terms energy: -199.892229 where: bonds (distance) C4'-P energy: -51.110 bonds (distance) P-C4' energy: -53.118 flat angles C4'-P-C4' energy: -31.719 flat angles P-C4'-P energy: -38.397 tors. eta vs tors. theta energy: -25.548 Dist. restrs. and SS energy: -7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -358.481346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.481346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.481346 (E_RNA) where: Base-Base interactions energy: -176.139 where: short stacking energy: -105.647 Base-Backbone interact. energy: 0.343 local terms energy: -182.685834 where: bonds (distance) C4'-P energy: -41.287 bonds (distance) P-C4' energy: -50.984 flat angles C4'-P-C4' energy: -48.913 flat angles P-C4'-P energy: -32.482 tors. eta vs tors. theta energy: -9.020 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -398.539999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.539999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.939999 (E_RNA) where: Base-Base interactions energy: -209.571 where: short stacking energy: -108.963 Base-Backbone interact. energy: -0.979 local terms energy: -175.390555 where: bonds (distance) C4'-P energy: -50.571 bonds (distance) P-C4' energy: -49.172 flat angles C4'-P-C4' energy: -42.024 flat angles P-C4'-P energy: -21.267 tors. eta vs tors. theta energy: -12.357 Dist. restrs. and SS energy: -12.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -383.370581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.370581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.970581 (E_RNA) where: Base-Base interactions energy: -175.533 where: short stacking energy: -102.286 Base-Backbone interact. energy: 0.106 local terms energy: -175.542624 where: bonds (distance) C4'-P energy: -55.634 bonds (distance) P-C4' energy: -37.909 flat angles C4'-P-C4' energy: -41.216 flat angles P-C4'-P energy: -29.527 tors. eta vs tors. theta energy: -11.257 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -373.790720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.790720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.590720 (E_RNA) where: Base-Base interactions energy: -161.499 where: short stacking energy: -96.346 Base-Backbone interact. energy: 1.679 local terms energy: -170.770362 where: bonds (distance) C4'-P energy: -41.820 bonds (distance) P-C4' energy: -55.574 flat angles C4'-P-C4' energy: -40.553 flat angles P-C4'-P energy: -25.078 tors. eta vs tors. theta energy: -7.745 Dist. restrs. and SS energy: -43.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -244.030232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.030232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.830232 (E_RNA) where: Base-Base interactions energy: -99.073 where: short stacking energy: -65.276 Base-Backbone interact. energy: 0.727 local terms energy: -138.484577 where: bonds (distance) C4'-P energy: -46.219 bonds (distance) P-C4' energy: -49.211 flat angles C4'-P-C4' energy: -35.835 flat angles P-C4'-P energy: -20.233 tors. eta vs tors. theta energy: 13.013 Dist. restrs. and SS energy: -7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -540.683433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.683433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.083433 (E_RNA) where: Base-Base interactions energy: -281.809 where: short stacking energy: -167.391 Base-Backbone interact. energy: 0.269 local terms energy: -246.544053 where: bonds (distance) C4'-P energy: -52.555 bonds (distance) P-C4' energy: -64.617 flat angles C4'-P-C4' energy: -53.366 flat angles P-C4'-P energy: -33.801 tors. eta vs tors. theta energy: -42.205 Dist. restrs. and SS energy: -12.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -487.619544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.619544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.019544 (E_RNA) where: Base-Base interactions energy: -253.272 where: short stacking energy: -156.646 Base-Backbone interact. energy: -1.547 local terms energy: -229.200808 where: bonds (distance) C4'-P energy: -55.558 bonds (distance) P-C4' energy: -48.808 flat angles C4'-P-C4' energy: -54.997 flat angles P-C4'-P energy: -35.143 tors. eta vs tors. theta energy: -34.695 Dist. restrs. and SS energy: -3.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -470.839785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.839785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.039785 (E_RNA) where: Base-Base interactions energy: -219.899 where: short stacking energy: -155.914 Base-Backbone interact. energy: -0.534 local terms energy: -221.606815 where: bonds (distance) C4'-P energy: -47.934 bonds (distance) P-C4' energy: -57.110 flat angles C4'-P-C4' energy: -52.331 flat angles P-C4'-P energy: -35.524 tors. eta vs tors. theta energy: -28.708 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -382.913842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.913842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.313842 (E_RNA) where: Base-Base interactions energy: -156.810 where: short stacking energy: -122.011 Base-Backbone interact. energy: -2.084 local terms energy: -211.419830 where: bonds (distance) C4'-P energy: -57.511 bonds (distance) P-C4' energy: -59.462 flat angles C4'-P-C4' energy: -52.031 flat angles P-C4'-P energy: -26.505 tors. eta vs tors. theta energy: -15.910 Dist. restrs. and SS energy: -12.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -378.407762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.407762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.807762 (E_RNA) where: Base-Base interactions energy: -158.607 where: short stacking energy: -119.215 Base-Backbone interact. energy: -1.735 local terms energy: -196.465907 where: bonds (distance) C4'-P energy: -49.446 bonds (distance) P-C4' energy: -53.227 flat angles C4'-P-C4' energy: -46.392 flat angles P-C4'-P energy: -33.962 tors. eta vs tors. theta energy: -13.440 Dist. restrs. and SS energy: -21.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -398.639055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.639055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.639055 (E_RNA) where: Base-Base interactions energy: -205.567 where: short stacking energy: -135.516 Base-Backbone interact. energy: -0.142 local terms energy: -192.929917 where: bonds (distance) C4'-P energy: -39.309 bonds (distance) P-C4' energy: -51.523 flat angles C4'-P-C4' energy: -50.304 flat angles P-C4'-P energy: -31.527 tors. eta vs tors. theta energy: -20.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -436.559160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.559160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.959160 (E_RNA) where: Base-Base interactions energy: -218.753 where: short stacking energy: -113.464 Base-Backbone interact. energy: -0.288 local terms energy: -177.918327 where: bonds (distance) C4'-P energy: -38.196 bonds (distance) P-C4' energy: -56.910 flat angles C4'-P-C4' energy: -57.624 flat angles P-C4'-P energy: -21.359 tors. eta vs tors. theta energy: -3.829 Dist. restrs. and SS energy: -39.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -341.728626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.728626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.528626 (E_RNA) where: Base-Base interactions energy: -177.334 where: short stacking energy: -88.840 Base-Backbone interact. energy: -0.984 local terms energy: -156.210080 where: bonds (distance) C4'-P energy: -41.554 bonds (distance) P-C4' energy: -46.332 flat angles C4'-P-C4' energy: -42.450 flat angles P-C4'-P energy: -30.027 tors. eta vs tors. theta energy: 4.153 Dist. restrs. and SS energy: -7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -450.859742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.859742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.459742 (E_RNA) where: Base-Base interactions energy: -214.601 where: short stacking energy: -101.547 Base-Backbone interact. energy: -0.003 local terms energy: -167.855553 where: bonds (distance) C4'-P energy: -46.434 bonds (distance) P-C4' energy: -41.019 flat angles C4'-P-C4' energy: -42.786 flat angles P-C4'-P energy: -27.477 tors. eta vs tors. theta energy: -10.140 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -381.678763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.678763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.478763 (E_RNA) where: Base-Base interactions energy: -168.196 where: short stacking energy: -92.747 Base-Backbone interact. energy: 4.102 local terms energy: -174.385012 where: bonds (distance) C4'-P energy: -49.516 bonds (distance) P-C4' energy: -45.170 flat angles C4'-P-C4' energy: -43.944 flat angles P-C4'-P energy: -26.350 tors. eta vs tors. theta energy: -9.405 Dist. restrs. and SS energy: -43.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -557.275361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.275361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.875361 (E_RNA) where: Base-Base interactions energy: -299.721 where: short stacking energy: -161.953 Base-Backbone interact. energy: -0.510 local terms energy: -242.644590 where: bonds (distance) C4'-P energy: -54.580 bonds (distance) P-C4' energy: -57.570 flat angles C4'-P-C4' energy: -59.005 flat angles P-C4'-P energy: -39.956 tors. eta vs tors. theta energy: -31.533 Dist. restrs. and SS energy: -14.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -509.143075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.143075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.343075 (E_RNA) where: Base-Base interactions energy: -247.721 where: short stacking energy: -165.010 Base-Backbone interact. energy: -1.526 local terms energy: -258.095585 where: bonds (distance) C4'-P energy: -55.430 bonds (distance) P-C4' energy: -60.800 flat angles C4'-P-C4' energy: -60.360 flat angles P-C4'-P energy: -38.280 tors. eta vs tors. theta energy: -43.226 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -496.699507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.699507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.699507 (E_RNA) where: Base-Base interactions energy: -240.870 where: short stacking energy: -149.278 Base-Backbone interact. energy: -0.937 local terms energy: -227.892478 where: bonds (distance) C4'-P energy: -61.192 bonds (distance) P-C4' energy: -53.420 flat angles C4'-P-C4' energy: -51.769 flat angles P-C4'-P energy: -32.177 tors. eta vs tors. theta energy: -29.335 Dist. restrs. and SS energy: -27.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -425.508730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.508730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.908730 (E_RNA) where: Base-Base interactions energy: -200.486 where: short stacking energy: -152.774 Base-Backbone interact. energy: 0.189 local terms energy: -212.611961 where: bonds (distance) C4'-P energy: -49.116 bonds (distance) P-C4' energy: -57.492 flat angles C4'-P-C4' energy: -49.497 flat angles P-C4'-P energy: -30.596 tors. eta vs tors. theta energy: -25.911 Dist. restrs. and SS energy: -12.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -430.096497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.096497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.296497 (E_RNA) where: Base-Base interactions energy: -200.025 where: short stacking energy: -132.166 Base-Backbone interact. energy: -0.585 local terms energy: -209.685958 where: bonds (distance) C4'-P energy: -45.091 bonds (distance) P-C4' energy: -55.736 flat angles C4'-P-C4' energy: -52.218 flat angles P-C4'-P energy: -40.003 tors. eta vs tors. theta energy: -16.638 Dist. restrs. and SS energy: -19.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -376.305882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.305882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.305882 (E_RNA) where: Base-Base interactions energy: -192.842 where: short stacking energy: -124.553 Base-Backbone interact. energy: -0.658 local terms energy: -182.805335 where: bonds (distance) C4'-P energy: -42.603 bonds (distance) P-C4' energy: -49.057 flat angles C4'-P-C4' energy: -43.536 flat angles P-C4'-P energy: -30.625 tors. eta vs tors. theta energy: -16.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -442.860403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.860403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.060403 (E_RNA) where: Base-Base interactions energy: -200.565 where: short stacking energy: -104.379 Base-Backbone interact. energy: 0.143 local terms energy: -195.637946 where: bonds (distance) C4'-P energy: -44.502 bonds (distance) P-C4' energy: -57.460 flat angles C4'-P-C4' energy: -44.679 flat angles P-C4'-P energy: -34.234 tors. eta vs tors. theta energy: -14.763 Dist. restrs. and SS energy: -46.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -519.559128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.559128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.359128 (E_RNA) where: Base-Base interactions energy: -244.601 where: short stacking energy: -123.564 Base-Backbone interact. energy: -0.557 local terms energy: -204.201632 where: bonds (distance) C4'-P energy: -42.815 bonds (distance) P-C4' energy: -45.706 flat angles C4'-P-C4' energy: -47.297 flat angles P-C4'-P energy: -40.976 tors. eta vs tors. theta energy: -27.408 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -366.957149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.957149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.357149 (E_RNA) where: Base-Base interactions energy: -167.038 where: short stacking energy: -73.909 Base-Backbone interact. energy: 2.066 local terms energy: -144.384215 where: bonds (distance) C4'-P energy: -39.962 bonds (distance) P-C4' energy: -51.318 flat angles C4'-P-C4' energy: -27.791 flat angles P-C4'-P energy: -27.907 tors. eta vs tors. theta energy: 2.593 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -484.506055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.506055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.906055 (E_RNA) where: Base-Base interactions energy: -241.059 where: short stacking energy: -95.959 Base-Backbone interact. energy: 2.744 local terms energy: -152.590694 where: bonds (distance) C4'-P energy: -53.529 bonds (distance) P-C4' energy: -28.786 flat angles C4'-P-C4' energy: -29.738 flat angles P-C4'-P energy: -37.517 tors. eta vs tors. theta energy: -3.021 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -605.729913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.729913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.329913 (E_RNA) where: Base-Base interactions energy: -331.925 where: short stacking energy: -165.832 Base-Backbone interact. energy: -1.115 local terms energy: -258.289251 where: bonds (distance) C4'-P energy: -58.604 bonds (distance) P-C4' energy: -65.852 flat angles C4'-P-C4' energy: -56.777 flat angles P-C4'-P energy: -39.563 tors. eta vs tors. theta energy: -37.494 Dist. restrs. and SS energy: -14.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -588.103387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.103387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.903387 (E_RNA) where: Base-Base interactions energy: -349.029 where: short stacking energy: -206.211 Base-Backbone interact. energy: 1.435 local terms energy: -233.309817 where: bonds (distance) C4'-P energy: -45.530 bonds (distance) P-C4' energy: -51.366 flat angles C4'-P-C4' energy: -53.153 flat angles P-C4'-P energy: -35.951 tors. eta vs tors. theta energy: -47.311 Dist. restrs. and SS energy: -7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -595.273725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.273725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.473725 (E_RNA) where: Base-Base interactions energy: -331.958 where: short stacking energy: -193.344 Base-Backbone interact. energy: -0.310 local terms energy: -234.205579 where: bonds (distance) C4'-P energy: -55.440 bonds (distance) P-C4' energy: -52.875 flat angles C4'-P-C4' energy: -49.052 flat angles P-C4'-P energy: -29.136 tors. eta vs tors. theta energy: -47.703 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -460.312437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.312437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.312437 (E_RNA) where: Base-Base interactions energy: -208.207 where: short stacking energy: -130.382 Base-Backbone interact. energy: -0.581 local terms energy: -224.523580 where: bonds (distance) C4'-P energy: -54.408 bonds (distance) P-C4' energy: -47.736 flat angles C4'-P-C4' energy: -58.839 flat angles P-C4'-P energy: -35.513 tors. eta vs tors. theta energy: -28.028 Dist. restrs. and SS energy: -27.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -442.959808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.959808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.159808 (E_RNA) where: Base-Base interactions energy: -217.658 where: short stacking energy: -129.031 Base-Backbone interact. energy: 0.507 local terms energy: -206.009370 where: bonds (distance) C4'-P energy: -47.085 bonds (distance) P-C4' energy: -58.265 flat angles C4'-P-C4' energy: -55.331 flat angles P-C4'-P energy: -21.136 tors. eta vs tors. theta energy: -24.193 Dist. restrs. and SS energy: -19.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -392.200270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.200270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.000270 (E_RNA) where: Base-Base interactions energy: -171.434 where: short stacking energy: -104.792 Base-Backbone interact. energy: -1.540 local terms energy: -212.026813 where: bonds (distance) C4'-P energy: -54.716 bonds (distance) P-C4' energy: -64.303 flat angles C4'-P-C4' energy: -50.215 flat angles P-C4'-P energy: -39.749 tors. eta vs tors. theta energy: -3.044 Dist. restrs. and SS energy: -7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -530.242557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.242557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.842557 (E_RNA) where: Base-Base interactions energy: -268.515 where: short stacking energy: -128.684 Base-Backbone interact. energy: -1.133 local terms energy: -192.193946 where: bonds (distance) C4'-P energy: -45.766 bonds (distance) P-C4' energy: -56.547 flat angles C4'-P-C4' energy: -47.602 flat angles P-C4'-P energy: -28.754 tors. eta vs tors. theta energy: -13.525 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -456.940514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.940514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.340514 (E_RNA) where: Base-Base interactions energy: -231.717 where: short stacking energy: -100.017 Base-Backbone interact. energy: -0.036 local terms energy: -176.587370 where: bonds (distance) C4'-P energy: -50.177 bonds (distance) P-C4' energy: -47.341 flat angles C4'-P-C4' energy: -40.465 flat angles P-C4'-P energy: -26.729 tors. eta vs tors. theta energy: -11.874 Dist. restrs. and SS energy: -48.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -621.100914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.100914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.900914 (E_RNA) where: Base-Base interactions energy: -322.104 where: short stacking energy: -137.438 Base-Backbone interact. energy: -1.660 local terms energy: -182.137137 where: bonds (distance) C4'-P energy: -38.628 bonds (distance) P-C4' energy: -51.092 flat angles C4'-P-C4' energy: -35.783 flat angles P-C4'-P energy: -30.671 tors. eta vs tors. theta energy: -25.963 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -443.027360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.027360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.227360 (E_RNA) where: Base-Base interactions energy: -201.113 where: short stacking energy: -108.156 Base-Backbone interact. energy: -0.226 local terms energy: -176.887854 where: bonds (distance) C4'-P energy: -51.844 bonds (distance) P-C4' energy: -31.466 flat angles C4'-P-C4' energy: -36.208 flat angles P-C4'-P energy: -31.436 tors. eta vs tors. theta energy: -25.934 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -602.388660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.388660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.988660 (E_RNA) where: Base-Base interactions energy: -344.545 where: short stacking energy: -211.511 Base-Backbone interact. energy: 0.082 local terms energy: -243.525503 where: bonds (distance) C4'-P energy: -51.625 bonds (distance) P-C4' energy: -57.610 flat angles C4'-P-C4' energy: -52.757 flat angles P-C4'-P energy: -35.112 tors. eta vs tors. theta energy: -46.422 Dist. restrs. and SS energy: -14.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -582.098924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.098924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.098924 (E_RNA) where: Base-Base interactions energy: -312.690 where: short stacking energy: -177.155 Base-Backbone interact. energy: -1.671 local terms energy: -249.737510 where: bonds (distance) C4'-P energy: -54.333 bonds (distance) P-C4' energy: -57.477 flat angles C4'-P-C4' energy: -46.908 flat angles P-C4'-P energy: -36.968 tors. eta vs tors. theta energy: -54.051 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -597.079188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.079188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.679188 (E_RNA) where: Base-Base interactions energy: -344.970 where: short stacking energy: -174.432 Base-Backbone interact. energy: -1.228 local terms energy: -227.481580 where: bonds (distance) C4'-P energy: -49.242 bonds (distance) P-C4' energy: -48.563 flat angles C4'-P-C4' energy: -50.307 flat angles P-C4'-P energy: -42.464 tors. eta vs tors. theta energy: -36.906 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -460.577237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.577237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.577237 (E_RNA) where: Base-Base interactions energy: -213.675 where: short stacking energy: -118.949 Base-Backbone interact. energy: -0.637 local terms energy: -210.265020 where: bonds (distance) C4'-P energy: -62.322 bonds (distance) P-C4' energy: -57.108 flat angles C4'-P-C4' energy: -43.798 flat angles P-C4'-P energy: -24.636 tors. eta vs tors. theta energy: -22.401 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -439.061209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.061209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.461209 (E_RNA) where: Base-Base interactions energy: -197.948 where: short stacking energy: -125.000 Base-Backbone interact. energy: 0.679 local terms energy: -220.192724 where: bonds (distance) C4'-P energy: -48.205 bonds (distance) P-C4' energy: -61.229 flat angles C4'-P-C4' energy: -52.985 flat angles P-C4'-P energy: -37.061 tors. eta vs tors. theta energy: -20.712 Dist. restrs. and SS energy: -21.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -570.962470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.962470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.562470 (E_RNA) where: Base-Base interactions energy: -270.017 where: short stacking energy: -124.984 Base-Backbone interact. energy: -0.131 local terms energy: -223.413887 where: bonds (distance) C4'-P energy: -49.008 bonds (distance) P-C4' energy: -57.001 flat angles C4'-P-C4' energy: -48.244 flat angles P-C4'-P energy: -39.177 tors. eta vs tors. theta energy: -29.983 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -360.530142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.530142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.530142 (E_RNA) where: Base-Base interactions energy: -172.797 where: short stacking energy: -101.675 Base-Backbone interact. energy: -0.655 local terms energy: -187.077678 where: bonds (distance) C4'-P energy: -57.079 bonds (distance) P-C4' energy: -48.446 flat angles C4'-P-C4' energy: -50.140 flat angles P-C4'-P energy: -29.979 tors. eta vs tors. theta energy: -1.434 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -711.630165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.630165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.630165 (E_RNA) where: Base-Base interactions energy: -389.217 where: short stacking energy: -175.403 Base-Backbone interact. energy: -1.053 local terms energy: -195.360805 where: bonds (distance) C4'-P energy: -40.342 bonds (distance) P-C4' energy: -34.572 flat angles C4'-P-C4' energy: -44.342 flat angles P-C4'-P energy: -29.787 tors. eta vs tors. theta energy: -46.320 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -443.492650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.492650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.892650 (E_RNA) where: Base-Base interactions energy: -218.488 where: short stacking energy: -88.026 Base-Backbone interact. energy: 1.806 local terms energy: -169.210120 where: bonds (distance) C4'-P energy: -52.044 bonds (distance) P-C4' energy: -47.745 flat angles C4'-P-C4' energy: -45.256 flat angles P-C4'-P energy: -27.539 tors. eta vs tors. theta energy: 3.374 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -486.146293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.146293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.146293 (E_RNA) where: Base-Base interactions energy: -232.868 where: short stacking energy: -113.550 Base-Backbone interact. energy: -1.064 local terms energy: -171.214898 where: bonds (distance) C4'-P energy: -45.041 bonds (distance) P-C4' energy: -49.719 flat angles C4'-P-C4' energy: -38.463 flat angles P-C4'-P energy: -28.382 tors. eta vs tors. theta energy: -9.610 Dist. restrs. and SS energy: -81.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -605.459504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.459504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.659504 (E_RNA) where: Base-Base interactions energy: -354.829 where: short stacking energy: -189.179 Base-Backbone interact. energy: 0.273 local terms energy: -231.102910 where: bonds (distance) C4'-P energy: -54.764 bonds (distance) P-C4' energy: -47.633 flat angles C4'-P-C4' energy: -50.989 flat angles P-C4'-P energy: -39.496 tors. eta vs tors. theta energy: -38.221 Dist. restrs. and SS energy: -19.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -555.667869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.667869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.267869 (E_RNA) where: Base-Base interactions energy: -292.275 where: short stacking energy: -187.043 Base-Backbone interact. energy: -2.834 local terms energy: -246.158372 where: bonds (distance) C4'-P energy: -46.785 bonds (distance) P-C4' energy: -58.630 flat angles C4'-P-C4' energy: -59.423 flat angles P-C4'-P energy: -32.601 tors. eta vs tors. theta energy: -48.718 Dist. restrs. and SS energy: -14.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -611.396520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.396520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.996520 (E_RNA) where: Base-Base interactions energy: -362.288 where: short stacking energy: -162.726 Base-Backbone interact. energy: -1.500 local terms energy: -224.209251 where: bonds (distance) C4'-P energy: -46.642 bonds (distance) P-C4' energy: -59.345 flat angles C4'-P-C4' energy: -50.599 flat angles P-C4'-P energy: -33.714 tors. eta vs tors. theta energy: -33.911 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -551.714765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.714765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.914765 (E_RNA) where: Base-Base interactions energy: -293.270 where: short stacking energy: -151.422 Base-Backbone interact. energy: -1.198 local terms energy: -210.446067 where: bonds (distance) C4'-P energy: -56.056 bonds (distance) P-C4' energy: -56.037 flat angles C4'-P-C4' energy: -46.810 flat angles P-C4'-P energy: -22.617 tors. eta vs tors. theta energy: -28.927 Dist. restrs. and SS energy: -46.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -621.802960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.802960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.802960 (E_RNA) where: Base-Base interactions energy: -323.135 where: short stacking energy: -174.320 Base-Backbone interact. energy: -2.182 local terms energy: -224.485172 where: bonds (distance) C4'-P energy: -61.312 bonds (distance) P-C4' energy: -40.035 flat angles C4'-P-C4' energy: -47.098 flat angles P-C4'-P energy: -32.468 tors. eta vs tors. theta energy: -43.573 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -434.316942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.316942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.316942 (E_RNA) where: Base-Base interactions energy: -192.148 where: short stacking energy: -120.174 Base-Backbone interact. energy: -1.109 local terms energy: -205.059953 where: bonds (distance) C4'-P energy: -54.364 bonds (distance) P-C4' energy: -42.989 flat angles C4'-P-C4' energy: -54.435 flat angles P-C4'-P energy: -30.691 tors. eta vs tors. theta energy: -22.581 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -746.181311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.181311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.381311 (E_RNA) where: Base-Base interactions energy: -396.575 where: short stacking energy: -181.740 Base-Backbone interact. energy: 0.333 local terms energy: -222.139545 where: bonds (distance) C4'-P energy: -42.946 bonds (distance) P-C4' energy: -56.401 flat angles C4'-P-C4' energy: -59.057 flat angles P-C4'-P energy: -21.862 tors. eta vs tors. theta energy: -41.873 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -437.618110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.618110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.218110 (E_RNA) where: Base-Base interactions energy: -225.633 where: short stacking energy: -99.988 Base-Backbone interact. energy: -1.870 local terms energy: -168.715463 where: bonds (distance) C4'-P energy: -56.797 bonds (distance) P-C4' energy: -32.400 flat angles C4'-P-C4' energy: -47.544 flat angles P-C4'-P energy: -24.835 tors. eta vs tors. theta energy: -7.140 Dist. restrs. and SS energy: -41.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -529.486394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.486394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.286394 (E_RNA) where: Base-Base interactions energy: -248.564 where: short stacking energy: -132.359 Base-Backbone interact. energy: -0.740 local terms energy: -200.982607 where: bonds (distance) C4'-P energy: -50.495 bonds (distance) P-C4' energy: -41.994 flat angles C4'-P-C4' energy: -49.113 flat angles P-C4'-P energy: -29.175 tors. eta vs tors. theta energy: -30.206 Dist. restrs. and SS energy: -79.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -454.973640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.973640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.173640 (E_RNA) where: Base-Base interactions energy: -224.318 where: short stacking energy: -99.283 Base-Backbone interact. energy: 1.653 local terms energy: -167.509288 where: bonds (distance) C4'-P energy: -41.344 bonds (distance) P-C4' energy: -43.437 flat angles C4'-P-C4' energy: -45.711 flat angles P-C4'-P energy: -32.344 tors. eta vs tors. theta energy: -4.674 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -629.167842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.167842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.167842 (E_RNA) where: Base-Base interactions energy: -354.189 where: short stacking energy: -186.308 Base-Backbone interact. energy: -0.557 local terms energy: -256.421463 where: bonds (distance) C4'-P energy: -56.161 bonds (distance) P-C4' energy: -61.592 flat angles C4'-P-C4' energy: -58.634 flat angles P-C4'-P energy: -40.375 tors. eta vs tors. theta energy: -39.659 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -664.195475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.195475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.595475 (E_RNA) where: Base-Base interactions energy: -408.544 where: short stacking energy: -196.196 Base-Backbone interact. energy: 1.345 local terms energy: -235.395784 where: bonds (distance) C4'-P energy: -50.636 bonds (distance) P-C4' energy: -47.020 flat angles C4'-P-C4' energy: -55.517 flat angles P-C4'-P energy: -33.720 tors. eta vs tors. theta energy: -48.503 Dist. restrs. and SS energy: -21.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -573.492982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.492982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.492982 (E_RNA) where: Base-Base interactions energy: -302.394 where: short stacking energy: -153.644 Base-Backbone interact. energy: -1.311 local terms energy: -233.788665 where: bonds (distance) C4'-P energy: -59.038 bonds (distance) P-C4' energy: -62.702 flat angles C4'-P-C4' energy: -44.208 flat angles P-C4'-P energy: -27.889 tors. eta vs tors. theta energy: -39.951 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -714.865785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.865785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.665785 (E_RNA) where: Base-Base interactions energy: -385.905 where: short stacking energy: -163.761 Base-Backbone interact. energy: 0.582 local terms energy: -232.343094 where: bonds (distance) C4'-P energy: -48.387 bonds (distance) P-C4' energy: -51.537 flat angles C4'-P-C4' energy: -50.983 flat angles P-C4'-P energy: -35.327 tors. eta vs tors. theta energy: -46.109 Dist. restrs. and SS energy: -97.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -553.746478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.746478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.346478 (E_RNA) where: Base-Base interactions energy: -295.068 where: short stacking energy: -146.805 Base-Backbone interact. energy: 3.861 local terms energy: -212.139514 where: bonds (distance) C4'-P energy: -45.856 bonds (distance) P-C4' energy: -61.774 flat angles C4'-P-C4' energy: -48.013 flat angles P-C4'-P energy: -37.942 tors. eta vs tors. theta energy: -18.555 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -798.571620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.571620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.971620 (E_RNA) where: Base-Base interactions energy: -437.693 where: short stacking energy: -186.911 Base-Backbone interact. energy: -1.361 local terms energy: -229.918251 where: bonds (distance) C4'-P energy: -55.894 bonds (distance) P-C4' energy: -48.145 flat angles C4'-P-C4' energy: -46.812 flat angles P-C4'-P energy: -32.518 tors. eta vs tors. theta energy: -46.550 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -463.204299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.204299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.804299 (E_RNA) where: Base-Base interactions energy: -247.786 where: short stacking energy: -131.049 Base-Backbone interact. energy: -0.043 local terms energy: -173.975644 where: bonds (distance) C4'-P energy: -47.740 bonds (distance) P-C4' energy: -40.948 flat angles C4'-P-C4' energy: -42.490 flat angles P-C4'-P energy: -19.545 tors. eta vs tors. theta energy: -23.253 Dist. restrs. and SS energy: -41.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -567.402269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.402269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.802269 (E_RNA) where: Base-Base interactions energy: -274.039 where: short stacking energy: -126.593 Base-Backbone interact. energy: -0.572 local terms energy: -199.190790 where: bonds (distance) C4'-P energy: -49.027 bonds (distance) P-C4' energy: -47.602 flat angles C4'-P-C4' energy: -42.528 flat angles P-C4'-P energy: -26.861 tors. eta vs tors. theta energy: -33.173 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -439.247951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.247951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.047951 (E_RNA) where: Base-Base interactions energy: -221.539 where: short stacking energy: -104.558 Base-Backbone interact. energy: 3.310 local terms energy: -177.818764 where: bonds (distance) C4'-P energy: -51.526 bonds (distance) P-C4' energy: -50.959 flat angles C4'-P-C4' energy: -35.408 flat angles P-C4'-P energy: -34.247 tors. eta vs tors. theta energy: -5.679 Dist. restrs. and SS energy: -43.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -379.814795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.814795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.014795 (E_RNA) where: Base-Base interactions energy: -164.411 where: short stacking energy: -82.781 Base-Backbone interact. energy: -0.775 local terms energy: -158.829053 where: bonds (distance) C4'-P energy: -40.934 bonds (distance) P-C4' energy: -39.116 flat angles C4'-P-C4' energy: -38.509 flat angles P-C4'-P energy: -37.660 tors. eta vs tors. theta energy: -2.610 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -731.995050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.995050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.195050 (E_RNA) where: Base-Base interactions energy: -428.744 where: short stacking energy: -214.137 Base-Backbone interact. energy: -0.691 local terms energy: -273.760197 where: bonds (distance) C4'-P energy: -55.933 bonds (distance) P-C4' energy: -61.683 flat angles C4'-P-C4' energy: -58.112 flat angles P-C4'-P energy: -34.466 tors. eta vs tors. theta energy: -63.567 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -591.367136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.367136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.167136 (E_RNA) where: Base-Base interactions energy: -321.385 where: short stacking energy: -183.613 Base-Backbone interact. energy: -0.779 local terms energy: -253.002798 where: bonds (distance) C4'-P energy: -62.374 bonds (distance) P-C4' energy: -59.614 flat angles C4'-P-C4' energy: -58.240 flat angles P-C4'-P energy: -35.482 tors. eta vs tors. theta energy: -37.291 Dist. restrs. and SS energy: -16.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -740.862428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.862428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.062428 (E_RNA) where: Base-Base interactions energy: -414.640 where: short stacking energy: -199.908 Base-Backbone interact. energy: 2.767 local terms energy: -237.189138 where: bonds (distance) C4'-P energy: -51.094 bonds (distance) P-C4' energy: -38.337 flat angles C4'-P-C4' energy: -63.710 flat angles P-C4'-P energy: -36.575 tors. eta vs tors. theta energy: -47.473 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -558.336934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.336934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.336934 (E_RNA) where: Base-Base interactions energy: -302.007 where: short stacking energy: -166.378 Base-Backbone interact. energy: -3.378 local terms energy: -216.952436 where: bonds (distance) C4'-P energy: -46.269 bonds (distance) P-C4' energy: -63.526 flat angles C4'-P-C4' energy: -39.668 flat angles P-C4'-P energy: -32.057 tors. eta vs tors. theta energy: -35.433 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -829.600205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.600205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.600205 (E_RNA) where: Base-Base interactions energy: -456.034 where: short stacking energy: -205.799 Base-Backbone interact. energy: -0.511 local terms energy: -247.055240 where: bonds (distance) C4'-P energy: -46.200 bonds (distance) P-C4' energy: -58.649 flat angles C4'-P-C4' energy: -52.889 flat angles P-C4'-P energy: -29.864 tors. eta vs tors. theta energy: -59.454 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -552.390660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.390660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.190660 (E_RNA) where: Base-Base interactions energy: -302.862 where: short stacking energy: -148.817 Base-Backbone interact. energy: -0.822 local terms energy: -196.506998 where: bonds (distance) C4'-P energy: -51.151 bonds (distance) P-C4' energy: -46.575 flat angles C4'-P-C4' energy: -39.322 flat angles P-C4'-P energy: -36.018 tors. eta vs tors. theta energy: -23.441 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -611.240906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.240906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.840906 (E_RNA) where: Base-Base interactions energy: -313.191 where: short stacking energy: -123.485 Base-Backbone interact. energy: 1.801 local terms energy: -204.450771 where: bonds (distance) C4'-P energy: -47.720 bonds (distance) P-C4' energy: -44.365 flat angles C4'-P-C4' energy: -50.310 flat angles P-C4'-P energy: -35.371 tors. eta vs tors. theta energy: -26.684 Dist. restrs. and SS energy: -95.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -391.770090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.770090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.770090 (E_RNA) where: Base-Base interactions energy: -179.614 where: short stacking energy: -85.377 Base-Backbone interact. energy: 0.269 local terms energy: -176.425724 where: bonds (distance) C4'-P energy: -53.810 bonds (distance) P-C4' energy: -56.374 flat angles C4'-P-C4' energy: -37.520 flat angles P-C4'-P energy: -24.706 tors. eta vs tors. theta energy: -4.016 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -421.928379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.928379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.328379 (E_RNA) where: Base-Base interactions energy: -220.337 where: short stacking energy: -84.918 Base-Backbone interact. energy: -0.977 local terms energy: -152.013878 where: bonds (distance) C4'-P energy: -47.363 bonds (distance) P-C4' energy: -46.967 flat angles C4'-P-C4' energy: -38.927 flat angles P-C4'-P energy: -22.557 tors. eta vs tors. theta energy: 3.799 Dist. restrs. and SS energy: -48.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -443.471272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.471272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.471272 (E_RNA) where: Base-Base interactions energy: -210.777 where: short stacking energy: -102.505 Base-Backbone interact. energy: 1.532 local terms energy: -162.225651 where: bonds (distance) C4'-P energy: -47.637 bonds (distance) P-C4' energy: -50.725 flat angles C4'-P-C4' energy: -32.679 flat angles P-C4'-P energy: -26.695 tors. eta vs tors. theta energy: -4.491 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -755.325118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.325118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.725118 (E_RNA) where: Base-Base interactions energy: -469.434 where: short stacking energy: -220.024 Base-Backbone interact. energy: 1.021 local terms energy: -256.311376 where: bonds (distance) C4'-P energy: -47.483 bonds (distance) P-C4' energy: -55.736 flat angles C4'-P-C4' energy: -58.962 flat angles P-C4'-P energy: -39.366 tors. eta vs tors. theta energy: -54.765 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -765.925758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.925758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.125758 (E_RNA) where: Base-Base interactions energy: -427.223 where: short stacking energy: -202.281 Base-Backbone interact. energy: 3.930 local terms energy: -250.832041 where: bonds (distance) C4'-P energy: -53.757 bonds (distance) P-C4' energy: -61.169 flat angles C4'-P-C4' energy: -55.174 flat angles P-C4'-P energy: -38.117 tors. eta vs tors. theta energy: -42.614 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -553.609713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.609713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.409713 (E_RNA) where: Base-Base interactions energy: -305.783 where: short stacking energy: -175.737 Base-Backbone interact. energy: -0.876 local terms energy: -239.750380 where: bonds (distance) C4'-P energy: -48.850 bonds (distance) P-C4' energy: -60.149 flat angles C4'-P-C4' energy: -57.605 flat angles P-C4'-P energy: -38.019 tors. eta vs tors. theta energy: -35.128 Dist. restrs. and SS energy: -7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -822.973888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.973888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.773888 (E_RNA) where: Base-Base interactions energy: -460.736 where: short stacking energy: -188.316 Base-Backbone interact. energy: -1.189 local terms energy: -236.848877 where: bonds (distance) C4'-P energy: -49.231 bonds (distance) P-C4' energy: -55.285 flat angles C4'-P-C4' energy: -54.995 flat angles P-C4'-P energy: -28.421 tors. eta vs tors. theta energy: -48.917 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -606.760080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.760080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.160080 (E_RNA) where: Base-Base interactions energy: -346.434 where: short stacking energy: -166.476 Base-Backbone interact. energy: 0.014 local terms energy: -220.740101 where: bonds (distance) C4'-P energy: -47.977 bonds (distance) P-C4' energy: -55.936 flat angles C4'-P-C4' energy: -51.527 flat angles P-C4'-P energy: -30.694 tors. eta vs tors. theta energy: -34.606 Dist. restrs. and SS energy: -39.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -664.451127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.451127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.851127 (E_RNA) where: Base-Base interactions energy: -334.098 where: short stacking energy: -150.326 Base-Backbone interact. energy: 3.908 local terms energy: -231.661285 where: bonds (distance) C4'-P energy: -51.250 bonds (distance) P-C4' energy: -49.319 flat angles C4'-P-C4' energy: -49.360 flat angles P-C4'-P energy: -37.141 tors. eta vs tors. theta energy: -44.590 Dist. restrs. and SS energy: -102.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -547.607888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.607888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.207888 (E_RNA) where: Base-Base interactions energy: -286.597 where: short stacking energy: -141.448 Base-Backbone interact. energy: -0.405 local terms energy: -192.206121 where: bonds (distance) C4'-P energy: -42.018 bonds (distance) P-C4' energy: -52.022 flat angles C4'-P-C4' energy: -39.003 flat angles P-C4'-P energy: -26.612 tors. eta vs tors. theta energy: -32.550 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -476.062718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.062718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.062718 (E_RNA) where: Base-Base interactions energy: -241.027 where: short stacking energy: -120.380 Base-Backbone interact. energy: -0.920 local terms energy: -189.114867 where: bonds (distance) C4'-P energy: -54.957 bonds (distance) P-C4' energy: -51.176 flat angles C4'-P-C4' energy: -33.620 flat angles P-C4'-P energy: -26.111 tors. eta vs tors. theta energy: -23.252 Dist. restrs. and SS energy: -45.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -405.603601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.603601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.003601 (E_RNA) where: Base-Base interactions energy: -176.068 where: short stacking energy: -112.122 Base-Backbone interact. energy: 0.156 local terms energy: -181.091857 where: bonds (distance) C4'-P energy: -48.545 bonds (distance) P-C4' energy: -46.934 flat angles C4'-P-C4' energy: -44.471 flat angles P-C4'-P energy: -35.221 tors. eta vs tors. theta energy: -5.921 Dist. restrs. and SS energy: -48.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -471.649731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.649731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.849731 (E_RNA) where: Base-Base interactions energy: -236.748 where: short stacking energy: -114.815 Base-Backbone interact. energy: -0.514 local terms energy: -160.588456 where: bonds (distance) C4'-P energy: -44.792 bonds (distance) P-C4' energy: -46.513 flat angles C4'-P-C4' energy: -38.029 flat angles P-C4'-P energy: -10.428 tors. eta vs tors. theta energy: -20.827 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -796.321341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -796.321341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.721341 (E_RNA) where: Base-Base interactions energy: -439.498 where: short stacking energy: -207.784 Base-Backbone interact. energy: -0.935 local terms energy: -262.287397 where: bonds (distance) C4'-P energy: -48.478 bonds (distance) P-C4' energy: -59.300 flat angles C4'-P-C4' energy: -61.298 flat angles P-C4'-P energy: -45.697 tors. eta vs tors. theta energy: -47.515 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -758.292149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.292149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.692149 (E_RNA) where: Base-Base interactions energy: -470.596 where: short stacking energy: -232.349 Base-Backbone interact. energy: 1.434 local terms energy: -258.530004 where: bonds (distance) C4'-P energy: -51.857 bonds (distance) P-C4' energy: -55.533 flat angles C4'-P-C4' energy: -57.815 flat angles P-C4'-P energy: -35.516 tors. eta vs tors. theta energy: -57.809 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -878.755124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.755124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.155124 (E_RNA) where: Base-Base interactions energy: -479.040 where: short stacking energy: -209.360 Base-Backbone interact. energy: -1.118 local terms energy: -268.997408 where: bonds (distance) C4'-P energy: -53.078 bonds (distance) P-C4' energy: -60.696 flat angles C4'-P-C4' energy: -57.201 flat angles P-C4'-P energy: -39.992 tors. eta vs tors. theta energy: -58.029 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -523.711552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.711552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.111552 (E_RNA) where: Base-Base interactions energy: -300.421 where: short stacking energy: -148.169 Base-Backbone interact. energy: 0.010 local terms energy: -219.700167 where: bonds (distance) C4'-P energy: -56.237 bonds (distance) P-C4' energy: -56.962 flat angles C4'-P-C4' energy: -46.247 flat angles P-C4'-P energy: -30.745 tors. eta vs tors. theta energy: -29.510 Dist. restrs. and SS energy: -3.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -746.834423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.834423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.634423 (E_RNA) where: Base-Base interactions energy: -414.043 where: short stacking energy: -182.387 Base-Backbone interact. energy: -0.005 local terms energy: -226.586399 where: bonds (distance) C4'-P energy: -44.545 bonds (distance) P-C4' energy: -41.131 flat angles C4'-P-C4' energy: -62.514 flat angles P-C4'-P energy: -36.670 tors. eta vs tors. theta energy: -41.728 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -547.123764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.123764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.723764 (E_RNA) where: Base-Base interactions energy: -297.020 where: short stacking energy: -148.899 Base-Backbone interact. energy: 0.797 local terms energy: -209.500227 where: bonds (distance) C4'-P energy: -48.049 bonds (distance) P-C4' energy: -52.915 flat angles C4'-P-C4' energy: -44.953 flat angles P-C4'-P energy: -31.790 tors. eta vs tors. theta energy: -31.794 Dist. restrs. and SS energy: -41.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -601.408087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.408087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.208087 (E_RNA) where: Base-Base interactions energy: -337.077 where: short stacking energy: -149.914 Base-Backbone interact. energy: 0.636 local terms energy: -194.767027 where: bonds (distance) C4'-P energy: -40.873 bonds (distance) P-C4' energy: -47.821 flat angles C4'-P-C4' energy: -51.975 flat angles P-C4'-P energy: -15.340 tors. eta vs tors. theta energy: -38.758 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -472.794131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.794131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.794131 (E_RNA) where: Base-Base interactions energy: -274.897 where: short stacking energy: -106.248 Base-Backbone interact. energy: -2.200 local terms energy: -150.696815 where: bonds (distance) C4'-P energy: -32.633 bonds (distance) P-C4' energy: -40.675 flat angles C4'-P-C4' energy: -43.279 flat angles P-C4'-P energy: -22.744 tors. eta vs tors. theta energy: -11.366 Dist. restrs. and SS energy: -45.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -480.038943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.038943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.238943 (E_RNA) where: Base-Base interactions energy: -246.221 where: short stacking energy: -104.460 Base-Backbone interact. energy: 0.950 local terms energy: -169.967737 where: bonds (distance) C4'-P energy: -44.482 bonds (distance) P-C4' energy: -54.288 flat angles C4'-P-C4' energy: -37.735 flat angles P-C4'-P energy: -21.425 tors. eta vs tors. theta energy: -12.038 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -475.347322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.347322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.947322 (E_RNA) where: Base-Base interactions energy: -215.440 where: short stacking energy: -94.119 Base-Backbone interact. energy: -1.571 local terms energy: -171.935756 where: bonds (distance) C4'-P energy: -41.628 bonds (distance) P-C4' energy: -46.731 flat angles C4'-P-C4' energy: -45.321 flat angles P-C4'-P energy: -26.346 tors. eta vs tors. theta energy: -11.910 Dist. restrs. and SS energy: -86.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -841.042377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.042377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.442377 (E_RNA) where: Base-Base interactions energy: -489.689 where: short stacking energy: -215.926 Base-Backbone interact. energy: -0.925 local terms energy: -256.827514 where: bonds (distance) C4'-P energy: -59.379 bonds (distance) P-C4' energy: -53.879 flat angles C4'-P-C4' energy: -48.336 flat angles P-C4'-P energy: -38.211 tors. eta vs tors. theta energy: -57.023 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -896.868843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.868843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.268843 (E_RNA) where: Base-Base interactions energy: -520.554 where: short stacking energy: -231.307 Base-Backbone interact. energy: -0.400 local terms energy: -246.314257 where: bonds (distance) C4'-P energy: -54.827 bonds (distance) P-C4' energy: -46.402 flat angles C4'-P-C4' energy: -58.144 flat angles P-C4'-P energy: -31.459 tors. eta vs tors. theta energy: -55.482 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -734.481639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.481639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.881639 (E_RNA) where: Base-Base interactions energy: -431.575 where: short stacking energy: -191.955 Base-Backbone interact. energy: -1.352 local terms energy: -270.953913 where: bonds (distance) C4'-P energy: -61.588 bonds (distance) P-C4' energy: -54.195 flat angles C4'-P-C4' energy: -62.353 flat angles P-C4'-P energy: -35.231 tors. eta vs tors. theta energy: -57.587 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -785.285928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.285928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.885928 (E_RNA) where: Base-Base interactions energy: -427.460 where: short stacking energy: -193.891 Base-Backbone interact. energy: 0.594 local terms energy: -245.020306 where: bonds (distance) C4'-P energy: -55.396 bonds (distance) P-C4' energy: -62.461 flat angles C4'-P-C4' energy: -52.541 flat angles P-C4'-P energy: -30.005 tors. eta vs tors. theta energy: -44.617 Dist. restrs. and SS energy: -113.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -477.369794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.369794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.369794 (E_RNA) where: Base-Base interactions energy: -255.625 where: short stacking energy: -130.950 Base-Backbone interact. energy: -2.147 local terms energy: -192.598034 where: bonds (distance) C4'-P energy: -48.384 bonds (distance) P-C4' energy: -46.697 flat angles C4'-P-C4' energy: -46.408 flat angles P-C4'-P energy: -32.240 tors. eta vs tors. theta energy: -18.869 Dist. restrs. and SS energy: -27.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -623.622902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -623.622902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.422902 (E_RNA) where: Base-Base interactions energy: -339.932 where: short stacking energy: -147.681 Base-Backbone interact. energy: -1.654 local terms energy: -211.837637 where: bonds (distance) C4'-P energy: -56.435 bonds (distance) P-C4' energy: -54.715 flat angles C4'-P-C4' energy: -38.826 flat angles P-C4'-P energy: -32.475 tors. eta vs tors. theta energy: -29.387 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -493.114498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.114498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.714498 (E_RNA) where: Base-Base interactions energy: -271.879 where: short stacking energy: -141.929 Base-Backbone interact. energy: 0.184 local terms energy: -171.019708 where: bonds (distance) C4'-P energy: -37.206 bonds (distance) P-C4' energy: -52.248 flat angles C4'-P-C4' energy: -48.520 flat angles P-C4'-P energy: -16.297 tors. eta vs tors. theta energy: -16.749 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -474.417101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.417101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.617101 (E_RNA) where: Base-Base interactions energy: -238.825 where: short stacking energy: -108.478 Base-Backbone interact. energy: 1.064 local terms energy: -189.855293 where: bonds (distance) C4'-P energy: -45.377 bonds (distance) P-C4' energy: -51.386 flat angles C4'-P-C4' energy: -50.461 flat angles P-C4'-P energy: -27.247 tors. eta vs tors. theta energy: -15.385 Dist. restrs. and SS energy: -46.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -499.080653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.080653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.480653 (E_RNA) where: Base-Base interactions energy: -235.472 where: short stacking energy: -113.191 Base-Backbone interact. energy: -1.002 local terms energy: -196.006878 where: bonds (distance) C4'-P energy: -53.281 bonds (distance) P-C4' energy: -44.464 flat angles C4'-P-C4' energy: -43.175 flat angles P-C4'-P energy: -35.525 tors. eta vs tors. theta energy: -19.561 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -535.417559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.417559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.617559 (E_RNA) where: Base-Base interactions energy: -263.716 where: short stacking energy: -124.544 Base-Backbone interact. energy: -0.001 local terms energy: -188.900514 where: bonds (distance) C4'-P energy: -40.165 bonds (distance) P-C4' energy: -53.464 flat angles C4'-P-C4' energy: -45.536 flat angles P-C4'-P energy: -30.425 tors. eta vs tors. theta energy: -19.310 Dist. restrs. and SS energy: -82.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -930.424320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -930.424320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.824320 (E_RNA) where: Base-Base interactions energy: -533.336 where: short stacking energy: -238.639 Base-Backbone interact. energy: -0.618 local terms energy: -266.870438 where: bonds (distance) C4'-P energy: -50.235 bonds (distance) P-C4' energy: -53.392 flat angles C4'-P-C4' energy: -62.703 flat angles P-C4'-P energy: -44.547 tors. eta vs tors. theta energy: -55.993 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -840.625107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.625107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.025107 (E_RNA) where: Base-Base interactions energy: -490.794 where: short stacking energy: -217.771 Base-Backbone interact. energy: -1.520 local terms energy: -254.711334 where: bonds (distance) C4'-P energy: -43.667 bonds (distance) P-C4' energy: -47.667 flat angles C4'-P-C4' energy: -61.331 flat angles P-C4'-P energy: -43.598 tors. eta vs tors. theta energy: -58.449 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -832.747021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.747021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.147021 (E_RNA) where: Base-Base interactions energy: -454.873 where: short stacking energy: -205.951 Base-Backbone interact. energy: -2.005 local terms energy: -264.269000 where: bonds (distance) C4'-P energy: -50.097 bonds (distance) P-C4' energy: -63.035 flat angles C4'-P-C4' energy: -66.593 flat angles P-C4'-P energy: -34.784 tors. eta vs tors. theta energy: -49.760 Dist. restrs. and SS energy: -111.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -696.109385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.109385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.309385 (E_RNA) where: Base-Base interactions energy: -415.088 where: short stacking energy: -211.805 Base-Backbone interact. energy: -1.342 local terms energy: -250.879865 where: bonds (distance) C4'-P energy: -53.504 bonds (distance) P-C4' energy: -49.854 flat angles C4'-P-C4' energy: -56.910 flat angles P-C4'-P energy: -29.488 tors. eta vs tors. theta energy: -61.124 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -695.553269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.553269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -627.153269 (E_RNA) where: Base-Base interactions energy: -404.279 where: short stacking energy: -207.975 Base-Backbone interact. energy: -0.983 local terms energy: -221.890708 where: bonds (distance) C4'-P energy: -52.563 bonds (distance) P-C4' energy: -45.303 flat angles C4'-P-C4' energy: -53.923 flat angles P-C4'-P energy: -23.692 tors. eta vs tors. theta energy: -46.410 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -493.350652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.350652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.350652 (E_RNA) where: Base-Base interactions energy: -251.165 where: short stacking energy: -131.206 Base-Backbone interact. energy: -4.601 local terms energy: -192.584565 where: bonds (distance) C4'-P energy: -49.922 bonds (distance) P-C4' energy: -44.790 flat angles C4'-P-C4' energy: -41.621 flat angles P-C4'-P energy: -28.751 tors. eta vs tors. theta energy: -27.500 Dist. restrs. and SS energy: -45.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -516.882153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.882153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.882153 (E_RNA) where: Base-Base interactions energy: -258.970 where: short stacking energy: -122.000 Base-Backbone interact. energy: -2.267 local terms energy: -201.644484 where: bonds (distance) C4'-P energy: -43.718 bonds (distance) P-C4' energy: -53.759 flat angles C4'-P-C4' energy: -54.689 flat angles P-C4'-P energy: -31.358 tors. eta vs tors. theta energy: -18.121 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -498.358498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.358498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.558498 (E_RNA) where: Base-Base interactions energy: -235.316 where: short stacking energy: -107.413 Base-Backbone interact. energy: -2.162 local terms energy: -205.080461 where: bonds (distance) C4'-P energy: -49.103 bonds (distance) P-C4' energy: -56.930 flat angles C4'-P-C4' energy: -45.621 flat angles P-C4'-P energy: -32.739 tors. eta vs tors. theta energy: -20.687 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -543.437927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.437927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.637927 (E_RNA) where: Base-Base interactions energy: -267.251 where: short stacking energy: -123.494 Base-Backbone interact. energy: -0.939 local terms energy: -183.448377 where: bonds (distance) C4'-P energy: -38.396 bonds (distance) P-C4' energy: -51.135 flat angles C4'-P-C4' energy: -48.591 flat angles P-C4'-P energy: -24.950 tors. eta vs tors. theta energy: -20.376 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -488.914129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.914129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.114129 (E_RNA) where: Base-Base interactions energy: -242.395 where: short stacking energy: -110.461 Base-Backbone interact. energy: 2.212 local terms energy: -174.930843 where: bonds (distance) C4'-P energy: -44.792 bonds (distance) P-C4' energy: -46.777 flat angles C4'-P-C4' energy: -43.384 flat angles P-C4'-P energy: -18.499 tors. eta vs tors. theta energy: -21.478 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -960.074134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.074134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -830.474134 (E_RNA) where: Base-Base interactions energy: -519.841 where: short stacking energy: -250.608 Base-Backbone interact. energy: -1.695 local terms energy: -308.937646 where: bonds (distance) C4'-P energy: -60.924 bonds (distance) P-C4' energy: -64.785 flat angles C4'-P-C4' energy: -66.299 flat angles P-C4'-P energy: -42.321 tors. eta vs tors. theta energy: -74.609 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -861.588232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -861.588232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.788232 (E_RNA) where: Base-Base interactions energy: -496.645 where: short stacking energy: -213.345 Base-Backbone interact. energy: -1.118 local terms energy: -272.025315 where: bonds (distance) C4'-P energy: -44.655 bonds (distance) P-C4' energy: -59.839 flat angles C4'-P-C4' energy: -61.384 flat angles P-C4'-P energy: -41.693 tors. eta vs tors. theta energy: -64.455 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -808.064212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -808.064212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.864212 (E_RNA) where: Base-Base interactions energy: -441.224 where: short stacking energy: -216.399 Base-Backbone interact. energy: 2.215 local terms energy: -253.855947 where: bonds (distance) C4'-P energy: -52.811 bonds (distance) P-C4' energy: -57.500 flat angles C4'-P-C4' energy: -62.427 flat angles P-C4'-P energy: -27.791 tors. eta vs tors. theta energy: -53.327 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -721.675910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.675910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.875910 (E_RNA) where: Base-Base interactions energy: -399.216 where: short stacking energy: -195.023 Base-Backbone interact. energy: -1.479 local terms energy: -247.180867 where: bonds (distance) C4'-P energy: -50.430 bonds (distance) P-C4' energy: -51.855 flat angles C4'-P-C4' energy: -56.732 flat angles P-C4'-P energy: -37.659 tors. eta vs tors. theta energy: -50.505 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -611.871931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.871931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.271931 (E_RNA) where: Base-Base interactions energy: -333.523 where: short stacking energy: -174.821 Base-Backbone interact. energy: -0.030 local terms energy: -247.719321 where: bonds (distance) C4'-P energy: -50.916 bonds (distance) P-C4' energy: -55.243 flat angles C4'-P-C4' energy: -52.179 flat angles P-C4'-P energy: -39.743 tors. eta vs tors. theta energy: -49.639 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -560.245467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.245467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.445467 (E_RNA) where: Base-Base interactions energy: -295.608 where: short stacking energy: -130.150 Base-Backbone interact. energy: -1.035 local terms energy: -180.801960 where: bonds (distance) C4'-P energy: -45.291 bonds (distance) P-C4' energy: -52.214 flat angles C4'-P-C4' energy: -53.941 flat angles P-C4'-P energy: -17.514 tors. eta vs tors. theta energy: -11.842 Dist. restrs. and SS energy: -82.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -518.723563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.723563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.123563 (E_RNA) where: Base-Base interactions energy: -261.114 where: short stacking energy: -115.251 Base-Backbone interact. energy: -2.314 local terms energy: -197.695780 where: bonds (distance) C4'-P energy: -50.610 bonds (distance) P-C4' energy: -55.454 flat angles C4'-P-C4' energy: -45.445 flat angles P-C4'-P energy: -31.760 tors. eta vs tors. theta energy: -14.428 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -574.867376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.867376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.667376 (E_RNA) where: Base-Base interactions energy: -291.300 where: short stacking energy: -121.593 Base-Backbone interact. energy: 2.309 local terms energy: -197.675890 where: bonds (distance) C4'-P energy: -39.714 bonds (distance) P-C4' energy: -52.475 flat angles C4'-P-C4' energy: -53.494 flat angles P-C4'-P energy: -24.396 tors. eta vs tors. theta energy: -27.598 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -516.572328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.572328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.772328 (E_RNA) where: Base-Base interactions energy: -251.171 where: short stacking energy: -118.434 Base-Backbone interact. energy: 1.098 local terms energy: -210.698883 where: bonds (distance) C4'-P energy: -43.498 bonds (distance) P-C4' energy: -61.797 flat angles C4'-P-C4' energy: -54.538 flat angles P-C4'-P energy: -32.756 tors. eta vs tors. theta energy: -18.111 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -436.749200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.749200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.149200 (E_RNA) where: Base-Base interactions energy: -215.543 where: short stacking energy: -87.778 Base-Backbone interact. energy: -2.199 local terms energy: -161.406859 where: bonds (distance) C4'-P energy: -40.412 bonds (distance) P-C4' energy: -46.549 flat angles C4'-P-C4' energy: -45.652 flat angles P-C4'-P energy: -25.276 tors. eta vs tors. theta energy: -3.518 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -960.207616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.207616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.207616 (E_RNA) where: Base-Base interactions energy: -542.707 where: short stacking energy: -245.853 Base-Backbone interact. energy: -0.930 local terms energy: -290.570030 where: bonds (distance) C4'-P energy: -56.604 bonds (distance) P-C4' energy: -54.953 flat angles C4'-P-C4' energy: -64.600 flat angles P-C4'-P energy: -38.029 tors. eta vs tors. theta energy: -76.384 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -878.040116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.040116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.240116 (E_RNA) where: Base-Base interactions energy: -515.576 where: short stacking energy: -222.046 Base-Backbone interact. energy: 0.738 local terms energy: -271.402320 where: bonds (distance) C4'-P energy: -53.158 bonds (distance) P-C4' energy: -49.333 flat angles C4'-P-C4' energy: -62.168 flat angles P-C4'-P energy: -40.483 tors. eta vs tors. theta energy: -66.261 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -814.855370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.855370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.455370 (E_RNA) where: Base-Base interactions energy: -453.678 where: short stacking energy: -201.517 Base-Backbone interact. energy: -0.398 local terms energy: -247.378973 where: bonds (distance) C4'-P energy: -52.767 bonds (distance) P-C4' energy: -53.458 flat angles C4'-P-C4' energy: -49.832 flat angles P-C4'-P energy: -33.915 tors. eta vs tors. theta energy: -57.407 Dist. restrs. and SS energy: -113.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -725.613107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.613107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.813107 (E_RNA) where: Base-Base interactions energy: -427.588 where: short stacking energy: -203.328 Base-Backbone interact. energy: -0.872 local terms energy: -223.353521 where: bonds (distance) C4'-P energy: -51.317 bonds (distance) P-C4' energy: -53.568 flat angles C4'-P-C4' energy: -48.563 flat angles P-C4'-P energy: -32.547 tors. eta vs tors. theta energy: -37.358 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -599.966861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.966861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.566861 (E_RNA) where: Base-Base interactions energy: -353.238 where: short stacking energy: -153.215 Base-Backbone interact. energy: -1.365 local terms energy: -203.964053 where: bonds (distance) C4'-P energy: -42.358 bonds (distance) P-C4' energy: -67.184 flat angles C4'-P-C4' energy: -47.033 flat angles P-C4'-P energy: -29.382 tors. eta vs tors. theta energy: -18.008 Dist. restrs. and SS energy: -41.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -682.250031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.250031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.450031 (E_RNA) where: Base-Base interactions energy: -380.789 where: short stacking energy: -164.508 Base-Backbone interact. energy: -0.703 local terms energy: -217.957569 where: bonds (distance) C4'-P energy: -45.686 bonds (distance) P-C4' energy: -43.857 flat angles C4'-P-C4' energy: -54.679 flat angles P-C4'-P energy: -30.809 tors. eta vs tors. theta energy: -42.926 Dist. restrs. and SS energy: -82.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -628.777488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.777488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.377488 (E_RNA) where: Base-Base interactions energy: -319.106 where: short stacking energy: -131.567 Base-Backbone interact. energy: -1.777 local terms energy: -212.495236 where: bonds (distance) C4'-P energy: -53.282 bonds (distance) P-C4' energy: -48.504 flat angles C4'-P-C4' energy: -36.081 flat angles P-C4'-P energy: -37.717 tors. eta vs tors. theta energy: -36.910 Dist. restrs. and SS energy: -95.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -530.578730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.578730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.578730 (E_RNA) where: Base-Base interactions energy: -281.955 where: short stacking energy: -146.103 Base-Backbone interact. energy: -0.425 local terms energy: -203.198528 where: bonds (distance) C4'-P energy: -36.243 bonds (distance) P-C4' energy: -54.581 flat angles C4'-P-C4' energy: -54.211 flat angles P-C4'-P energy: -26.793 tors. eta vs tors. theta energy: -31.371 Dist. restrs. and SS energy: -45.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -468.272979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.272979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.072979 (E_RNA) where: Base-Base interactions energy: -224.232 where: short stacking energy: -104.348 Base-Backbone interact. energy: -0.795 local terms energy: -182.045721 where: bonds (distance) C4'-P energy: -40.179 bonds (distance) P-C4' energy: -53.771 flat angles C4'-P-C4' energy: -48.379 flat angles P-C4'-P energy: -28.087 tors. eta vs tors. theta energy: -11.630 Dist. restrs. and SS energy: -61.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -447.896691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.896691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.496691 (E_RNA) where: Base-Base interactions energy: -215.151 where: short stacking energy: -105.311 Base-Backbone interact. energy: -0.826 local terms energy: -172.519760 where: bonds (distance) C4'-P energy: -47.061 bonds (distance) P-C4' energy: -43.727 flat angles C4'-P-C4' energy: -31.980 flat angles P-C4'-P energy: -27.127 tors. eta vs tors. theta energy: -22.626 Dist. restrs. and SS energy: -59.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -966.005206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.005206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.405206 (E_RNA) where: Base-Base interactions energy: -545.410 where: short stacking energy: -256.850 Base-Backbone interact. energy: 1.009 local terms energy: -292.004379 where: bonds (distance) C4'-P energy: -50.231 bonds (distance) P-C4' energy: -64.083 flat angles C4'-P-C4' energy: -63.830 flat angles P-C4'-P energy: -47.599 tors. eta vs tors. theta energy: -66.262 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -843.256542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.256542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.656542 (E_RNA) where: Base-Base interactions energy: -482.391 where: short stacking energy: -210.669 Base-Backbone interact. energy: -1.267 local terms energy: -265.998382 where: bonds (distance) C4'-P energy: -53.316 bonds (distance) P-C4' energy: -60.093 flat angles C4'-P-C4' energy: -57.042 flat angles P-C4'-P energy: -36.735 tors. eta vs tors. theta energy: -58.811 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -834.416901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.416901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.216901 (E_RNA) where: Base-Base interactions energy: -457.107 where: short stacking energy: -207.316 Base-Backbone interact. energy: -1.438 local terms energy: -260.671731 where: bonds (distance) C4'-P energy: -59.052 bonds (distance) P-C4' energy: -46.144 flat angles C4'-P-C4' energy: -56.245 flat angles P-C4'-P energy: -43.943 tors. eta vs tors. theta energy: -55.288 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -757.018137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -757.018137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.818137 (E_RNA) where: Base-Base interactions energy: -436.299 where: short stacking energy: -210.198 Base-Backbone interact. energy: -1.758 local terms energy: -248.761175 where: bonds (distance) C4'-P energy: -55.546 bonds (distance) P-C4' energy: -47.798 flat angles C4'-P-C4' energy: -59.877 flat angles P-C4'-P energy: -33.567 tors. eta vs tors. theta energy: -51.973 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -597.582748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.582748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.982748 (E_RNA) where: Base-Base interactions energy: -350.031 where: short stacking energy: -159.346 Base-Backbone interact. energy: -0.927 local terms energy: -216.024342 where: bonds (distance) C4'-P energy: -42.132 bonds (distance) P-C4' energy: -63.030 flat angles C4'-P-C4' energy: -43.390 flat angles P-C4'-P energy: -21.372 tors. eta vs tors. theta energy: -46.101 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -689.458388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.458388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.858388 (E_RNA) where: Base-Base interactions energy: -382.641 where: short stacking energy: -156.591 Base-Backbone interact. energy: -1.100 local terms energy: -212.117138 where: bonds (distance) C4'-P energy: -50.348 bonds (distance) P-C4' energy: -50.101 flat angles C4'-P-C4' energy: -53.692 flat angles P-C4'-P energy: -23.655 tors. eta vs tors. theta energy: -34.320 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -641.299787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -641.299787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.099787 (E_RNA) where: Base-Base interactions energy: -334.630 where: short stacking energy: -150.237 Base-Backbone interact. energy: 1.255 local terms energy: -201.725092 where: bonds (distance) C4'-P energy: -51.312 bonds (distance) P-C4' energy: -48.957 flat angles C4'-P-C4' energy: -39.518 flat angles P-C4'-P energy: -27.436 tors. eta vs tors. theta energy: -34.501 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -512.920005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.920005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.920005 (E_RNA) where: Base-Base interactions energy: -265.998 where: short stacking energy: -127.103 Base-Backbone interact. energy: 2.815 local terms energy: -195.736993 where: bonds (distance) C4'-P energy: -48.618 bonds (distance) P-C4' energy: -59.577 flat angles C4'-P-C4' energy: -48.235 flat angles P-C4'-P energy: -16.971 tors. eta vs tors. theta energy: -22.336 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -496.443553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.443553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.043553 (E_RNA) where: Base-Base interactions energy: -246.538 where: short stacking energy: -117.425 Base-Backbone interact. energy: -1.717 local terms energy: -179.788547 where: bonds (distance) C4'-P energy: -36.522 bonds (distance) P-C4' energy: -40.445 flat angles C4'-P-C4' energy: -47.501 flat angles P-C4'-P energy: -25.938 tors. eta vs tors. theta energy: -29.382 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -462.395740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.395740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.395740 (E_RNA) where: Base-Base interactions energy: -222.544 where: short stacking energy: -113.691 Base-Backbone interact. energy: -1.817 local terms energy: -184.035179 where: bonds (distance) C4'-P energy: -46.902 bonds (distance) P-C4' energy: -40.189 flat angles C4'-P-C4' energy: -43.025 flat angles P-C4'-P energy: -28.292 tors. eta vs tors. theta energy: -25.627 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -975.357772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.357772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -847.557772 (E_RNA) where: Base-Base interactions energy: -558.685 where: short stacking energy: -255.233 Base-Backbone interact. energy: -0.133 local terms energy: -288.740037 where: bonds (distance) C4'-P energy: -51.840 bonds (distance) P-C4' energy: -57.084 flat angles C4'-P-C4' energy: -63.387 flat angles P-C4'-P energy: -44.571 tors. eta vs tors. theta energy: -71.858 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -853.657889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.657889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.857889 (E_RNA) where: Base-Base interactions energy: -493.181 where: short stacking energy: -214.226 Base-Backbone interact. energy: 0.682 local terms energy: -269.358798 where: bonds (distance) C4'-P energy: -58.558 bonds (distance) P-C4' energy: -55.791 flat angles C4'-P-C4' energy: -62.703 flat angles P-C4'-P energy: -35.438 tors. eta vs tors. theta energy: -56.869 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -829.433894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.433894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.633894 (E_RNA) where: Base-Base interactions energy: -463.544 where: short stacking energy: -186.375 Base-Backbone interact. energy: -2.581 local terms energy: -235.509448 where: bonds (distance) C4'-P energy: -53.400 bonds (distance) P-C4' energy: -50.983 flat angles C4'-P-C4' energy: -58.258 flat angles P-C4'-P energy: -29.105 tors. eta vs tors. theta energy: -43.763 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -765.691547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.691547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.291547 (E_RNA) where: Base-Base interactions energy: -446.456 where: short stacking energy: -194.548 Base-Backbone interact. energy: 0.935 local terms energy: -242.770082 where: bonds (distance) C4'-P energy: -51.836 bonds (distance) P-C4' energy: -50.652 flat angles C4'-P-C4' energy: -62.419 flat angles P-C4'-P energy: -33.749 tors. eta vs tors. theta energy: -44.114 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -764.717175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -764.717175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.917175 (E_RNA) where: Base-Base interactions energy: -446.274 where: short stacking energy: -196.532 Base-Backbone interact. energy: 2.156 local terms energy: -228.798781 where: bonds (distance) C4'-P energy: -44.100 bonds (distance) P-C4' energy: -43.598 flat angles C4'-P-C4' energy: -54.955 flat angles P-C4'-P energy: -34.128 tors. eta vs tors. theta energy: -52.018 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -546.112367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.112367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.112367 (E_RNA) where: Base-Base interactions energy: -299.360 where: short stacking energy: -139.727 Base-Backbone interact. energy: 0.787 local terms energy: -211.539710 where: bonds (distance) C4'-P energy: -49.707 bonds (distance) P-C4' energy: -52.355 flat angles C4'-P-C4' energy: -44.985 flat angles P-C4'-P energy: -40.876 tors. eta vs tors. theta energy: -23.617 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -700.478613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.478613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.678613 (E_RNA) where: Base-Base interactions energy: -386.616 where: short stacking energy: -164.161 Base-Backbone interact. energy: 0.020 local terms energy: -213.082085 where: bonds (distance) C4'-P energy: -43.652 bonds (distance) P-C4' energy: -46.607 flat angles C4'-P-C4' energy: -45.150 flat angles P-C4'-P energy: -33.755 tors. eta vs tors. theta energy: -43.919 Dist. restrs. and SS energy: -100.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -570.928769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.928769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.928769 (E_RNA) where: Base-Base interactions energy: -304.335 where: short stacking energy: -157.566 Base-Backbone interact. energy: -1.214 local terms energy: -211.379543 where: bonds (distance) C4'-P energy: -50.421 bonds (distance) P-C4' energy: -38.987 flat angles C4'-P-C4' energy: -49.638 flat angles P-C4'-P energy: -31.869 tors. eta vs tors. theta energy: -40.463 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -494.979549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.979549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.379549 (E_RNA) where: Base-Base interactions energy: -235.050 where: short stacking energy: -122.765 Base-Backbone interact. energy: -0.669 local terms energy: -201.660373 where: bonds (distance) C4'-P energy: -42.457 bonds (distance) P-C4' energy: -57.985 flat angles C4'-P-C4' energy: -42.090 flat angles P-C4'-P energy: -28.011 tors. eta vs tors. theta energy: -31.117 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -438.983798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.983798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.583798 (E_RNA) where: Base-Base interactions energy: -212.402 where: short stacking energy: -98.061 Base-Backbone interact. energy: 4.309 local terms energy: -162.490236 where: bonds (distance) C4'-P energy: -36.891 bonds (distance) P-C4' energy: -48.234 flat angles C4'-P-C4' energy: -42.199 flat angles P-C4'-P energy: -21.281 tors. eta vs tors. theta energy: -13.885 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -985.368953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.368953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -861.168953 (E_RNA) where: Base-Base interactions energy: -557.539 where: short stacking energy: -264.860 Base-Backbone interact. energy: -0.260 local terms energy: -303.369345 where: bonds (distance) C4'-P energy: -52.985 bonds (distance) P-C4' energy: -61.502 flat angles C4'-P-C4' energy: -62.745 flat angles P-C4'-P energy: -49.818 tors. eta vs tors. theta energy: -76.318 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -914.027596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -914.027596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.427596 (E_RNA) where: Base-Base interactions energy: -503.208 where: short stacking energy: -215.335 Base-Backbone interact. energy: -1.684 local terms energy: -279.535123 where: bonds (distance) C4'-P energy: -55.207 bonds (distance) P-C4' energy: -61.700 flat angles C4'-P-C4' energy: -60.850 flat angles P-C4'-P energy: -41.074 tors. eta vs tors. theta energy: -60.704 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -834.517773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.517773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.917773 (E_RNA) where: Base-Base interactions energy: -478.407 where: short stacking energy: -212.952 Base-Backbone interact. energy: 0.665 local terms energy: -263.175721 where: bonds (distance) C4'-P energy: -52.341 bonds (distance) P-C4' energy: -59.617 flat angles C4'-P-C4' energy: -56.782 flat angles P-C4'-P energy: -39.785 tors. eta vs tors. theta energy: -54.650 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -827.266431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.266431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.066431 (E_RNA) where: Base-Base interactions energy: -481.402 where: short stacking energy: -199.021 Base-Backbone interact. energy: 1.994 local terms energy: -232.657807 where: bonds (distance) C4'-P energy: -50.059 bonds (distance) P-C4' energy: -51.437 flat angles C4'-P-C4' energy: -48.122 flat angles P-C4'-P energy: -35.991 tors. eta vs tors. theta energy: -47.049 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -673.092266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.092266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.892266 (E_RNA) where: Base-Base interactions energy: -372.310 where: short stacking energy: -146.942 Base-Backbone interact. energy: -1.572 local terms energy: -220.009948 where: bonds (distance) C4'-P energy: -54.606 bonds (distance) P-C4' energy: -50.423 flat angles C4'-P-C4' energy: -51.468 flat angles P-C4'-P energy: -34.222 tors. eta vs tors. theta energy: -29.291 Dist. restrs. and SS energy: -79.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -671.315399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.315399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.115399 (E_RNA) where: Base-Base interactions energy: -358.932 where: short stacking energy: -180.407 Base-Backbone interact. energy: 0.983 local terms energy: -225.166604 where: bonds (distance) C4'-P energy: -49.823 bonds (distance) P-C4' energy: -50.131 flat angles C4'-P-C4' energy: -49.915 flat angles P-C4'-P energy: -26.737 tors. eta vs tors. theta energy: -48.560 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -415.386114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.386114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.986114 (E_RNA) where: Base-Base interactions energy: -198.069 where: short stacking energy: -118.875 Base-Backbone interact. energy: -1.079 local terms energy: -183.838546 where: bonds (distance) C4'-P energy: -52.003 bonds (distance) P-C4' energy: -47.264 flat angles C4'-P-C4' energy: -43.820 flat angles P-C4'-P energy: -27.905 tors. eta vs tors. theta energy: -12.846 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -528.928890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.928890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.728890 (E_RNA) where: Base-Base interactions energy: -278.357 where: short stacking energy: -125.380 Base-Backbone interact. energy: -1.929 local terms energy: -196.442873 where: bonds (distance) C4'-P energy: -46.061 bonds (distance) P-C4' energy: -53.760 flat angles C4'-P-C4' energy: -47.563 flat angles P-C4'-P energy: -29.847 tors. eta vs tors. theta energy: -19.212 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -511.007329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.007329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.407329 (E_RNA) where: Base-Base interactions energy: -252.650 where: short stacking energy: -102.265 Base-Backbone interact. energy: -1.265 local terms energy: -172.492293 where: bonds (distance) C4'-P energy: -40.198 bonds (distance) P-C4' energy: -50.361 flat angles C4'-P-C4' energy: -50.353 flat angles P-C4'-P energy: -16.533 tors. eta vs tors. theta energy: -15.047 Dist. restrs. and SS energy: -84.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -511.233441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.233441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.833441 (E_RNA) where: Base-Base interactions energy: -251.613 where: short stacking energy: -113.138 Base-Backbone interact. energy: -1.635 local terms energy: -171.585616 where: bonds (distance) C4'-P energy: -40.109 bonds (distance) P-C4' energy: -49.160 flat angles C4'-P-C4' energy: -45.505 flat angles P-C4'-P energy: -25.648 tors. eta vs tors. theta energy: -11.164 Dist. restrs. and SS energy: -86.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -979.646868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -979.646868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -850.046868 (E_RNA) where: Base-Base interactions energy: -559.159 where: short stacking energy: -264.595 Base-Backbone interact. energy: 0.008 local terms energy: -290.895696 where: bonds (distance) C4'-P energy: -55.340 bonds (distance) P-C4' energy: -57.829 flat angles C4'-P-C4' energy: -58.354 flat angles P-C4'-P energy: -42.872 tors. eta vs tors. theta energy: -76.500 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -908.847409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -908.847409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.647409 (E_RNA) where: Base-Base interactions energy: -506.370 where: short stacking energy: -233.751 Base-Backbone interact. energy: -1.026 local terms energy: -277.251586 where: bonds (distance) C4'-P energy: -59.938 bonds (distance) P-C4' energy: -54.820 flat angles C4'-P-C4' energy: -62.918 flat angles P-C4'-P energy: -41.131 tors. eta vs tors. theta energy: -58.445 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -850.780925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.780925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -733.780925 (E_RNA) where: Base-Base interactions energy: -476.524 where: short stacking energy: -191.355 Base-Backbone interact. energy: 0.100 local terms energy: -257.356968 where: bonds (distance) C4'-P energy: -50.073 bonds (distance) P-C4' energy: -57.844 flat angles C4'-P-C4' energy: -62.642 flat angles P-C4'-P energy: -35.215 tors. eta vs tors. theta energy: -51.584 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -802.039254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -802.039254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.439254 (E_RNA) where: Base-Base interactions energy: -447.423 where: short stacking energy: -198.182 Base-Backbone interact. energy: -1.186 local terms energy: -259.830598 where: bonds (distance) C4'-P energy: -48.494 bonds (distance) P-C4' energy: -60.224 flat angles C4'-P-C4' energy: -55.252 flat angles P-C4'-P energy: -38.378 tors. eta vs tors. theta energy: -57.484 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -696.154235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.154235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.354235 (E_RNA) where: Base-Base interactions energy: -354.673 where: short stacking energy: -177.040 Base-Backbone interact. energy: -0.975 local terms energy: -248.706221 where: bonds (distance) C4'-P energy: -59.672 bonds (distance) P-C4' energy: -50.545 flat angles C4'-P-C4' energy: -61.547 flat angles P-C4'-P energy: -32.691 tors. eta vs tors. theta energy: -44.252 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -650.237366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.237366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.237366 (E_RNA) where: Base-Base interactions energy: -350.901 where: short stacking energy: -166.233 Base-Backbone interact. energy: 1.749 local terms energy: -229.085048 where: bonds (distance) C4'-P energy: -44.139 bonds (distance) P-C4' energy: -60.552 flat angles C4'-P-C4' energy: -47.040 flat angles P-C4'-P energy: -40.710 tors. eta vs tors. theta energy: -36.644 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -572.504686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.504686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.904686 (E_RNA) where: Base-Base interactions energy: -303.181 where: short stacking energy: -133.050 Base-Backbone interact. energy: -1.816 local terms energy: -209.907568 where: bonds (distance) C4'-P energy: -46.216 bonds (distance) P-C4' energy: -53.037 flat angles C4'-P-C4' energy: -52.410 flat angles P-C4'-P energy: -34.186 tors. eta vs tors. theta energy: -24.058 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -379.571291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.571291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.571291 (E_RNA) where: Base-Base interactions energy: -174.397 where: short stacking energy: -110.012 Base-Backbone interact. energy: -0.241 local terms energy: -168.933636 where: bonds (distance) C4'-P energy: -40.812 bonds (distance) P-C4' energy: -44.714 flat angles C4'-P-C4' energy: -44.765 flat angles P-C4'-P energy: -31.704 tors. eta vs tors. theta energy: -6.938 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -540.800819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.800819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.200819 (E_RNA) where: Base-Base interactions energy: -273.236 where: short stacking energy: -94.841 Base-Backbone interact. energy: -1.636 local terms energy: -181.328286 where: bonds (distance) C4'-P energy: -51.463 bonds (distance) P-C4' energy: -45.777 flat angles C4'-P-C4' energy: -42.265 flat angles P-C4'-P energy: -31.843 tors. eta vs tors. theta energy: -9.981 Dist. restrs. and SS energy: -84.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -582.823290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.823290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.823290 (E_RNA) where: Base-Base interactions energy: -283.009 where: short stacking energy: -123.106 Base-Backbone interact. energy: -1.216 local terms energy: -190.598559 where: bonds (distance) C4'-P energy: -42.471 bonds (distance) P-C4' energy: -57.497 flat angles C4'-P-C4' energy: -38.638 flat angles P-C4'-P energy: -28.170 tors. eta vs tors. theta energy: -23.824 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -977.246509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.246509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.446509 (E_RNA) where: Base-Base interactions energy: -573.408 where: short stacking energy: -275.298 Base-Backbone interact. energy: -1.414 local terms energy: -274.625113 where: bonds (distance) C4'-P energy: -43.413 bonds (distance) P-C4' energy: -45.355 flat angles C4'-P-C4' energy: -68.431 flat angles P-C4'-P energy: -38.386 tors. eta vs tors. theta energy: -79.040 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -895.467258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -895.467258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.867258 (E_RNA) where: Base-Base interactions energy: -501.698 where: short stacking energy: -232.228 Base-Backbone interact. energy: -2.037 local terms energy: -262.132088 where: bonds (distance) C4'-P energy: -36.407 bonds (distance) P-C4' energy: -59.649 flat angles C4'-P-C4' energy: -59.230 flat angles P-C4'-P energy: -42.991 tors. eta vs tors. theta energy: -63.856 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -871.108981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.108981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.908981 (E_RNA) where: Base-Base interactions energy: -511.005 where: short stacking energy: -210.481 Base-Backbone interact. energy: 2.550 local terms energy: -247.454260 where: bonds (distance) C4'-P energy: -47.728 bonds (distance) P-C4' energy: -58.564 flat angles C4'-P-C4' energy: -55.074 flat angles P-C4'-P energy: -37.011 tors. eta vs tors. theta energy: -49.077 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -814.768683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.768683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.368683 (E_RNA) where: Base-Base interactions energy: -472.310 where: short stacking energy: -221.747 Base-Backbone interact. energy: -1.769 local terms energy: -254.290419 where: bonds (distance) C4'-P energy: -49.982 bonds (distance) P-C4' energy: -54.143 flat angles C4'-P-C4' energy: -49.752 flat angles P-C4'-P energy: -43.110 tors. eta vs tors. theta energy: -57.302 Dist. restrs. and SS energy: -86.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -714.201194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.201194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.401194 (E_RNA) where: Base-Base interactions energy: -400.408 where: short stacking energy: -195.646 Base-Backbone interact. energy: 0.709 local terms energy: -222.702118 where: bonds (distance) C4'-P energy: -37.014 bonds (distance) P-C4' energy: -48.399 flat angles C4'-P-C4' energy: -58.795 flat angles P-C4'-P energy: -31.518 tors. eta vs tors. theta energy: -46.977 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -624.093621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.093621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.293621 (E_RNA) where: Base-Base interactions energy: -316.779 where: short stacking energy: -150.241 Base-Backbone interact. energy: 0.774 local terms energy: -216.289267 where: bonds (distance) C4'-P energy: -55.193 bonds (distance) P-C4' energy: -53.865 flat angles C4'-P-C4' energy: -50.367 flat angles P-C4'-P energy: -23.219 tors. eta vs tors. theta energy: -33.644 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -580.615978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.615978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.815978 (E_RNA) where: Base-Base interactions energy: -318.943 where: short stacking energy: -145.935 Base-Backbone interact. energy: 0.117 local terms energy: -205.990825 where: bonds (distance) C4'-P energy: -47.540 bonds (distance) P-C4' energy: -38.800 flat angles C4'-P-C4' energy: -52.972 flat angles P-C4'-P energy: -29.297 tors. eta vs tors. theta energy: -37.382 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -571.221803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.221803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.821803 (E_RNA) where: Base-Base interactions energy: -277.381 where: short stacking energy: -124.920 Base-Backbone interact. energy: 0.322 local terms energy: -207.762631 where: bonds (distance) C4'-P energy: -48.200 bonds (distance) P-C4' energy: -54.241 flat angles C4'-P-C4' energy: -39.702 flat angles P-C4'-P energy: -30.009 tors. eta vs tors. theta energy: -35.611 Dist. restrs. and SS energy: -86.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -375.734396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.734396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.734396 (E_RNA) where: Base-Base interactions energy: -161.243 where: short stacking energy: -72.045 Base-Backbone interact. energy: -0.772 local terms energy: -177.719902 where: bonds (distance) C4'-P energy: -36.069 bonds (distance) P-C4' energy: -50.593 flat angles C4'-P-C4' energy: -52.323 flat angles P-C4'-P energy: -23.208 tors. eta vs tors. theta energy: -15.527 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -581.303651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -581.303651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.103651 (E_RNA) where: Base-Base interactions energy: -296.590 where: short stacking energy: -114.844 Base-Backbone interact. energy: -0.672 local terms energy: -177.841380 where: bonds (distance) C4'-P energy: -44.064 bonds (distance) P-C4' energy: -52.282 flat angles C4'-P-C4' energy: -41.560 flat angles P-C4'-P energy: -21.804 tors. eta vs tors. theta energy: -18.132 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -981.066271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -981.066271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -851.466271 (E_RNA) where: Base-Base interactions energy: -556.624 where: short stacking energy: -263.849 Base-Backbone interact. energy: -0.182 local terms energy: -294.660462 where: bonds (distance) C4'-P energy: -58.107 bonds (distance) P-C4' energy: -59.297 flat angles C4'-P-C4' energy: -62.879 flat angles P-C4'-P energy: -39.958 tors. eta vs tors. theta energy: -74.419 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -929.621218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -929.621218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -801.821218 (E_RNA) where: Base-Base interactions energy: -526.469 where: short stacking energy: -217.783 Base-Backbone interact. energy: -1.685 local terms energy: -273.667190 where: bonds (distance) C4'-P energy: -63.474 bonds (distance) P-C4' energy: -55.257 flat angles C4'-P-C4' energy: -61.357 flat angles P-C4'-P energy: -32.671 tors. eta vs tors. theta energy: -60.909 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -863.498112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -863.498112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.498112 (E_RNA) where: Base-Base interactions energy: -501.122 where: short stacking energy: -204.925 Base-Backbone interact. energy: 1.074 local terms energy: -255.450069 where: bonds (distance) C4'-P energy: -55.692 bonds (distance) P-C4' energy: -53.096 flat angles C4'-P-C4' energy: -56.200 flat angles P-C4'-P energy: -36.500 tors. eta vs tors. theta energy: -53.962 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -799.547885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.547885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.547885 (E_RNA) where: Base-Base interactions energy: -448.715 where: short stacking energy: -191.758 Base-Backbone interact. energy: -1.597 local terms energy: -259.235855 where: bonds (distance) C4'-P energy: -57.785 bonds (distance) P-C4' energy: -61.343 flat angles C4'-P-C4' energy: -61.737 flat angles P-C4'-P energy: -28.449 tors. eta vs tors. theta energy: -49.921 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -755.704188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.704188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.504188 (E_RNA) where: Base-Base interactions energy: -396.954 where: short stacking energy: -204.631 Base-Backbone interact. energy: -1.902 local terms energy: -259.648335 where: bonds (distance) C4'-P energy: -51.827 bonds (distance) P-C4' energy: -53.175 flat angles C4'-P-C4' energy: -53.288 flat angles P-C4'-P energy: -41.890 tors. eta vs tors. theta energy: -59.467 Dist. restrs. and SS energy: -97.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -646.892010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -646.892010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.692010 (E_RNA) where: Base-Base interactions energy: -341.707 where: short stacking energy: -141.451 Base-Backbone interact. energy: -2.258 local terms energy: -223.727041 where: bonds (distance) C4'-P energy: -46.087 bonds (distance) P-C4' energy: -46.971 flat angles C4'-P-C4' energy: -59.335 flat angles P-C4'-P energy: -32.329 tors. eta vs tors. theta energy: -39.006 Dist. restrs. and SS energy: -79.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -578.889123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.889123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.089123 (E_RNA) where: Base-Base interactions energy: -281.392 where: short stacking energy: -130.641 Base-Backbone interact. energy: -2.314 local terms energy: -212.383115 where: bonds (distance) C4'-P energy: -50.514 bonds (distance) P-C4' energy: -61.445 flat angles C4'-P-C4' energy: -53.539 flat angles P-C4'-P energy: -26.083 tors. eta vs tors. theta energy: -20.802 Dist. restrs. and SS energy: -82.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -602.371254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.371254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.771254 (E_RNA) where: Base-Base interactions energy: -357.066 where: short stacking energy: -161.398 Base-Backbone interact. energy: -1.599 local terms energy: -186.106089 where: bonds (distance) C4'-P energy: -50.051 bonds (distance) P-C4' energy: -40.336 flat angles C4'-P-C4' energy: -38.560 flat angles P-C4'-P energy: -26.753 tors. eta vs tors. theta energy: -30.406 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -584.104546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.104546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.104546 (E_RNA) where: Base-Base interactions energy: -298.128 where: short stacking energy: -129.639 Base-Backbone interact. energy: 0.419 local terms energy: -187.394961 where: bonds (distance) C4'-P energy: -42.945 bonds (distance) P-C4' energy: -44.138 flat angles C4'-P-C4' energy: -46.723 flat angles P-C4'-P energy: -34.222 tors. eta vs tors. theta energy: -19.367 Dist. restrs. and SS energy: -99.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -324.916831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.916831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.916831 (E_RNA) where: Base-Base interactions energy: -135.190 where: short stacking energy: -62.117 Base-Backbone interact. energy: 0.503 local terms energy: -154.230669 where: bonds (distance) C4'-P energy: -46.048 bonds (distance) P-C4' energy: -48.524 flat angles C4'-P-C4' energy: -39.623 flat angles P-C4'-P energy: -25.244 tors. eta vs tors. theta energy: 5.208 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -984.067070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.067070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -854.467070 (E_RNA) where: Base-Base interactions energy: -554.093 where: short stacking energy: -264.449 Base-Backbone interact. energy: -0.986 local terms energy: -299.388437 where: bonds (distance) C4'-P energy: -55.204 bonds (distance) P-C4' energy: -60.228 flat angles C4'-P-C4' energy: -59.309 flat angles P-C4'-P energy: -46.517 tors. eta vs tors. theta energy: -78.131 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -948.454726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -948.454726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -818.854726 (E_RNA) where: Base-Base interactions energy: -535.962 where: short stacking energy: -231.365 Base-Backbone interact. energy: -0.317 local terms energy: -282.575289 where: bonds (distance) C4'-P energy: -50.269 bonds (distance) P-C4' energy: -62.923 flat angles C4'-P-C4' energy: -60.843 flat angles P-C4'-P energy: -43.944 tors. eta vs tors. theta energy: -64.597 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -875.278951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.278951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.478951 (E_RNA) where: Base-Base interactions energy: -501.526 where: short stacking energy: -216.800 Base-Backbone interact. energy: 4.252 local terms energy: -268.204835 where: bonds (distance) C4'-P energy: -44.353 bonds (distance) P-C4' energy: -60.295 flat angles C4'-P-C4' energy: -67.479 flat angles P-C4'-P energy: -37.599 tors. eta vs tors. theta energy: -58.479 Dist. restrs. and SS energy: -109.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -800.921580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.921580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.121580 (E_RNA) where: Base-Base interactions energy: -451.144 where: short stacking energy: -209.785 Base-Backbone interact. energy: -1.826 local terms energy: -256.151444 where: bonds (distance) C4'-P energy: -40.989 bonds (distance) P-C4' energy: -49.286 flat angles C4'-P-C4' energy: -60.552 flat angles P-C4'-P energy: -45.274 tors. eta vs tors. theta energy: -60.051 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -731.990492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.990492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.390492 (E_RNA) where: Base-Base interactions energy: -393.246 where: short stacking energy: -185.686 Base-Backbone interact. energy: -1.522 local terms energy: -243.622509 where: bonds (distance) C4'-P energy: -57.888 bonds (distance) P-C4' energy: -46.436 flat angles C4'-P-C4' energy: -50.788 flat angles P-C4'-P energy: -35.123 tors. eta vs tors. theta energy: -53.387 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -718.002595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.002595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.002595 (E_RNA) where: Base-Base interactions energy: -393.945 where: short stacking energy: -170.666 Base-Backbone interact. energy: -2.951 local terms energy: -240.106999 where: bonds (distance) C4'-P energy: -51.747 bonds (distance) P-C4' energy: -48.599 flat angles C4'-P-C4' energy: -60.689 flat angles P-C4'-P energy: -33.155 tors. eta vs tors. theta energy: -45.918 Dist. restrs. and SS energy: -81.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -607.594917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.594917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.994917 (E_RNA) where: Base-Base interactions energy: -294.520 where: short stacking energy: -148.276 Base-Backbone interact. energy: 0.774 local terms energy: -220.248543 where: bonds (distance) C4'-P energy: -44.540 bonds (distance) P-C4' energy: -54.309 flat angles C4'-P-C4' energy: -54.208 flat angles P-C4'-P energy: -26.608 tors. eta vs tors. theta energy: -40.584 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -643.856860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.856860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.456860 (E_RNA) where: Base-Base interactions energy: -338.601 where: short stacking energy: -137.758 Base-Backbone interact. energy: 4.833 local terms energy: -205.689125 where: bonds (distance) C4'-P energy: -48.795 bonds (distance) P-C4' energy: -53.987 flat angles C4'-P-C4' energy: -44.963 flat angles P-C4'-P energy: -31.098 tors. eta vs tors. theta energy: -26.846 Dist. restrs. and SS energy: -104.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -516.337577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.337577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.737577 (E_RNA) where: Base-Base interactions energy: -272.819 where: short stacking energy: -99.307 Base-Backbone interact. energy: 0.210 local terms energy: -186.128144 where: bonds (distance) C4'-P energy: -51.581 bonds (distance) P-C4' energy: -58.304 flat angles C4'-P-C4' energy: -33.246 flat angles P-C4'-P energy: -27.732 tors. eta vs tors. theta energy: -15.266 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -360.134397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.134397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.334397 (E_RNA) where: Base-Base interactions energy: -145.546 where: short stacking energy: -84.651 Base-Backbone interact. energy: 0.818 local terms energy: -168.606563 where: bonds (distance) C4'-P energy: -49.643 bonds (distance) P-C4' energy: -55.958 flat angles C4'-P-C4' energy: -40.901 flat angles P-C4'-P energy: -25.122 tors. eta vs tors. theta energy: 3.017 Dist. restrs. and SS energy: -46.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -979.978198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -979.978198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.978198 (E_RNA) where: Base-Base interactions energy: -549.856 where: short stacking energy: -250.685 Base-Backbone interact. energy: -0.430 local terms energy: -303.692448 where: bonds (distance) C4'-P energy: -61.750 bonds (distance) P-C4' energy: -55.222 flat angles C4'-P-C4' energy: -62.840 flat angles P-C4'-P energy: -39.893 tors. eta vs tors. theta energy: -83.987 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -953.305947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -953.305947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -825.505947 (E_RNA) where: Base-Base interactions energy: -558.042 where: short stacking energy: -247.742 Base-Backbone interact. energy: -0.638 local terms energy: -266.826629 where: bonds (distance) C4'-P energy: -42.821 bonds (distance) P-C4' energy: -50.177 flat angles C4'-P-C4' energy: -63.714 flat angles P-C4'-P energy: -43.421 tors. eta vs tors. theta energy: -66.694 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -915.120795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -915.120795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -792.720795 (E_RNA) where: Base-Base interactions energy: -532.145 where: short stacking energy: -216.554 Base-Backbone interact. energy: -0.792 local terms energy: -259.784395 where: bonds (distance) C4'-P energy: -56.992 bonds (distance) P-C4' energy: -53.889 flat angles C4'-P-C4' energy: -49.710 flat angles P-C4'-P energy: -33.101 tors. eta vs tors. theta energy: -66.092 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -815.020280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.020280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.020280 (E_RNA) where: Base-Base interactions energy: -466.127 where: short stacking energy: -208.110 Base-Backbone interact. energy: -1.042 local terms energy: -257.851287 where: bonds (distance) C4'-P energy: -47.030 bonds (distance) P-C4' energy: -53.700 flat angles C4'-P-C4' energy: -59.750 flat angles P-C4'-P energy: -32.868 tors. eta vs tors. theta energy: -64.503 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -737.816499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.816499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.216499 (E_RNA) where: Base-Base interactions energy: -393.557 where: short stacking energy: -196.468 Base-Backbone interact. energy: -0.718 local terms energy: -249.941227 where: bonds (distance) C4'-P energy: -49.462 bonds (distance) P-C4' energy: -56.590 flat angles C4'-P-C4' energy: -59.465 flat angles P-C4'-P energy: -31.601 tors. eta vs tors. theta energy: -52.823 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -723.845160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -723.845160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.445160 (E_RNA) where: Base-Base interactions energy: -401.875 where: short stacking energy: -180.044 Base-Backbone interact. energy: -0.740 local terms energy: -234.830631 where: bonds (distance) C4'-P energy: -49.743 bonds (distance) P-C4' energy: -49.086 flat angles C4'-P-C4' energy: -47.125 flat angles P-C4'-P energy: -41.718 tors. eta vs tors. theta energy: -47.158 Dist. restrs. and SS energy: -86.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -748.761474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.761474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.161474 (E_RNA) where: Base-Base interactions energy: -418.337 where: short stacking energy: -170.870 Base-Backbone interact. energy: 2.274 local terms energy: -212.098366 where: bonds (distance) C4'-P energy: -44.162 bonds (distance) P-C4' energy: -39.346 flat angles C4'-P-C4' energy: -54.030 flat angles P-C4'-P energy: -27.277 tors. eta vs tors. theta energy: -47.283 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -599.391606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.391606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.391606 (E_RNA) where: Base-Base interactions energy: -305.083 where: short stacking energy: -146.671 Base-Backbone interact. energy: -1.400 local terms energy: -202.908582 where: bonds (distance) C4'-P energy: -49.108 bonds (distance) P-C4' energy: -52.233 flat angles C4'-P-C4' energy: -43.622 flat angles P-C4'-P energy: -32.177 tors. eta vs tors. theta energy: -25.769 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -445.870673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.870673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.270673 (E_RNA) where: Base-Base interactions energy: -221.329 where: short stacking energy: -107.845 Base-Backbone interact. energy: -1.214 local terms energy: -165.727700 where: bonds (distance) C4'-P energy: -47.669 bonds (distance) P-C4' energy: -36.206 flat angles C4'-P-C4' energy: -36.793 flat angles P-C4'-P energy: -27.458 tors. eta vs tors. theta energy: -17.602 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -440.060388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.060388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.260388 (E_RNA) where: Base-Base interactions energy: -202.596 where: short stacking energy: -88.770 Base-Backbone interact. energy: -0.927 local terms energy: -162.737153 where: bonds (distance) C4'-P energy: -40.455 bonds (distance) P-C4' energy: -60.418 flat angles C4'-P-C4' energy: -34.580 flat angles P-C4'-P energy: -22.069 tors. eta vs tors. theta energy: -5.215 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -988.401660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -988.401660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -858.801660 (E_RNA) where: Base-Base interactions energy: -564.028 where: short stacking energy: -262.764 Base-Backbone interact. energy: -0.015 local terms energy: -294.758468 where: bonds (distance) C4'-P energy: -56.355 bonds (distance) P-C4' energy: -59.954 flat angles C4'-P-C4' energy: -58.420 flat angles P-C4'-P energy: -42.211 tors. eta vs tors. theta energy: -77.818 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -975.071881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.071881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -847.271881 (E_RNA) where: Base-Base interactions energy: -567.781 where: short stacking energy: -250.827 Base-Backbone interact. energy: -0.720 local terms energy: -278.771134 where: bonds (distance) C4'-P energy: -62.165 bonds (distance) P-C4' energy: -52.407 flat angles C4'-P-C4' energy: -49.408 flat angles P-C4'-P energy: -42.961 tors. eta vs tors. theta energy: -71.830 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -940.092366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -940.092366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.492366 (E_RNA) where: Base-Base interactions energy: -564.252 where: short stacking energy: -223.253 Base-Backbone interact. energy: 0.588 local terms energy: -255.828802 where: bonds (distance) C4'-P energy: -49.127 bonds (distance) P-C4' energy: -54.463 flat angles C4'-P-C4' energy: -54.444 flat angles P-C4'-P energy: -36.217 tors. eta vs tors. theta energy: -61.578 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -783.395165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.395165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.595165 (E_RNA) where: Base-Base interactions energy: -429.938 where: short stacking energy: -212.135 Base-Backbone interact. energy: -0.070 local terms energy: -261.586908 where: bonds (distance) C4'-P energy: -59.750 bonds (distance) P-C4' energy: -49.744 flat angles C4'-P-C4' energy: -52.478 flat angles P-C4'-P energy: -38.198 tors. eta vs tors. theta energy: -61.417 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -754.807257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -754.807257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.007257 (E_RNA) where: Base-Base interactions energy: -427.110 where: short stacking energy: -199.994 Base-Backbone interact. energy: -2.142 local terms energy: -233.755138 where: bonds (distance) C4'-P energy: -44.074 bonds (distance) P-C4' energy: -51.597 flat angles C4'-P-C4' energy: -53.188 flat angles P-C4'-P energy: -34.555 tors. eta vs tors. theta energy: -50.341 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -797.318906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.318906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.918906 (E_RNA) where: Base-Base interactions energy: -458.116 where: short stacking energy: -188.365 Base-Backbone interact. energy: 0.146 local terms energy: -216.949413 where: bonds (distance) C4'-P energy: -57.630 bonds (distance) P-C4' energy: -44.974 flat angles C4'-P-C4' energy: -52.541 flat angles P-C4'-P energy: -20.125 tors. eta vs tors. theta energy: -41.679 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -724.343252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.343252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.343252 (E_RNA) where: Base-Base interactions energy: -386.156 where: short stacking energy: -161.083 Base-Backbone interact. energy: 0.342 local terms energy: -230.528381 where: bonds (distance) C4'-P energy: -52.398 bonds (distance) P-C4' energy: -47.762 flat angles C4'-P-C4' energy: -46.386 flat angles P-C4'-P energy: -43.757 tors. eta vs tors. theta energy: -40.226 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -576.965270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.965270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.965270 (E_RNA) where: Base-Base interactions energy: -298.853 where: short stacking energy: -138.190 Base-Backbone interact. energy: -0.241 local terms energy: -187.871882 where: bonds (distance) C4'-P energy: -46.361 bonds (distance) P-C4' energy: -47.557 flat angles C4'-P-C4' energy: -44.828 flat angles P-C4'-P energy: -26.104 tors. eta vs tors. theta energy: -23.023 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -472.901267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.901267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.101267 (E_RNA) where: Base-Base interactions energy: -212.901 where: short stacking energy: -76.044 Base-Backbone interact. energy: 0.708 local terms energy: -177.907444 where: bonds (distance) C4'-P energy: -47.981 bonds (distance) P-C4' energy: -57.192 flat angles C4'-P-C4' energy: -49.810 flat angles P-C4'-P energy: -15.807 tors. eta vs tors. theta energy: -7.118 Dist. restrs. and SS energy: -82.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -534.502675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.502675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.102675 (E_RNA) where: Base-Base interactions energy: -265.318 where: short stacking energy: -108.113 Base-Backbone interact. energy: 2.007 local terms energy: -175.792200 where: bonds (distance) C4'-P energy: -40.265 bonds (distance) P-C4' energy: -30.810 flat angles C4'-P-C4' energy: -42.277 flat angles P-C4'-P energy: -36.588 tors. eta vs tors. theta energy: -25.852 Dist. restrs. and SS energy: -95.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -985.943356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.943356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -858.143356 (E_RNA) where: Base-Base interactions energy: -566.882 where: short stacking energy: -268.548 Base-Backbone interact. energy: -0.606 local terms energy: -290.655706 where: bonds (distance) C4'-P energy: -50.845 bonds (distance) P-C4' energy: -60.355 flat angles C4'-P-C4' energy: -59.048 flat angles P-C4'-P energy: -39.959 tors. eta vs tors. theta energy: -80.448 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -985.553219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.553219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.953219 (E_RNA) where: Base-Base interactions energy: -569.377 where: short stacking energy: -244.707 Base-Backbone interact. energy: -1.224 local terms energy: -285.352223 where: bonds (distance) C4'-P energy: -48.487 bonds (distance) P-C4' energy: -56.635 flat angles C4'-P-C4' energy: -66.163 flat angles P-C4'-P energy: -34.580 tors. eta vs tors. theta energy: -79.487 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -976.952449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -976.952449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -852.752449 (E_RNA) where: Base-Base interactions energy: -579.708 where: short stacking energy: -245.670 Base-Backbone interact. energy: 0.559 local terms energy: -273.603704 where: bonds (distance) C4'-P energy: -52.068 bonds (distance) P-C4' energy: -51.369 flat angles C4'-P-C4' energy: -52.653 flat angles P-C4'-P energy: -40.657 tors. eta vs tors. theta energy: -76.857 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -783.191130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.191130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.391130 (E_RNA) where: Base-Base interactions energy: -432.317 where: short stacking energy: -211.939 Base-Backbone interact. energy: -0.944 local terms energy: -258.130414 where: bonds (distance) C4'-P energy: -44.649 bonds (distance) P-C4' energy: -52.631 flat angles C4'-P-C4' energy: -55.705 flat angles P-C4'-P energy: -42.803 tors. eta vs tors. theta energy: -62.342 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -762.069314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.069314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.469314 (E_RNA) where: Base-Base interactions energy: -430.505 where: short stacking energy: -204.314 Base-Backbone interact. energy: -0.787 local terms energy: -237.177562 where: bonds (distance) C4'-P energy: -47.317 bonds (distance) P-C4' energy: -49.525 flat angles C4'-P-C4' energy: -50.833 flat angles P-C4'-P energy: -33.461 tors. eta vs tors. theta energy: -56.041 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -802.967994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -802.967994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.367994 (E_RNA) where: Base-Base interactions energy: -436.625 where: short stacking energy: -195.098 Base-Backbone interact. energy: -0.904 local terms energy: -244.838599 where: bonds (distance) C4'-P energy: -55.720 bonds (distance) P-C4' energy: -49.342 flat angles C4'-P-C4' energy: -49.732 flat angles P-C4'-P energy: -32.519 tors. eta vs tors. theta energy: -57.526 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -748.910004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.910004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.710004 (E_RNA) where: Base-Base interactions energy: -422.500 where: short stacking energy: -183.597 Base-Backbone interact. energy: -0.523 local terms energy: -219.686067 where: bonds (distance) C4'-P energy: -38.754 bonds (distance) P-C4' energy: -52.281 flat angles C4'-P-C4' energy: -46.820 flat angles P-C4'-P energy: -35.571 tors. eta vs tors. theta energy: -46.260 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -619.194327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.194327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.794327 (E_RNA) where: Base-Base interactions energy: -329.058 where: short stacking energy: -170.734 Base-Backbone interact. energy: 2.718 local terms energy: -206.454715 where: bonds (distance) C4'-P energy: -38.699 bonds (distance) P-C4' energy: -59.135 flat angles C4'-P-C4' energy: -46.038 flat angles P-C4'-P energy: -20.487 tors. eta vs tors. theta energy: -42.096 Dist. restrs. and SS energy: -86.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -588.868691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.868691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.868691 (E_RNA) where: Base-Base interactions energy: -281.169 where: short stacking energy: -110.088 Base-Backbone interact. energy: 4.627 local terms energy: -204.326174 where: bonds (distance) C4'-P energy: -50.594 bonds (distance) P-C4' energy: -52.285 flat angles C4'-P-C4' energy: -46.668 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -25.384 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -472.682062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.682062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.882062 (E_RNA) where: Base-Base interactions energy: -236.606 where: short stacking energy: -109.812 Base-Backbone interact. energy: -0.684 local terms energy: -161.591704 where: bonds (distance) C4'-P energy: -42.934 bonds (distance) P-C4' energy: -38.902 flat angles C4'-P-C4' energy: -39.325 flat angles P-C4'-P energy: -25.412 tors. eta vs tors. theta energy: -15.020 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -1004.044382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.044382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -878.044382 (E_RNA) where: Base-Base interactions energy: -572.202 where: short stacking energy: -265.142 Base-Backbone interact. energy: -1.148 local terms energy: -304.694113 where: bonds (distance) C4'-P energy: -63.858 bonds (distance) P-C4' energy: -61.281 flat angles C4'-P-C4' energy: -58.706 flat angles P-C4'-P energy: -41.478 tors. eta vs tors. theta energy: -79.372 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -968.103330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -968.103330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.503330 (E_RNA) where: Base-Base interactions energy: -567.739 where: short stacking energy: -229.342 Base-Backbone interact. energy: -0.691 local terms energy: -270.073020 where: bonds (distance) C4'-P energy: -55.535 bonds (distance) P-C4' energy: -50.571 flat angles C4'-P-C4' energy: -60.443 flat angles P-C4'-P energy: -39.097 tors. eta vs tors. theta energy: -64.427 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -943.353237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -943.353237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -822.753237 (E_RNA) where: Base-Base interactions energy: -545.868 where: short stacking energy: -232.575 Base-Backbone interact. energy: 0.053 local terms energy: -276.937905 where: bonds (distance) C4'-P energy: -52.280 bonds (distance) P-C4' energy: -56.157 flat angles C4'-P-C4' energy: -64.122 flat angles P-C4'-P energy: -39.344 tors. eta vs tors. theta energy: -65.035 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -772.921822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.921822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.121822 (E_RNA) where: Base-Base interactions energy: -432.364 where: short stacking energy: -203.216 Base-Backbone interact. energy: -1.534 local terms energy: -247.223416 where: bonds (distance) C4'-P energy: -51.030 bonds (distance) P-C4' energy: -43.243 flat angles C4'-P-C4' energy: -57.362 flat angles P-C4'-P energy: -43.901 tors. eta vs tors. theta energy: -51.687 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -789.356359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.356359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.756359 (E_RNA) where: Base-Base interactions energy: -450.425 where: short stacking energy: -209.821 Base-Backbone interact. energy: -0.325 local terms energy: -245.006638 where: bonds (distance) C4'-P energy: -52.566 bonds (distance) P-C4' energy: -50.704 flat angles C4'-P-C4' energy: -52.805 flat angles P-C4'-P energy: -34.037 tors. eta vs tors. theta energy: -54.895 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -837.455496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.455496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.055496 (E_RNA) where: Base-Base interactions energy: -456.186 where: short stacking energy: -207.672 Base-Backbone interact. energy: 0.865 local terms energy: -259.733702 where: bonds (distance) C4'-P energy: -51.456 bonds (distance) P-C4' energy: -51.908 flat angles C4'-P-C4' energy: -57.940 flat angles P-C4'-P energy: -36.127 tors. eta vs tors. theta energy: -62.303 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -798.018397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.018397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.818397 (E_RNA) where: Base-Base interactions energy: -436.981 where: short stacking energy: -198.001 Base-Backbone interact. energy: -0.095 local terms energy: -245.742247 where: bonds (distance) C4'-P energy: -44.838 bonds (distance) P-C4' energy: -61.463 flat angles C4'-P-C4' energy: -49.465 flat angles P-C4'-P energy: -35.365 tors. eta vs tors. theta energy: -54.612 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -626.720900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.720900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.120900 (E_RNA) where: Base-Base interactions energy: -348.626 where: short stacking energy: -139.432 Base-Backbone interact. energy: -0.018 local terms energy: -166.476758 where: bonds (distance) C4'-P energy: -36.362 bonds (distance) P-C4' energy: -49.814 flat angles C4'-P-C4' energy: -37.151 flat angles P-C4'-P energy: -16.084 tors. eta vs tors. theta energy: -27.066 Dist. restrs. and SS energy: -111.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -566.943806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.943806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.743806 (E_RNA) where: Base-Base interactions energy: -277.160 where: short stacking energy: -110.719 Base-Backbone interact. energy: -0.932 local terms energy: -200.651273 where: bonds (distance) C4'-P energy: -51.506 bonds (distance) P-C4' energy: -48.488 flat angles C4'-P-C4' energy: -49.290 flat angles P-C4'-P energy: -26.081 tors. eta vs tors. theta energy: -25.287 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -583.155880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.155880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.555880 (E_RNA) where: Base-Base interactions energy: -310.844 where: short stacking energy: -137.645 Base-Backbone interact. energy: -0.279 local terms energy: -160.432537 where: bonds (distance) C4'-P energy: -36.801 bonds (distance) P-C4' energy: -41.786 flat angles C4'-P-C4' energy: -39.482 flat angles P-C4'-P energy: -20.405 tors. eta vs tors. theta energy: -21.959 Dist. restrs. and SS energy: -111.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -980.690197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.690197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -851.090197 (E_RNA) where: Base-Base interactions energy: -554.949 where: short stacking energy: -253.736 Base-Backbone interact. energy: -0.013 local terms energy: -296.128381 where: bonds (distance) C4'-P energy: -55.996 bonds (distance) P-C4' energy: -61.064 flat angles C4'-P-C4' energy: -66.725 flat angles P-C4'-P energy: -42.332 tors. eta vs tors. theta energy: -70.010 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -985.772074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.772074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -856.172074 (E_RNA) where: Base-Base interactions energy: -600.442 where: short stacking energy: -254.129 Base-Backbone interact. energy: -0.320 local terms energy: -255.409517 where: bonds (distance) C4'-P energy: -38.040 bonds (distance) P-C4' energy: -48.913 flat angles C4'-P-C4' energy: -58.874 flat angles P-C4'-P energy: -41.920 tors. eta vs tors. theta energy: -67.661 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -951.066807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -951.066807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.866807 (E_RNA) where: Base-Base interactions energy: -555.381 where: short stacking energy: -234.953 Base-Backbone interact. energy: -0.566 local terms energy: -270.919403 where: bonds (distance) C4'-P energy: -57.569 bonds (distance) P-C4' energy: -52.440 flat angles C4'-P-C4' energy: -50.525 flat angles P-C4'-P energy: -38.770 tors. eta vs tors. theta energy: -71.616 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -777.638311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.638311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.638311 (E_RNA) where: Base-Base interactions energy: -423.985 where: short stacking energy: -188.105 Base-Backbone interact. energy: -0.351 local terms energy: -263.302142 where: bonds (distance) C4'-P energy: -52.867 bonds (distance) P-C4' energy: -57.807 flat angles C4'-P-C4' energy: -59.426 flat angles P-C4'-P energy: -39.853 tors. eta vs tors. theta energy: -53.350 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -836.584636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.584636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.784636 (E_RNA) where: Base-Base interactions energy: -472.616 where: short stacking energy: -201.473 Base-Backbone interact. energy: 0.441 local terms energy: -236.609961 where: bonds (distance) C4'-P energy: -43.570 bonds (distance) P-C4' energy: -50.631 flat angles C4'-P-C4' energy: -53.771 flat angles P-C4'-P energy: -35.840 tors. eta vs tors. theta energy: -52.799 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -793.546337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -793.546337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.746337 (E_RNA) where: Base-Base interactions energy: -450.074 where: short stacking energy: -216.007 Base-Backbone interact. energy: 2.150 local terms energy: -253.822891 where: bonds (distance) C4'-P energy: -43.677 bonds (distance) P-C4' energy: -56.655 flat angles C4'-P-C4' energy: -53.932 flat angles P-C4'-P energy: -35.419 tors. eta vs tors. theta energy: -64.140 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -753.263803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.263803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.063803 (E_RNA) where: Base-Base interactions energy: -408.218 where: short stacking energy: -194.649 Base-Backbone interact. energy: -0.694 local terms energy: -229.151819 where: bonds (distance) C4'-P energy: -44.788 bonds (distance) P-C4' energy: -46.959 flat angles C4'-P-C4' energy: -60.425 flat angles P-C4'-P energy: -34.388 tors. eta vs tors. theta energy: -42.591 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -698.585924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.585924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.785924 (E_RNA) where: Base-Base interactions energy: -361.958 where: short stacking energy: -151.334 Base-Backbone interact. energy: -0.775 local terms energy: -208.052407 where: bonds (distance) C4'-P energy: -49.177 bonds (distance) P-C4' energy: -37.509 flat angles C4'-P-C4' energy: -49.371 flat angles P-C4'-P energy: -32.017 tors. eta vs tors. theta energy: -39.979 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -621.703129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.703129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.503129 (E_RNA) where: Base-Base interactions energy: -315.801 where: short stacking energy: -132.443 Base-Backbone interact. energy: 0.321 local terms energy: -182.023119 where: bonds (distance) C4'-P energy: -36.399 bonds (distance) P-C4' energy: -45.017 flat angles C4'-P-C4' energy: -46.789 flat angles P-C4'-P energy: -32.248 tors. eta vs tors. theta energy: -21.571 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -597.722025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.722025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.322025 (E_RNA) where: Base-Base interactions energy: -321.226 where: short stacking energy: -127.483 Base-Backbone interact. energy: -0.324 local terms energy: -171.772724 where: bonds (distance) C4'-P energy: -42.457 bonds (distance) P-C4' energy: -51.858 flat angles C4'-P-C4' energy: -41.394 flat angles P-C4'-P energy: -21.496 tors. eta vs tors. theta energy: -14.568 Dist. restrs. and SS energy: -104.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -977.451647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.451647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.651647 (E_RNA) where: Base-Base interactions energy: -558.810 where: short stacking energy: -246.278 Base-Backbone interact. energy: -0.799 local terms energy: -290.042093 where: bonds (distance) C4'-P energy: -49.963 bonds (distance) P-C4' energy: -65.795 flat angles C4'-P-C4' energy: -62.579 flat angles P-C4'-P energy: -45.089 tors. eta vs tors. theta energy: -66.616 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -996.044523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.044523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -868.244523 (E_RNA) where: Base-Base interactions energy: -579.431 where: short stacking energy: -249.240 Base-Backbone interact. energy: 1.133 local terms energy: -289.946439 where: bonds (distance) C4'-P energy: -57.283 bonds (distance) P-C4' energy: -48.490 flat angles C4'-P-C4' energy: -63.896 flat angles P-C4'-P energy: -44.399 tors. eta vs tors. theta energy: -75.878 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -937.279970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.279970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.079970 (E_RNA) where: Base-Base interactions energy: -542.040 where: short stacking energy: -231.435 Base-Backbone interact. energy: -1.470 local terms energy: -269.570850 where: bonds (distance) C4'-P energy: -46.903 bonds (distance) P-C4' energy: -53.139 flat angles C4'-P-C4' energy: -66.550 flat angles P-C4'-P energy: -31.864 tors. eta vs tors. theta energy: -71.115 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -853.710612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.710612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.710612 (E_RNA) where: Base-Base interactions energy: -482.317 where: short stacking energy: -202.142 Base-Backbone interact. energy: -0.480 local terms energy: -244.914227 where: bonds (distance) C4'-P energy: -53.767 bonds (distance) P-C4' energy: -49.479 flat angles C4'-P-C4' energy: -57.225 flat angles P-C4'-P energy: -29.369 tors. eta vs tors. theta energy: -55.074 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -744.958956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.958956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.158956 (E_RNA) where: Base-Base interactions energy: -403.749 where: short stacking energy: -177.762 Base-Backbone interact. energy: -1.932 local terms energy: -247.477929 where: bonds (distance) C4'-P energy: -47.085 bonds (distance) P-C4' energy: -50.200 flat angles C4'-P-C4' energy: -55.067 flat angles P-C4'-P energy: -39.585 tors. eta vs tors. theta energy: -55.542 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -751.585013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.585013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.585013 (E_RNA) where: Base-Base interactions energy: -429.402 where: short stacking energy: -193.112 Base-Backbone interact. energy: -1.045 local terms energy: -231.137287 where: bonds (distance) C4'-P energy: -48.113 bonds (distance) P-C4' energy: -57.316 flat angles C4'-P-C4' energy: -42.043 flat angles P-C4'-P energy: -39.277 tors. eta vs tors. theta energy: -44.388 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -725.234967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.234967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.634967 (E_RNA) where: Base-Base interactions energy: -389.861 where: short stacking energy: -171.613 Base-Backbone interact. energy: 0.840 local terms energy: -224.613983 where: bonds (distance) C4'-P energy: -52.584 bonds (distance) P-C4' energy: -43.393 flat angles C4'-P-C4' energy: -53.875 flat angles P-C4'-P energy: -30.984 tors. eta vs tors. theta energy: -43.777 Dist. restrs. and SS energy: -111.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -689.821754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.821754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.421754 (E_RNA) where: Base-Base interactions energy: -372.574 where: short stacking energy: -155.062 Base-Backbone interact. energy: 2.833 local terms energy: -197.680738 where: bonds (distance) C4'-P energy: -47.453 bonds (distance) P-C4' energy: -41.055 flat angles C4'-P-C4' energy: -54.434 flat angles P-C4'-P energy: -23.732 tors. eta vs tors. theta energy: -31.007 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -671.397006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.397006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.397006 (E_RNA) where: Base-Base interactions energy: -359.483 where: short stacking energy: -157.016 Base-Backbone interact. energy: 2.013 local terms energy: -187.926526 where: bonds (distance) C4'-P energy: -44.595 bonds (distance) P-C4' energy: -41.615 flat angles C4'-P-C4' energy: -51.073 flat angles P-C4'-P energy: -30.436 tors. eta vs tors. theta energy: -20.206 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -708.632469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.632469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.232469 (E_RNA) where: Base-Base interactions energy: -377.144 where: short stacking energy: -161.681 Base-Backbone interact. energy: -0.785 local terms energy: -226.302881 where: bonds (distance) C4'-P energy: -51.165 bonds (distance) P-C4' energy: -53.424 flat angles C4'-P-C4' energy: -42.938 flat angles P-C4'-P energy: -40.370 tors. eta vs tors. theta energy: -38.407 Dist. restrs. and SS energy: -104.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -1002.505756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1002.505756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.905756 (E_RNA) where: Base-Base interactions energy: -572.178 where: short stacking energy: -257.291 Base-Backbone interact. energy: -0.552 local terms energy: -300.174819 where: bonds (distance) C4'-P energy: -54.310 bonds (distance) P-C4' energy: -59.296 flat angles C4'-P-C4' energy: -62.920 flat angles P-C4'-P energy: -47.214 tors. eta vs tors. theta energy: -76.434 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -952.566795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -952.566795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.566795 (E_RNA) where: Base-Base interactions energy: -531.783 where: short stacking energy: -248.611 Base-Backbone interact. energy: -2.534 local terms energy: -292.250210 where: bonds (distance) C4'-P energy: -51.576 bonds (distance) P-C4' energy: -51.365 flat angles C4'-P-C4' energy: -66.831 flat angles P-C4'-P energy: -45.763 tors. eta vs tors. theta energy: -76.716 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -937.491325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.491325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.091325 (E_RNA) where: Base-Base interactions energy: -563.477 where: short stacking energy: -229.885 Base-Backbone interact. energy: -2.153 local terms energy: -249.460550 where: bonds (distance) C4'-P energy: -58.781 bonds (distance) P-C4' energy: -46.536 flat angles C4'-P-C4' energy: -43.426 flat angles P-C4'-P energy: -39.903 tors. eta vs tors. theta energy: -60.816 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -868.888514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -868.888514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.088514 (E_RNA) where: Base-Base interactions energy: -475.896 where: short stacking energy: -203.633 Base-Backbone interact. energy: -0.356 local terms energy: -264.836848 where: bonds (distance) C4'-P energy: -54.213 bonds (distance) P-C4' energy: -54.304 flat angles C4'-P-C4' energy: -63.293 flat angles P-C4'-P energy: -38.276 tors. eta vs tors. theta energy: -54.750 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -811.879207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -811.879207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.279207 (E_RNA) where: Base-Base interactions energy: -456.114 where: short stacking energy: -212.132 Base-Backbone interact. energy: 0.240 local terms energy: -262.405299 where: bonds (distance) C4'-P energy: -51.006 bonds (distance) P-C4' energy: -58.623 flat angles C4'-P-C4' energy: -48.962 flat angles P-C4'-P energy: -38.945 tors. eta vs tors. theta energy: -64.870 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -738.553922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.553922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.553922 (E_RNA) where: Base-Base interactions energy: -405.214 where: short stacking energy: -183.759 Base-Backbone interact. energy: 2.290 local terms energy: -245.630708 where: bonds (distance) C4'-P energy: -53.118 bonds (distance) P-C4' energy: -53.512 flat angles C4'-P-C4' energy: -38.396 flat angles P-C4'-P energy: -44.172 tors. eta vs tors. theta energy: -56.432 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -740.196152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.196152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.796152 (E_RNA) where: Base-Base interactions energy: -387.491 where: short stacking energy: -158.590 Base-Backbone interact. energy: -1.759 local terms energy: -228.545941 where: bonds (distance) C4'-P energy: -51.559 bonds (distance) P-C4' energy: -56.875 flat angles C4'-P-C4' energy: -55.743 flat angles P-C4'-P energy: -33.147 tors. eta vs tors. theta energy: -31.222 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -761.382977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.382977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.782977 (E_RNA) where: Base-Base interactions energy: -424.884 where: short stacking energy: -194.824 Base-Backbone interact. energy: 0.078 local terms energy: -224.976740 where: bonds (distance) C4'-P energy: -40.733 bonds (distance) P-C4' energy: -48.204 flat angles C4'-P-C4' energy: -56.891 flat angles P-C4'-P energy: -28.982 tors. eta vs tors. theta energy: -50.166 Dist. restrs. and SS energy: -111.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -800.587421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.587421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.787421 (E_RNA) where: Base-Base interactions energy: -444.337 where: short stacking energy: -194.291 Base-Backbone interact. energy: -0.405 local terms energy: -237.045514 where: bonds (distance) C4'-P energy: -51.279 bonds (distance) P-C4' energy: -49.973 flat angles C4'-P-C4' energy: -48.808 flat angles P-C4'-P energy: -34.721 tors. eta vs tors. theta energy: -52.265 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -644.142834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.142834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.142834 (E_RNA) where: Base-Base interactions energy: -332.148 where: short stacking energy: -139.544 Base-Backbone interact. energy: -2.168 local terms energy: -183.827051 where: bonds (distance) C4'-P energy: -28.894 bonds (distance) P-C4' energy: -43.927 flat angles C4'-P-C4' energy: -52.490 flat angles P-C4'-P energy: -37.510 tors. eta vs tors. theta energy: -21.005 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -1018.976833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1018.976833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.376833 (E_RNA) where: Base-Base interactions energy: -581.948 where: short stacking energy: -248.220 Base-Backbone interact. energy: -0.429 local terms energy: -306.999402 where: bonds (distance) C4'-P energy: -61.394 bonds (distance) P-C4' energy: -56.661 flat angles C4'-P-C4' energy: -67.115 flat angles P-C4'-P energy: -46.296 tors. eta vs tors. theta energy: -75.533 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -973.876948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -973.876948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -844.276948 (E_RNA) where: Base-Base interactions energy: -554.650 where: short stacking energy: -266.839 Base-Backbone interact. energy: -0.627 local terms energy: -289.000237 where: bonds (distance) C4'-P energy: -53.342 bonds (distance) P-C4' energy: -52.076 flat angles C4'-P-C4' energy: -65.144 flat angles P-C4'-P energy: -40.585 tors. eta vs tors. theta energy: -77.853 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -947.370335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -947.370335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.970335 (E_RNA) where: Base-Base interactions energy: -551.817 where: short stacking energy: -226.835 Base-Backbone interact. energy: 2.804 local terms energy: -275.956856 where: bonds (distance) C4'-P energy: -55.132 bonds (distance) P-C4' energy: -60.580 flat angles C4'-P-C4' energy: -58.617 flat angles P-C4'-P energy: -39.835 tors. eta vs tors. theta energy: -61.793 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -884.058166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.058166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.458166 (E_RNA) where: Base-Base interactions energy: -491.857 where: short stacking energy: -217.446 Base-Backbone interact. energy: -0.463 local terms energy: -262.138114 where: bonds (distance) C4'-P energy: -49.303 bonds (distance) P-C4' energy: -50.170 flat angles C4'-P-C4' energy: -57.002 flat angles P-C4'-P energy: -43.467 tors. eta vs tors. theta energy: -62.195 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -812.344605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.344605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.744605 (E_RNA) where: Base-Base interactions energy: -447.737 where: short stacking energy: -217.144 Base-Backbone interact. energy: -0.231 local terms energy: -270.776852 where: bonds (distance) C4'-P energy: -54.401 bonds (distance) P-C4' energy: -56.127 flat angles C4'-P-C4' energy: -53.474 flat angles P-C4'-P energy: -38.582 tors. eta vs tors. theta energy: -68.193 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -750.455064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.455064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.455064 (E_RNA) where: Base-Base interactions energy: -405.647 where: short stacking energy: -161.583 Base-Backbone interact. energy: -1.717 local terms energy: -217.090814 where: bonds (distance) C4'-P energy: -48.499 bonds (distance) P-C4' energy: -43.299 flat angles C4'-P-C4' energy: -57.600 flat angles P-C4'-P energy: -39.827 tors. eta vs tors. theta energy: -27.866 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -705.730001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.730001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.930001 (E_RNA) where: Base-Base interactions energy: -384.398 where: short stacking energy: -167.939 Base-Backbone interact. energy: -1.286 local terms energy: -228.245625 where: bonds (distance) C4'-P energy: -41.886 bonds (distance) P-C4' energy: -45.205 flat angles C4'-P-C4' energy: -58.111 flat angles P-C4'-P energy: -33.301 tors. eta vs tors. theta energy: -49.742 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -797.028728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.028728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.028728 (E_RNA) where: Base-Base interactions energy: -450.663 where: short stacking energy: -191.320 Base-Backbone interact. energy: 3.582 local terms energy: -223.947017 where: bonds (distance) C4'-P energy: -42.850 bonds (distance) P-C4' energy: -34.562 flat angles C4'-P-C4' energy: -53.001 flat angles P-C4'-P energy: -42.088 tors. eta vs tors. theta energy: -51.446 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -728.912765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.912765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.312765 (E_RNA) where: Base-Base interactions energy: -377.968 where: short stacking energy: -159.762 Base-Backbone interact. energy: -0.653 local terms energy: -238.691910 where: bonds (distance) C4'-P energy: -48.429 bonds (distance) P-C4' energy: -49.266 flat angles C4'-P-C4' energy: -51.818 flat angles P-C4'-P energy: -34.132 tors. eta vs tors. theta energy: -55.046 Dist. restrs. and SS energy: -111.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -660.598314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.598314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.998314 (E_RNA) where: Base-Base interactions energy: -353.910 where: short stacking energy: -145.062 Base-Backbone interact. energy: -0.246 local terms energy: -176.842777 where: bonds (distance) C4'-P energy: -41.605 bonds (distance) P-C4' energy: -41.007 flat angles C4'-P-C4' energy: -31.755 flat angles P-C4'-P energy: -29.573 tors. eta vs tors. theta energy: -32.903 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -1050.747304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1050.747304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.947304 (E_RNA) where: Base-Base interactions energy: -628.575 where: short stacking energy: -261.420 Base-Backbone interact. energy: 1.480 local terms energy: -295.852885 where: bonds (distance) C4'-P energy: -49.814 bonds (distance) P-C4' energy: -61.109 flat angles C4'-P-C4' energy: -63.702 flat angles P-C4'-P energy: -45.577 tors. eta vs tors. theta energy: -75.651 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -989.189768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.189768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -863.189768 (E_RNA) where: Base-Base interactions energy: -585.590 where: short stacking energy: -263.730 Base-Backbone interact. energy: -0.628 local terms energy: -276.970919 where: bonds (distance) C4'-P energy: -40.700 bonds (distance) P-C4' energy: -50.620 flat angles C4'-P-C4' energy: -64.633 flat angles P-C4'-P energy: -41.776 tors. eta vs tors. theta energy: -79.242 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -946.771169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -946.771169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.771169 (E_RNA) where: Base-Base interactions energy: -537.945 where: short stacking energy: -242.084 Base-Backbone interact. energy: -0.747 local terms energy: -282.079559 where: bonds (distance) C4'-P energy: -54.538 bonds (distance) P-C4' energy: -54.571 flat angles C4'-P-C4' energy: -56.124 flat angles P-C4'-P energy: -45.100 tors. eta vs tors. theta energy: -71.746 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -929.681769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -929.681769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.081769 (E_RNA) where: Base-Base interactions energy: -559.256 where: short stacking energy: -235.669 Base-Backbone interact. energy: 0.037 local terms energy: -249.862834 where: bonds (distance) C4'-P energy: -59.601 bonds (distance) P-C4' energy: -44.702 flat angles C4'-P-C4' energy: -46.486 flat angles P-C4'-P energy: -33.106 tors. eta vs tors. theta energy: -65.968 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -792.938269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -792.938269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.138269 (E_RNA) where: Base-Base interactions energy: -428.235 where: short stacking energy: -180.308 Base-Backbone interact. energy: 0.639 local terms energy: -237.542175 where: bonds (distance) C4'-P energy: -43.775 bonds (distance) P-C4' energy: -54.603 flat angles C4'-P-C4' energy: -50.378 flat angles P-C4'-P energy: -40.862 tors. eta vs tors. theta energy: -47.923 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -809.334423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -809.334423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.934423 (E_RNA) where: Base-Base interactions energy: -446.830 where: short stacking energy: -208.242 Base-Backbone interact. energy: -0.691 local terms energy: -257.413990 where: bonds (distance) C4'-P energy: -50.849 bonds (distance) P-C4' energy: -48.264 flat angles C4'-P-C4' energy: -61.012 flat angles P-C4'-P energy: -36.260 tors. eta vs tors. theta energy: -61.029 Dist. restrs. and SS energy: -104.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -832.642328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.642328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.042328 (E_RNA) where: Base-Base interactions energy: -459.653 where: short stacking energy: -188.016 Base-Backbone interact. energy: -1.112 local terms energy: -242.276639 where: bonds (distance) C4'-P energy: -46.752 bonds (distance) P-C4' energy: -50.001 flat angles C4'-P-C4' energy: -57.791 flat angles P-C4'-P energy: -34.562 tors. eta vs tors. theta energy: -53.170 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -624.136735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.136735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.336735 (E_RNA) where: Base-Base interactions energy: -340.637 where: short stacking energy: -153.188 Base-Backbone interact. energy: 0.775 local terms energy: -192.474907 where: bonds (distance) C4'-P energy: -38.607 bonds (distance) P-C4' energy: -35.553 flat angles C4'-P-C4' energy: -53.158 flat angles P-C4'-P energy: -32.456 tors. eta vs tors. theta energy: -32.702 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -727.409195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.409195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.809195 (E_RNA) where: Base-Base interactions energy: -387.048 where: short stacking energy: -167.808 Base-Backbone interact. energy: -0.590 local terms energy: -219.171350 where: bonds (distance) C4'-P energy: -38.945 bonds (distance) P-C4' energy: -46.842 flat angles C4'-P-C4' energy: -53.721 flat angles P-C4'-P energy: -33.381 tors. eta vs tors. theta energy: -46.283 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -657.745269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.745269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.145269 (E_RNA) where: Base-Base interactions energy: -332.467 where: short stacking energy: -131.754 Base-Backbone interact. energy: 3.261 local terms energy: -207.938967 where: bonds (distance) C4'-P energy: -47.576 bonds (distance) P-C4' energy: -51.810 flat angles C4'-P-C4' energy: -57.715 flat angles P-C4'-P energy: -29.554 tors. eta vs tors. theta energy: -21.285 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -1047.352323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.352323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.552323 (E_RNA) where: Base-Base interactions energy: -630.414 where: short stacking energy: -264.219 Base-Backbone interact. energy: -1.008 local terms energy: -288.130613 where: bonds (distance) C4'-P energy: -53.912 bonds (distance) P-C4' energy: -49.484 flat angles C4'-P-C4' energy: -66.783 flat angles P-C4'-P energy: -43.374 tors. eta vs tors. theta energy: -74.577 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -1006.262423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.262423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -878.462423 (E_RNA) where: Base-Base interactions energy: -577.211 where: short stacking energy: -271.931 Base-Backbone interact. energy: -0.657 local terms energy: -300.594448 where: bonds (distance) C4'-P energy: -55.197 bonds (distance) P-C4' energy: -60.841 flat angles C4'-P-C4' energy: -64.960 flat angles P-C4'-P energy: -41.355 tors. eta vs tors. theta energy: -78.241 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -950.398872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -950.398872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -827.998872 (E_RNA) where: Base-Base interactions energy: -551.520 where: short stacking energy: -252.009 Base-Backbone interact. energy: -0.649 local terms energy: -275.829909 where: bonds (distance) C4'-P energy: -53.390 bonds (distance) P-C4' energy: -57.896 flat angles C4'-P-C4' energy: -58.160 flat angles P-C4'-P energy: -36.451 tors. eta vs tors. theta energy: -69.933 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -918.832971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -918.832971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -796.432971 (E_RNA) where: Base-Base interactions energy: -532.830 where: short stacking energy: -222.487 Base-Backbone interact. energy: 0.167 local terms energy: -263.769456 where: bonds (distance) C4'-P energy: -56.317 bonds (distance) P-C4' energy: -49.843 flat angles C4'-P-C4' energy: -56.395 flat angles P-C4'-P energy: -34.888 tors. eta vs tors. theta energy: -66.327 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -821.950698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -821.950698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.950698 (E_RNA) where: Base-Base interactions energy: -462.258 where: short stacking energy: -183.220 Base-Backbone interact. energy: -2.617 local terms energy: -231.075096 where: bonds (distance) C4'-P energy: -41.953 bonds (distance) P-C4' energy: -53.690 flat angles C4'-P-C4' energy: -51.330 flat angles P-C4'-P energy: -31.719 tors. eta vs tors. theta energy: -52.383 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -893.915743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.915743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.915743 (E_RNA) where: Base-Base interactions energy: -507.456 where: short stacking energy: -212.276 Base-Backbone interact. energy: 0.812 local terms energy: -261.271984 where: bonds (distance) C4'-P energy: -47.582 bonds (distance) P-C4' energy: -57.640 flat angles C4'-P-C4' energy: -52.024 flat angles P-C4'-P energy: -38.009 tors. eta vs tors. theta energy: -66.016 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -781.750688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.750688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.550688 (E_RNA) where: Base-Base interactions energy: -428.587 where: short stacking energy: -203.075 Base-Backbone interact. energy: 0.187 local terms energy: -247.150855 where: bonds (distance) C4'-P energy: -55.552 bonds (distance) P-C4' energy: -48.861 flat angles C4'-P-C4' energy: -48.462 flat angles P-C4'-P energy: -42.934 tors. eta vs tors. theta energy: -51.342 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -795.709680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.709680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.509680 (E_RNA) where: Base-Base interactions energy: -451.506 where: short stacking energy: -220.026 Base-Backbone interact. energy: -0.871 local terms energy: -219.132798 where: bonds (distance) C4'-P energy: -34.258 bonds (distance) P-C4' energy: -41.461 flat angles C4'-P-C4' energy: -46.268 flat angles P-C4'-P energy: -36.849 tors. eta vs tors. theta energy: -60.296 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -604.007546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.007546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.407546 (E_RNA) where: Base-Base interactions energy: -310.522 where: short stacking energy: -134.756 Base-Backbone interact. energy: -0.915 local terms energy: -198.971063 where: bonds (distance) C4'-P energy: -37.616 bonds (distance) P-C4' energy: -52.192 flat angles C4'-P-C4' energy: -47.413 flat angles P-C4'-P energy: -29.671 tors. eta vs tors. theta energy: -32.080 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -698.455538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.455538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.655538 (E_RNA) where: Base-Base interactions energy: -383.324 where: short stacking energy: -166.910 Base-Backbone interact. energy: -1.119 local terms energy: -186.212821 where: bonds (distance) C4'-P energy: -33.062 bonds (distance) P-C4' energy: -39.256 flat angles C4'-P-C4' energy: -55.860 flat angles P-C4'-P energy: -24.775 tors. eta vs tors. theta energy: -33.259 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -1035.462071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.462071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.662071 (E_RNA) where: Base-Base interactions energy: -605.766 where: short stacking energy: -249.339 Base-Backbone interact. energy: -1.521 local terms energy: -300.374923 where: bonds (distance) C4'-P energy: -62.050 bonds (distance) P-C4' energy: -55.397 flat angles C4'-P-C4' energy: -67.069 flat angles P-C4'-P energy: -45.555 tors. eta vs tors. theta energy: -70.304 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -999.077060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.077060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.877060 (E_RNA) where: Base-Base interactions energy: -572.437 where: short stacking energy: -281.369 Base-Backbone interact. energy: -0.711 local terms energy: -301.729117 where: bonds (distance) C4'-P energy: -54.761 bonds (distance) P-C4' energy: -55.819 flat angles C4'-P-C4' energy: -59.108 flat angles P-C4'-P energy: -46.067 tors. eta vs tors. theta energy: -85.975 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -951.284577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -951.284577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -830.684577 (E_RNA) where: Base-Base interactions energy: -561.553 where: short stacking energy: -228.536 Base-Backbone interact. energy: -0.350 local terms energy: -268.781807 where: bonds (distance) C4'-P energy: -49.100 bonds (distance) P-C4' energy: -60.781 flat angles C4'-P-C4' energy: -59.922 flat angles P-C4'-P energy: -39.051 tors. eta vs tors. theta energy: -59.929 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -916.703929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -916.703929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.903929 (E_RNA) where: Base-Base interactions energy: -513.152 where: short stacking energy: -226.360 Base-Backbone interact. energy: -1.768 local terms energy: -273.983833 where: bonds (distance) C4'-P energy: -46.703 bonds (distance) P-C4' energy: -54.315 flat angles C4'-P-C4' energy: -60.057 flat angles P-C4'-P energy: -47.820 tors. eta vs tors. theta energy: -65.089 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -901.814355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -901.814355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.014355 (E_RNA) where: Base-Base interactions energy: -521.140 where: short stacking energy: -227.281 Base-Backbone interact. energy: -0.679 local terms energy: -252.195529 where: bonds (distance) C4'-P energy: -41.781 bonds (distance) P-C4' energy: -43.126 flat angles C4'-P-C4' energy: -59.498 flat angles P-C4'-P energy: -36.112 tors. eta vs tors. theta energy: -71.679 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -805.886155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -805.886155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.086155 (E_RNA) where: Base-Base interactions energy: -433.540 where: short stacking energy: -184.956 Base-Backbone interact. energy: -0.637 local terms energy: -243.909092 where: bonds (distance) C4'-P energy: -50.859 bonds (distance) P-C4' energy: -51.529 flat angles C4'-P-C4' energy: -51.940 flat angles P-C4'-P energy: -38.759 tors. eta vs tors. theta energy: -50.822 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -865.977822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -865.977822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.177822 (E_RNA) where: Base-Base interactions energy: -490.534 where: short stacking energy: -227.784 Base-Backbone interact. energy: 0.729 local terms energy: -248.372703 where: bonds (distance) C4'-P energy: -50.972 bonds (distance) P-C4' energy: -50.104 flat angles C4'-P-C4' energy: -50.453 flat angles P-C4'-P energy: -39.643 tors. eta vs tors. theta energy: -57.201 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -775.756997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.756997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -660.556997 (E_RNA) where: Base-Base interactions energy: -433.704 where: short stacking energy: -187.133 Base-Backbone interact. energy: 3.655 local terms energy: -230.508035 where: bonds (distance) C4'-P energy: -36.962 bonds (distance) P-C4' energy: -48.532 flat angles C4'-P-C4' energy: -56.678 flat angles P-C4'-P energy: -37.918 tors. eta vs tors. theta energy: -50.418 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -703.855999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.855999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.855999 (E_RNA) where: Base-Base interactions energy: -380.749 where: short stacking energy: -175.673 Base-Backbone interact. energy: -0.286 local terms energy: -196.820908 where: bonds (distance) C4'-P energy: -42.092 bonds (distance) P-C4' energy: -40.846 flat angles C4'-P-C4' energy: -56.217 flat angles P-C4'-P energy: -23.609 tors. eta vs tors. theta energy: -34.057 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -620.011927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -620.011927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.811927 (E_RNA) where: Base-Base interactions energy: -329.018 where: short stacking energy: -143.116 Base-Backbone interact. energy: 2.874 local terms energy: -205.668318 where: bonds (distance) C4'-P energy: -54.245 bonds (distance) P-C4' energy: -43.132 flat angles C4'-P-C4' energy: -39.380 flat angles P-C4'-P energy: -36.456 tors. eta vs tors. theta energy: -32.455 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -1049.030077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1049.030077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.430077 (E_RNA) where: Base-Base interactions energy: -638.281 where: short stacking energy: -261.435 Base-Backbone interact. energy: -0.823 local terms energy: -280.326242 where: bonds (distance) C4'-P energy: -47.232 bonds (distance) P-C4' energy: -58.446 flat angles C4'-P-C4' energy: -59.702 flat angles P-C4'-P energy: -37.167 tors. eta vs tors. theta energy: -77.780 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -997.790797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.790797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -868.190797 (E_RNA) where: Base-Base interactions energy: -570.717 where: short stacking energy: -270.319 Base-Backbone interact. energy: 0.293 local terms energy: -297.766279 where: bonds (distance) C4'-P energy: -53.232 bonds (distance) P-C4' energy: -55.891 flat angles C4'-P-C4' energy: -63.147 flat angles P-C4'-P energy: -44.834 tors. eta vs tors. theta energy: -80.663 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -940.276966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -940.276966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -817.876966 (E_RNA) where: Base-Base interactions energy: -552.598 where: short stacking energy: -222.229 Base-Backbone interact. energy: -0.577 local terms energy: -264.702432 where: bonds (distance) C4'-P energy: -48.885 bonds (distance) P-C4' energy: -61.050 flat angles C4'-P-C4' energy: -60.873 flat angles P-C4'-P energy: -40.518 tors. eta vs tors. theta energy: -53.377 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -926.198406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -926.198406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -796.598406 (E_RNA) where: Base-Base interactions energy: -532.056 where: short stacking energy: -235.758 Base-Backbone interact. energy: 0.297 local terms energy: -264.839381 where: bonds (distance) C4'-P energy: -41.828 bonds (distance) P-C4' energy: -54.744 flat angles C4'-P-C4' energy: -52.544 flat angles P-C4'-P energy: -40.570 tors. eta vs tors. theta energy: -75.154 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -914.094876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -914.094876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.094876 (E_RNA) where: Base-Base interactions energy: -515.065 where: short stacking energy: -227.278 Base-Backbone interact. energy: -0.981 local terms energy: -272.049433 where: bonds (distance) C4'-P energy: -47.790 bonds (distance) P-C4' energy: -57.480 flat angles C4'-P-C4' energy: -60.762 flat angles P-C4'-P energy: -42.100 tors. eta vs tors. theta energy: -63.918 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -858.985333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.985333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.185333 (E_RNA) where: Base-Base interactions energy: -473.846 where: short stacking energy: -202.427 Base-Backbone interact. energy: 1.447 local terms energy: -258.785676 where: bonds (distance) C4'-P energy: -53.534 bonds (distance) P-C4' energy: -50.034 flat angles C4'-P-C4' energy: -60.037 flat angles P-C4'-P energy: -33.452 tors. eta vs tors. theta energy: -61.728 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -758.654352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.654352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.654352 (E_RNA) where: Base-Base interactions energy: -402.369 where: short stacking energy: -175.857 Base-Backbone interact. energy: 0.934 local terms energy: -231.219601 where: bonds (distance) C4'-P energy: -51.981 bonds (distance) P-C4' energy: -47.289 flat angles C4'-P-C4' energy: -58.283 flat angles P-C4'-P energy: -35.461 tors. eta vs tors. theta energy: -38.205 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -775.624592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.624592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.424592 (E_RNA) where: Base-Base interactions energy: -425.270 where: short stacking energy: -191.673 Base-Backbone interact. energy: -0.567 local terms energy: -243.586800 where: bonds (distance) C4'-P energy: -52.797 bonds (distance) P-C4' energy: -51.619 flat angles C4'-P-C4' energy: -48.182 flat angles P-C4'-P energy: -40.390 tors. eta vs tors. theta energy: -50.599 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -667.649376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.649376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.049376 (E_RNA) where: Base-Base interactions energy: -345.628 where: short stacking energy: -137.569 Base-Backbone interact. energy: 3.300 local terms energy: -195.721291 where: bonds (distance) C4'-P energy: -36.795 bonds (distance) P-C4' energy: -50.607 flat angles C4'-P-C4' energy: -52.758 flat angles P-C4'-P energy: -26.746 tors. eta vs tors. theta energy: -28.815 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -541.920162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.920162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.320162 (E_RNA) where: Base-Base interactions energy: -265.678 where: short stacking energy: -121.646 Base-Backbone interact. energy: -0.611 local terms energy: -191.030707 where: bonds (distance) C4'-P energy: -48.024 bonds (distance) P-C4' energy: -42.560 flat angles C4'-P-C4' energy: -50.611 flat angles P-C4'-P energy: -33.443 tors. eta vs tors. theta energy: -16.393 Dist. restrs. and SS energy: -84.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -1053.192365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.192365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.592365 (E_RNA) where: Base-Base interactions energy: -636.194 where: short stacking energy: -256.607 Base-Backbone interact. energy: -1.520 local terms energy: -285.878049 where: bonds (distance) C4'-P energy: -56.815 bonds (distance) P-C4' energy: -55.938 flat angles C4'-P-C4' energy: -60.488 flat angles P-C4'-P energy: -38.279 tors. eta vs tors. theta energy: -74.358 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -983.091280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -983.091280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.491280 (E_RNA) where: Base-Base interactions energy: -573.912 where: short stacking energy: -262.734 Base-Backbone interact. energy: 0.671 local terms energy: -280.249691 where: bonds (distance) C4'-P energy: -50.355 bonds (distance) P-C4' energy: -51.524 flat angles C4'-P-C4' energy: -60.823 flat angles P-C4'-P energy: -39.853 tors. eta vs tors. theta energy: -77.696 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -951.823856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -951.823856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -822.223856 (E_RNA) where: Base-Base interactions energy: -538.825 where: short stacking energy: -254.407 Base-Backbone interact. energy: -0.041 local terms energy: -283.357339 where: bonds (distance) C4'-P energy: -50.935 bonds (distance) P-C4' energy: -53.785 flat angles C4'-P-C4' energy: -59.097 flat angles P-C4'-P energy: -34.722 tors. eta vs tors. theta energy: -84.818 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -935.556277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -935.556277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -816.756277 (E_RNA) where: Base-Base interactions energy: -542.635 where: short stacking energy: -235.988 Base-Backbone interact. energy: 0.335 local terms energy: -274.456947 where: bonds (distance) C4'-P energy: -60.599 bonds (distance) P-C4' energy: -50.153 flat angles C4'-P-C4' energy: -55.974 flat angles P-C4'-P energy: -41.637 tors. eta vs tors. theta energy: -66.094 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -910.156103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -910.156103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.156103 (E_RNA) where: Base-Base interactions energy: -525.205 where: short stacking energy: -231.815 Base-Backbone interact. energy: -0.369 local terms energy: -258.582541 where: bonds (distance) C4'-P energy: -29.448 bonds (distance) P-C4' energy: -54.715 flat angles C4'-P-C4' energy: -64.040 flat angles P-C4'-P energy: -39.061 tors. eta vs tors. theta energy: -71.318 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -854.092172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -854.092172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -726.292172 (E_RNA) where: Base-Base interactions energy: -469.652 where: short stacking energy: -206.619 Base-Backbone interact. energy: 0.850 local terms energy: -257.490158 where: bonds (distance) C4'-P energy: -54.006 bonds (distance) P-C4' energy: -52.389 flat angles C4'-P-C4' energy: -63.244 flat angles P-C4'-P energy: -30.472 tors. eta vs tors. theta energy: -57.380 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -804.986538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -804.986538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.186538 (E_RNA) where: Base-Base interactions energy: -453.504 where: short stacking energy: -186.289 Base-Backbone interact. energy: -1.176 local terms energy: -231.506633 where: bonds (distance) C4'-P energy: -52.661 bonds (distance) P-C4' energy: -46.658 flat angles C4'-P-C4' energy: -50.014 flat angles P-C4'-P energy: -33.137 tors. eta vs tors. theta energy: -49.037 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -752.286113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.286113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.486113 (E_RNA) where: Base-Base interactions energy: -397.460 where: short stacking energy: -169.542 Base-Backbone interact. energy: 1.117 local terms energy: -228.142616 where: bonds (distance) C4'-P energy: -51.368 bonds (distance) P-C4' energy: -50.728 flat angles C4'-P-C4' energy: -54.007 flat angles P-C4'-P energy: -33.048 tors. eta vs tors. theta energy: -38.992 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -678.995700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.995700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.195700 (E_RNA) where: Base-Base interactions energy: -372.489 where: short stacking energy: -141.834 Base-Backbone interact. energy: -0.346 local terms energy: -178.360904 where: bonds (distance) C4'-P energy: -37.904 bonds (distance) P-C4' energy: -44.093 flat angles C4'-P-C4' energy: -35.641 flat angles P-C4'-P energy: -30.311 tors. eta vs tors. theta energy: -30.412 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -583.121363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.121363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.521363 (E_RNA) where: Base-Base interactions energy: -298.841 where: short stacking energy: -129.168 Base-Backbone interact. energy: 1.156 local terms energy: -200.836274 where: bonds (distance) C4'-P energy: -52.610 bonds (distance) P-C4' energy: -51.028 flat angles C4'-P-C4' energy: -37.886 flat angles P-C4'-P energy: -26.339 tors. eta vs tors. theta energy: -32.973 Dist. restrs. and SS energy: -84.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -1055.718646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.718646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.118646 (E_RNA) where: Base-Base interactions energy: -635.568 where: short stacking energy: -269.688 Base-Backbone interact. energy: -0.878 local terms energy: -289.672684 where: bonds (distance) C4'-P energy: -51.668 bonds (distance) P-C4' energy: -50.282 flat angles C4'-P-C4' energy: -62.053 flat angles P-C4'-P energy: -47.948 tors. eta vs tors. theta energy: -77.721 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -989.671244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.671244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.071244 (E_RNA) where: Base-Base interactions energy: -557.576 where: short stacking energy: -244.748 Base-Backbone interact. energy: -0.875 local terms energy: -301.620408 where: bonds (distance) C4'-P energy: -62.592 bonds (distance) P-C4' energy: -60.453 flat angles C4'-P-C4' energy: -57.433 flat angles P-C4'-P energy: -45.093 tors. eta vs tors. theta energy: -76.050 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -984.789486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.789486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.189486 (E_RNA) where: Base-Base interactions energy: -566.554 where: short stacking energy: -273.510 Base-Backbone interact. energy: -1.417 local terms energy: -287.218542 where: bonds (distance) C4'-P energy: -47.720 bonds (distance) P-C4' energy: -55.421 flat angles C4'-P-C4' energy: -57.586 flat angles P-C4'-P energy: -46.369 tors. eta vs tors. theta energy: -80.123 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -949.774026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -949.774026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -825.574026 (E_RNA) where: Base-Base interactions energy: -558.019 where: short stacking energy: -220.428 Base-Backbone interact. energy: -2.378 local terms energy: -265.176408 where: bonds (distance) C4'-P energy: -58.182 bonds (distance) P-C4' energy: -44.516 flat angles C4'-P-C4' energy: -59.951 flat angles P-C4'-P energy: -32.570 tors. eta vs tors. theta energy: -69.957 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -910.575130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -910.575130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.975130 (E_RNA) where: Base-Base interactions energy: -511.998 where: short stacking energy: -216.964 Base-Backbone interact. energy: -0.211 local terms energy: -268.765918 where: bonds (distance) C4'-P energy: -56.058 bonds (distance) P-C4' energy: -52.452 flat angles C4'-P-C4' energy: -57.420 flat angles P-C4'-P energy: -35.399 tors. eta vs tors. theta energy: -67.438 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -878.102313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.102313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.502313 (E_RNA) where: Base-Base interactions energy: -512.556 where: short stacking energy: -221.570 Base-Backbone interact. energy: -0.398 local terms energy: -235.548300 where: bonds (distance) C4'-P energy: -39.337 bonds (distance) P-C4' energy: -55.770 flat angles C4'-P-C4' energy: -46.581 flat angles P-C4'-P energy: -33.791 tors. eta vs tors. theta energy: -60.069 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -834.888844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.888844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.088844 (E_RNA) where: Base-Base interactions energy: -483.086 where: short stacking energy: -186.896 Base-Backbone interact. energy: -1.310 local terms energy: -231.692308 where: bonds (distance) C4'-P energy: -52.618 bonds (distance) P-C4' energy: -42.871 flat angles C4'-P-C4' energy: -55.056 flat angles P-C4'-P energy: -31.319 tors. eta vs tors. theta energy: -49.828 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -711.162046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.162046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.162046 (E_RNA) where: Base-Base interactions energy: -379.324 where: short stacking energy: -147.838 Base-Backbone interact. energy: 0.340 local terms energy: -206.177460 where: bonds (distance) C4'-P energy: -48.050 bonds (distance) P-C4' energy: -56.720 flat angles C4'-P-C4' energy: -43.590 flat angles P-C4'-P energy: -31.728 tors. eta vs tors. theta energy: -26.089 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -676.437426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.437426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.637426 (E_RNA) where: Base-Base interactions energy: -352.380 where: short stacking energy: -146.907 Base-Backbone interact. energy: -0.368 local terms energy: -195.889998 where: bonds (distance) C4'-P energy: -42.562 bonds (distance) P-C4' energy: -56.884 flat angles C4'-P-C4' energy: -40.996 flat angles P-C4'-P energy: -27.716 tors. eta vs tors. theta energy: -27.733 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -619.057625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.057625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.857625 (E_RNA) where: Base-Base interactions energy: -326.426 where: short stacking energy: -144.755 Base-Backbone interact. energy: -0.961 local terms energy: -203.469815 where: bonds (distance) C4'-P energy: -58.532 bonds (distance) P-C4' energy: -33.466 flat angles C4'-P-C4' energy: -55.435 flat angles P-C4'-P energy: -30.151 tors. eta vs tors. theta energy: -25.885 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -1071.556604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1071.556604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -941.956604 (E_RNA) where: Base-Base interactions energy: -641.128 where: short stacking energy: -261.992 Base-Backbone interact. energy: -2.166 local terms energy: -298.662451 where: bonds (distance) C4'-P energy: -58.542 bonds (distance) P-C4' energy: -59.567 flat angles C4'-P-C4' energy: -62.879 flat angles P-C4'-P energy: -40.199 tors. eta vs tors. theta energy: -77.475 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -998.136290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -998.136290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -870.336290 (E_RNA) where: Base-Base interactions energy: -569.739 where: short stacking energy: -250.785 Base-Backbone interact. energy: -0.574 local terms energy: -300.023347 where: bonds (distance) C4'-P energy: -63.382 bonds (distance) P-C4' energy: -50.984 flat angles C4'-P-C4' energy: -60.628 flat angles P-C4'-P energy: -42.466 tors. eta vs tors. theta energy: -82.565 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -975.591631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.591631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -851.391631 (E_RNA) where: Base-Base interactions energy: -568.240 where: short stacking energy: -229.811 Base-Backbone interact. energy: -1.706 local terms energy: -281.445591 where: bonds (distance) C4'-P energy: -50.719 bonds (distance) P-C4' energy: -55.101 flat angles C4'-P-C4' energy: -64.398 flat angles P-C4'-P energy: -38.525 tors. eta vs tors. theta energy: -72.703 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -954.162367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -954.162367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.962367 (E_RNA) where: Base-Base interactions energy: -549.573 where: short stacking energy: -268.346 Base-Backbone interact. energy: 0.270 local terms energy: -280.659337 where: bonds (distance) C4'-P energy: -51.231 bonds (distance) P-C4' energy: -54.149 flat angles C4'-P-C4' energy: -59.488 flat angles P-C4'-P energy: -34.725 tors. eta vs tors. theta energy: -81.066 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -874.340337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -874.340337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.540337 (E_RNA) where: Base-Base interactions energy: -486.989 where: short stacking energy: -209.603 Base-Backbone interact. energy: -0.028 local terms energy: -259.522861 where: bonds (distance) C4'-P energy: -44.337 bonds (distance) P-C4' energy: -52.021 flat angles C4'-P-C4' energy: -63.359 flat angles P-C4'-P energy: -42.624 tors. eta vs tors. theta energy: -57.182 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -908.175992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -908.175992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.375992 (E_RNA) where: Base-Base interactions energy: -515.865 where: short stacking energy: -233.766 Base-Backbone interact. energy: -0.768 local terms energy: -263.743333 where: bonds (distance) C4'-P energy: -47.520 bonds (distance) P-C4' energy: -47.919 flat angles C4'-P-C4' energy: -56.401 flat angles P-C4'-P energy: -36.936 tors. eta vs tors. theta energy: -74.967 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -869.452261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.452261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.652261 (E_RNA) where: Base-Base interactions energy: -498.934 where: short stacking energy: -225.520 Base-Backbone interact. energy: -1.881 local terms energy: -240.837336 where: bonds (distance) C4'-P energy: -44.396 bonds (distance) P-C4' energy: -53.096 flat angles C4'-P-C4' energy: -52.808 flat angles P-C4'-P energy: -32.379 tors. eta vs tors. theta energy: -58.158 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -698.260297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.260297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.060297 (E_RNA) where: Base-Base interactions energy: -378.361 where: short stacking energy: -146.129 Base-Backbone interact. energy: 4.337 local terms energy: -209.036097 where: bonds (distance) C4'-P energy: -38.570 bonds (distance) P-C4' energy: -51.066 flat angles C4'-P-C4' energy: -54.435 flat angles P-C4'-P energy: -36.799 tors. eta vs tors. theta energy: -28.167 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -725.635500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.635500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.835500 (E_RNA) where: Base-Base interactions energy: -384.831 where: short stacking energy: -150.792 Base-Backbone interact. energy: 1.554 local terms energy: -214.558832 where: bonds (distance) C4'-P energy: -39.009 bonds (distance) P-C4' energy: -41.030 flat angles C4'-P-C4' energy: -61.122 flat angles P-C4'-P energy: -39.086 tors. eta vs tors. theta energy: -34.311 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -610.782289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -610.782289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.782289 (E_RNA) where: Base-Base interactions energy: -320.057 where: short stacking energy: -150.187 Base-Backbone interact. energy: -0.939 local terms energy: -199.786437 where: bonds (distance) C4'-P energy: -38.411 bonds (distance) P-C4' energy: -42.902 flat angles C4'-P-C4' energy: -53.946 flat angles P-C4'-P energy: -30.124 tors. eta vs tors. theta energy: -34.402 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -1091.330067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.330067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -967.130067 (E_RNA) where: Base-Base interactions energy: -657.654 where: short stacking energy: -276.260 Base-Backbone interact. energy: 0.297 local terms energy: -309.772558 where: bonds (distance) C4'-P energy: -50.705 bonds (distance) P-C4' energy: -61.655 flat angles C4'-P-C4' energy: -65.977 flat angles P-C4'-P energy: -44.250 tors. eta vs tors. theta energy: -87.186 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -968.822843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -968.822843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -846.422843 (E_RNA) where: Base-Base interactions energy: -570.855 where: short stacking energy: -236.194 Base-Backbone interact. energy: 0.168 local terms energy: -275.735257 where: bonds (distance) C4'-P energy: -56.397 bonds (distance) P-C4' energy: -56.541 flat angles C4'-P-C4' energy: -55.606 flat angles P-C4'-P energy: -40.058 tors. eta vs tors. theta energy: -67.133 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -983.082220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -983.082220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.282220 (E_RNA) where: Base-Base interactions energy: -567.665 where: short stacking energy: -251.595 Base-Backbone interact. energy: 2.764 local terms energy: -290.380885 where: bonds (distance) C4'-P energy: -48.590 bonds (distance) P-C4' energy: -59.803 flat angles C4'-P-C4' energy: -58.780 flat angles P-C4'-P energy: -48.811 tors. eta vs tors. theta energy: -74.397 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -936.827833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -936.827833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.427833 (E_RNA) where: Base-Base interactions energy: -532.607 where: short stacking energy: -241.896 Base-Backbone interact. energy: -2.280 local terms energy: -279.540324 where: bonds (distance) C4'-P energy: -53.010 bonds (distance) P-C4' energy: -53.372 flat angles C4'-P-C4' energy: -62.288 flat angles P-C4'-P energy: -44.551 tors. eta vs tors. theta energy: -66.320 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -890.489431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -890.489431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.889431 (E_RNA) where: Base-Base interactions energy: -514.691 where: short stacking energy: -222.675 Base-Backbone interact. energy: -0.204 local terms energy: -245.994791 where: bonds (distance) C4'-P energy: -41.493 bonds (distance) P-C4' energy: -45.602 flat angles C4'-P-C4' energy: -54.311 flat angles P-C4'-P energy: -42.328 tors. eta vs tors. theta energy: -62.261 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -921.528837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.528837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.728837 (E_RNA) where: Base-Base interactions energy: -526.853 where: short stacking energy: -256.120 Base-Backbone interact. energy: -0.087 local terms energy: -266.789203 where: bonds (distance) C4'-P energy: -48.070 bonds (distance) P-C4' energy: -52.242 flat angles C4'-P-C4' energy: -54.640 flat angles P-C4'-P energy: -36.954 tors. eta vs tors. theta energy: -74.884 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -873.258789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -873.258789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.058789 (E_RNA) where: Base-Base interactions energy: -497.389 where: short stacking energy: -208.230 Base-Backbone interact. energy: -0.423 local terms energy: -251.247138 where: bonds (distance) C4'-P energy: -51.097 bonds (distance) P-C4' energy: -49.872 flat angles C4'-P-C4' energy: -46.069 flat angles P-C4'-P energy: -42.103 tors. eta vs tors. theta energy: -62.106 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -740.957162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.957162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.157162 (E_RNA) where: Base-Base interactions energy: -419.651 where: short stacking energy: -172.276 Base-Backbone interact. energy: 3.364 local terms energy: -196.870660 where: bonds (distance) C4'-P energy: -41.627 bonds (distance) P-C4' energy: -47.387 flat angles C4'-P-C4' energy: -50.107 flat angles P-C4'-P energy: -23.718 tors. eta vs tors. theta energy: -34.032 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -679.352964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.352964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.352964 (E_RNA) where: Base-Base interactions energy: -364.167 where: short stacking energy: -154.139 Base-Backbone interact. energy: -1.039 local terms energy: -197.146113 where: bonds (distance) C4'-P energy: -51.561 bonds (distance) P-C4' energy: -40.858 flat angles C4'-P-C4' energy: -42.373 flat angles P-C4'-P energy: -34.035 tors. eta vs tors. theta energy: -28.319 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -655.725395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.725395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.525395 (E_RNA) where: Base-Base interactions energy: -339.773 where: short stacking energy: -145.600 Base-Backbone interact. energy: -2.318 local terms energy: -216.434496 where: bonds (distance) C4'-P energy: -49.717 bonds (distance) P-C4' energy: -54.511 flat angles C4'-P-C4' energy: -53.973 flat angles P-C4'-P energy: -29.273 tors. eta vs tors. theta energy: -28.960 Dist. restrs. and SS energy: -97.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -1101.886254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1101.886254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.286254 (E_RNA) where: Base-Base interactions energy: -656.132 where: short stacking energy: -283.602 Base-Backbone interact. energy: 0.450 local terms energy: -316.603726 where: bonds (distance) C4'-P energy: -57.845 bonds (distance) P-C4' energy: -58.078 flat angles C4'-P-C4' energy: -66.602 flat angles P-C4'-P energy: -43.584 tors. eta vs tors. theta energy: -90.494 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -990.420176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -990.420176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -868.020176 (E_RNA) where: Base-Base interactions energy: -591.807 where: short stacking energy: -229.377 Base-Backbone interact. energy: -0.415 local terms energy: -275.798367 where: bonds (distance) C4'-P energy: -61.861 bonds (distance) P-C4' energy: -51.634 flat angles C4'-P-C4' energy: -57.859 flat angles P-C4'-P energy: -39.956 tors. eta vs tors. theta energy: -64.488 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -1002.413081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1002.413081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.813081 (E_RNA) where: Base-Base interactions energy: -589.479 where: short stacking energy: -264.270 Base-Backbone interact. energy: -0.264 local terms energy: -283.069709 where: bonds (distance) C4'-P energy: -54.152 bonds (distance) P-C4' energy: -48.487 flat angles C4'-P-C4' energy: -60.878 flat angles P-C4'-P energy: -37.109 tors. eta vs tors. theta energy: -82.444 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -958.477799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -958.477799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.477799 (E_RNA) where: Base-Base interactions energy: -556.433 where: short stacking energy: -229.677 Base-Backbone interact. energy: -1.682 local terms energy: -274.362908 where: bonds (distance) C4'-P energy: -51.819 bonds (distance) P-C4' energy: -51.746 flat angles C4'-P-C4' energy: -65.397 flat angles P-C4'-P energy: -39.414 tors. eta vs tors. theta energy: -65.987 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -915.854322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -915.854322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.854322 (E_RNA) where: Base-Base interactions energy: -520.959 where: short stacking energy: -233.662 Base-Backbone interact. energy: -2.749 local terms energy: -266.146404 where: bonds (distance) C4'-P energy: -50.038 bonds (distance) P-C4' energy: -48.161 flat angles C4'-P-C4' energy: -65.530 flat angles P-C4'-P energy: -37.644 tors. eta vs tors. theta energy: -64.773 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -878.831485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.831485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.631485 (E_RNA) where: Base-Base interactions energy: -496.704 where: short stacking energy: -216.423 Base-Backbone interact. energy: 0.649 local terms energy: -258.576186 where: bonds (distance) C4'-P energy: -62.191 bonds (distance) P-C4' energy: -48.252 flat angles C4'-P-C4' energy: -51.729 flat angles P-C4'-P energy: -37.030 tors. eta vs tors. theta energy: -59.375 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -810.459950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.459950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.659950 (E_RNA) where: Base-Base interactions energy: -451.507 where: short stacking energy: -189.050 Base-Backbone interact. energy: -0.203 local terms energy: -230.950724 where: bonds (distance) C4'-P energy: -45.780 bonds (distance) P-C4' energy: -50.571 flat angles C4'-P-C4' energy: -58.992 flat angles P-C4'-P energy: -29.291 tors. eta vs tors. theta energy: -46.316 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -731.223151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.223151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.623151 (E_RNA) where: Base-Base interactions energy: -390.006 where: short stacking energy: -158.987 Base-Backbone interact. energy: -1.362 local terms energy: -210.255185 where: bonds (distance) C4'-P energy: -41.535 bonds (distance) P-C4' energy: -53.657 flat angles C4'-P-C4' energy: -51.001 flat angles P-C4'-P energy: -33.563 tors. eta vs tors. theta energy: -30.500 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -691.477891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.477891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.677891 (E_RNA) where: Base-Base interactions energy: -363.068 where: short stacking energy: -141.586 Base-Backbone interact. energy: 1.951 local terms energy: -202.560274 where: bonds (distance) C4'-P energy: -40.426 bonds (distance) P-C4' energy: -46.815 flat angles C4'-P-C4' energy: -45.447 flat angles P-C4'-P energy: -33.757 tors. eta vs tors. theta energy: -36.115 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -622.268429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.268429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.668429 (E_RNA) where: Base-Base interactions energy: -338.507 where: short stacking energy: -145.779 Base-Backbone interact. energy: -1.243 local terms energy: -188.918471 where: bonds (distance) C4'-P energy: -42.294 bonds (distance) P-C4' energy: -50.985 flat angles C4'-P-C4' energy: -40.900 flat angles P-C4'-P energy: -27.662 tors. eta vs tors. theta energy: -27.078 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -1098.026522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1098.026522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -968.426522 (E_RNA) where: Base-Base interactions energy: -657.300 where: short stacking energy: -286.296 Base-Backbone interact. energy: -0.236 local terms energy: -310.890601 where: bonds (distance) C4'-P energy: -56.749 bonds (distance) P-C4' energy: -56.430 flat angles C4'-P-C4' energy: -66.516 flat angles P-C4'-P energy: -47.969 tors. eta vs tors. theta energy: -83.226 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -1021.561671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.561671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -895.561671 (E_RNA) where: Base-Base interactions energy: -602.632 where: short stacking energy: -265.244 Base-Backbone interact. energy: 0.089 local terms energy: -293.018015 where: bonds (distance) C4'-P energy: -57.635 bonds (distance) P-C4' energy: -52.415 flat angles C4'-P-C4' energy: -61.977 flat angles P-C4'-P energy: -42.901 tors. eta vs tors. theta energy: -78.090 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -970.748247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -970.748247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -848.348247 (E_RNA) where: Base-Base interactions energy: -558.792 where: short stacking energy: -223.998 Base-Backbone interact. energy: -3.261 local terms energy: -286.295980 where: bonds (distance) C4'-P energy: -59.362 bonds (distance) P-C4' energy: -59.424 flat angles C4'-P-C4' energy: -63.209 flat angles P-C4'-P energy: -37.231 tors. eta vs tors. theta energy: -67.069 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -988.359758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -988.359758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -862.359758 (E_RNA) where: Base-Base interactions energy: -584.418 where: short stacking energy: -263.589 Base-Backbone interact. energy: -0.390 local terms energy: -277.552092 where: bonds (distance) C4'-P energy: -55.366 bonds (distance) P-C4' energy: -59.507 flat angles C4'-P-C4' energy: -53.439 flat angles P-C4'-P energy: -35.506 tors. eta vs tors. theta energy: -73.734 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -913.487996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -913.487996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.887996 (E_RNA) where: Base-Base interactions energy: -509.329 where: short stacking energy: -220.730 Base-Backbone interact. energy: -1.120 local terms energy: -273.439010 where: bonds (distance) C4'-P energy: -53.372 bonds (distance) P-C4' energy: -49.002 flat angles C4'-P-C4' energy: -56.963 flat angles P-C4'-P energy: -47.181 tors. eta vs tors. theta energy: -66.921 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -877.529284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.529284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.729284 (E_RNA) where: Base-Base interactions energy: -473.588 where: short stacking energy: -214.524 Base-Backbone interact. energy: -0.051 local terms energy: -276.090410 where: bonds (distance) C4'-P energy: -49.995 bonds (distance) P-C4' energy: -53.650 flat angles C4'-P-C4' energy: -61.004 flat angles P-C4'-P energy: -48.431 tors. eta vs tors. theta energy: -63.011 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -840.025283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.025283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.225283 (E_RNA) where: Base-Base interactions energy: -472.180 where: short stacking energy: -212.392 Base-Backbone interact. energy: -0.706 local terms energy: -239.339284 where: bonds (distance) C4'-P energy: -52.334 bonds (distance) P-C4' energy: -44.913 flat angles C4'-P-C4' energy: -49.880 flat angles P-C4'-P energy: -31.421 tors. eta vs tors. theta energy: -60.791 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -701.780989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.780989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.980989 (E_RNA) where: Base-Base interactions energy: -363.326 where: short stacking energy: -151.755 Base-Backbone interact. energy: -1.498 local terms energy: -209.156875 where: bonds (distance) C4'-P energy: -43.845 bonds (distance) P-C4' energy: -53.444 flat angles C4'-P-C4' energy: -50.243 flat angles P-C4'-P energy: -30.810 tors. eta vs tors. theta energy: -30.814 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -755.308620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.308620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.308620 (E_RNA) where: Base-Base interactions energy: -427.100 where: short stacking energy: -174.398 Base-Backbone interact. energy: -0.475 local terms energy: -201.733041 where: bonds (distance) C4'-P energy: -39.828 bonds (distance) P-C4' energy: -41.655 flat angles C4'-P-C4' energy: -46.182 flat angles P-C4'-P energy: -25.246 tors. eta vs tors. theta energy: -48.822 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -643.266166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.266166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.266166 (E_RNA) where: Base-Base interactions energy: -347.231 where: short stacking energy: -155.139 Base-Backbone interact. energy: 1.455 local terms energy: -189.490371 where: bonds (distance) C4'-P energy: -37.216 bonds (distance) P-C4' energy: -40.666 flat angles C4'-P-C4' energy: -49.343 flat angles P-C4'-P energy: -34.031 tors. eta vs tors. theta energy: -28.235 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -1103.672695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1103.672695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -974.072695 (E_RNA) where: Base-Base interactions energy: -680.812 where: short stacking energy: -284.588 Base-Backbone interact. energy: -0.316 local terms energy: -292.944719 where: bonds (distance) C4'-P energy: -44.583 bonds (distance) P-C4' energy: -50.417 flat angles C4'-P-C4' energy: -64.742 flat angles P-C4'-P energy: -42.166 tors. eta vs tors. theta energy: -91.036 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -1036.747259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1036.747259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.147259 (E_RNA) where: Base-Base interactions energy: -601.874 where: short stacking energy: -256.634 Base-Backbone interact. energy: -0.771 local terms energy: -304.502024 where: bonds (distance) C4'-P energy: -55.027 bonds (distance) P-C4' energy: -57.981 flat angles C4'-P-C4' energy: -63.270 flat angles P-C4'-P energy: -47.659 tors. eta vs tors. theta energy: -80.564 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -996.437412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.437412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.237412 (E_RNA) where: Base-Base interactions energy: -598.096 where: short stacking energy: -263.989 Base-Backbone interact. energy: 0.541 local terms energy: -274.681721 where: bonds (distance) C4'-P energy: -46.538 bonds (distance) P-C4' energy: -52.013 flat angles C4'-P-C4' energy: -61.000 flat angles P-C4'-P energy: -39.705 tors. eta vs tors. theta energy: -75.425 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -956.679549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -956.679549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.079549 (E_RNA) where: Base-Base interactions energy: -557.690 where: short stacking energy: -236.043 Base-Backbone interact. energy: 0.487 local terms energy: -278.876288 where: bonds (distance) C4'-P energy: -52.908 bonds (distance) P-C4' energy: -54.818 flat angles C4'-P-C4' energy: -61.609 flat angles P-C4'-P energy: -39.601 tors. eta vs tors. theta energy: -69.940 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -911.541003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -911.541003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -781.941003 (E_RNA) where: Base-Base interactions energy: -518.310 where: short stacking energy: -244.536 Base-Backbone interact. energy: -0.774 local terms energy: -262.856968 where: bonds (distance) C4'-P energy: -52.208 bonds (distance) P-C4' energy: -56.959 flat angles C4'-P-C4' energy: -52.702 flat angles P-C4'-P energy: -32.107 tors. eta vs tors. theta energy: -68.881 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -909.260494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -909.260494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.060494 (E_RNA) where: Base-Base interactions energy: -517.519 where: short stacking energy: -226.634 Base-Backbone interact. energy: -1.378 local terms energy: -266.163546 where: bonds (distance) C4'-P energy: -51.328 bonds (distance) P-C4' energy: -39.634 flat angles C4'-P-C4' energy: -61.247 flat angles P-C4'-P energy: -45.073 tors. eta vs tors. theta energy: -68.881 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -872.502774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.502774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -742.902774 (E_RNA) where: Base-Base interactions energy: -480.809 where: short stacking energy: -216.403 Base-Backbone interact. energy: -1.539 local terms energy: -260.554817 where: bonds (distance) C4'-P energy: -56.238 bonds (distance) P-C4' energy: -52.552 flat angles C4'-P-C4' energy: -54.031 flat angles P-C4'-P energy: -32.380 tors. eta vs tors. theta energy: -65.354 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -712.111913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.111913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.911913 (E_RNA) where: Base-Base interactions energy: -399.235 where: short stacking energy: -142.017 Base-Backbone interact. energy: -1.003 local terms energy: -187.673658 where: bonds (distance) C4'-P energy: -33.140 bonds (distance) P-C4' energy: -43.637 flat angles C4'-P-C4' energy: -40.604 flat angles P-C4'-P energy: -37.926 tors. eta vs tors. theta energy: -32.367 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -742.768339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.768339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.768339 (E_RNA) where: Base-Base interactions energy: -375.120 where: short stacking energy: -153.858 Base-Backbone interact. energy: -0.380 local terms energy: -241.268418 where: bonds (distance) C4'-P energy: -50.407 bonds (distance) P-C4' energy: -54.198 flat angles C4'-P-C4' energy: -50.682 flat angles P-C4'-P energy: -38.614 tors. eta vs tors. theta energy: -47.367 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -676.329318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.329318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.129318 (E_RNA) where: Base-Base interactions energy: -368.087 where: short stacking energy: -162.935 Base-Backbone interact. energy: -0.356 local terms energy: -201.686066 where: bonds (distance) C4'-P energy: -37.721 bonds (distance) P-C4' energy: -41.813 flat angles C4'-P-C4' energy: -45.624 flat angles P-C4'-P energy: -36.936 tors. eta vs tors. theta energy: -39.592 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -1093.121284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1093.121284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.521284 (E_RNA) where: Base-Base interactions energy: -656.357 where: short stacking energy: -260.791 Base-Backbone interact. energy: 0.712 local terms energy: -307.876229 where: bonds (distance) C4'-P energy: -61.468 bonds (distance) P-C4' energy: -66.019 flat angles C4'-P-C4' energy: -66.749 flat angles P-C4'-P energy: -38.645 tors. eta vs tors. theta energy: -74.995 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -1030.728222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1030.728222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -904.728222 (E_RNA) where: Base-Base interactions energy: -617.473 where: short stacking energy: -267.754 Base-Backbone interact. energy: -0.346 local terms energy: -286.909602 where: bonds (distance) C4'-P energy: -58.853 bonds (distance) P-C4' energy: -46.727 flat angles C4'-P-C4' energy: -57.069 flat angles P-C4'-P energy: -42.306 tors. eta vs tors. theta energy: -81.955 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -1014.568355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.568355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.768355 (E_RNA) where: Base-Base interactions energy: -597.211 where: short stacking energy: -261.767 Base-Backbone interact. energy: 1.334 local terms energy: -290.890996 where: bonds (distance) C4'-P energy: -54.041 bonds (distance) P-C4' energy: -56.907 flat angles C4'-P-C4' energy: -61.693 flat angles P-C4'-P energy: -42.113 tors. eta vs tors. theta energy: -76.136 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -942.147336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -942.147336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -817.947336 (E_RNA) where: Base-Base interactions energy: -554.401 where: short stacking energy: -228.595 Base-Backbone interact. energy: -2.032 local terms energy: -261.514463 where: bonds (distance) C4'-P energy: -53.369 bonds (distance) P-C4' energy: -51.236 flat angles C4'-P-C4' energy: -46.103 flat angles P-C4'-P energy: -38.947 tors. eta vs tors. theta energy: -71.860 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -897.594956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.594956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.994956 (E_RNA) where: Base-Base interactions energy: -497.287 where: short stacking energy: -232.262 Base-Backbone interact. energy: -1.241 local terms energy: -269.467670 where: bonds (distance) C4'-P energy: -53.525 bonds (distance) P-C4' energy: -47.102 flat angles C4'-P-C4' energy: -53.162 flat angles P-C4'-P energy: -44.390 tors. eta vs tors. theta energy: -71.289 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -884.585972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.585972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.585972 (E_RNA) where: Base-Base interactions energy: -499.305 where: short stacking energy: -228.752 Base-Backbone interact. energy: -0.908 local terms energy: -258.373571 where: bonds (distance) C4'-P energy: -48.959 bonds (distance) P-C4' energy: -49.041 flat angles C4'-P-C4' energy: -54.667 flat angles P-C4'-P energy: -38.501 tors. eta vs tors. theta energy: -67.205 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -867.709971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -867.709971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.709971 (E_RNA) where: Base-Base interactions energy: -483.790 where: short stacking energy: -204.356 Base-Backbone interact. energy: -1.505 local terms energy: -256.415637 where: bonds (distance) C4'-P energy: -50.588 bonds (distance) P-C4' energy: -58.998 flat angles C4'-P-C4' energy: -55.653 flat angles P-C4'-P energy: -24.435 tors. eta vs tors. theta energy: -66.742 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -768.579910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.579910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.979910 (E_RNA) where: Base-Base interactions energy: -409.942 where: short stacking energy: -185.054 Base-Backbone interact. energy: -0.130 local terms energy: -228.907728 where: bonds (distance) C4'-P energy: -49.693 bonds (distance) P-C4' energy: -57.120 flat angles C4'-P-C4' energy: -45.984 flat angles P-C4'-P energy: -24.526 tors. eta vs tors. theta energy: -51.584 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -687.241244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.241244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.041244 (E_RNA) where: Base-Base interactions energy: -367.706 where: short stacking energy: -154.448 Base-Backbone interact. energy: -1.528 local terms energy: -193.807268 where: bonds (distance) C4'-P energy: -40.987 bonds (distance) P-C4' energy: -38.122 flat angles C4'-P-C4' energy: -58.501 flat angles P-C4'-P energy: -28.243 tors. eta vs tors. theta energy: -27.955 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -686.048965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.048965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.648965 (E_RNA) where: Base-Base interactions energy: -379.472 where: short stacking energy: -155.225 Base-Backbone interact. energy: 0.066 local terms energy: -193.243388 where: bonds (distance) C4'-P energy: -55.963 bonds (distance) P-C4' energy: -38.613 flat angles C4'-P-C4' energy: -37.817 flat angles P-C4'-P energy: -27.150 tors. eta vs tors. theta energy: -33.700 Dist. restrs. and SS energy: -113.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -1080.767041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1080.767041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.967041 (E_RNA) where: Base-Base interactions energy: -640.487 where: short stacking energy: -259.797 Base-Backbone interact. energy: 0.001 local terms energy: -312.481166 where: bonds (distance) C4'-P energy: -59.159 bonds (distance) P-C4' energy: -63.386 flat angles C4'-P-C4' energy: -61.753 flat angles P-C4'-P energy: -47.036 tors. eta vs tors. theta energy: -81.147 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -1017.270009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1017.270009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.670009 (E_RNA) where: Base-Base interactions energy: -589.353 where: short stacking energy: -250.732 Base-Backbone interact. energy: -0.098 local terms energy: -298.218503 where: bonds (distance) C4'-P energy: -48.985 bonds (distance) P-C4' energy: -61.138 flat angles C4'-P-C4' energy: -68.754 flat angles P-C4'-P energy: -44.559 tors. eta vs tors. theta energy: -74.783 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -1001.270371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.270371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -873.470371 (E_RNA) where: Base-Base interactions energy: -576.798 where: short stacking energy: -261.348 Base-Backbone interact. energy: -0.528 local terms energy: -296.143520 where: bonds (distance) C4'-P energy: -50.420 bonds (distance) P-C4' energy: -59.746 flat angles C4'-P-C4' energy: -58.056 flat angles P-C4'-P energy: -44.854 tors. eta vs tors. theta energy: -83.067 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -940.993992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -940.993992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.393992 (E_RNA) where: Base-Base interactions energy: -554.338 where: short stacking energy: -218.720 Base-Backbone interact. energy: 1.351 local terms energy: -267.406956 where: bonds (distance) C4'-P energy: -44.416 bonds (distance) P-C4' energy: -57.028 flat angles C4'-P-C4' energy: -64.518 flat angles P-C4'-P energy: -44.229 tors. eta vs tors. theta energy: -57.216 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -892.831938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -892.831938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.231938 (E_RNA) where: Base-Base interactions energy: -507.767 where: short stacking energy: -224.311 Base-Backbone interact. energy: -0.391 local terms energy: -255.074125 where: bonds (distance) C4'-P energy: -51.996 bonds (distance) P-C4' energy: -56.164 flat angles C4'-P-C4' energy: -59.950 flat angles P-C4'-P energy: -32.597 tors. eta vs tors. theta energy: -54.367 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -875.327370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.327370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.327370 (E_RNA) where: Base-Base interactions energy: -502.291 where: short stacking energy: -224.285 Base-Backbone interact. energy: -0.272 local terms energy: -255.764643 where: bonds (distance) C4'-P energy: -41.534 bonds (distance) P-C4' energy: -47.465 flat angles C4'-P-C4' energy: -62.721 flat angles P-C4'-P energy: -41.918 tors. eta vs tors. theta energy: -62.126 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -837.381247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.381247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.581247 (E_RNA) where: Base-Base interactions energy: -472.683 where: short stacking energy: -208.674 Base-Backbone interact. energy: -0.424 local terms energy: -236.474020 where: bonds (distance) C4'-P energy: -45.819 bonds (distance) P-C4' energy: -48.275 flat angles C4'-P-C4' energy: -51.675 flat angles P-C4'-P energy: -29.099 tors. eta vs tors. theta energy: -61.606 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -785.964893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.964893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.364893 (E_RNA) where: Base-Base interactions energy: -427.712 where: short stacking energy: -174.903 Base-Backbone interact. energy: 1.711 local terms energy: -230.364483 where: bonds (distance) C4'-P energy: -47.608 bonds (distance) P-C4' energy: -43.502 flat angles C4'-P-C4' energy: -55.079 flat angles P-C4'-P energy: -32.479 tors. eta vs tors. theta energy: -51.695 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -718.174209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.174209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.374209 (E_RNA) where: Base-Base interactions energy: -401.576 where: short stacking energy: -171.361 Base-Backbone interact. energy: 0.498 local terms energy: -189.295849 where: bonds (distance) C4'-P energy: -47.036 bonds (distance) P-C4' energy: -37.571 flat angles C4'-P-C4' energy: -33.773 flat angles P-C4'-P energy: -23.313 tors. eta vs tors. theta energy: -47.604 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -701.770497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.770497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.970497 (E_RNA) where: Base-Base interactions energy: -373.519 where: short stacking energy: -150.205 Base-Backbone interact. energy: -0.868 local terms energy: -208.582941 where: bonds (distance) C4'-P energy: -46.013 bonds (distance) P-C4' energy: -51.553 flat angles C4'-P-C4' energy: -50.997 flat angles P-C4'-P energy: -27.590 tors. eta vs tors. theta energy: -32.430 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -1096.066139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.066139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.466139 (E_RNA) where: Base-Base interactions energy: -658.758 where: short stacking energy: -259.474 Base-Backbone interact. energy: -0.499 local terms energy: -307.208695 where: bonds (distance) C4'-P energy: -58.697 bonds (distance) P-C4' energy: -46.938 flat angles C4'-P-C4' energy: -66.797 flat angles P-C4'-P energy: -48.463 tors. eta vs tors. theta energy: -86.314 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -1012.740567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1012.740567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -884.940567 (E_RNA) where: Base-Base interactions energy: -581.829 where: short stacking energy: -262.034 Base-Backbone interact. energy: -0.426 local terms energy: -302.685223 where: bonds (distance) C4'-P energy: -54.550 bonds (distance) P-C4' energy: -60.820 flat angles C4'-P-C4' energy: -64.505 flat angles P-C4'-P energy: -44.719 tors. eta vs tors. theta energy: -78.092 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -1007.408620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1007.408620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -877.808620 (E_RNA) where: Base-Base interactions energy: -594.492 where: short stacking energy: -250.027 Base-Backbone interact. energy: -0.253 local terms energy: -283.063079 where: bonds (distance) C4'-P energy: -52.630 bonds (distance) P-C4' energy: -51.891 flat angles C4'-P-C4' energy: -60.192 flat angles P-C4'-P energy: -47.522 tors. eta vs tors. theta energy: -70.828 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -914.346157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -914.346157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.546157 (E_RNA) where: Base-Base interactions energy: -509.833 where: short stacking energy: -225.102 Base-Backbone interact. energy: -0.159 local terms energy: -276.554136 where: bonds (distance) C4'-P energy: -58.832 bonds (distance) P-C4' energy: -56.049 flat angles C4'-P-C4' energy: -61.581 flat angles P-C4'-P energy: -35.537 tors. eta vs tors. theta energy: -64.554 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -887.093974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.093974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.293974 (E_RNA) where: Base-Base interactions energy: -513.361 where: short stacking energy: -198.294 Base-Backbone interact. energy: -1.118 local terms energy: -244.815337 where: bonds (distance) C4'-P energy: -37.547 bonds (distance) P-C4' energy: -52.040 flat angles C4'-P-C4' energy: -62.571 flat angles P-C4'-P energy: -38.854 tors. eta vs tors. theta energy: -53.803 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -883.970197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -883.970197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.170197 (E_RNA) where: Base-Base interactions energy: -515.042 where: short stacking energy: -236.081 Base-Backbone interact. energy: 0.457 local terms energy: -241.585202 where: bonds (distance) C4'-P energy: -40.179 bonds (distance) P-C4' energy: -59.231 flat angles C4'-P-C4' energy: -47.644 flat angles P-C4'-P energy: -27.109 tors. eta vs tors. theta energy: -67.422 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -853.255653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.255653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.455653 (E_RNA) where: Base-Base interactions energy: -469.124 where: short stacking energy: -200.257 Base-Backbone interact. energy: -0.788 local terms energy: -255.543645 where: bonds (distance) C4'-P energy: -51.267 bonds (distance) P-C4' energy: -54.903 flat angles C4'-P-C4' energy: -49.592 flat angles P-C4'-P energy: -43.966 tors. eta vs tors. theta energy: -55.816 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -817.890744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -817.890744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.490744 (E_RNA) where: Base-Base interactions energy: -451.445 where: short stacking energy: -197.560 Base-Backbone interact. energy: -1.272 local terms energy: -242.773391 where: bonds (distance) C4'-P energy: -53.641 bonds (distance) P-C4' energy: -37.973 flat angles C4'-P-C4' energy: -53.803 flat angles P-C4'-P energy: -38.476 tors. eta vs tors. theta energy: -58.880 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -736.609406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.609406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.609406 (E_RNA) where: Base-Base interactions energy: -402.936 where: short stacking energy: -156.190 Base-Backbone interact. energy: 0.329 local terms energy: -208.002175 where: bonds (distance) C4'-P energy: -48.810 bonds (distance) P-C4' energy: -57.489 flat angles C4'-P-C4' energy: -38.356 flat angles P-C4'-P energy: -29.234 tors. eta vs tors. theta energy: -34.113 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -690.232787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.232787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.032787 (E_RNA) where: Base-Base interactions energy: -381.127 where: short stacking energy: -162.221 Base-Backbone interact. energy: 0.054 local terms energy: -193.960387 where: bonds (distance) C4'-P energy: -32.118 bonds (distance) P-C4' energy: -49.113 flat angles C4'-P-C4' energy: -44.126 flat angles P-C4'-P energy: -28.045 tors. eta vs tors. theta energy: -40.559 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -1085.060610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.060610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.460610 (E_RNA) where: Base-Base interactions energy: -652.261 where: short stacking energy: -270.604 Base-Backbone interact. energy: -0.985 local terms energy: -302.214678 where: bonds (distance) C4'-P energy: -64.646 bonds (distance) P-C4' energy: -53.502 flat angles C4'-P-C4' energy: -59.507 flat angles P-C4'-P energy: -38.618 tors. eta vs tors. theta energy: -85.942 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -1010.456615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.456615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -880.856615 (E_RNA) where: Base-Base interactions energy: -584.406 where: short stacking energy: -260.959 Base-Backbone interact. energy: 0.151 local terms energy: -296.601722 where: bonds (distance) C4'-P energy: -46.365 bonds (distance) P-C4' energy: -57.308 flat angles C4'-P-C4' energy: -61.904 flat angles P-C4'-P energy: -47.254 tors. eta vs tors. theta energy: -83.770 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -1014.425947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.425947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -884.825947 (E_RNA) where: Base-Base interactions energy: -600.609 where: short stacking energy: -264.875 Base-Backbone interact. energy: -0.254 local terms energy: -283.962592 where: bonds (distance) C4'-P energy: -51.064 bonds (distance) P-C4' energy: -57.157 flat angles C4'-P-C4' energy: -59.368 flat angles P-C4'-P energy: -40.835 tors. eta vs tors. theta energy: -75.538 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -897.637352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.637352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.637352 (E_RNA) where: Base-Base interactions energy: -494.325 where: short stacking energy: -231.757 Base-Backbone interact. energy: -0.208 local terms energy: -277.103889 where: bonds (distance) C4'-P energy: -55.482 bonds (distance) P-C4' energy: -60.485 flat angles C4'-P-C4' energy: -57.751 flat angles P-C4'-P energy: -35.181 tors. eta vs tors. theta energy: -68.206 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -910.446785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -910.446785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.446785 (E_RNA) where: Base-Base interactions energy: -518.745 where: short stacking energy: -233.186 Base-Backbone interact. energy: -0.640 local terms energy: -265.061236 where: bonds (distance) C4'-P energy: -48.587 bonds (distance) P-C4' energy: -46.929 flat angles C4'-P-C4' energy: -62.363 flat angles P-C4'-P energy: -42.731 tors. eta vs tors. theta energy: -64.451 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -891.852394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -891.852394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -764.052394 (E_RNA) where: Base-Base interactions energy: -499.233 where: short stacking energy: -215.967 Base-Backbone interact. energy: -1.180 local terms energy: -263.639193 where: bonds (distance) C4'-P energy: -53.886 bonds (distance) P-C4' energy: -61.442 flat angles C4'-P-C4' energy: -49.210 flat angles P-C4'-P energy: -33.310 tors. eta vs tors. theta energy: -65.791 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -868.961004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -868.961004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.161004 (E_RNA) where: Base-Base interactions energy: -492.915 where: short stacking energy: -230.051 Base-Backbone interact. energy: 1.928 local terms energy: -250.174499 where: bonds (distance) C4'-P energy: -36.527 bonds (distance) P-C4' energy: -47.578 flat angles C4'-P-C4' energy: -61.171 flat angles P-C4'-P energy: -31.599 tors. eta vs tors. theta energy: -73.299 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -809.270578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -809.270578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.270578 (E_RNA) where: Base-Base interactions energy: -428.596 where: short stacking energy: -185.982 Base-Backbone interact. energy: -0.399 local terms energy: -254.275452 where: bonds (distance) C4'-P energy: -60.038 bonds (distance) P-C4' energy: -48.421 flat angles C4'-P-C4' energy: -52.107 flat angles P-C4'-P energy: -37.085 tors. eta vs tors. theta energy: -56.624 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -790.186228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -790.186228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.186228 (E_RNA) where: Base-Base interactions energy: -444.811 where: short stacking energy: -186.855 Base-Backbone interact. energy: -1.438 local terms energy: -217.936946 where: bonds (distance) C4'-P energy: -43.616 bonds (distance) P-C4' energy: -44.192 flat angles C4'-P-C4' energy: -58.997 flat angles P-C4'-P energy: -25.485 tors. eta vs tors. theta energy: -45.646 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -685.872789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.872789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.272789 (E_RNA) where: Base-Base interactions energy: -358.059 where: short stacking energy: -155.456 Base-Backbone interact. energy: 2.382 local terms energy: -209.595589 where: bonds (distance) C4'-P energy: -33.262 bonds (distance) P-C4' energy: -50.620 flat angles C4'-P-C4' energy: -56.754 flat angles P-C4'-P energy: -31.934 tors. eta vs tors. theta energy: -37.026 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -1095.913379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.913379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -968.113379 (E_RNA) where: Base-Base interactions energy: -650.632 where: short stacking energy: -274.292 Base-Backbone interact. energy: -0.982 local terms energy: -316.499142 where: bonds (distance) C4'-P energy: -60.125 bonds (distance) P-C4' energy: -60.222 flat angles C4'-P-C4' energy: -63.873 flat angles P-C4'-P energy: -43.491 tors. eta vs tors. theta energy: -88.787 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -1014.768591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.768591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.968591 (E_RNA) where: Base-Base interactions energy: -590.343 where: short stacking energy: -266.471 Base-Backbone interact. energy: -2.300 local terms energy: -294.324794 where: bonds (distance) C4'-P energy: -53.656 bonds (distance) P-C4' energy: -58.590 flat angles C4'-P-C4' energy: -60.243 flat angles P-C4'-P energy: -40.952 tors. eta vs tors. theta energy: -80.884 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -996.054469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.054469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.454469 (E_RNA) where: Base-Base interactions energy: -583.046 where: short stacking energy: -261.092 Base-Backbone interact. energy: -0.673 local terms energy: -282.735647 where: bonds (distance) C4'-P energy: -53.615 bonds (distance) P-C4' energy: -54.149 flat angles C4'-P-C4' energy: -55.161 flat angles P-C4'-P energy: -42.650 tors. eta vs tors. theta energy: -77.162 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -937.057644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.057644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -811.057644 (E_RNA) where: Base-Base interactions energy: -522.701 where: short stacking energy: -240.609 Base-Backbone interact. energy: -1.521 local terms energy: -286.836359 where: bonds (distance) C4'-P energy: -50.433 bonds (distance) P-C4' energy: -61.458 flat angles C4'-P-C4' energy: -66.288 flat angles P-C4'-P energy: -35.886 tors. eta vs tors. theta energy: -72.771 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -878.193176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.193176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.193176 (E_RNA) where: Base-Base interactions energy: -490.547 where: short stacking energy: -213.001 Base-Backbone interact. energy: -1.338 local terms energy: -260.307576 where: bonds (distance) C4'-P energy: -51.841 bonds (distance) P-C4' energy: -57.701 flat angles C4'-P-C4' energy: -49.733 flat angles P-C4'-P energy: -37.371 tors. eta vs tors. theta energy: -63.663 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -881.527654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -881.527654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.727654 (E_RNA) where: Base-Base interactions energy: -506.625 where: short stacking energy: -213.747 Base-Backbone interact. energy: -1.129 local terms energy: -245.974200 where: bonds (distance) C4'-P energy: -46.832 bonds (distance) P-C4' energy: -61.941 flat angles C4'-P-C4' energy: -54.520 flat angles P-C4'-P energy: -30.763 tors. eta vs tors. theta energy: -51.918 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -841.682823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.682823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.082823 (E_RNA) where: Base-Base interactions energy: -470.972 where: short stacking energy: -198.793 Base-Backbone interact. energy: -0.407 local terms energy: -240.702862 where: bonds (distance) C4'-P energy: -41.746 bonds (distance) P-C4' energy: -52.799 flat angles C4'-P-C4' energy: -48.752 flat angles P-C4'-P energy: -41.156 tors. eta vs tors. theta energy: -56.250 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -787.948567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -787.948567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -660.148567 (E_RNA) where: Base-Base interactions energy: -441.031 where: short stacking energy: -170.422 Base-Backbone interact. energy: -0.538 local terms energy: -218.580283 where: bonds (distance) C4'-P energy: -46.828 bonds (distance) P-C4' energy: -38.059 flat angles C4'-P-C4' energy: -49.378 flat angles P-C4'-P energy: -33.169 tors. eta vs tors. theta energy: -51.146 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -787.698625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -787.698625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.098625 (E_RNA) where: Base-Base interactions energy: -438.980 where: short stacking energy: -182.032 Base-Backbone interact. energy: -0.824 local terms energy: -218.295483 where: bonds (distance) C4'-P energy: -41.247 bonds (distance) P-C4' energy: -46.225 flat angles C4'-P-C4' energy: -53.196 flat angles P-C4'-P energy: -30.790 tors. eta vs tors. theta energy: -46.836 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -700.489614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.489614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.689614 (E_RNA) where: Base-Base interactions energy: -388.224 where: short stacking energy: -159.564 Base-Backbone interact. energy: -0.573 local terms energy: -192.892815 where: bonds (distance) C4'-P energy: -44.913 bonds (distance) P-C4' energy: -28.898 flat angles C4'-P-C4' energy: -48.655 flat angles P-C4'-P energy: -35.070 tors. eta vs tors. theta energy: -35.357 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -1074.941723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1074.941723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -950.741723 (E_RNA) where: Base-Base interactions energy: -645.861 where: short stacking energy: -278.611 Base-Backbone interact. energy: 0.420 local terms energy: -305.300603 where: bonds (distance) C4'-P energy: -57.234 bonds (distance) P-C4' energy: -63.477 flat angles C4'-P-C4' energy: -57.239 flat angles P-C4'-P energy: -42.661 tors. eta vs tors. theta energy: -84.689 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -1010.590177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.590177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -880.990177 (E_RNA) where: Base-Base interactions energy: -589.812 where: short stacking energy: -276.563 Base-Backbone interact. energy: -0.798 local terms energy: -290.380107 where: bonds (distance) C4'-P energy: -51.236 bonds (distance) P-C4' energy: -46.096 flat angles C4'-P-C4' energy: -61.603 flat angles P-C4'-P energy: -45.805 tors. eta vs tors. theta energy: -85.640 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -990.423647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -990.423647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.823647 (E_RNA) where: Base-Base interactions energy: -578.049 where: short stacking energy: -256.168 Base-Backbone interact. energy: -0.994 local terms energy: -281.780454 where: bonds (distance) C4'-P energy: -51.590 bonds (distance) P-C4' energy: -57.111 flat angles C4'-P-C4' energy: -59.640 flat angles P-C4'-P energy: -41.421 tors. eta vs tors. theta energy: -72.018 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -921.791863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.791863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -792.191863 (E_RNA) where: Base-Base interactions energy: -513.752 where: short stacking energy: -227.215 Base-Backbone interact. energy: 2.334 local terms energy: -280.772997 where: bonds (distance) C4'-P energy: -55.839 bonds (distance) P-C4' energy: -53.992 flat angles C4'-P-C4' energy: -50.724 flat angles P-C4'-P energy: -49.737 tors. eta vs tors. theta energy: -70.481 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -909.368778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -909.368778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.768778 (E_RNA) where: Base-Base interactions energy: -511.065 where: short stacking energy: -218.136 Base-Backbone interact. energy: -1.898 local terms energy: -266.805766 where: bonds (distance) C4'-P energy: -60.923 bonds (distance) P-C4' energy: -47.179 flat angles C4'-P-C4' energy: -60.910 flat angles P-C4'-P energy: -37.100 tors. eta vs tors. theta energy: -60.695 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -856.663384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.663384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.063384 (E_RNA) where: Base-Base interactions energy: -478.993 where: short stacking energy: -207.082 Base-Backbone interact. energy: -1.058 local terms energy: -247.011862 where: bonds (distance) C4'-P energy: -51.412 bonds (distance) P-C4' energy: -46.903 flat angles C4'-P-C4' energy: -51.301 flat angles P-C4'-P energy: -36.151 tors. eta vs tors. theta energy: -61.244 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -845.068399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.068399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.268399 (E_RNA) where: Base-Base interactions energy: -485.354 where: short stacking energy: -205.903 Base-Backbone interact. energy: -0.263 local terms energy: -231.651970 where: bonds (distance) C4'-P energy: -45.943 bonds (distance) P-C4' energy: -53.411 flat angles C4'-P-C4' energy: -42.987 flat angles P-C4'-P energy: -29.406 tors. eta vs tors. theta energy: -59.905 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -785.515969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.515969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.115969 (E_RNA) where: Base-Base interactions energy: -457.026 where: short stacking energy: -191.497 Base-Backbone interact. energy: 0.500 local terms energy: -206.589917 where: bonds (distance) C4'-P energy: -47.845 bonds (distance) P-C4' energy: -36.106 flat angles C4'-P-C4' energy: -43.570 flat angles P-C4'-P energy: -32.981 tors. eta vs tors. theta energy: -46.088 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -777.353974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.353974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.553974 (E_RNA) where: Base-Base interactions energy: -443.742 where: short stacking energy: -177.929 Base-Backbone interact. energy: -0.338 local terms energy: -205.473966 where: bonds (distance) C4'-P energy: -44.421 bonds (distance) P-C4' energy: -36.164 flat angles C4'-P-C4' energy: -52.056 flat angles P-C4'-P energy: -26.340 tors. eta vs tors. theta energy: -46.493 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -694.396664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.396664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.196664 (E_RNA) where: Base-Base interactions energy: -371.976 where: short stacking energy: -157.701 Base-Backbone interact. energy: 1.759 local terms energy: -199.979765 where: bonds (distance) C4'-P energy: -53.652 bonds (distance) P-C4' energy: -58.819 flat angles C4'-P-C4' energy: -26.296 flat angles P-C4'-P energy: -28.239 tors. eta vs tors. theta energy: -32.974 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -1081.538073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1081.538073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -951.938073 (E_RNA) where: Base-Base interactions energy: -635.684 where: short stacking energy: -273.472 Base-Backbone interact. energy: -0.207 local terms energy: -316.046398 where: bonds (distance) C4'-P energy: -56.508 bonds (distance) P-C4' energy: -62.066 flat angles C4'-P-C4' energy: -65.099 flat angles P-C4'-P energy: -46.371 tors. eta vs tors. theta energy: -86.002 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -1005.332391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.332391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.332391 (E_RNA) where: Base-Base interactions energy: -591.410 where: short stacking energy: -238.116 Base-Backbone interact. energy: -0.381 local terms energy: -287.541969 where: bonds (distance) C4'-P energy: -52.481 bonds (distance) P-C4' energy: -61.149 flat angles C4'-P-C4' energy: -56.685 flat angles P-C4'-P energy: -41.898 tors. eta vs tors. theta energy: -75.328 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -1002.836789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1002.836789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.836789 (E_RNA) where: Base-Base interactions energy: -573.039 where: short stacking energy: -253.102 Base-Backbone interact. energy: -2.192 local terms energy: -301.605870 where: bonds (distance) C4'-P energy: -50.277 bonds (distance) P-C4' energy: -56.707 flat angles C4'-P-C4' energy: -64.946 flat angles P-C4'-P energy: -44.701 tors. eta vs tors. theta energy: -84.975 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -893.119811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.119811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.119811 (E_RNA) where: Base-Base interactions energy: -492.267 where: short stacking energy: -212.047 Base-Backbone interact. energy: -1.055 local terms energy: -273.797796 where: bonds (distance) C4'-P energy: -49.547 bonds (distance) P-C4' energy: -50.927 flat angles C4'-P-C4' energy: -67.213 flat angles P-C4'-P energy: -43.732 tors. eta vs tors. theta energy: -62.378 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -919.925268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -919.925268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -792.125268 (E_RNA) where: Base-Base interactions energy: -507.232 where: short stacking energy: -237.366 Base-Backbone interact. energy: -1.148 local terms energy: -283.745132 where: bonds (distance) C4'-P energy: -50.614 bonds (distance) P-C4' energy: -49.819 flat angles C4'-P-C4' energy: -55.380 flat angles P-C4'-P energy: -52.967 tors. eta vs tors. theta energy: -74.966 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -884.864905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.864905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.864905 (E_RNA) where: Base-Base interactions energy: -530.164 where: short stacking energy: -225.841 Base-Backbone interact. energy: -0.785 local terms energy: -227.916006 where: bonds (distance) C4'-P energy: -44.914 bonds (distance) P-C4' energy: -37.181 flat angles C4'-P-C4' energy: -51.425 flat angles P-C4'-P energy: -29.076 tors. eta vs tors. theta energy: -65.320 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -860.766302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.766302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.766302 (E_RNA) where: Base-Base interactions energy: -491.104 where: short stacking energy: -193.931 Base-Backbone interact. energy: -1.129 local terms energy: -242.534013 where: bonds (distance) C4'-P energy: -47.001 bonds (distance) P-C4' energy: -52.108 flat angles C4'-P-C4' energy: -51.538 flat angles P-C4'-P energy: -33.247 tors. eta vs tors. theta energy: -58.639 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -812.515741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.515741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.715741 (E_RNA) where: Base-Base interactions energy: -456.458 where: short stacking energy: -187.853 Base-Backbone interact. energy: -0.301 local terms energy: -227.956010 where: bonds (distance) C4'-P energy: -50.080 bonds (distance) P-C4' energy: -38.476 flat angles C4'-P-C4' energy: -54.819 flat angles P-C4'-P energy: -32.038 tors. eta vs tors. theta energy: -52.542 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -761.537375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.537375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.737375 (E_RNA) where: Base-Base interactions energy: -409.097 where: short stacking energy: -166.659 Base-Backbone interact. energy: -0.380 local terms energy: -224.260410 where: bonds (distance) C4'-P energy: -46.109 bonds (distance) P-C4' energy: -47.216 flat angles C4'-P-C4' energy: -51.500 flat angles P-C4'-P energy: -33.355 tors. eta vs tors. theta energy: -46.079 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -671.997368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.997368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.197368 (E_RNA) where: Base-Base interactions energy: -350.720 where: short stacking energy: -143.070 Base-Backbone interact. energy: -0.748 local terms energy: -201.729242 where: bonds (distance) C4'-P energy: -52.855 bonds (distance) P-C4' energy: -43.778 flat angles C4'-P-C4' energy: -46.385 flat angles P-C4'-P energy: -31.828 tors. eta vs tors. theta energy: -26.883 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -1086.001183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.001183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.401183 (E_RNA) where: Base-Base interactions energy: -654.957 where: short stacking energy: -280.602 Base-Backbone interact. energy: -0.296 local terms energy: -301.148266 where: bonds (distance) C4'-P energy: -48.942 bonds (distance) P-C4' energy: -53.941 flat angles C4'-P-C4' energy: -64.568 flat angles P-C4'-P energy: -47.910 tors. eta vs tors. theta energy: -85.787 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -1008.902340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.902340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.302340 (E_RNA) where: Base-Base interactions energy: -599.712 where: short stacking energy: -247.263 Base-Backbone interact. energy: -1.292 local terms energy: -278.298509 where: bonds (distance) C4'-P energy: -51.200 bonds (distance) P-C4' energy: -52.736 flat angles C4'-P-C4' energy: -64.319 flat angles P-C4'-P energy: -41.426 tors. eta vs tors. theta energy: -68.618 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -994.722953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.722953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.922953 (E_RNA) where: Base-Base interactions energy: -584.463 where: short stacking energy: -253.732 Base-Backbone interact. energy: -0.407 local terms energy: -282.053293 where: bonds (distance) C4'-P energy: -55.910 bonds (distance) P-C4' energy: -43.670 flat angles C4'-P-C4' energy: -64.610 flat angles P-C4'-P energy: -41.394 tors. eta vs tors. theta energy: -76.470 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -899.842594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -899.842594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -773.842594 (E_RNA) where: Base-Base interactions energy: -526.692 where: short stacking energy: -218.417 Base-Backbone interact. energy: -0.537 local terms energy: -246.613110 where: bonds (distance) C4'-P energy: -48.130 bonds (distance) P-C4' energy: -51.782 flat angles C4'-P-C4' energy: -51.278 flat angles P-C4'-P energy: -35.481 tors. eta vs tors. theta energy: -59.942 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -897.196491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.196491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.596491 (E_RNA) where: Base-Base interactions energy: -518.319 where: short stacking energy: -218.637 Base-Backbone interact. energy: 3.244 local terms energy: -252.521557 where: bonds (distance) C4'-P energy: -42.982 bonds (distance) P-C4' energy: -58.656 flat angles C4'-P-C4' energy: -64.226 flat angles P-C4'-P energy: -23.763 tors. eta vs tors. theta energy: -62.894 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -884.733893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.733893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.133893 (E_RNA) where: Base-Base interactions energy: -476.965 where: short stacking energy: -210.743 Base-Backbone interact. energy: -0.886 local terms energy: -277.282372 where: bonds (distance) C4'-P energy: -51.820 bonds (distance) P-C4' energy: -55.228 flat angles C4'-P-C4' energy: -59.639 flat angles P-C4'-P energy: -38.839 tors. eta vs tors. theta energy: -71.756 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -865.344329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -865.344329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.744329 (E_RNA) where: Base-Base interactions energy: -495.538 where: short stacking energy: -206.309 Base-Backbone interact. energy: -0.684 local terms energy: -248.521970 where: bonds (distance) C4'-P energy: -44.958 bonds (distance) P-C4' energy: -55.846 flat angles C4'-P-C4' energy: -55.148 flat angles P-C4'-P energy: -29.430 tors. eta vs tors. theta energy: -63.139 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -796.885646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -796.885646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.685646 (E_RNA) where: Base-Base interactions energy: -431.883 where: short stacking energy: -189.298 Base-Backbone interact. energy: -0.531 local terms energy: -240.271510 where: bonds (distance) C4'-P energy: -51.730 bonds (distance) P-C4' energy: -51.048 flat angles C4'-P-C4' energy: -52.841 flat angles P-C4'-P energy: -24.258 tors. eta vs tors. theta energy: -60.395 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -710.731669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -710.731669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.131669 (E_RNA) where: Base-Base interactions energy: -386.901 where: short stacking energy: -169.691 Base-Backbone interact. energy: 2.668 local terms energy: -205.899080 where: bonds (distance) C4'-P energy: -33.850 bonds (distance) P-C4' energy: -47.118 flat angles C4'-P-C4' energy: -56.969 flat angles P-C4'-P energy: -24.437 tors. eta vs tors. theta energy: -43.526 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -693.290281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.290281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.090281 (E_RNA) where: Base-Base interactions energy: -354.265 where: short stacking energy: -151.247 Base-Backbone interact. energy: -1.096 local terms energy: -213.729376 where: bonds (distance) C4'-P energy: -51.006 bonds (distance) P-C4' energy: -51.054 flat angles C4'-P-C4' energy: -47.087 flat angles P-C4'-P energy: -31.767 tors. eta vs tors. theta energy: -32.815 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -1101.673627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1101.673627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.673627 (E_RNA) where: Base-Base interactions energy: -665.100 where: short stacking energy: -293.814 Base-Backbone interact. energy: 0.549 local terms energy: -311.122822 where: bonds (distance) C4'-P energy: -57.451 bonds (distance) P-C4' energy: -60.548 flat angles C4'-P-C4' energy: -61.390 flat angles P-C4'-P energy: -41.799 tors. eta vs tors. theta energy: -89.935 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -1017.196339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1017.196339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.596339 (E_RNA) where: Base-Base interactions energy: -582.886 where: short stacking energy: -260.676 Base-Backbone interact. energy: -0.520 local terms energy: -304.190935 where: bonds (distance) C4'-P energy: -60.570 bonds (distance) P-C4' energy: -57.183 flat angles C4'-P-C4' energy: -66.309 flat angles P-C4'-P energy: -40.934 tors. eta vs tors. theta energy: -79.194 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -992.710848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -992.710848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -863.110848 (E_RNA) where: Base-Base interactions energy: -587.576 where: short stacking energy: -239.943 Base-Backbone interact. energy: -0.616 local terms energy: -274.918587 where: bonds (distance) C4'-P energy: -49.884 bonds (distance) P-C4' energy: -53.212 flat angles C4'-P-C4' energy: -62.939 flat angles P-C4'-P energy: -34.689 tors. eta vs tors. theta energy: -74.195 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -926.692992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -926.692992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.092992 (E_RNA) where: Base-Base interactions energy: -520.963 where: short stacking energy: -240.963 Base-Backbone interact. energy: -1.059 local terms energy: -275.070251 where: bonds (distance) C4'-P energy: -51.789 bonds (distance) P-C4' energy: -53.487 flat angles C4'-P-C4' energy: -60.258 flat angles P-C4'-P energy: -41.273 tors. eta vs tors. theta energy: -68.262 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -878.747016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.747016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.547016 (E_RNA) where: Base-Base interactions energy: -514.090 where: short stacking energy: -208.455 Base-Backbone interact. energy: -0.471 local terms energy: -239.985683 where: bonds (distance) C4'-P energy: -47.571 bonds (distance) P-C4' energy: -47.707 flat angles C4'-P-C4' energy: -50.498 flat angles P-C4'-P energy: -38.055 tors. eta vs tors. theta energy: -56.155 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -859.081549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -859.081549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.281549 (E_RNA) where: Base-Base interactions energy: -477.781 where: short stacking energy: -218.584 Base-Backbone interact. energy: -0.765 local terms energy: -252.735281 where: bonds (distance) C4'-P energy: -40.021 bonds (distance) P-C4' energy: -57.664 flat angles C4'-P-C4' energy: -51.787 flat angles P-C4'-P energy: -39.454 tors. eta vs tors. theta energy: -63.810 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -840.093013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.093013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.093013 (E_RNA) where: Base-Base interactions energy: -462.477 where: short stacking energy: -207.987 Base-Backbone interact. energy: -0.509 local terms energy: -251.106797 where: bonds (distance) C4'-P energy: -46.083 bonds (distance) P-C4' energy: -52.271 flat angles C4'-P-C4' energy: -57.031 flat angles P-C4'-P energy: -32.634 tors. eta vs tors. theta energy: -63.088 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -772.120561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.120561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.120561 (E_RNA) where: Base-Base interactions energy: -412.785 where: short stacking energy: -168.017 Base-Backbone interact. energy: 0.420 local terms energy: -233.754822 where: bonds (distance) C4'-P energy: -43.646 bonds (distance) P-C4' energy: -52.389 flat angles C4'-P-C4' energy: -59.442 flat angles P-C4'-P energy: -29.757 tors. eta vs tors. theta energy: -48.520 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -719.657049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.657049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.657049 (E_RNA) where: Base-Base interactions energy: -384.665 where: short stacking energy: -147.579 Base-Backbone interact. energy: 3.128 local terms energy: -212.119924 where: bonds (distance) C4'-P energy: -41.208 bonds (distance) P-C4' energy: -51.502 flat angles C4'-P-C4' energy: -50.859 flat angles P-C4'-P energy: -32.432 tors. eta vs tors. theta energy: -36.119 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -665.154898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.154898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.954898 (E_RNA) where: Base-Base interactions energy: -332.875 where: short stacking energy: -144.491 Base-Backbone interact. energy: -0.888 local terms energy: -207.191935 where: bonds (distance) C4'-P energy: -36.783 bonds (distance) P-C4' energy: -54.357 flat angles C4'-P-C4' energy: -44.406 flat angles P-C4'-P energy: -29.885 tors. eta vs tors. theta energy: -41.761 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -1089.623618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.623618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.023618 (E_RNA) where: Base-Base interactions energy: -652.104 where: short stacking energy: -270.670 Base-Backbone interact. energy: -0.885 local terms energy: -307.034175 where: bonds (distance) C4'-P energy: -59.651 bonds (distance) P-C4' energy: -56.090 flat angles C4'-P-C4' energy: -65.953 flat angles P-C4'-P energy: -41.597 tors. eta vs tors. theta energy: -83.744 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -1002.040258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1002.040258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.240258 (E_RNA) where: Base-Base interactions energy: -584.939 where: short stacking energy: -248.215 Base-Backbone interact. energy: -0.739 local terms energy: -288.562198 where: bonds (distance) C4'-P energy: -55.534 bonds (distance) P-C4' energy: -48.470 flat angles C4'-P-C4' energy: -65.811 flat angles P-C4'-P energy: -36.964 tors. eta vs tors. theta energy: -81.783 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -999.139671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.139671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.339671 (E_RNA) where: Base-Base interactions energy: -583.767 where: short stacking energy: -277.534 Base-Backbone interact. energy: -0.785 local terms energy: -286.787246 where: bonds (distance) C4'-P energy: -51.349 bonds (distance) P-C4' energy: -45.887 flat angles C4'-P-C4' energy: -63.728 flat angles P-C4'-P energy: -47.338 tors. eta vs tors. theta energy: -78.485 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -982.059551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.059551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -852.459551 (E_RNA) where: Base-Base interactions energy: -573.157 where: short stacking energy: -234.600 Base-Backbone interact. energy: -0.782 local terms energy: -278.519974 where: bonds (distance) C4'-P energy: -57.219 bonds (distance) P-C4' energy: -58.079 flat angles C4'-P-C4' energy: -54.542 flat angles P-C4'-P energy: -39.614 tors. eta vs tors. theta energy: -69.065 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -904.200497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.200497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.200497 (E_RNA) where: Base-Base interactions energy: -515.743 where: short stacking energy: -225.654 Base-Backbone interact. energy: -0.059 local terms energy: -262.398653 where: bonds (distance) C4'-P energy: -40.619 bonds (distance) P-C4' energy: -53.651 flat angles C4'-P-C4' energy: -53.550 flat angles P-C4'-P energy: -42.469 tors. eta vs tors. theta energy: -72.110 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -843.844723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.844723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.044723 (E_RNA) where: Base-Base interactions energy: -487.178 where: short stacking energy: -190.780 Base-Backbone interact. energy: -1.786 local terms energy: -227.081016 where: bonds (distance) C4'-P energy: -40.824 bonds (distance) P-C4' energy: -51.413 flat angles C4'-P-C4' energy: -55.998 flat angles P-C4'-P energy: -28.756 tors. eta vs tors. theta energy: -50.090 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -875.350650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.350650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.150650 (E_RNA) where: Base-Base interactions energy: -501.671 where: short stacking energy: -222.763 Base-Backbone interact. energy: 0.846 local terms energy: -250.325996 where: bonds (distance) C4'-P energy: -45.419 bonds (distance) P-C4' energy: -49.908 flat angles C4'-P-C4' energy: -56.732 flat angles P-C4'-P energy: -37.340 tors. eta vs tors. theta energy: -60.928 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -792.174700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -792.174700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.174700 (E_RNA) where: Base-Base interactions energy: -427.103 where: short stacking energy: -172.134 Base-Backbone interact. energy: -0.719 local terms energy: -238.352867 where: bonds (distance) C4'-P energy: -43.056 bonds (distance) P-C4' energy: -53.317 flat angles C4'-P-C4' energy: -54.713 flat angles P-C4'-P energy: -41.000 tors. eta vs tors. theta energy: -46.267 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -754.725771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -754.725771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.925771 (E_RNA) where: Base-Base interactions energy: -405.950 where: short stacking energy: -178.580 Base-Backbone interact. energy: -0.688 local terms energy: -220.287794 where: bonds (distance) C4'-P energy: -43.165 bonds (distance) P-C4' energy: -50.413 flat angles C4'-P-C4' energy: -47.933 flat angles P-C4'-P energy: -31.140 tors. eta vs tors. theta energy: -47.636 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -672.983152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.983152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.583152 (E_RNA) where: Base-Base interactions energy: -353.816 where: short stacking energy: -151.762 Base-Backbone interact. energy: 0.542 local terms energy: -197.308862 where: bonds (distance) C4'-P energy: -49.228 bonds (distance) P-C4' energy: -45.916 flat angles C4'-P-C4' energy: -41.467 flat angles P-C4'-P energy: -26.411 tors. eta vs tors. theta energy: -34.287 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -1078.738558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.738558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.138558 (E_RNA) where: Base-Base interactions energy: -635.245 where: short stacking energy: -277.416 Base-Backbone interact. energy: -0.731 local terms energy: -313.162838 where: bonds (distance) C4'-P energy: -55.491 bonds (distance) P-C4' energy: -54.596 flat angles C4'-P-C4' energy: -66.309 flat angles P-C4'-P energy: -46.654 tors. eta vs tors. theta energy: -90.112 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -1004.620737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.620737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -875.020737 (E_RNA) where: Base-Base interactions energy: -584.176 where: short stacking energy: -260.143 Base-Backbone interact. energy: -0.405 local terms energy: -290.439699 where: bonds (distance) C4'-P energy: -51.816 bonds (distance) P-C4' energy: -49.038 flat angles C4'-P-C4' energy: -62.722 flat angles P-C4'-P energy: -46.980 tors. eta vs tors. theta energy: -79.884 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -982.018729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.018729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -854.218729 (E_RNA) where: Base-Base interactions energy: -567.377 where: short stacking energy: -249.659 Base-Backbone interact. energy: -0.448 local terms energy: -286.394343 where: bonds (distance) C4'-P energy: -46.441 bonds (distance) P-C4' energy: -64.684 flat angles C4'-P-C4' energy: -53.061 flat angles P-C4'-P energy: -38.957 tors. eta vs tors. theta energy: -83.252 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -1005.469013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.469013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.269013 (E_RNA) where: Base-Base interactions energy: -598.744 where: short stacking energy: -257.235 Base-Backbone interact. energy: -1.563 local terms energy: -280.962413 where: bonds (distance) C4'-P energy: -49.848 bonds (distance) P-C4' energy: -53.840 flat angles C4'-P-C4' energy: -63.300 flat angles P-C4'-P energy: -45.131 tors. eta vs tors. theta energy: -68.843 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -916.718006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -916.718006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -792.518006 (E_RNA) where: Base-Base interactions energy: -529.721 where: short stacking energy: -256.583 Base-Backbone interact. energy: -0.701 local terms energy: -262.096454 where: bonds (distance) C4'-P energy: -47.410 bonds (distance) P-C4' energy: -44.973 flat angles C4'-P-C4' energy: -54.598 flat angles P-C4'-P energy: -46.580 tors. eta vs tors. theta energy: -68.535 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -883.040371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -883.040371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.440371 (E_RNA) where: Base-Base interactions energy: -480.719 where: short stacking energy: -215.087 Base-Backbone interact. energy: -0.513 local terms energy: -272.208140 where: bonds (distance) C4'-P energy: -49.652 bonds (distance) P-C4' energy: -55.869 flat angles C4'-P-C4' energy: -61.535 flat angles P-C4'-P energy: -41.106 tors. eta vs tors. theta energy: -64.045 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -829.414514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.414514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.414514 (E_RNA) where: Base-Base interactions energy: -478.426 where: short stacking energy: -185.792 Base-Backbone interact. energy: 0.949 local terms energy: -225.937634 where: bonds (distance) C4'-P energy: -45.255 bonds (distance) P-C4' energy: -48.569 flat angles C4'-P-C4' energy: -51.344 flat angles P-C4'-P energy: -34.303 tors. eta vs tors. theta energy: -46.467 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -801.578541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -801.578541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.778541 (E_RNA) where: Base-Base interactions energy: -430.640 where: short stacking energy: -192.802 Base-Backbone interact. energy: -0.116 local terms energy: -243.022303 where: bonds (distance) C4'-P energy: -47.058 bonds (distance) P-C4' energy: -47.836 flat angles C4'-P-C4' energy: -50.575 flat angles P-C4'-P energy: -41.738 tors. eta vs tors. theta energy: -55.815 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -729.579207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.579207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.579207 (E_RNA) where: Base-Base interactions energy: -388.490 where: short stacking energy: -154.647 Base-Backbone interact. energy: -0.978 local terms energy: -214.111167 where: bonds (distance) C4'-P energy: -53.312 bonds (distance) P-C4' energy: -51.374 flat angles C4'-P-C4' energy: -43.340 flat angles P-C4'-P energy: -26.045 tors. eta vs tors. theta energy: -40.041 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -682.149369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.149369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.549369 (E_RNA) where: Base-Base interactions energy: -376.482 where: short stacking energy: -156.075 Base-Backbone interact. energy: -0.397 local terms energy: -175.670708 where: bonds (distance) C4'-P energy: -40.529 bonds (distance) P-C4' energy: -36.542 flat angles C4'-P-C4' energy: -41.411 flat angles P-C4'-P energy: -18.071 tors. eta vs tors. theta energy: -39.118 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -1097.435470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1097.435470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -969.635470 (E_RNA) where: Base-Base interactions energy: -655.776 where: short stacking energy: -268.961 Base-Backbone interact. energy: -0.711 local terms energy: -313.148765 where: bonds (distance) C4'-P energy: -57.659 bonds (distance) P-C4' energy: -61.708 flat angles C4'-P-C4' energy: -66.129 flat angles P-C4'-P energy: -40.494 tors. eta vs tors. theta energy: -87.159 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -999.614448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.614448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -870.014448 (E_RNA) where: Base-Base interactions energy: -570.293 where: short stacking energy: -257.261 Base-Backbone interact. energy: -1.234 local terms energy: -298.487639 where: bonds (distance) C4'-P energy: -52.414 bonds (distance) P-C4' energy: -52.993 flat angles C4'-P-C4' energy: -65.062 flat angles P-C4'-P energy: -43.770 tors. eta vs tors. theta energy: -84.248 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -984.910616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.910616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -857.110616 (E_RNA) where: Base-Base interactions energy: -576.540 where: short stacking energy: -238.872 Base-Backbone interact. energy: -0.630 local terms energy: -279.940651 where: bonds (distance) C4'-P energy: -52.475 bonds (distance) P-C4' energy: -60.996 flat angles C4'-P-C4' energy: -64.674 flat angles P-C4'-P energy: -36.248 tors. eta vs tors. theta energy: -65.548 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -994.617463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.617463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -865.017463 (E_RNA) where: Base-Base interactions energy: -586.540 where: short stacking energy: -248.476 Base-Backbone interact. energy: -2.061 local terms energy: -276.416087 where: bonds (distance) C4'-P energy: -41.858 bonds (distance) P-C4' energy: -55.938 flat angles C4'-P-C4' energy: -61.340 flat angles P-C4'-P energy: -33.753 tors. eta vs tors. theta energy: -83.527 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -902.153656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -902.153656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.553656 (E_RNA) where: Base-Base interactions energy: -502.310 where: short stacking energy: -233.569 Base-Backbone interact. energy: 0.102 local terms energy: -270.346247 where: bonds (distance) C4'-P energy: -45.572 bonds (distance) P-C4' energy: -55.760 flat angles C4'-P-C4' energy: -58.308 flat angles P-C4'-P energy: -41.494 tors. eta vs tors. theta energy: -69.212 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -860.322293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.322293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.122293 (E_RNA) where: Base-Base interactions energy: -486.222 where: short stacking energy: -205.077 Base-Backbone interact. energy: -1.206 local terms energy: -248.695022 where: bonds (distance) C4'-P energy: -49.967 bonds (distance) P-C4' energy: -46.505 flat angles C4'-P-C4' energy: -53.250 flat angles P-C4'-P energy: -44.162 tors. eta vs tors. theta energy: -54.811 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -873.625506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -873.625506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.025506 (E_RNA) where: Base-Base interactions energy: -529.949 where: short stacking energy: -209.896 Base-Backbone interact. energy: 1.643 local terms energy: -215.719854 where: bonds (distance) C4'-P energy: -37.366 bonds (distance) P-C4' energy: -41.271 flat angles C4'-P-C4' energy: -43.787 flat angles P-C4'-P energy: -35.056 tors. eta vs tors. theta energy: -58.240 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -806.376346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.376346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.976346 (E_RNA) where: Base-Base interactions energy: -453.883 where: short stacking energy: -210.157 Base-Backbone interact. energy: -0.487 local terms energy: -229.606846 where: bonds (distance) C4'-P energy: -48.548 bonds (distance) P-C4' energy: -50.813 flat angles C4'-P-C4' energy: -44.209 flat angles P-C4'-P energy: -33.734 tors. eta vs tors. theta energy: -52.303 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -730.952786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.952786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.952786 (E_RNA) where: Base-Base interactions energy: -408.716 where: short stacking energy: -175.774 Base-Backbone interact. energy: -0.692 local terms energy: -195.544901 where: bonds (distance) C4'-P energy: -48.778 bonds (distance) P-C4' energy: -42.938 flat angles C4'-P-C4' energy: -50.919 flat angles P-C4'-P energy: -10.078 tors. eta vs tors. theta energy: -42.832 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -682.848871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.848871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.048871 (E_RNA) where: Base-Base interactions energy: -365.599 where: short stacking energy: -127.993 Base-Backbone interact. energy: 2.319 local terms energy: -191.769014 where: bonds (distance) C4'-P energy: -39.086 bonds (distance) P-C4' energy: -48.948 flat angles C4'-P-C4' energy: -47.078 flat angles P-C4'-P energy: -22.374 tors. eta vs tors. theta energy: -34.282 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -1086.513861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.513861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.913861 (E_RNA) where: Base-Base interactions energy: -643.924 where: short stacking energy: -276.289 Base-Backbone interact. energy: -0.368 local terms energy: -312.621610 where: bonds (distance) C4'-P energy: -51.069 bonds (distance) P-C4' energy: -65.448 flat angles C4'-P-C4' energy: -62.894 flat angles P-C4'-P energy: -46.330 tors. eta vs tors. theta energy: -86.881 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -1026.738130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.738130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -898.938130 (E_RNA) where: Base-Base interactions energy: -608.685 where: short stacking energy: -255.657 Base-Backbone interact. energy: -0.739 local terms energy: -289.514402 where: bonds (distance) C4'-P energy: -56.013 bonds (distance) P-C4' energy: -54.287 flat angles C4'-P-C4' energy: -63.398 flat angles P-C4'-P energy: -33.612 tors. eta vs tors. theta energy: -82.205 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -989.264149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.264149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.664149 (E_RNA) where: Base-Base interactions energy: -587.473 where: short stacking energy: -245.673 Base-Backbone interact. energy: 1.101 local terms energy: -273.291634 where: bonds (distance) C4'-P energy: -58.708 bonds (distance) P-C4' energy: -52.749 flat angles C4'-P-C4' energy: -53.020 flat angles P-C4'-P energy: -37.171 tors. eta vs tors. theta energy: -71.644 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -1005.985868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.985868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.785868 (E_RNA) where: Base-Base interactions energy: -586.016 where: short stacking energy: -260.971 Base-Backbone interact. energy: -0.803 local terms energy: -294.966562 where: bonds (distance) C4'-P energy: -50.058 bonds (distance) P-C4' energy: -50.128 flat angles C4'-P-C4' energy: -55.990 flat angles P-C4'-P energy: -52.021 tors. eta vs tors. theta energy: -86.770 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -896.758463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.758463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.158463 (E_RNA) where: Base-Base interactions energy: -503.862 where: short stacking energy: -235.395 Base-Backbone interact. energy: -0.154 local terms energy: -263.142275 where: bonds (distance) C4'-P energy: -50.043 bonds (distance) P-C4' energy: -54.960 flat angles C4'-P-C4' energy: -59.777 flat angles P-C4'-P energy: -33.344 tors. eta vs tors. theta energy: -65.018 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -869.116404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.116404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.116404 (E_RNA) where: Base-Base interactions energy: -508.927 where: short stacking energy: -203.746 Base-Backbone interact. energy: 0.198 local terms energy: -234.387333 where: bonds (distance) C4'-P energy: -43.194 bonds (distance) P-C4' energy: -57.863 flat angles C4'-P-C4' energy: -50.031 flat angles P-C4'-P energy: -33.466 tors. eta vs tors. theta energy: -49.834 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -857.337927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -857.337927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -733.137927 (E_RNA) where: Base-Base interactions energy: -483.813 where: short stacking energy: -216.352 Base-Backbone interact. energy: -0.657 local terms energy: -248.668210 where: bonds (distance) C4'-P energy: -52.989 bonds (distance) P-C4' energy: -52.619 flat angles C4'-P-C4' energy: -51.593 flat angles P-C4'-P energy: -29.889 tors. eta vs tors. theta energy: -61.578 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -810.767043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.767043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.767043 (E_RNA) where: Base-Base interactions energy: -454.886 where: short stacking energy: -198.680 Base-Backbone interact. energy: -0.671 local terms energy: -229.209995 where: bonds (distance) C4'-P energy: -41.630 bonds (distance) P-C4' energy: -44.611 flat angles C4'-P-C4' energy: -55.236 flat angles P-C4'-P energy: -30.359 tors. eta vs tors. theta energy: -57.374 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -766.331215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.331215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.131215 (E_RNA) where: Base-Base interactions energy: -420.341 where: short stacking energy: -178.111 Base-Backbone interact. energy: -0.348 local terms energy: -221.442443 where: bonds (distance) C4'-P energy: -55.639 bonds (distance) P-C4' energy: -45.003 flat angles C4'-P-C4' energy: -48.161 flat angles P-C4'-P energy: -27.861 tors. eta vs tors. theta energy: -44.778 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -647.476252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.476252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.276252 (E_RNA) where: Base-Base interactions energy: -330.336 where: short stacking energy: -133.609 Base-Backbone interact. energy: -0.673 local terms energy: -192.267524 where: bonds (distance) C4'-P energy: -46.793 bonds (distance) P-C4' energy: -44.599 flat angles C4'-P-C4' energy: -42.632 flat angles P-C4'-P energy: -28.176 tors. eta vs tors. theta energy: -30.068 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -1085.679211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.679211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -957.879211 (E_RNA) where: Base-Base interactions energy: -645.329 where: short stacking energy: -269.284 Base-Backbone interact. energy: -0.647 local terms energy: -311.902751 where: bonds (distance) C4'-P energy: -55.961 bonds (distance) P-C4' energy: -53.086 flat angles C4'-P-C4' energy: -66.749 flat angles P-C4'-P energy: -51.130 tors. eta vs tors. theta energy: -84.976 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -1004.553571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.553571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.753571 (E_RNA) where: Base-Base interactions energy: -584.473 where: short stacking energy: -255.907 Base-Backbone interact. energy: -0.695 local terms energy: -291.585624 where: bonds (distance) C4'-P energy: -60.585 bonds (distance) P-C4' energy: -51.336 flat angles C4'-P-C4' energy: -61.024 flat angles P-C4'-P energy: -39.544 tors. eta vs tors. theta energy: -79.097 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -1001.293681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.293681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -873.493681 (E_RNA) where: Base-Base interactions energy: -591.577 where: short stacking energy: -251.977 Base-Backbone interact. energy: -0.148 local terms energy: -281.769626 where: bonds (distance) C4'-P energy: -58.260 bonds (distance) P-C4' energy: -52.273 flat angles C4'-P-C4' energy: -58.601 flat angles P-C4'-P energy: -42.677 tors. eta vs tors. theta energy: -69.959 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -985.815773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.815773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -858.015773 (E_RNA) where: Base-Base interactions energy: -572.859 where: short stacking energy: -261.070 Base-Backbone interact. energy: -1.473 local terms energy: -283.683376 where: bonds (distance) C4'-P energy: -42.426 bonds (distance) P-C4' energy: -54.050 flat angles C4'-P-C4' energy: -59.361 flat angles P-C4'-P energy: -44.027 tors. eta vs tors. theta energy: -83.819 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -902.792851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -902.792851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.992851 (E_RNA) where: Base-Base interactions energy: -517.837 where: short stacking energy: -237.847 Base-Backbone interact. energy: -2.262 local terms energy: -254.893795 where: bonds (distance) C4'-P energy: -50.414 bonds (distance) P-C4' energy: -51.032 flat angles C4'-P-C4' energy: -55.279 flat angles P-C4'-P energy: -35.273 tors. eta vs tors. theta energy: -62.895 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -926.873640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -926.873640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.073640 (E_RNA) where: Base-Base interactions energy: -556.493 where: short stacking energy: -224.341 Base-Backbone interact. energy: 1.575 local terms energy: -244.155701 where: bonds (distance) C4'-P energy: -43.010 bonds (distance) P-C4' energy: -37.779 flat angles C4'-P-C4' energy: -58.745 flat angles P-C4'-P energy: -34.213 tors. eta vs tors. theta energy: -70.409 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -836.818368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.818368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.218368 (E_RNA) where: Base-Base interactions energy: -472.965 where: short stacking energy: -208.664 Base-Backbone interact. energy: 3.501 local terms energy: -237.754570 where: bonds (distance) C4'-P energy: -46.700 bonds (distance) P-C4' energy: -53.385 flat angles C4'-P-C4' energy: -53.635 flat angles P-C4'-P energy: -30.918 tors. eta vs tors. theta energy: -53.117 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -797.048238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.048238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.048238 (E_RNA) where: Base-Base interactions energy: -427.939 where: short stacking energy: -193.408 Base-Backbone interact. energy: 1.647 local terms energy: -244.756928 where: bonds (distance) C4'-P energy: -45.356 bonds (distance) P-C4' energy: -61.502 flat angles C4'-P-C4' energy: -49.086 flat angles P-C4'-P energy: -33.818 tors. eta vs tors. theta energy: -54.995 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -791.997555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.997555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.397555 (E_RNA) where: Base-Base interactions energy: -435.492 where: short stacking energy: -198.708 Base-Backbone interact. energy: -0.490 local terms energy: -226.416240 where: bonds (distance) C4'-P energy: -38.225 bonds (distance) P-C4' energy: -51.880 flat angles C4'-P-C4' energy: -56.393 flat angles P-C4'-P energy: -30.819 tors. eta vs tors. theta energy: -49.098 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -669.209413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.209413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.809413 (E_RNA) where: Base-Base interactions energy: -341.213 where: short stacking energy: -147.703 Base-Backbone interact. energy: -0.609 local terms energy: -204.987582 where: bonds (distance) C4'-P energy: -44.465 bonds (distance) P-C4' energy: -49.619 flat angles C4'-P-C4' energy: -52.500 flat angles P-C4'-P energy: -25.125 tors. eta vs tors. theta energy: -33.279 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -1081.023835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1081.023835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -951.423835 (E_RNA) where: Base-Base interactions energy: -643.916 where: short stacking energy: -267.248 Base-Backbone interact. energy: -2.981 local terms energy: -304.526798 where: bonds (distance) C4'-P energy: -57.315 bonds (distance) P-C4' energy: -50.276 flat angles C4'-P-C4' energy: -64.615 flat angles P-C4'-P energy: -50.292 tors. eta vs tors. theta energy: -82.029 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -1048.939087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1048.939087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -921.139087 (E_RNA) where: Base-Base interactions energy: -626.967 where: short stacking energy: -260.059 Base-Backbone interact. energy: -0.216 local terms energy: -293.956762 where: bonds (distance) C4'-P energy: -59.391 bonds (distance) P-C4' energy: -57.587 flat angles C4'-P-C4' energy: -57.027 flat angles P-C4'-P energy: -42.493 tors. eta vs tors. theta energy: -77.459 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -989.156821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.156821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.556821 (E_RNA) where: Base-Base interactions energy: -570.654 where: short stacking energy: -241.653 Base-Backbone interact. energy: -1.477 local terms energy: -287.425817 where: bonds (distance) C4'-P energy: -52.449 bonds (distance) P-C4' energy: -63.221 flat angles C4'-P-C4' energy: -54.740 flat angles P-C4'-P energy: -40.183 tors. eta vs tors. theta energy: -76.832 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -964.608587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.608587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.808587 (E_RNA) where: Base-Base interactions energy: -577.452 where: short stacking energy: -243.871 Base-Backbone interact. energy: -1.716 local terms energy: -257.640087 where: bonds (distance) C4'-P energy: -51.058 bonds (distance) P-C4' energy: -47.010 flat angles C4'-P-C4' energy: -55.938 flat angles P-C4'-P energy: -36.597 tors. eta vs tors. theta energy: -67.037 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -895.804386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -895.804386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.204386 (E_RNA) where: Base-Base interactions energy: -501.904 where: short stacking energy: -223.734 Base-Backbone interact. energy: -0.111 local terms energy: -264.189372 where: bonds (distance) C4'-P energy: -47.207 bonds (distance) P-C4' energy: -49.352 flat angles C4'-P-C4' energy: -65.636 flat angles P-C4'-P energy: -41.597 tors. eta vs tors. theta energy: -60.397 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -886.333518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -886.333518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.733518 (E_RNA) where: Base-Base interactions energy: -506.394 where: short stacking energy: -215.746 Base-Backbone interact. energy: -0.106 local terms energy: -250.233104 where: bonds (distance) C4'-P energy: -51.941 bonds (distance) P-C4' energy: -50.853 flat angles C4'-P-C4' energy: -48.181 flat angles P-C4'-P energy: -42.720 tors. eta vs tors. theta energy: -56.538 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -829.279686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.279686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.079686 (E_RNA) where: Base-Base interactions energy: -466.111 where: short stacking energy: -208.651 Base-Backbone interact. energy: -0.522 local terms energy: -238.446789 where: bonds (distance) C4'-P energy: -52.014 bonds (distance) P-C4' energy: -42.642 flat angles C4'-P-C4' energy: -52.525 flat angles P-C4'-P energy: -32.732 tors. eta vs tors. theta energy: -58.534 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -842.365858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -842.365858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.765858 (E_RNA) where: Base-Base interactions energy: -480.968 where: short stacking energy: -204.529 Base-Backbone interact. energy: 0.495 local terms energy: -232.292517 where: bonds (distance) C4'-P energy: -40.426 bonds (distance) P-C4' energy: -52.750 flat angles C4'-P-C4' energy: -56.957 flat angles P-C4'-P energy: -32.894 tors. eta vs tors. theta energy: -49.265 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -781.677610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.677610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.877610 (E_RNA) where: Base-Base interactions energy: -431.059 where: short stacking energy: -181.565 Base-Backbone interact. energy: -2.282 local terms energy: -220.536059 where: bonds (distance) C4'-P energy: -41.402 bonds (distance) P-C4' energy: -49.465 flat angles C4'-P-C4' energy: -51.026 flat angles P-C4'-P energy: -26.969 tors. eta vs tors. theta energy: -51.674 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -678.006550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.006550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.406550 (E_RNA) where: Base-Base interactions energy: -376.450 where: short stacking energy: -138.000 Base-Backbone interact. energy: -1.808 local terms energy: -179.148383 where: bonds (distance) C4'-P energy: -38.856 bonds (distance) P-C4' energy: -37.868 flat angles C4'-P-C4' energy: -49.674 flat angles P-C4'-P energy: -16.799 tors. eta vs tors. theta energy: -35.952 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -1088.047712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1088.047712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.247712 (E_RNA) where: Base-Base interactions energy: -658.442 where: short stacking energy: -281.837 Base-Backbone interact. energy: -0.283 local terms energy: -301.522652 where: bonds (distance) C4'-P energy: -57.383 bonds (distance) P-C4' energy: -54.502 flat angles C4'-P-C4' energy: -64.112 flat angles P-C4'-P energy: -36.662 tors. eta vs tors. theta energy: -88.864 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -1012.206107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1012.206107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -884.406107 (E_RNA) where: Base-Base interactions energy: -612.938 where: short stacking energy: -238.008 Base-Backbone interact. energy: 0.552 local terms energy: -272.020203 where: bonds (distance) C4'-P energy: -51.794 bonds (distance) P-C4' energy: -51.416 flat angles C4'-P-C4' energy: -61.984 flat angles P-C4'-P energy: -35.831 tors. eta vs tors. theta energy: -70.995 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -975.973656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.973656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -857.173656 (E_RNA) where: Base-Base interactions energy: -587.729 where: short stacking energy: -238.880 Base-Backbone interact. energy: -0.242 local terms energy: -269.203139 where: bonds (distance) C4'-P energy: -46.295 bonds (distance) P-C4' energy: -48.055 flat angles C4'-P-C4' energy: -60.793 flat angles P-C4'-P energy: -42.512 tors. eta vs tors. theta energy: -71.548 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -970.347391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -970.347391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -842.547391 (E_RNA) where: Base-Base interactions energy: -547.547 where: short stacking energy: -229.489 Base-Backbone interact. energy: -0.454 local terms energy: -294.546718 where: bonds (distance) C4'-P energy: -53.546 bonds (distance) P-C4' energy: -54.784 flat angles C4'-P-C4' energy: -63.782 flat angles P-C4'-P energy: -50.606 tors. eta vs tors. theta energy: -71.827 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -885.816745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -885.816745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.016745 (E_RNA) where: Base-Base interactions energy: -503.811 where: short stacking energy: -226.391 Base-Backbone interact. energy: 0.358 local terms energy: -254.563455 where: bonds (distance) C4'-P energy: -44.867 bonds (distance) P-C4' energy: -49.251 flat angles C4'-P-C4' energy: -54.153 flat angles P-C4'-P energy: -40.228 tors. eta vs tors. theta energy: -66.065 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -870.412369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -870.412369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -742.612369 (E_RNA) where: Base-Base interactions energy: -499.957 where: short stacking energy: -192.910 Base-Backbone interact. energy: -1.961 local terms energy: -240.694466 where: bonds (distance) C4'-P energy: -39.980 bonds (distance) P-C4' energy: -59.449 flat angles C4'-P-C4' energy: -48.333 flat angles P-C4'-P energy: -40.555 tors. eta vs tors. theta energy: -52.377 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -860.000253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.000253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.000253 (E_RNA) where: Base-Base interactions energy: -495.944 where: short stacking energy: -217.520 Base-Backbone interact. energy: 2.247 local terms energy: -240.303441 where: bonds (distance) C4'-P energy: -42.954 bonds (distance) P-C4' energy: -42.386 flat angles C4'-P-C4' energy: -57.786 flat angles P-C4'-P energy: -43.337 tors. eta vs tors. theta energy: -53.841 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -842.698428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -842.698428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.298428 (E_RNA) where: Base-Base interactions energy: -478.594 where: short stacking energy: -211.378 Base-Backbone interact. energy: -0.457 local terms energy: -241.247188 where: bonds (distance) C4'-P energy: -48.412 bonds (distance) P-C4' energy: -54.699 flat angles C4'-P-C4' energy: -47.850 flat angles P-C4'-P energy: -31.128 tors. eta vs tors. theta energy: -59.158 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -798.138629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.138629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.538629 (E_RNA) where: Base-Base interactions energy: -452.725 where: short stacking energy: -203.788 Base-Backbone interact. energy: -1.501 local terms energy: -214.312783 where: bonds (distance) C4'-P energy: -39.297 bonds (distance) P-C4' energy: -44.929 flat angles C4'-P-C4' energy: -45.570 flat angles P-C4'-P energy: -28.852 tors. eta vs tors. theta energy: -55.665 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -680.197357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.197357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.397357 (E_RNA) where: Base-Base interactions energy: -357.659 where: short stacking energy: -147.183 Base-Backbone interact. energy: 0.376 local terms energy: -195.113847 where: bonds (distance) C4'-P energy: -43.989 bonds (distance) P-C4' energy: -44.929 flat angles C4'-P-C4' energy: -46.634 flat angles P-C4'-P energy: -27.547 tors. eta vs tors. theta energy: -32.014 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -1094.824272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1094.824272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -965.224272 (E_RNA) where: Base-Base interactions energy: -660.657 where: short stacking energy: -270.577 Base-Backbone interact. energy: 0.494 local terms energy: -305.061850 where: bonds (distance) C4'-P energy: -57.126 bonds (distance) P-C4' energy: -59.835 flat angles C4'-P-C4' energy: -60.190 flat angles P-C4'-P energy: -48.128 tors. eta vs tors. theta energy: -79.784 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -1016.903800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.903800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.103800 (E_RNA) where: Base-Base interactions energy: -592.917 where: short stacking energy: -256.624 Base-Backbone interact. energy: -0.340 local terms energy: -295.847467 where: bonds (distance) C4'-P energy: -51.526 bonds (distance) P-C4' energy: -64.417 flat angles C4'-P-C4' energy: -59.215 flat angles P-C4'-P energy: -47.731 tors. eta vs tors. theta energy: -72.959 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -997.284401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.284401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.684401 (E_RNA) where: Base-Base interactions energy: -572.857 where: short stacking energy: -232.903 Base-Backbone interact. energy: 0.252 local terms energy: -295.078864 where: bonds (distance) C4'-P energy: -62.086 bonds (distance) P-C4' energy: -58.239 flat angles C4'-P-C4' energy: -58.622 flat angles P-C4'-P energy: -39.738 tors. eta vs tors. theta energy: -76.394 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -919.443313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -919.443313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.443313 (E_RNA) where: Base-Base interactions energy: -529.942 where: short stacking energy: -232.084 Base-Backbone interact. energy: 0.232 local terms energy: -263.732619 where: bonds (distance) C4'-P energy: -59.667 bonds (distance) P-C4' energy: -45.874 flat angles C4'-P-C4' energy: -56.117 flat angles P-C4'-P energy: -42.226 tors. eta vs tors. theta energy: -59.850 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -929.618454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -929.618454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -803.618454 (E_RNA) where: Base-Base interactions energy: -535.147 where: short stacking energy: -236.576 Base-Backbone interact. energy: -0.218 local terms energy: -268.253509 where: bonds (distance) C4'-P energy: -47.100 bonds (distance) P-C4' energy: -55.097 flat angles C4'-P-C4' energy: -67.750 flat angles P-C4'-P energy: -22.206 tors. eta vs tors. theta energy: -76.101 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -878.764829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.764829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.964829 (E_RNA) where: Base-Base interactions energy: -489.804 where: short stacking energy: -214.601 Base-Backbone interact. energy: 0.434 local terms energy: -261.593954 where: bonds (distance) C4'-P energy: -52.684 bonds (distance) P-C4' energy: -62.807 flat angles C4'-P-C4' energy: -47.761 flat angles P-C4'-P energy: -35.680 tors. eta vs tors. theta energy: -62.662 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -846.371521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.371521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.971521 (E_RNA) where: Base-Base interactions energy: -480.240 where: short stacking energy: -186.604 Base-Backbone interact. energy: -0.831 local terms energy: -242.900830 where: bonds (distance) C4'-P energy: -43.756 bonds (distance) P-C4' energy: -58.038 flat angles C4'-P-C4' energy: -53.921 flat angles P-C4'-P energy: -32.731 tors. eta vs tors. theta energy: -54.455 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -847.873784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -847.873784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.473784 (E_RNA) where: Base-Base interactions energy: -469.896 where: short stacking energy: -206.681 Base-Backbone interact. energy: -0.723 local terms energy: -254.855618 where: bonds (distance) C4'-P energy: -52.150 bonds (distance) P-C4' energy: -50.047 flat angles C4'-P-C4' energy: -55.107 flat angles P-C4'-P energy: -35.066 tors. eta vs tors. theta energy: -62.486 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -811.824014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -811.824014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.024014 (E_RNA) where: Base-Base interactions energy: -464.650 where: short stacking energy: -198.022 Base-Backbone interact. energy: -0.695 local terms energy: -218.678479 where: bonds (distance) C4'-P energy: -44.099 bonds (distance) P-C4' energy: -46.495 flat angles C4'-P-C4' energy: -47.056 flat angles P-C4'-P energy: -16.882 tors. eta vs tors. theta energy: -64.147 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -668.049992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.049992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.649992 (E_RNA) where: Base-Base interactions energy: -339.409 where: short stacking energy: -141.791 Base-Backbone interact. energy: 6.014 local terms energy: -212.254865 where: bonds (distance) C4'-P energy: -53.558 bonds (distance) P-C4' energy: -49.349 flat angles C4'-P-C4' energy: -41.436 flat angles P-C4'-P energy: -32.351 tors. eta vs tors. theta energy: -35.561 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -1111.947845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1111.947845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.147845 (E_RNA) where: Base-Base interactions energy: -674.867 where: short stacking energy: -272.035 Base-Backbone interact. energy: -0.468 local terms energy: -308.813310 where: bonds (distance) C4'-P energy: -62.592 bonds (distance) P-C4' energy: -57.569 flat angles C4'-P-C4' energy: -64.347 flat angles P-C4'-P energy: -40.158 tors. eta vs tors. theta energy: -84.148 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -1015.554648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1015.554648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.554648 (E_RNA) where: Base-Base interactions energy: -588.834 where: short stacking energy: -250.615 Base-Backbone interact. energy: -0.327 local terms energy: -300.393763 where: bonds (distance) C4'-P energy: -60.615 bonds (distance) P-C4' energy: -63.591 flat angles C4'-P-C4' energy: -59.053 flat angles P-C4'-P energy: -43.700 tors. eta vs tors. theta energy: -73.435 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -985.242413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.242413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.242413 (E_RNA) where: Base-Base interactions energy: -588.962 where: short stacking energy: -246.477 Base-Backbone interact. energy: -0.578 local terms energy: -269.701724 where: bonds (distance) C4'-P energy: -49.088 bonds (distance) P-C4' energy: -51.231 flat angles C4'-P-C4' energy: -56.126 flat angles P-C4'-P energy: -37.318 tors. eta vs tors. theta energy: -75.939 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -927.899225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.899225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -801.899225 (E_RNA) where: Base-Base interactions energy: -539.625 where: short stacking energy: -238.633 Base-Backbone interact. energy: -0.109 local terms energy: -262.165603 where: bonds (distance) C4'-P energy: -57.993 bonds (distance) P-C4' energy: -55.058 flat angles C4'-P-C4' energy: -45.917 flat angles P-C4'-P energy: -38.226 tors. eta vs tors. theta energy: -64.972 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -954.383568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -954.383568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.783568 (E_RNA) where: Base-Base interactions energy: -566.400 where: short stacking energy: -243.822 Base-Backbone interact. energy: 1.307 local terms energy: -259.690441 where: bonds (distance) C4'-P energy: -50.669 bonds (distance) P-C4' energy: -44.875 flat angles C4'-P-C4' energy: -55.973 flat angles P-C4'-P energy: -41.300 tors. eta vs tors. theta energy: -66.874 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -864.723891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -864.723891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.923891 (E_RNA) where: Base-Base interactions energy: -490.036 where: short stacking energy: -220.896 Base-Backbone interact. energy: -0.896 local terms energy: -245.991619 where: bonds (distance) C4'-P energy: -49.232 bonds (distance) P-C4' energy: -49.966 flat angles C4'-P-C4' energy: -58.533 flat angles P-C4'-P energy: -29.001 tors. eta vs tors. theta energy: -59.260 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -860.678752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.678752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.078752 (E_RNA) where: Base-Base interactions energy: -518.157 where: short stacking energy: -207.327 Base-Backbone interact. energy: -0.892 local terms energy: -212.030038 where: bonds (distance) C4'-P energy: -46.912 bonds (distance) P-C4' energy: -38.144 flat angles C4'-P-C4' energy: -43.307 flat angles P-C4'-P energy: -32.471 tors. eta vs tors. theta energy: -51.196 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -796.030792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -796.030792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.030792 (E_RNA) where: Base-Base interactions energy: -450.696 where: short stacking energy: -190.101 Base-Backbone interact. energy: -1.406 local terms energy: -226.928808 where: bonds (distance) C4'-P energy: -46.856 bonds (distance) P-C4' energy: -45.351 flat angles C4'-P-C4' energy: -49.779 flat angles P-C4'-P energy: -35.525 tors. eta vs tors. theta energy: -49.418 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -797.491791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.491791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.091791 (E_RNA) where: Base-Base interactions energy: -464.474 where: short stacking energy: -186.257 Base-Backbone interact. energy: 1.185 local terms energy: -211.802870 where: bonds (distance) C4'-P energy: -48.906 bonds (distance) P-C4' energy: -45.309 flat angles C4'-P-C4' energy: -49.530 flat angles P-C4'-P energy: -25.062 tors. eta vs tors. theta energy: -42.996 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -656.559138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.559138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.559138 (E_RNA) where: Base-Base interactions energy: -322.935 where: short stacking energy: -130.840 Base-Backbone interact. energy: -0.577 local terms energy: -207.047059 where: bonds (distance) C4'-P energy: -51.188 bonds (distance) P-C4' energy: -62.598 flat angles C4'-P-C4' energy: -38.990 flat angles P-C4'-P energy: -30.824 tors. eta vs tors. theta energy: -23.447 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -1102.645589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.645589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -973.045589 (E_RNA) where: Base-Base interactions energy: -658.698 where: short stacking energy: -276.485 Base-Backbone interact. energy: 2.176 local terms energy: -316.523920 where: bonds (distance) C4'-P energy: -55.660 bonds (distance) P-C4' energy: -53.843 flat angles C4'-P-C4' energy: -67.930 flat angles P-C4'-P energy: -50.896 tors. eta vs tors. theta energy: -88.195 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -1027.199277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1027.199277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.199277 (E_RNA) where: Base-Base interactions energy: -619.019 where: short stacking energy: -269.368 Base-Backbone interact. energy: -0.209 local terms energy: -281.971371 where: bonds (distance) C4'-P energy: -46.363 bonds (distance) P-C4' energy: -47.599 flat angles C4'-P-C4' energy: -69.299 flat angles P-C4'-P energy: -45.107 tors. eta vs tors. theta energy: -73.603 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -989.546932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.546932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.946932 (E_RNA) where: Base-Base interactions energy: -584.591 where: short stacking energy: -252.454 Base-Backbone interact. energy: -0.531 local terms energy: -274.824709 where: bonds (distance) C4'-P energy: -49.941 bonds (distance) P-C4' energy: -53.716 flat angles C4'-P-C4' energy: -55.534 flat angles P-C4'-P energy: -40.204 tors. eta vs tors. theta energy: -75.431 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -980.821827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.821827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -856.621827 (E_RNA) where: Base-Base interactions energy: -580.771 where: short stacking energy: -254.272 Base-Backbone interact. energy: -0.122 local terms energy: -275.729057 where: bonds (distance) C4'-P energy: -52.966 bonds (distance) P-C4' energy: -47.729 flat angles C4'-P-C4' energy: -58.107 flat angles P-C4'-P energy: -46.402 tors. eta vs tors. theta energy: -70.524 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -874.253607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -874.253607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.253607 (E_RNA) where: Base-Base interactions energy: -504.904 where: short stacking energy: -224.691 Base-Backbone interact. energy: -0.900 local terms energy: -242.448924 where: bonds (distance) C4'-P energy: -44.575 bonds (distance) P-C4' energy: -56.682 flat angles C4'-P-C4' energy: -45.511 flat angles P-C4'-P energy: -37.743 tors. eta vs tors. theta energy: -57.938 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -835.732951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.732951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.932951 (E_RNA) where: Base-Base interactions energy: -461.049 where: short stacking energy: -218.983 Base-Backbone interact. energy: -0.382 local terms energy: -246.501811 where: bonds (distance) C4'-P energy: -47.852 bonds (distance) P-C4' energy: -51.709 flat angles C4'-P-C4' energy: -57.679 flat angles P-C4'-P energy: -40.178 tors. eta vs tors. theta energy: -49.084 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -872.228017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.228017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.428017 (E_RNA) where: Base-Base interactions energy: -512.488 where: short stacking energy: -207.180 Base-Backbone interact. energy: -1.446 local terms energy: -230.493996 where: bonds (distance) C4'-P energy: -47.692 bonds (distance) P-C4' energy: -46.085 flat angles C4'-P-C4' energy: -48.478 flat angles P-C4'-P energy: -40.765 tors. eta vs tors. theta energy: -47.474 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -819.995298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.995298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.995298 (E_RNA) where: Base-Base interactions energy: -465.010 where: short stacking energy: -199.539 Base-Backbone interact. energy: -0.511 local terms energy: -228.474467 where: bonds (distance) C4'-P energy: -30.450 bonds (distance) P-C4' energy: -57.819 flat angles C4'-P-C4' energy: -52.947 flat angles P-C4'-P energy: -33.968 tors. eta vs tors. theta energy: -53.290 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -798.950088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.950088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.350088 (E_RNA) where: Base-Base interactions energy: -436.299 where: short stacking energy: -194.290 Base-Backbone interact. energy: -0.540 local terms energy: -232.511772 where: bonds (distance) C4'-P energy: -47.000 bonds (distance) P-C4' energy: -53.914 flat angles C4'-P-C4' energy: -39.513 flat angles P-C4'-P energy: -34.224 tors. eta vs tors. theta energy: -57.862 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -651.481916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.481916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.681916 (E_RNA) where: Base-Base interactions energy: -344.035 where: short stacking energy: -142.165 Base-Backbone interact. energy: 2.975 local terms energy: -182.622520 where: bonds (distance) C4'-P energy: -34.932 bonds (distance) P-C4' energy: -51.385 flat angles C4'-P-C4' energy: -32.913 flat angles P-C4'-P energy: -33.988 tors. eta vs tors. theta energy: -29.405 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -1100.753334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1100.753334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -971.153334 (E_RNA) where: Base-Base interactions energy: -678.515 where: short stacking energy: -274.500 Base-Backbone interact. energy: -0.103 local terms energy: -292.534968 where: bonds (distance) C4'-P energy: -53.755 bonds (distance) P-C4' energy: -46.715 flat angles C4'-P-C4' energy: -61.844 flat angles P-C4'-P energy: -44.927 tors. eta vs tors. theta energy: -85.293 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -1039.579336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.579336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -915.379336 (E_RNA) where: Base-Base interactions energy: -629.970 where: short stacking energy: -266.240 Base-Backbone interact. energy: -0.133 local terms energy: -285.275857 where: bonds (distance) C4'-P energy: -59.570 bonds (distance) P-C4' energy: -55.109 flat angles C4'-P-C4' energy: -52.837 flat angles P-C4'-P energy: -39.190 tors. eta vs tors. theta energy: -78.569 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -982.949120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.949120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -856.949120 (E_RNA) where: Base-Base interactions energy: -591.654 where: short stacking energy: -257.163 Base-Backbone interact. energy: -1.060 local terms energy: -264.235102 where: bonds (distance) C4'-P energy: -53.350 bonds (distance) P-C4' energy: -47.035 flat angles C4'-P-C4' energy: -52.467 flat angles P-C4'-P energy: -40.874 tors. eta vs tors. theta energy: -70.509 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -976.675039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -976.675039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -848.875039 (E_RNA) where: Base-Base interactions energy: -582.821 where: short stacking energy: -248.234 Base-Backbone interact. energy: -0.594 local terms energy: -265.460421 where: bonds (distance) C4'-P energy: -46.170 bonds (distance) P-C4' energy: -46.629 flat angles C4'-P-C4' energy: -57.066 flat angles P-C4'-P energy: -44.797 tors. eta vs tors. theta energy: -70.798 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -889.534507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.534507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.334507 (E_RNA) where: Base-Base interactions energy: -494.676 where: short stacking energy: -218.567 Base-Backbone interact. energy: -0.245 local terms energy: -270.413549 where: bonds (distance) C4'-P energy: -56.782 bonds (distance) P-C4' energy: -60.996 flat angles C4'-P-C4' energy: -51.241 flat angles P-C4'-P energy: -37.755 tors. eta vs tors. theta energy: -63.640 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -848.051327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.051327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.851327 (E_RNA) where: Base-Base interactions energy: -474.437 where: short stacking energy: -198.019 Base-Backbone interact. energy: -1.214 local terms energy: -248.199966 where: bonds (distance) C4'-P energy: -53.263 bonds (distance) P-C4' energy: -52.926 flat angles C4'-P-C4' energy: -56.548 flat angles P-C4'-P energy: -34.730 tors. eta vs tors. theta energy: -50.733 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -843.768681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.768681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.968681 (E_RNA) where: Base-Base interactions energy: -466.757 where: short stacking energy: -192.269 Base-Backbone interact. energy: -0.747 local terms energy: -248.464703 where: bonds (distance) C4'-P energy: -49.521 bonds (distance) P-C4' energy: -54.900 flat angles C4'-P-C4' energy: -59.243 flat angles P-C4'-P energy: -26.955 tors. eta vs tors. theta energy: -57.846 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -853.180058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.180058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.580058 (E_RNA) where: Base-Base interactions energy: -485.922 where: short stacking energy: -200.718 Base-Backbone interact. energy: -0.764 local terms energy: -236.893470 where: bonds (distance) C4'-P energy: -40.451 bonds (distance) P-C4' energy: -60.366 flat angles C4'-P-C4' energy: -56.707 flat angles P-C4'-P energy: -29.161 tors. eta vs tors. theta energy: -50.208 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -771.356159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.356159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.156159 (E_RNA) where: Base-Base interactions energy: -417.226 where: short stacking energy: -178.256 Base-Backbone interact. energy: -1.113 local terms energy: -228.817125 where: bonds (distance) C4'-P energy: -52.758 bonds (distance) P-C4' energy: -40.125 flat angles C4'-P-C4' energy: -56.382 flat angles P-C4'-P energy: -23.485 tors. eta vs tors. theta energy: -56.068 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -659.597339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.597339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.597339 (E_RNA) where: Base-Base interactions energy: -348.794 where: short stacking energy: -142.857 Base-Backbone interact. energy: -2.156 local terms energy: -182.646853 where: bonds (distance) C4'-P energy: -23.467 bonds (distance) P-C4' energy: -47.298 flat angles C4'-P-C4' energy: -50.621 flat angles P-C4'-P energy: -28.203 tors. eta vs tors. theta energy: -33.058 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -1112.167166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1112.167166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -982.567166 (E_RNA) where: Base-Base interactions energy: -669.278 where: short stacking energy: -269.264 Base-Backbone interact. energy: -0.438 local terms energy: -312.850999 where: bonds (distance) C4'-P energy: -57.152 bonds (distance) P-C4' energy: -58.934 flat angles C4'-P-C4' energy: -65.814 flat angles P-C4'-P energy: -48.893 tors. eta vs tors. theta energy: -82.058 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -1014.975880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.975880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -888.975880 (E_RNA) where: Base-Base interactions energy: -601.073 where: short stacking energy: -272.500 Base-Backbone interact. energy: -0.897 local terms energy: -287.005285 where: bonds (distance) C4'-P energy: -52.612 bonds (distance) P-C4' energy: -50.881 flat angles C4'-P-C4' energy: -57.909 flat angles P-C4'-P energy: -49.839 tors. eta vs tors. theta energy: -75.764 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -973.691935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -973.691935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.891935 (E_RNA) where: Base-Base interactions energy: -565.171 where: short stacking energy: -247.477 Base-Backbone interact. energy: -0.441 local terms energy: -280.279938 where: bonds (distance) C4'-P energy: -56.912 bonds (distance) P-C4' energy: -47.226 flat angles C4'-P-C4' energy: -60.857 flat angles P-C4'-P energy: -42.218 tors. eta vs tors. theta energy: -73.068 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -946.192121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -946.192121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.192121 (E_RNA) where: Base-Base interactions energy: -536.955 where: short stacking energy: -243.888 Base-Backbone interact. energy: -1.621 local terms energy: -281.615906 where: bonds (distance) C4'-P energy: -53.071 bonds (distance) P-C4' energy: -56.302 flat angles C4'-P-C4' energy: -60.518 flat angles P-C4'-P energy: -38.532 tors. eta vs tors. theta energy: -73.193 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -896.938776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.938776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.738776 (E_RNA) where: Base-Base interactions energy: -512.663 where: short stacking energy: -232.427 Base-Backbone interact. energy: -0.999 local terms energy: -259.077010 where: bonds (distance) C4'-P energy: -45.613 bonds (distance) P-C4' energy: -51.708 flat angles C4'-P-C4' energy: -58.749 flat angles P-C4'-P energy: -27.595 tors. eta vs tors. theta energy: -75.412 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -874.941178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -874.941178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.141178 (E_RNA) where: Base-Base interactions energy: -486.497 where: short stacking energy: -208.138 Base-Backbone interact. energy: -0.514 local terms energy: -260.129989 where: bonds (distance) C4'-P energy: -51.496 bonds (distance) P-C4' energy: -50.386 flat angles C4'-P-C4' energy: -55.935 flat angles P-C4'-P energy: -40.446 tors. eta vs tors. theta energy: -61.867 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -812.279474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.279474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.679474 (E_RNA) where: Base-Base interactions energy: -455.914 where: short stacking energy: -193.276 Base-Backbone interact. energy: -0.433 local terms energy: -235.332192 where: bonds (distance) C4'-P energy: -44.013 bonds (distance) P-C4' energy: -41.551 flat angles C4'-P-C4' energy: -53.015 flat angles P-C4'-P energy: -38.542 tors. eta vs tors. theta energy: -58.212 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -840.894524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.894524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.494524 (E_RNA) where: Base-Base interactions energy: -484.327 where: short stacking energy: -188.481 Base-Backbone interact. energy: -0.113 local terms energy: -234.054701 where: bonds (distance) C4'-P energy: -40.945 bonds (distance) P-C4' energy: -48.076 flat angles C4'-P-C4' energy: -61.089 flat angles P-C4'-P energy: -29.449 tors. eta vs tors. theta energy: -54.496 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -779.201410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.201410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.601410 (E_RNA) where: Base-Base interactions energy: -429.423 where: short stacking energy: -189.705 Base-Backbone interact. energy: -0.929 local terms energy: -219.249834 where: bonds (distance) C4'-P energy: -41.769 bonds (distance) P-C4' energy: -40.413 flat angles C4'-P-C4' energy: -52.191 flat angles P-C4'-P energy: -36.383 tors. eta vs tors. theta energy: -48.494 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -656.440402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.440402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.640402 (E_RNA) where: Base-Base interactions energy: -341.405 where: short stacking energy: -130.342 Base-Backbone interact. energy: -1.169 local terms energy: -186.065970 where: bonds (distance) C4'-P energy: -38.407 bonds (distance) P-C4' energy: -46.478 flat angles C4'-P-C4' energy: -46.788 flat angles P-C4'-P energy: -26.742 tors. eta vs tors. theta energy: -27.651 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -1084.582606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1084.582606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -954.982606 (E_RNA) where: Base-Base interactions energy: -650.201 where: short stacking energy: -257.632 Base-Backbone interact. energy: 1.387 local terms energy: -306.168718 where: bonds (distance) C4'-P energy: -58.994 bonds (distance) P-C4' energy: -52.600 flat angles C4'-P-C4' energy: -67.752 flat angles P-C4'-P energy: -45.840 tors. eta vs tors. theta energy: -80.983 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -1039.815710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.815710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.215710 (E_RNA) where: Base-Base interactions energy: -619.878 where: short stacking energy: -270.441 Base-Backbone interact. energy: 0.130 local terms energy: -290.467743 where: bonds (distance) C4'-P energy: -56.958 bonds (distance) P-C4' energy: -55.396 flat angles C4'-P-C4' energy: -61.122 flat angles P-C4'-P energy: -38.178 tors. eta vs tors. theta energy: -78.814 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -972.074919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.074919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -847.874919 (E_RNA) where: Base-Base interactions energy: -564.721 where: short stacking energy: -232.808 Base-Backbone interact. energy: -1.026 local terms energy: -282.128324 where: bonds (distance) C4'-P energy: -45.688 bonds (distance) P-C4' energy: -56.194 flat angles C4'-P-C4' energy: -63.106 flat angles P-C4'-P energy: -44.961 tors. eta vs tors. theta energy: -72.179 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -949.138411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -949.138411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -821.338411 (E_RNA) where: Base-Base interactions energy: -554.686 where: short stacking energy: -260.423 Base-Backbone interact. energy: 1.445 local terms energy: -268.097412 where: bonds (distance) C4'-P energy: -49.892 bonds (distance) P-C4' energy: -32.279 flat angles C4'-P-C4' energy: -63.124 flat angles P-C4'-P energy: -41.594 tors. eta vs tors. theta energy: -81.209 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -918.502811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -918.502811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.302811 (E_RNA) where: Base-Base interactions energy: -542.823 where: short stacking energy: -234.702 Base-Backbone interact. energy: -1.500 local terms energy: -249.979838 where: bonds (distance) C4'-P energy: -41.917 bonds (distance) P-C4' energy: -52.126 flat angles C4'-P-C4' energy: -55.219 flat angles P-C4'-P energy: -35.535 tors. eta vs tors. theta energy: -65.183 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -891.320619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -891.320619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.720619 (E_RNA) where: Base-Base interactions energy: -519.599 where: short stacking energy: -206.963 Base-Backbone interact. energy: 6.348 local terms energy: -248.469781 where: bonds (distance) C4'-P energy: -43.817 bonds (distance) P-C4' energy: -59.076 flat angles C4'-P-C4' energy: -57.628 flat angles P-C4'-P energy: -34.245 tors. eta vs tors. theta energy: -53.704 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -887.288400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.288400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.288400 (E_RNA) where: Base-Base interactions energy: -508.655 where: short stacking energy: -201.979 Base-Backbone interact. energy: -1.002 local terms energy: -251.631271 where: bonds (distance) C4'-P energy: -37.402 bonds (distance) P-C4' energy: -52.741 flat angles C4'-P-C4' energy: -58.005 flat angles P-C4'-P energy: -38.400 tors. eta vs tors. theta energy: -65.083 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -810.494185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.494185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.494185 (E_RNA) where: Base-Base interactions energy: -454.597 where: short stacking energy: -181.836 Base-Backbone interact. energy: 1.176 local terms energy: -231.072922 where: bonds (distance) C4'-P energy: -31.446 bonds (distance) P-C4' energy: -50.647 flat angles C4'-P-C4' energy: -56.748 flat angles P-C4'-P energy: -37.538 tors. eta vs tors. theta energy: -54.694 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -753.907732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.907732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -627.907732 (E_RNA) where: Base-Base interactions energy: -420.359 where: short stacking energy: -152.403 Base-Backbone interact. energy: 1.100 local terms energy: -208.648391 where: bonds (distance) C4'-P energy: -39.037 bonds (distance) P-C4' energy: -44.953 flat angles C4'-P-C4' energy: -58.788 flat angles P-C4'-P energy: -27.041 tors. eta vs tors. theta energy: -38.830 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -713.917037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.917037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.717037 (E_RNA) where: Base-Base interactions energy: -389.505 where: short stacking energy: -167.024 Base-Backbone interact. energy: -0.562 local terms energy: -199.649759 where: bonds (distance) C4'-P energy: -43.672 bonds (distance) P-C4' energy: -46.525 flat angles C4'-P-C4' energy: -47.782 flat angles P-C4'-P energy: -30.673 tors. eta vs tors. theta energy: -30.997 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -1097.639972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1097.639972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -969.839972 (E_RNA) where: Base-Base interactions energy: -658.609 where: short stacking energy: -266.419 Base-Backbone interact. energy: 1.956 local terms energy: -313.187066 where: bonds (distance) C4'-P energy: -61.075 bonds (distance) P-C4' energy: -58.169 flat angles C4'-P-C4' energy: -68.530 flat angles P-C4'-P energy: -41.527 tors. eta vs tors. theta energy: -83.886 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -1025.778232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.778232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -899.778232 (E_RNA) where: Base-Base interactions energy: -599.589 where: short stacking energy: -265.389 Base-Backbone interact. energy: -0.673 local terms energy: -299.515834 where: bonds (distance) C4'-P energy: -59.772 bonds (distance) P-C4' energy: -61.156 flat angles C4'-P-C4' energy: -54.112 flat angles P-C4'-P energy: -50.256 tors. eta vs tors. theta energy: -74.220 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -986.727799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -986.727799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.127799 (E_RNA) where: Base-Base interactions energy: -584.200 where: short stacking energy: -248.596 Base-Backbone interact. energy: -1.286 local terms energy: -280.641458 where: bonds (distance) C4'-P energy: -55.826 bonds (distance) P-C4' energy: -59.146 flat angles C4'-P-C4' energy: -56.298 flat angles P-C4'-P energy: -38.290 tors. eta vs tors. theta energy: -71.081 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -933.184405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -933.184405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -807.184405 (E_RNA) where: Base-Base interactions energy: -526.557 where: short stacking energy: -236.467 Base-Backbone interact. energy: 0.209 local terms energy: -280.836544 where: bonds (distance) C4'-P energy: -51.066 bonds (distance) P-C4' energy: -56.815 flat angles C4'-P-C4' energy: -58.772 flat angles P-C4'-P energy: -45.633 tors. eta vs tors. theta energy: -68.550 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -917.797560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -917.797560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.997560 (E_RNA) where: Base-Base interactions energy: -517.696 where: short stacking energy: -238.151 Base-Backbone interact. energy: -0.676 local terms energy: -271.625599 where: bonds (distance) C4'-P energy: -56.655 bonds (distance) P-C4' energy: -52.767 flat angles C4'-P-C4' energy: -55.294 flat angles P-C4'-P energy: -34.356 tors. eta vs tors. theta energy: -72.554 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -886.661365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -886.661365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.661365 (E_RNA) where: Base-Base interactions energy: -503.132 where: short stacking energy: -208.356 Base-Backbone interact. energy: -0.705 local terms energy: -256.824661 where: bonds (distance) C4'-P energy: -53.787 bonds (distance) P-C4' energy: -47.151 flat angles C4'-P-C4' energy: -54.675 flat angles P-C4'-P energy: -36.156 tors. eta vs tors. theta energy: -65.056 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -822.740600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.740600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.540600 (E_RNA) where: Base-Base interactions energy: -443.146 where: short stacking energy: -194.335 Base-Backbone interact. energy: -0.048 local terms energy: -255.346585 where: bonds (distance) C4'-P energy: -51.629 bonds (distance) P-C4' energy: -60.583 flat angles C4'-P-C4' energy: -60.253 flat angles P-C4'-P energy: -34.065 tors. eta vs tors. theta energy: -48.817 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -803.805596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.805596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.405596 (E_RNA) where: Base-Base interactions energy: -455.262 where: short stacking energy: -190.171 Base-Backbone interact. energy: 0.532 local terms energy: -226.676545 where: bonds (distance) C4'-P energy: -43.087 bonds (distance) P-C4' energy: -49.348 flat angles C4'-P-C4' energy: -52.155 flat angles P-C4'-P energy: -34.268 tors. eta vs tors. theta energy: -47.818 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -752.257446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.257446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.057446 (E_RNA) where: Base-Base interactions energy: -407.253 where: short stacking energy: -173.405 Base-Backbone interact. energy: -0.263 local terms energy: -220.541453 where: bonds (distance) C4'-P energy: -40.706 bonds (distance) P-C4' energy: -46.410 flat angles C4'-P-C4' energy: -51.688 flat angles P-C4'-P energy: -31.268 tors. eta vs tors. theta energy: -50.470 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -676.301809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.301809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.101809 (E_RNA) where: Base-Base interactions energy: -349.224 where: short stacking energy: -139.948 Base-Backbone interact. energy: -0.682 local terms energy: -202.195516 where: bonds (distance) C4'-P energy: -38.457 bonds (distance) P-C4' energy: -45.660 flat angles C4'-P-C4' energy: -43.752 flat angles P-C4'-P energy: -40.047 tors. eta vs tors. theta energy: -34.279 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -1098.437106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1098.437106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -968.837106 (E_RNA) where: Base-Base interactions energy: -663.557 where: short stacking energy: -271.338 Base-Backbone interact. energy: -1.625 local terms energy: -303.654881 where: bonds (distance) C4'-P energy: -53.858 bonds (distance) P-C4' energy: -59.813 flat angles C4'-P-C4' energy: -63.718 flat angles P-C4'-P energy: -42.727 tors. eta vs tors. theta energy: -83.539 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -1027.858880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1027.858880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.058880 (E_RNA) where: Base-Base interactions energy: -612.672 where: short stacking energy: -274.981 Base-Backbone interact. energy: 0.815 local terms energy: -288.201388 where: bonds (distance) C4'-P energy: -50.523 bonds (distance) P-C4' energy: -45.333 flat angles C4'-P-C4' energy: -59.825 flat angles P-C4'-P energy: -49.933 tors. eta vs tors. theta energy: -82.588 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -1010.986842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.986842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -883.186842 (E_RNA) where: Base-Base interactions energy: -609.504 where: short stacking energy: -253.776 Base-Backbone interact. energy: -0.239 local terms energy: -273.443414 where: bonds (distance) C4'-P energy: -49.548 bonds (distance) P-C4' energy: -42.079 flat angles C4'-P-C4' energy: -63.725 flat angles P-C4'-P energy: -43.755 tors. eta vs tors. theta energy: -74.337 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -919.404117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -919.404117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.404117 (E_RNA) where: Base-Base interactions energy: -532.650 where: short stacking energy: -238.308 Base-Backbone interact. energy: 1.635 local terms energy: -262.388517 where: bonds (distance) C4'-P energy: -45.382 bonds (distance) P-C4' energy: -58.583 flat angles C4'-P-C4' energy: -53.417 flat angles P-C4'-P energy: -36.635 tors. eta vs tors. theta energy: -68.372 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -903.085775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -903.085775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.885775 (E_RNA) where: Base-Base interactions energy: -503.767 where: short stacking energy: -224.391 Base-Backbone interact. energy: -0.263 local terms energy: -274.855732 where: bonds (distance) C4'-P energy: -47.870 bonds (distance) P-C4' energy: -54.904 flat angles C4'-P-C4' energy: -62.907 flat angles P-C4'-P energy: -40.698 tors. eta vs tors. theta energy: -68.477 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -850.405427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.405427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.805427 (E_RNA) where: Base-Base interactions energy: -473.162 where: short stacking energy: -208.945 Base-Backbone interact. energy: -1.266 local terms energy: -246.378241 where: bonds (distance) C4'-P energy: -43.840 bonds (distance) P-C4' energy: -49.327 flat angles C4'-P-C4' energy: -55.947 flat angles P-C4'-P energy: -37.862 tors. eta vs tors. theta energy: -59.402 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -836.196112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.196112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.796112 (E_RNA) where: Base-Base interactions energy: -475.190 where: short stacking energy: -224.180 Base-Backbone interact. energy: 0.421 local terms energy: -239.027440 where: bonds (distance) C4'-P energy: -43.631 bonds (distance) P-C4' energy: -47.058 flat angles C4'-P-C4' energy: -53.237 flat angles P-C4'-P energy: -26.523 tors. eta vs tors. theta energy: -68.580 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -809.219188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -809.219188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.419188 (E_RNA) where: Base-Base interactions energy: -439.009 where: short stacking energy: -189.150 Base-Backbone interact. energy: -1.750 local terms energy: -240.659445 where: bonds (distance) C4'-P energy: -39.792 bonds (distance) P-C4' energy: -55.846 flat angles C4'-P-C4' energy: -48.299 flat angles P-C4'-P energy: -38.660 tors. eta vs tors. theta energy: -58.063 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -666.498580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.498580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.698580 (E_RNA) where: Base-Base interactions energy: -328.446 where: short stacking energy: -121.109 Base-Backbone interact. energy: 0.360 local terms energy: -210.612205 where: bonds (distance) C4'-P energy: -48.366 bonds (distance) P-C4' energy: -51.442 flat angles C4'-P-C4' energy: -49.879 flat angles P-C4'-P energy: -33.501 tors. eta vs tors. theta energy: -27.423 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -721.153180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.153180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.353180 (E_RNA) where: Base-Base interactions energy: -388.520 where: short stacking energy: -164.651 Base-Backbone interact. energy: 0.060 local terms energy: -204.892990 where: bonds (distance) C4'-P energy: -35.385 bonds (distance) P-C4' energy: -46.758 flat angles C4'-P-C4' energy: -61.293 flat angles P-C4'-P energy: -18.431 tors. eta vs tors. theta energy: -43.024 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -1087.920972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.920972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.320972 (E_RNA) where: Base-Base interactions energy: -649.689 where: short stacking energy: -268.761 Base-Backbone interact. energy: -4.505 local terms energy: -304.127578 where: bonds (distance) C4'-P energy: -57.016 bonds (distance) P-C4' energy: -52.783 flat angles C4'-P-C4' energy: -62.814 flat angles P-C4'-P energy: -47.886 tors. eta vs tors. theta energy: -83.629 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -1004.758820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.758820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -878.758820 (E_RNA) where: Base-Base interactions energy: -591.892 where: short stacking energy: -259.117 Base-Backbone interact. energy: -0.161 local terms energy: -286.705516 where: bonds (distance) C4'-P energy: -53.033 bonds (distance) P-C4' energy: -55.557 flat angles C4'-P-C4' energy: -59.689 flat angles P-C4'-P energy: -38.336 tors. eta vs tors. theta energy: -80.090 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -1001.904688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.904688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.304688 (E_RNA) where: Base-Base interactions energy: -591.642 where: short stacking energy: -256.345 Base-Backbone interact. energy: 1.457 local terms energy: -282.118912 where: bonds (distance) C4'-P energy: -47.403 bonds (distance) P-C4' energy: -59.195 flat angles C4'-P-C4' energy: -63.588 flat angles P-C4'-P energy: -45.109 tors. eta vs tors. theta energy: -66.824 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -921.323789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.323789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -795.323789 (E_RNA) where: Base-Base interactions energy: -510.829 where: short stacking energy: -220.384 Base-Backbone interact. energy: 0.301 local terms energy: -284.795694 where: bonds (distance) C4'-P energy: -55.670 bonds (distance) P-C4' energy: -58.824 flat angles C4'-P-C4' energy: -60.859 flat angles P-C4'-P energy: -45.738 tors. eta vs tors. theta energy: -63.705 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -900.060170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -900.060170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.460170 (E_RNA) where: Base-Base interactions energy: -509.743 where: short stacking energy: -235.488 Base-Backbone interact. energy: 0.386 local terms energy: -261.102746 where: bonds (distance) C4'-P energy: -50.166 bonds (distance) P-C4' energy: -52.081 flat angles C4'-P-C4' energy: -52.883 flat angles P-C4'-P energy: -38.745 tors. eta vs tors. theta energy: -67.228 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -889.100665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.100665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.300665 (E_RNA) where: Base-Base interactions energy: -509.558 where: short stacking energy: -206.717 Base-Backbone interact. energy: -1.487 local terms energy: -250.256221 where: bonds (distance) C4'-P energy: -48.037 bonds (distance) P-C4' energy: -41.711 flat angles C4'-P-C4' energy: -54.076 flat angles P-C4'-P energy: -42.644 tors. eta vs tors. theta energy: -63.788 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -811.732680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -811.732680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.932680 (E_RNA) where: Base-Base interactions energy: -470.989 where: short stacking energy: -202.736 Base-Backbone interact. energy: -2.042 local terms energy: -210.902058 where: bonds (distance) C4'-P energy: -38.488 bonds (distance) P-C4' energy: -48.514 flat angles C4'-P-C4' energy: -41.776 flat angles P-C4'-P energy: -29.734 tors. eta vs tors. theta energy: -52.390 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -796.610041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -796.610041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.810041 (E_RNA) where: Base-Base interactions energy: -442.842 where: short stacking energy: -175.981 Base-Backbone interact. energy: 2.172 local terms energy: -228.140323 where: bonds (distance) C4'-P energy: -41.185 bonds (distance) P-C4' energy: -46.392 flat angles C4'-P-C4' energy: -51.652 flat angles P-C4'-P energy: -35.871 tors. eta vs tors. theta energy: -53.040 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -701.454276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.454276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.054276 (E_RNA) where: Base-Base interactions energy: -377.663 where: short stacking energy: -154.559 Base-Backbone interact. energy: -1.619 local terms energy: -199.772328 where: bonds (distance) C4'-P energy: -44.733 bonds (distance) P-C4' energy: -40.914 flat angles C4'-P-C4' energy: -45.394 flat angles P-C4'-P energy: -29.905 tors. eta vs tors. theta energy: -38.826 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -717.668210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.668210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.068210 (E_RNA) where: Base-Base interactions energy: -382.672 where: short stacking energy: -167.514 Base-Backbone interact. energy: -0.131 local terms energy: -214.265250 where: bonds (distance) C4'-P energy: -44.032 bonds (distance) P-C4' energy: -48.065 flat angles C4'-P-C4' energy: -60.642 flat angles P-C4'-P energy: -21.682 tors. eta vs tors. theta energy: -39.845 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -1106.809989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1106.809989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -977.209989 (E_RNA) where: Base-Base interactions energy: -662.878 where: short stacking energy: -271.622 Base-Backbone interact. energy: -0.416 local terms energy: -313.916417 where: bonds (distance) C4'-P energy: -60.573 bonds (distance) P-C4' energy: -60.336 flat angles C4'-P-C4' energy: -63.610 flat angles P-C4'-P energy: -48.929 tors. eta vs tors. theta energy: -80.468 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -1011.946523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.946523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.946523 (E_RNA) where: Base-Base interactions energy: -594.794 where: short stacking energy: -250.045 Base-Backbone interact. energy: -0.247 local terms energy: -290.905285 where: bonds (distance) C4'-P energy: -54.142 bonds (distance) P-C4' energy: -59.821 flat angles C4'-P-C4' energy: -68.746 flat angles P-C4'-P energy: -43.491 tors. eta vs tors. theta energy: -64.705 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -997.531329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.531329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.531329 (E_RNA) where: Base-Base interactions energy: -586.633 where: short stacking energy: -239.105 Base-Backbone interact. energy: -0.287 local terms energy: -284.610993 where: bonds (distance) C4'-P energy: -52.293 bonds (distance) P-C4' energy: -60.993 flat angles C4'-P-C4' energy: -62.184 flat angles P-C4'-P energy: -39.708 tors. eta vs tors. theta energy: -69.434 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -925.812389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -925.812389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -796.212389 (E_RNA) where: Base-Base interactions energy: -511.413 where: short stacking energy: -231.338 Base-Backbone interact. energy: -0.374 local terms energy: -284.424871 where: bonds (distance) C4'-P energy: -44.191 bonds (distance) P-C4' energy: -57.128 flat angles C4'-P-C4' energy: -62.318 flat angles P-C4'-P energy: -47.375 tors. eta vs tors. theta energy: -73.414 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -952.444054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -952.444054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.644054 (E_RNA) where: Base-Base interactions energy: -558.444 where: short stacking energy: -226.003 Base-Backbone interact. energy: 0.669 local terms energy: -266.868583 where: bonds (distance) C4'-P energy: -58.810 bonds (distance) P-C4' energy: -47.834 flat angles C4'-P-C4' energy: -61.304 flat angles P-C4'-P energy: -35.636 tors. eta vs tors. theta energy: -63.285 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -892.079788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -892.079788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.079788 (E_RNA) where: Base-Base interactions energy: -505.705 where: short stacking energy: -223.775 Base-Backbone interact. energy: -1.014 local terms energy: -259.360259 where: bonds (distance) C4'-P energy: -39.725 bonds (distance) P-C4' energy: -52.403 flat angles C4'-P-C4' energy: -60.359 flat angles P-C4'-P energy: -42.233 tors. eta vs tors. theta energy: -64.640 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -832.886897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.886897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.086897 (E_RNA) where: Base-Base interactions energy: -475.858 where: short stacking energy: -209.457 Base-Backbone interact. energy: 0.622 local terms energy: -229.851702 where: bonds (distance) C4'-P energy: -44.883 bonds (distance) P-C4' energy: -34.370 flat angles C4'-P-C4' energy: -57.876 flat angles P-C4'-P energy: -38.475 tors. eta vs tors. theta energy: -54.248 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -779.821399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.821399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.021399 (E_RNA) where: Base-Base interactions energy: -426.365 where: short stacking energy: -173.744 Base-Backbone interact. energy: 0.769 local terms energy: -226.424522 where: bonds (distance) C4'-P energy: -52.677 bonds (distance) P-C4' energy: -50.311 flat angles C4'-P-C4' energy: -49.254 flat angles P-C4'-P energy: -30.391 tors. eta vs tors. theta energy: -43.792 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -734.885124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.885124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.085124 (E_RNA) where: Base-Base interactions energy: -390.761 where: short stacking energy: -174.515 Base-Backbone interact. energy: 0.301 local terms energy: -216.624938 where: bonds (distance) C4'-P energy: -40.532 bonds (distance) P-C4' energy: -48.348 flat angles C4'-P-C4' energy: -49.513 flat angles P-C4'-P energy: -31.075 tors. eta vs tors. theta energy: -47.156 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -690.154741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.154741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.354741 (E_RNA) where: Base-Base interactions energy: -361.009 where: short stacking energy: -145.793 Base-Backbone interact. energy: -1.265 local terms energy: -200.080086 where: bonds (distance) C4'-P energy: -40.228 bonds (distance) P-C4' energy: -48.006 flat angles C4'-P-C4' energy: -50.974 flat angles P-C4'-P energy: -27.814 tors. eta vs tors. theta energy: -33.059 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -1091.735402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.735402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.935402 (E_RNA) where: Base-Base interactions energy: -642.044 where: short stacking energy: -280.473 Base-Backbone interact. energy: -0.753 local terms energy: -321.137593 where: bonds (distance) C4'-P energy: -62.371 bonds (distance) P-C4' energy: -61.115 flat angles C4'-P-C4' energy: -60.660 flat angles P-C4'-P energy: -49.442 tors. eta vs tors. theta energy: -87.550 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -1019.564759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.564759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -893.564759 (E_RNA) where: Base-Base interactions energy: -589.120 where: short stacking energy: -261.852 Base-Backbone interact. energy: -0.391 local terms energy: -304.054544 where: bonds (distance) C4'-P energy: -57.448 bonds (distance) P-C4' energy: -49.561 flat angles C4'-P-C4' energy: -66.576 flat angles P-C4'-P energy: -39.617 tors. eta vs tors. theta energy: -90.852 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -992.979282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -992.979282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -865.179282 (E_RNA) where: Base-Base interactions energy: -587.960 where: short stacking energy: -266.055 Base-Backbone interact. energy: -0.369 local terms energy: -276.849693 where: bonds (distance) C4'-P energy: -50.899 bonds (distance) P-C4' energy: -56.345 flat angles C4'-P-C4' energy: -55.671 flat angles P-C4'-P energy: -38.811 tors. eta vs tors. theta energy: -75.123 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -939.174491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -939.174491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.174491 (E_RNA) where: Base-Base interactions energy: -556.625 where: short stacking energy: -215.428 Base-Backbone interact. energy: -1.812 local terms energy: -254.737012 where: bonds (distance) C4'-P energy: -41.407 bonds (distance) P-C4' energy: -56.563 flat angles C4'-P-C4' energy: -56.812 flat angles P-C4'-P energy: -44.876 tors. eta vs tors. theta energy: -55.079 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -898.248087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.248087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.448087 (E_RNA) where: Base-Base interactions energy: -500.240 where: short stacking energy: -222.804 Base-Backbone interact. energy: -0.772 local terms energy: -269.436203 where: bonds (distance) C4'-P energy: -59.191 bonds (distance) P-C4' energy: -55.756 flat angles C4'-P-C4' energy: -57.728 flat angles P-C4'-P energy: -39.049 tors. eta vs tors. theta energy: -57.713 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -878.326537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.326537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.126537 (E_RNA) where: Base-Base interactions energy: -488.149 where: short stacking energy: -230.942 Base-Backbone interact. energy: -0.689 local terms energy: -265.288799 where: bonds (distance) C4'-P energy: -48.498 bonds (distance) P-C4' energy: -55.258 flat angles C4'-P-C4' energy: -55.213 flat angles P-C4'-P energy: -37.154 tors. eta vs tors. theta energy: -69.166 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -833.682591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.682591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.682591 (E_RNA) where: Base-Base interactions energy: -455.248 where: short stacking energy: -198.614 Base-Backbone interact. energy: -0.382 local terms energy: -252.052794 where: bonds (distance) C4'-P energy: -48.863 bonds (distance) P-C4' energy: -53.182 flat angles C4'-P-C4' energy: -59.672 flat angles P-C4'-P energy: -35.474 tors. eta vs tors. theta energy: -54.862 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -804.752788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -804.752788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.952788 (E_RNA) where: Base-Base interactions energy: -445.256 where: short stacking energy: -173.353 Base-Backbone interact. energy: 0.137 local terms energy: -231.833907 where: bonds (distance) C4'-P energy: -47.473 bonds (distance) P-C4' energy: -48.842 flat angles C4'-P-C4' energy: -49.642 flat angles P-C4'-P energy: -35.987 tors. eta vs tors. theta energy: -49.889 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -753.124089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.124089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -625.324089 (E_RNA) where: Base-Base interactions energy: -405.912 where: short stacking energy: -164.205 Base-Backbone interact. energy: -0.007 local terms energy: -219.405521 where: bonds (distance) C4'-P energy: -38.873 bonds (distance) P-C4' energy: -49.959 flat angles C4'-P-C4' energy: -60.294 flat angles P-C4'-P energy: -28.927 tors. eta vs tors. theta energy: -41.353 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -694.946609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.946609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.546609 (E_RNA) where: Base-Base interactions energy: -377.556 where: short stacking energy: -145.398 Base-Backbone interact. energy: -0.752 local terms energy: -194.238430 where: bonds (distance) C4'-P energy: -41.519 bonds (distance) P-C4' energy: -37.096 flat angles C4'-P-C4' energy: -51.395 flat angles P-C4'-P energy: -29.797 tors. eta vs tors. theta energy: -34.432 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -1088.259246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1088.259246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.659246 (E_RNA) where: Base-Base interactions energy: -646.271 where: short stacking energy: -288.260 Base-Backbone interact. energy: -0.896 local terms energy: -311.491835 where: bonds (distance) C4'-P energy: -60.162 bonds (distance) P-C4' energy: -55.594 flat angles C4'-P-C4' energy: -63.821 flat angles P-C4'-P energy: -47.432 tors. eta vs tors. theta energy: -84.483 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -1027.126785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1027.126785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.526785 (E_RNA) where: Base-Base interactions energy: -594.465 where: short stacking energy: -273.023 Base-Backbone interact. energy: -1.462 local terms energy: -301.599708 where: bonds (distance) C4'-P energy: -54.638 bonds (distance) P-C4' energy: -59.818 flat angles C4'-P-C4' energy: -57.682 flat angles P-C4'-P energy: -46.014 tors. eta vs tors. theta energy: -83.447 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -985.242057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.242057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -857.442057 (E_RNA) where: Base-Base interactions energy: -554.600 where: short stacking energy: -243.832 Base-Backbone interact. energy: -0.733 local terms energy: -302.108840 where: bonds (distance) C4'-P energy: -58.317 bonds (distance) P-C4' energy: -64.953 flat angles C4'-P-C4' energy: -59.655 flat angles P-C4'-P energy: -44.960 tors. eta vs tors. theta energy: -74.224 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -970.785091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -970.785091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.185091 (E_RNA) where: Base-Base interactions energy: -578.887 where: short stacking energy: -205.106 Base-Backbone interact. energy: -2.685 local terms energy: -259.612747 where: bonds (distance) C4'-P energy: -56.119 bonds (distance) P-C4' energy: -47.577 flat angles C4'-P-C4' energy: -57.469 flat angles P-C4'-P energy: -35.982 tors. eta vs tors. theta energy: -62.465 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -885.732844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -885.732844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.932844 (E_RNA) where: Base-Base interactions energy: -498.896 where: short stacking energy: -218.429 Base-Backbone interact. energy: -1.948 local terms energy: -257.088483 where: bonds (distance) C4'-P energy: -43.639 bonds (distance) P-C4' energy: -54.704 flat angles C4'-P-C4' energy: -54.158 flat angles P-C4'-P energy: -40.289 tors. eta vs tors. theta energy: -64.299 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -891.153280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -891.153280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.553280 (E_RNA) where: Base-Base interactions energy: -518.573 where: short stacking energy: -244.414 Base-Backbone interact. energy: -1.438 local terms energy: -241.542306 where: bonds (distance) C4'-P energy: -35.374 bonds (distance) P-C4' energy: -40.078 flat angles C4'-P-C4' energy: -58.441 flat angles P-C4'-P energy: -34.158 tors. eta vs tors. theta energy: -73.491 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -869.387125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.387125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.587125 (E_RNA) where: Base-Base interactions energy: -497.721 where: short stacking energy: -218.326 Base-Backbone interact. energy: 0.295 local terms energy: -244.160535 where: bonds (distance) C4'-P energy: -40.688 bonds (distance) P-C4' energy: -50.726 flat angles C4'-P-C4' energy: -61.497 flat angles P-C4'-P energy: -26.762 tors. eta vs tors. theta energy: -64.488 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -842.298058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -842.298058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.298058 (E_RNA) where: Base-Base interactions energy: -474.898 where: short stacking energy: -205.828 Base-Backbone interact. energy: -0.187 local terms energy: -241.212151 where: bonds (distance) C4'-P energy: -45.202 bonds (distance) P-C4' energy: -42.827 flat angles C4'-P-C4' energy: -55.359 flat angles P-C4'-P energy: -37.262 tors. eta vs tors. theta energy: -60.563 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -784.876569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.876569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.276569 (E_RNA) where: Base-Base interactions energy: -432.260 where: short stacking energy: -183.689 Base-Backbone interact. energy: -0.612 local terms energy: -222.404655 where: bonds (distance) C4'-P energy: -48.066 bonds (distance) P-C4' energy: -48.801 flat angles C4'-P-C4' energy: -48.189 flat angles P-C4'-P energy: -26.051 tors. eta vs tors. theta energy: -51.297 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -739.043210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -739.043210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.043210 (E_RNA) where: Base-Base interactions energy: -395.325 where: short stacking energy: -165.061 Base-Backbone interact. energy: -0.749 local terms energy: -216.968540 where: bonds (distance) C4'-P energy: -44.968 bonds (distance) P-C4' energy: -49.378 flat angles C4'-P-C4' energy: -53.262 flat angles P-C4'-P energy: -30.597 tors. eta vs tors. theta energy: -38.764 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -1070.726009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1070.726009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -942.926009 (E_RNA) where: Base-Base interactions energy: -649.957 where: short stacking energy: -277.486 Base-Backbone interact. energy: -1.352 local terms energy: -291.617122 where: bonds (distance) C4'-P energy: -55.257 bonds (distance) P-C4' energy: -52.975 flat angles C4'-P-C4' energy: -64.163 flat angles P-C4'-P energy: -40.100 tors. eta vs tors. theta energy: -79.122 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -1026.721898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.721898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -898.921898 (E_RNA) where: Base-Base interactions energy: -603.806 where: short stacking energy: -260.206 Base-Backbone interact. energy: 0.657 local terms energy: -295.772593 where: bonds (distance) C4'-P energy: -51.168 bonds (distance) P-C4' energy: -59.475 flat angles C4'-P-C4' energy: -63.263 flat angles P-C4'-P energy: -42.748 tors. eta vs tors. theta energy: -79.119 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -967.903327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -967.903327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.303327 (E_RNA) where: Base-Base interactions energy: -555.583 where: short stacking energy: -245.029 Base-Backbone interact. energy: -1.342 local terms energy: -281.378634 where: bonds (distance) C4'-P energy: -48.335 bonds (distance) P-C4' energy: -53.250 flat angles C4'-P-C4' energy: -66.907 flat angles P-C4'-P energy: -42.285 tors. eta vs tors. theta energy: -70.601 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -947.800373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -947.800373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.000373 (E_RNA) where: Base-Base interactions energy: -553.054 where: short stacking energy: -221.642 Base-Backbone interact. energy: 1.301 local terms energy: -268.247678 where: bonds (distance) C4'-P energy: -53.180 bonds (distance) P-C4' energy: -56.580 flat angles C4'-P-C4' energy: -54.950 flat angles P-C4'-P energy: -46.021 tors. eta vs tors. theta energy: -57.517 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -871.137087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.137087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.337087 (E_RNA) where: Base-Base interactions energy: -476.659 where: short stacking energy: -208.531 Base-Backbone interact. energy: -0.359 local terms energy: -266.319433 where: bonds (distance) C4'-P energy: -61.235 bonds (distance) P-C4' energy: -51.513 flat angles C4'-P-C4' energy: -54.481 flat angles P-C4'-P energy: -35.104 tors. eta vs tors. theta energy: -63.987 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -901.458712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -901.458712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.858712 (E_RNA) where: Base-Base interactions energy: -522.944 where: short stacking energy: -232.966 Base-Backbone interact. energy: -0.380 local terms energy: -248.533977 where: bonds (distance) C4'-P energy: -46.995 bonds (distance) P-C4' energy: -48.797 flat angles C4'-P-C4' energy: -54.736 flat angles P-C4'-P energy: -30.946 tors. eta vs tors. theta energy: -67.060 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -849.386074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.386074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.586074 (E_RNA) where: Base-Base interactions energy: -464.656 where: short stacking energy: -206.635 Base-Backbone interact. energy: -0.375 local terms energy: -256.554643 where: bonds (distance) C4'-P energy: -52.301 bonds (distance) P-C4' energy: -47.536 flat angles C4'-P-C4' energy: -61.255 flat angles P-C4'-P energy: -30.976 tors. eta vs tors. theta energy: -64.486 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -809.291865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -809.291865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.091865 (E_RNA) where: Base-Base interactions energy: -454.651 where: short stacking energy: -205.670 Base-Backbone interact. energy: -1.200 local terms energy: -229.240522 where: bonds (distance) C4'-P energy: -50.117 bonds (distance) P-C4' energy: -54.961 flat angles C4'-P-C4' energy: -43.788 flat angles P-C4'-P energy: -27.104 tors. eta vs tors. theta energy: -53.271 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -775.563742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.563742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.763742 (E_RNA) where: Base-Base interactions energy: -421.830 where: short stacking energy: -183.998 Base-Backbone interact. energy: 0.343 local terms energy: -235.276614 where: bonds (distance) C4'-P energy: -45.741 bonds (distance) P-C4' energy: -57.650 flat angles C4'-P-C4' energy: -50.852 flat angles P-C4'-P energy: -32.725 tors. eta vs tors. theta energy: -48.310 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -677.905117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.905117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.705117 (E_RNA) where: Base-Base interactions energy: -343.908 where: short stacking energy: -152.021 Base-Backbone interact. energy: -0.275 local terms energy: -209.522241 where: bonds (distance) C4'-P energy: -48.216 bonds (distance) P-C4' energy: -55.041 flat angles C4'-P-C4' energy: -49.743 flat angles P-C4'-P energy: -21.313 tors. eta vs tors. theta energy: -35.209 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -1089.885972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.885972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.085972 (E_RNA) where: Base-Base interactions energy: -653.759 where: short stacking energy: -281.874 Base-Backbone interact. energy: -0.957 local terms energy: -307.370256 where: bonds (distance) C4'-P energy: -57.806 bonds (distance) P-C4' energy: -61.067 flat angles C4'-P-C4' energy: -58.406 flat angles P-C4'-P energy: -48.391 tors. eta vs tors. theta energy: -81.700 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -1032.956279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1032.956279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -908.756279 (E_RNA) where: Base-Base interactions energy: -607.994 where: short stacking energy: -263.808 Base-Backbone interact. energy: 0.057 local terms energy: -300.819479 where: bonds (distance) C4'-P energy: -49.935 bonds (distance) P-C4' energy: -60.480 flat angles C4'-P-C4' energy: -63.710 flat angles P-C4'-P energy: -48.382 tors. eta vs tors. theta energy: -78.313 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -1008.855455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.855455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.855455 (E_RNA) where: Base-Base interactions energy: -596.740 where: short stacking energy: -260.730 Base-Backbone interact. energy: -0.318 local terms energy: -285.798236 where: bonds (distance) C4'-P energy: -56.385 bonds (distance) P-C4' energy: -59.773 flat angles C4'-P-C4' energy: -56.326 flat angles P-C4'-P energy: -44.391 tors. eta vs tors. theta energy: -68.923 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -965.744651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.744651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.544651 (E_RNA) where: Base-Base interactions energy: -580.796 where: short stacking energy: -230.640 Base-Backbone interact. energy: -2.371 local terms energy: -258.377309 where: bonds (distance) C4'-P energy: -50.285 bonds (distance) P-C4' energy: -35.934 flat angles C4'-P-C4' energy: -59.951 flat angles P-C4'-P energy: -45.610 tors. eta vs tors. theta energy: -66.597 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -899.254088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -899.254088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.454088 (E_RNA) where: Base-Base interactions energy: -506.067 where: short stacking energy: -208.460 Base-Backbone interact. energy: -1.404 local terms energy: -263.983010 where: bonds (distance) C4'-P energy: -47.565 bonds (distance) P-C4' energy: -53.973 flat angles C4'-P-C4' energy: -57.288 flat angles P-C4'-P energy: -38.253 tors. eta vs tors. theta energy: -66.903 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -866.164279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.164279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.364279 (E_RNA) where: Base-Base interactions energy: -487.139 where: short stacking energy: -224.039 Base-Backbone interact. energy: -0.934 local terms energy: -250.291665 where: bonds (distance) C4'-P energy: -50.320 bonds (distance) P-C4' energy: -46.637 flat angles C4'-P-C4' energy: -52.621 flat angles P-C4'-P energy: -34.292 tors. eta vs tors. theta energy: -66.422 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -846.330384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.330384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.530384 (E_RNA) where: Base-Base interactions energy: -469.499 where: short stacking energy: -209.389 Base-Backbone interact. energy: -0.158 local terms energy: -248.873287 where: bonds (distance) C4'-P energy: -44.425 bonds (distance) P-C4' energy: -51.577 flat angles C4'-P-C4' energy: -55.585 flat angles P-C4'-P energy: -40.014 tors. eta vs tors. theta energy: -57.273 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -798.002761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.002761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.802761 (E_RNA) where: Base-Base interactions energy: -431.621 where: short stacking energy: -184.660 Base-Backbone interact. energy: 1.951 local terms energy: -244.132623 where: bonds (distance) C4'-P energy: -47.282 bonds (distance) P-C4' energy: -53.573 flat angles C4'-P-C4' energy: -56.521 flat angles P-C4'-P energy: -28.982 tors. eta vs tors. theta energy: -57.774 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -798.603435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.603435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.003435 (E_RNA) where: Base-Base interactions energy: -430.330 where: short stacking energy: -188.754 Base-Backbone interact. energy: 0.112 local terms energy: -238.785574 where: bonds (distance) C4'-P energy: -40.763 bonds (distance) P-C4' energy: -51.518 flat angles C4'-P-C4' energy: -50.821 flat angles P-C4'-P energy: -35.450 tors. eta vs tors. theta energy: -60.233 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -718.151116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.151116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.751116 (E_RNA) where: Base-Base interactions energy: -403.014 where: short stacking energy: -164.994 Base-Backbone interact. energy: -1.786 local terms energy: -190.952071 where: bonds (distance) C4'-P energy: -39.401 bonds (distance) P-C4' energy: -38.198 flat angles C4'-P-C4' energy: -47.654 flat angles P-C4'-P energy: -31.734 tors. eta vs tors. theta energy: -33.965 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -1088.465849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1088.465849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.665849 (E_RNA) where: Base-Base interactions energy: -650.131 where: short stacking energy: -268.497 Base-Backbone interact. energy: -0.886 local terms energy: -309.648817 where: bonds (distance) C4'-P energy: -54.143 bonds (distance) P-C4' energy: -58.666 flat angles C4'-P-C4' energy: -65.664 flat angles P-C4'-P energy: -45.735 tors. eta vs tors. theta energy: -85.440 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -1033.024475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1033.024475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -903.424475 (E_RNA) where: Base-Base interactions energy: -613.149 where: short stacking energy: -273.244 Base-Backbone interact. energy: 0.944 local terms energy: -291.219781 where: bonds (distance) C4'-P energy: -58.276 bonds (distance) P-C4' energy: -55.307 flat angles C4'-P-C4' energy: -52.236 flat angles P-C4'-P energy: -44.272 tors. eta vs tors. theta energy: -81.129 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -1007.087271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1007.087271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -877.487271 (E_RNA) where: Base-Base interactions energy: -598.872 where: short stacking energy: -249.271 Base-Backbone interact. energy: -1.801 local terms energy: -276.814434 where: bonds (distance) C4'-P energy: -50.799 bonds (distance) P-C4' energy: -60.870 flat angles C4'-P-C4' energy: -52.150 flat angles P-C4'-P energy: -37.717 tors. eta vs tors. theta energy: -75.278 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -987.470946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.470946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -857.870946 (E_RNA) where: Base-Base interactions energy: -594.095 where: short stacking energy: -246.710 Base-Backbone interact. energy: -0.797 local terms energy: -262.978952 where: bonds (distance) C4'-P energy: -54.576 bonds (distance) P-C4' energy: -39.294 flat angles C4'-P-C4' energy: -63.486 flat angles P-C4'-P energy: -34.976 tors. eta vs tors. theta energy: -70.648 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -893.990015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.990015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.190015 (E_RNA) where: Base-Base interactions energy: -502.049 where: short stacking energy: -235.179 Base-Backbone interact. energy: 0.205 local terms energy: -264.345992 where: bonds (distance) C4'-P energy: -47.794 bonds (distance) P-C4' energy: -44.744 flat angles C4'-P-C4' energy: -59.650 flat angles P-C4'-P energy: -42.654 tors. eta vs tors. theta energy: -69.504 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -863.449514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -863.449514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.449514 (E_RNA) where: Base-Base interactions energy: -489.862 where: short stacking energy: -216.047 Base-Backbone interact. energy: -0.825 local terms energy: -246.762547 where: bonds (distance) C4'-P energy: -50.274 bonds (distance) P-C4' energy: -36.839 flat angles C4'-P-C4' energy: -59.299 flat angles P-C4'-P energy: -42.113 tors. eta vs tors. theta energy: -58.238 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -853.264447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.264447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.464447 (E_RNA) where: Base-Base interactions energy: -456.187 where: short stacking energy: -209.176 Base-Backbone interact. energy: -1.277 local terms energy: -268.001154 where: bonds (distance) C4'-P energy: -56.662 bonds (distance) P-C4' energy: -53.340 flat angles C4'-P-C4' energy: -61.016 flat angles P-C4'-P energy: -37.084 tors. eta vs tors. theta energy: -59.899 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -778.971413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.971413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.371413 (E_RNA) where: Base-Base interactions energy: -435.352 where: short stacking energy: -199.685 Base-Backbone interact. energy: -0.460 local terms energy: -213.559682 where: bonds (distance) C4'-P energy: -43.919 bonds (distance) P-C4' energy: -41.989 flat angles C4'-P-C4' energy: -46.223 flat angles P-C4'-P energy: -26.058 tors. eta vs tors. theta energy: -55.371 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -777.072736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.072736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.272736 (E_RNA) where: Base-Base interactions energy: -434.688 where: short stacking energy: -182.270 Base-Backbone interact. energy: 1.203 local terms energy: -215.788288 where: bonds (distance) C4'-P energy: -43.986 bonds (distance) P-C4' energy: -38.426 flat angles C4'-P-C4' energy: -50.138 flat angles P-C4'-P energy: -32.253 tors. eta vs tors. theta energy: -50.985 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -678.856187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.856187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.256187 (E_RNA) where: Base-Base interactions energy: -360.854 where: short stacking energy: -142.454 Base-Backbone interact. energy: -1.134 local terms energy: -196.268654 where: bonds (distance) C4'-P energy: -47.202 bonds (distance) P-C4' energy: -51.055 flat angles C4'-P-C4' energy: -40.329 flat angles P-C4'-P energy: -29.411 tors. eta vs tors. theta energy: -28.272 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -1093.021919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1093.021919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.421919 (E_RNA) where: Base-Base interactions energy: -661.749 where: short stacking energy: -282.651 Base-Backbone interact. energy: -1.003 local terms energy: -300.669872 where: bonds (distance) C4'-P energy: -55.409 bonds (distance) P-C4' energy: -58.704 flat angles C4'-P-C4' energy: -62.232 flat angles P-C4'-P energy: -40.138 tors. eta vs tors. theta energy: -84.186 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -1049.798533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1049.798533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.798533 (E_RNA) where: Base-Base interactions energy: -620.845 where: short stacking energy: -277.501 Base-Backbone interact. energy: 0.434 local terms energy: -303.388228 where: bonds (distance) C4'-P energy: -52.885 bonds (distance) P-C4' energy: -53.226 flat angles C4'-P-C4' energy: -63.269 flat angles P-C4'-P energy: -49.021 tors. eta vs tors. theta energy: -84.987 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -1002.777867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1002.777867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -873.177867 (E_RNA) where: Base-Base interactions energy: -577.721 where: short stacking energy: -259.186 Base-Backbone interact. energy: 0.047 local terms energy: -295.503825 where: bonds (distance) C4'-P energy: -55.233 bonds (distance) P-C4' energy: -57.025 flat angles C4'-P-C4' energy: -61.897 flat angles P-C4'-P energy: -39.963 tors. eta vs tors. theta energy: -81.385 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -992.750980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -992.750980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -863.150980 (E_RNA) where: Base-Base interactions energy: -583.078 where: short stacking energy: -240.266 Base-Backbone interact. energy: -0.660 local terms energy: -279.413379 where: bonds (distance) C4'-P energy: -51.951 bonds (distance) P-C4' energy: -50.324 flat angles C4'-P-C4' energy: -62.221 flat angles P-C4'-P energy: -43.356 tors. eta vs tors. theta energy: -71.560 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -918.726659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -918.726659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.126659 (E_RNA) where: Base-Base interactions energy: -511.322 where: short stacking energy: -229.345 Base-Backbone interact. energy: -2.526 local terms energy: -275.279021 where: bonds (distance) C4'-P energy: -47.178 bonds (distance) P-C4' energy: -51.167 flat angles C4'-P-C4' energy: -62.605 flat angles P-C4'-P energy: -43.264 tors. eta vs tors. theta energy: -71.065 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -864.403285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -864.403285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.603285 (E_RNA) where: Base-Base interactions energy: -478.237 where: short stacking energy: -208.613 Base-Backbone interact. energy: -1.104 local terms energy: -257.261802 where: bonds (distance) C4'-P energy: -50.232 bonds (distance) P-C4' energy: -50.669 flat angles C4'-P-C4' energy: -51.121 flat angles P-C4'-P energy: -45.137 tors. eta vs tors. theta energy: -60.102 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -814.737962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.737962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.937962 (E_RNA) where: Base-Base interactions energy: -447.800 where: short stacking energy: -190.475 Base-Backbone interact. energy: 0.869 local terms energy: -240.007895 where: bonds (distance) C4'-P energy: -49.257 bonds (distance) P-C4' energy: -48.146 flat angles C4'-P-C4' energy: -53.002 flat angles P-C4'-P energy: -41.383 tors. eta vs tors. theta energy: -48.220 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -803.358850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.358850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.758850 (E_RNA) where: Base-Base interactions energy: -444.237 where: short stacking energy: -198.943 Base-Backbone interact. energy: 0.274 local terms energy: -229.796165 where: bonds (distance) C4'-P energy: -42.206 bonds (distance) P-C4' energy: -49.407 flat angles C4'-P-C4' energy: -50.535 flat angles P-C4'-P energy: -38.404 tors. eta vs tors. theta energy: -49.244 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -730.819682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.819682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.219682 (E_RNA) where: Base-Base interactions energy: -415.937 where: short stacking energy: -173.177 Base-Backbone interact. energy: -0.728 local terms energy: -184.554101 where: bonds (distance) C4'-P energy: -44.888 bonds (distance) P-C4' energy: -45.684 flat angles C4'-P-C4' energy: -31.972 flat angles P-C4'-P energy: -25.475 tors. eta vs tors. theta energy: -36.535 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -679.593639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.593639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.993639 (E_RNA) where: Base-Base interactions energy: -369.563 where: short stacking energy: -157.558 Base-Backbone interact. energy: 1.130 local terms energy: -190.561001 where: bonds (distance) C4'-P energy: -38.550 bonds (distance) P-C4' energy: -49.161 flat angles C4'-P-C4' energy: -46.660 flat angles P-C4'-P energy: -31.986 tors. eta vs tors. theta energy: -24.203 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -1105.383336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1105.383336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.783336 (E_RNA) where: Base-Base interactions energy: -664.083 where: short stacking energy: -276.872 Base-Backbone interact. energy: -0.396 local terms energy: -311.304155 where: bonds (distance) C4'-P energy: -59.126 bonds (distance) P-C4' energy: -53.435 flat angles C4'-P-C4' energy: -60.577 flat angles P-C4'-P energy: -54.469 tors. eta vs tors. theta energy: -83.697 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -1028.987146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1028.987146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.187146 (E_RNA) where: Base-Base interactions energy: -583.471 where: short stacking energy: -272.945 Base-Backbone interact. energy: -1.064 local terms energy: -316.652433 where: bonds (distance) C4'-P energy: -61.804 bonds (distance) P-C4' energy: -63.875 flat angles C4'-P-C4' energy: -64.716 flat angles P-C4'-P energy: -46.978 tors. eta vs tors. theta energy: -79.279 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -1001.451727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.451727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -877.251727 (E_RNA) where: Base-Base interactions energy: -591.585 where: short stacking energy: -259.591 Base-Backbone interact. energy: 0.833 local terms energy: -286.499538 where: bonds (distance) C4'-P energy: -47.717 bonds (distance) P-C4' energy: -52.298 flat angles C4'-P-C4' energy: -67.376 flat angles P-C4'-P energy: -42.155 tors. eta vs tors. theta energy: -76.954 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -978.234880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.234880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -854.034880 (E_RNA) where: Base-Base interactions energy: -567.392 where: short stacking energy: -224.027 Base-Backbone interact. energy: -1.059 local terms energy: -285.583355 where: bonds (distance) C4'-P energy: -51.084 bonds (distance) P-C4' energy: -58.181 flat angles C4'-P-C4' energy: -61.987 flat angles P-C4'-P energy: -38.883 tors. eta vs tors. theta energy: -75.448 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -915.462888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -915.462888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.862888 (E_RNA) where: Base-Base interactions energy: -535.520 where: short stacking energy: -225.191 Base-Backbone interact. energy: 0.496 local terms energy: -259.839130 where: bonds (distance) C4'-P energy: -52.478 bonds (distance) P-C4' energy: -49.094 flat angles C4'-P-C4' energy: -56.051 flat angles P-C4'-P energy: -41.548 tors. eta vs tors. theta energy: -60.669 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -850.170675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.170675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.170675 (E_RNA) where: Base-Base interactions energy: -482.890 where: short stacking energy: -211.916 Base-Backbone interact. energy: 1.191 local terms energy: -242.471190 where: bonds (distance) C4'-P energy: -47.024 bonds (distance) P-C4' energy: -42.260 flat angles C4'-P-C4' energy: -56.681 flat angles P-C4'-P energy: -37.588 tors. eta vs tors. theta energy: -58.917 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -831.258459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.258459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.458459 (E_RNA) where: Base-Base interactions energy: -486.654 where: short stacking energy: -201.384 Base-Backbone interact. energy: 2.494 local terms energy: -219.298214 where: bonds (distance) C4'-P energy: -36.822 bonds (distance) P-C4' energy: -50.673 flat angles C4'-P-C4' energy: -52.989 flat angles P-C4'-P energy: -18.194 tors. eta vs tors. theta energy: -60.620 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -822.718293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.718293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.918293 (E_RNA) where: Base-Base interactions energy: -479.785 where: short stacking energy: -196.268 Base-Backbone interact. energy: 0.973 local terms energy: -216.106704 where: bonds (distance) C4'-P energy: -35.568 bonds (distance) P-C4' energy: -48.489 flat angles C4'-P-C4' energy: -47.314 flat angles P-C4'-P energy: -31.354 tors. eta vs tors. theta energy: -53.382 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -722.307118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.307118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.707118 (E_RNA) where: Base-Base interactions energy: -395.338 where: short stacking energy: -169.236 Base-Backbone interact. energy: 1.933 local terms energy: -199.301935 where: bonds (distance) C4'-P energy: -41.654 bonds (distance) P-C4' energy: -42.471 flat angles C4'-P-C4' energy: -54.819 flat angles P-C4'-P energy: -22.241 tors. eta vs tors. theta energy: -38.117 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -700.394858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.394858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.794858 (E_RNA) where: Base-Base interactions energy: -379.875 where: short stacking energy: -142.594 Base-Backbone interact. energy: 1.717 local terms energy: -192.636329 where: bonds (distance) C4'-P energy: -45.558 bonds (distance) P-C4' energy: -33.993 flat angles C4'-P-C4' energy: -53.186 flat angles P-C4'-P energy: -25.976 tors. eta vs tors. theta energy: -33.924 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -1106.092706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1106.092706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.292706 (E_RNA) where: Base-Base interactions energy: -668.790 where: short stacking energy: -274.224 Base-Backbone interact. energy: -0.271 local terms energy: -309.231957 where: bonds (distance) C4'-P energy: -59.592 bonds (distance) P-C4' energy: -57.418 flat angles C4'-P-C4' energy: -66.152 flat angles P-C4'-P energy: -40.261 tors. eta vs tors. theta energy: -85.808 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -1009.687399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.687399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -883.687399 (E_RNA) where: Base-Base interactions energy: -595.594 where: short stacking energy: -255.919 Base-Backbone interact. energy: -0.640 local terms energy: -287.453760 where: bonds (distance) C4'-P energy: -52.115 bonds (distance) P-C4' energy: -47.196 flat angles C4'-P-C4' energy: -62.239 flat angles P-C4'-P energy: -43.530 tors. eta vs tors. theta energy: -82.373 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -1021.330660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.330660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -895.330660 (E_RNA) where: Base-Base interactions energy: -608.204 where: short stacking energy: -264.308 Base-Backbone interact. energy: -0.366 local terms energy: -286.760734 where: bonds (distance) C4'-P energy: -55.380 bonds (distance) P-C4' energy: -46.397 flat angles C4'-P-C4' energy: -61.700 flat angles P-C4'-P energy: -43.709 tors. eta vs tors. theta energy: -79.574 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -1001.508269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.508269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.908269 (E_RNA) where: Base-Base interactions energy: -608.285 where: short stacking energy: -231.787 Base-Backbone interact. energy: -1.001 local terms energy: -262.622155 where: bonds (distance) C4'-P energy: -43.630 bonds (distance) P-C4' energy: -57.540 flat angles C4'-P-C4' energy: -58.938 flat angles P-C4'-P energy: -34.455 tors. eta vs tors. theta energy: -68.059 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -898.610971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.610971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.010971 (E_RNA) where: Base-Base interactions energy: -525.462 where: short stacking energy: -221.933 Base-Backbone interact. energy: 2.599 local terms energy: -255.147929 where: bonds (distance) C4'-P energy: -51.034 bonds (distance) P-C4' energy: -42.128 flat angles C4'-P-C4' energy: -63.784 flat angles P-C4'-P energy: -40.387 tors. eta vs tors. theta energy: -57.815 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -875.891350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.891350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.891350 (E_RNA) where: Base-Base interactions energy: -492.653 where: short stacking energy: -211.636 Base-Backbone interact. energy: 2.287 local terms energy: -259.524784 where: bonds (distance) C4'-P energy: -51.421 bonds (distance) P-C4' energy: -52.810 flat angles C4'-P-C4' energy: -56.672 flat angles P-C4'-P energy: -39.033 tors. eta vs tors. theta energy: -59.588 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -822.671178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.671178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.871178 (E_RNA) where: Base-Base interactions energy: -451.023 where: short stacking energy: -193.582 Base-Backbone interact. energy: -0.025 local terms energy: -243.823612 where: bonds (distance) C4'-P energy: -55.838 bonds (distance) P-C4' energy: -44.168 flat angles C4'-P-C4' energy: -50.321 flat angles P-C4'-P energy: -38.253 tors. eta vs tors. theta energy: -55.245 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -782.373133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.373133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.573133 (E_RNA) where: Base-Base interactions energy: -418.549 where: short stacking energy: -174.221 Base-Backbone interact. energy: -1.084 local terms energy: -234.939552 where: bonds (distance) C4'-P energy: -38.965 bonds (distance) P-C4' energy: -50.067 flat angles C4'-P-C4' energy: -52.937 flat angles P-C4'-P energy: -45.001 tors. eta vs tors. theta energy: -47.969 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -737.054558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.054558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.454558 (E_RNA) where: Base-Base interactions energy: -388.149 where: short stacking energy: -164.304 Base-Backbone interact. energy: -0.575 local terms energy: -227.730421 where: bonds (distance) C4'-P energy: -44.579 bonds (distance) P-C4' energy: -55.112 flat angles C4'-P-C4' energy: -51.086 flat angles P-C4'-P energy: -34.682 tors. eta vs tors. theta energy: -42.271 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -702.409822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.409822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.009822 (E_RNA) where: Base-Base interactions energy: -387.491 where: short stacking energy: -162.158 Base-Backbone interact. energy: 1.731 local terms energy: -194.249735 where: bonds (distance) C4'-P energy: -40.229 bonds (distance) P-C4' energy: -39.860 flat angles C4'-P-C4' energy: -46.266 flat angles P-C4'-P energy: -25.763 tors. eta vs tors. theta energy: -42.131 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -1095.966863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.966863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.366863 (E_RNA) where: Base-Base interactions energy: -649.119 where: short stacking energy: -276.437 Base-Backbone interact. energy: 0.729 local terms energy: -317.977220 where: bonds (distance) C4'-P energy: -56.248 bonds (distance) P-C4' energy: -59.149 flat angles C4'-P-C4' energy: -72.308 flat angles P-C4'-P energy: -48.469 tors. eta vs tors. theta energy: -81.804 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -1061.493735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.493735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -935.493735 (E_RNA) where: Base-Base interactions energy: -640.519 where: short stacking energy: -267.607 Base-Backbone interact. energy: -1.034 local terms energy: -293.940590 where: bonds (distance) C4'-P energy: -48.266 bonds (distance) P-C4' energy: -60.331 flat angles C4'-P-C4' energy: -64.776 flat angles P-C4'-P energy: -46.418 tors. eta vs tors. theta energy: -74.150 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -988.653114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -988.653114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.053114 (E_RNA) where: Base-Base interactions energy: -572.946 where: short stacking energy: -252.633 Base-Backbone interact. energy: -1.066 local terms energy: -285.040545 where: bonds (distance) C4'-P energy: -45.416 bonds (distance) P-C4' energy: -52.741 flat angles C4'-P-C4' energy: -58.168 flat angles P-C4'-P energy: -45.834 tors. eta vs tors. theta energy: -82.882 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -1004.809538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.809538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.409538 (E_RNA) where: Base-Base interactions energy: -601.184 where: short stacking energy: -230.527 Base-Backbone interact. energy: 1.719 local terms energy: -282.943919 where: bonds (distance) C4'-P energy: -55.088 bonds (distance) P-C4' energy: -53.688 flat angles C4'-P-C4' energy: -65.646 flat angles P-C4'-P energy: -43.785 tors. eta vs tors. theta energy: -64.737 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -918.718946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -918.718946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.918946 (E_RNA) where: Base-Base interactions energy: -539.068 where: short stacking energy: -235.633 Base-Backbone interact. energy: -1.446 local terms energy: -259.404780 where: bonds (distance) C4'-P energy: -55.973 bonds (distance) P-C4' energy: -51.000 flat angles C4'-P-C4' energy: -49.781 flat angles P-C4'-P energy: -39.317 tors. eta vs tors. theta energy: -63.334 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -864.963466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -864.963466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.163466 (E_RNA) where: Base-Base interactions energy: -462.359 where: short stacking energy: -195.029 Base-Backbone interact. energy: 0.418 local terms energy: -275.221717 where: bonds (distance) C4'-P energy: -50.894 bonds (distance) P-C4' energy: -55.112 flat angles C4'-P-C4' energy: -61.229 flat angles P-C4'-P energy: -40.135 tors. eta vs tors. theta energy: -67.852 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -862.968837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.968837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.968837 (E_RNA) where: Base-Base interactions energy: -484.539 where: short stacking energy: -222.016 Base-Backbone interact. energy: -0.464 local terms energy: -251.966060 where: bonds (distance) C4'-P energy: -47.186 bonds (distance) P-C4' energy: -58.284 flat angles C4'-P-C4' energy: -53.455 flat angles P-C4'-P energy: -31.308 tors. eta vs tors. theta energy: -61.733 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -761.257667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.257667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.857667 (E_RNA) where: Base-Base interactions energy: -412.024 where: short stacking energy: -163.783 Base-Backbone interact. energy: 3.131 local terms energy: -229.964981 where: bonds (distance) C4'-P energy: -53.734 bonds (distance) P-C4' energy: -47.434 flat angles C4'-P-C4' energy: -46.642 flat angles P-C4'-P energy: -38.226 tors. eta vs tors. theta energy: -43.928 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -742.677493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.677493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.877493 (E_RNA) where: Base-Base interactions energy: -381.180 where: short stacking energy: -157.248 Base-Backbone interact. energy: 0.409 local terms energy: -234.107029 where: bonds (distance) C4'-P energy: -54.879 bonds (distance) P-C4' energy: -57.315 flat angles C4'-P-C4' energy: -52.726 flat angles P-C4'-P energy: -30.127 tors. eta vs tors. theta energy: -39.060 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -717.033219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.033219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.633219 (E_RNA) where: Base-Base interactions energy: -375.390 where: short stacking energy: -151.534 Base-Backbone interact. energy: -1.020 local terms energy: -218.223727 where: bonds (distance) C4'-P energy: -44.070 bonds (distance) P-C4' energy: -52.869 flat angles C4'-P-C4' energy: -48.282 flat angles P-C4'-P energy: -34.690 tors. eta vs tors. theta energy: -38.312 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -1093.623558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1093.623558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.023558 (E_RNA) where: Base-Base interactions energy: -662.272 where: short stacking energy: -269.957 Base-Backbone interact. energy: -0.225 local terms energy: -301.526894 where: bonds (distance) C4'-P energy: -59.633 bonds (distance) P-C4' energy: -53.215 flat angles C4'-P-C4' energy: -59.161 flat angles P-C4'-P energy: -49.178 tors. eta vs tors. theta energy: -80.340 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -1035.710414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.710414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -906.110414 (E_RNA) where: Base-Base interactions energy: -608.400 where: short stacking energy: -262.335 Base-Backbone interact. energy: 0.107 local terms energy: -297.817928 where: bonds (distance) C4'-P energy: -49.446 bonds (distance) P-C4' energy: -61.676 flat angles C4'-P-C4' energy: -64.275 flat angles P-C4'-P energy: -48.076 tors. eta vs tors. theta energy: -74.343 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -1011.210353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.210353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.610353 (E_RNA) where: Base-Base interactions energy: -613.198 where: short stacking energy: -238.725 Base-Backbone interact. energy: -1.144 local terms energy: -267.268374 where: bonds (distance) C4'-P energy: -43.940 bonds (distance) P-C4' energy: -52.759 flat angles C4'-P-C4' energy: -60.451 flat angles P-C4'-P energy: -39.564 tors. eta vs tors. theta energy: -70.554 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -961.190302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -961.190302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -835.190302 (E_RNA) where: Base-Base interactions energy: -561.911 where: short stacking energy: -251.241 Base-Backbone interact. energy: 1.597 local terms energy: -274.876564 where: bonds (distance) C4'-P energy: -50.319 bonds (distance) P-C4' energy: -44.806 flat angles C4'-P-C4' energy: -61.659 flat angles P-C4'-P energy: -44.007 tors. eta vs tors. theta energy: -74.085 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -889.226193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.226193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.426193 (E_RNA) where: Base-Base interactions energy: -494.991 where: short stacking energy: -210.181 Base-Backbone interact. energy: 4.447 local terms energy: -270.882265 where: bonds (distance) C4'-P energy: -59.798 bonds (distance) P-C4' energy: -55.599 flat angles C4'-P-C4' energy: -57.740 flat angles P-C4'-P energy: -41.512 tors. eta vs tors. theta energy: -56.233 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -885.225384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -885.225384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.425384 (E_RNA) where: Base-Base interactions energy: -504.098 where: short stacking energy: -222.353 Base-Backbone interact. energy: -1.579 local terms energy: -251.748370 where: bonds (distance) C4'-P energy: -50.483 bonds (distance) P-C4' energy: -53.420 flat angles C4'-P-C4' energy: -56.919 flat angles P-C4'-P energy: -24.150 tors. eta vs tors. theta energy: -66.776 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -846.781737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.781737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.981737 (E_RNA) where: Base-Base interactions energy: -450.149 where: short stacking energy: -200.027 Base-Backbone interact. energy: 0.811 local terms energy: -269.644588 where: bonds (distance) C4'-P energy: -57.013 bonds (distance) P-C4' energy: -55.677 flat angles C4'-P-C4' energy: -52.095 flat angles P-C4'-P energy: -38.628 tors. eta vs tors. theta energy: -66.231 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -723.261638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -723.261638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.461638 (E_RNA) where: Base-Base interactions energy: -380.674 where: short stacking energy: -163.363 Base-Backbone interact. energy: -0.462 local terms energy: -214.325189 where: bonds (distance) C4'-P energy: -52.173 bonds (distance) P-C4' energy: -47.467 flat angles C4'-P-C4' energy: -49.088 flat angles P-C4'-P energy: -30.683 tors. eta vs tors. theta energy: -34.914 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -706.587850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.587850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.787850 (E_RNA) where: Base-Base interactions energy: -381.432 where: short stacking energy: -159.433 Base-Backbone interact. energy: -0.778 local terms energy: -196.577896 where: bonds (distance) C4'-P energy: -40.037 bonds (distance) P-C4' energy: -41.496 flat angles C4'-P-C4' energy: -53.759 flat angles P-C4'-P energy: -34.400 tors. eta vs tors. theta energy: -26.886 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -692.803618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.803618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.803618 (E_RNA) where: Base-Base interactions energy: -372.412 where: short stacking energy: -145.544 Base-Backbone interact. energy: -0.532 local terms energy: -193.859616 where: bonds (distance) C4'-P energy: -30.254 bonds (distance) P-C4' energy: -46.681 flat angles C4'-P-C4' energy: -55.130 flat angles P-C4'-P energy: -32.064 tors. eta vs tors. theta energy: -29.731 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -1080.647766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1080.647766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -954.647766 (E_RNA) where: Base-Base interactions energy: -640.772 where: short stacking energy: -261.630 Base-Backbone interact. energy: 1.608 local terms energy: -315.483736 where: bonds (distance) C4'-P energy: -54.269 bonds (distance) P-C4' energy: -64.098 flat angles C4'-P-C4' energy: -66.647 flat angles P-C4'-P energy: -51.136 tors. eta vs tors. theta energy: -79.334 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -1041.426247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.426247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.826247 (E_RNA) where: Base-Base interactions energy: -614.146 where: short stacking energy: -270.538 Base-Backbone interact. energy: 0.591 local terms energy: -298.270961 where: bonds (distance) C4'-P energy: -52.569 bonds (distance) P-C4' energy: -58.634 flat angles C4'-P-C4' energy: -64.919 flat angles P-C4'-P energy: -46.733 tors. eta vs tors. theta energy: -75.416 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -1025.922832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.922832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -896.322832 (E_RNA) where: Base-Base interactions energy: -619.750 where: short stacking energy: -258.463 Base-Backbone interact. energy: -1.564 local terms energy: -275.008859 where: bonds (distance) C4'-P energy: -50.216 bonds (distance) P-C4' energy: -56.041 flat angles C4'-P-C4' energy: -58.918 flat angles P-C4'-P energy: -37.749 tors. eta vs tors. theta energy: -72.086 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -973.108785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -973.108785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.308785 (E_RNA) where: Base-Base interactions energy: -561.391 where: short stacking energy: -247.351 Base-Backbone interact. energy: -0.593 local terms energy: -283.325544 where: bonds (distance) C4'-P energy: -50.540 bonds (distance) P-C4' energy: -56.819 flat angles C4'-P-C4' energy: -62.131 flat angles P-C4'-P energy: -42.073 tors. eta vs tors. theta energy: -71.763 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -906.605496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -906.605496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.805496 (E_RNA) where: Base-Base interactions energy: -508.979 where: short stacking energy: -221.844 Base-Backbone interact. energy: -0.093 local terms energy: -269.733669 where: bonds (distance) C4'-P energy: -51.056 bonds (distance) P-C4' energy: -55.546 flat angles C4'-P-C4' energy: -63.784 flat angles P-C4'-P energy: -38.273 tors. eta vs tors. theta energy: -61.076 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -879.692065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.692065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.892065 (E_RNA) where: Base-Base interactions energy: -486.367 where: short stacking energy: -237.329 Base-Backbone interact. energy: -0.435 local terms energy: -265.091029 where: bonds (distance) C4'-P energy: -52.754 bonds (distance) P-C4' energy: -40.078 flat angles C4'-P-C4' energy: -58.784 flat angles P-C4'-P energy: -40.107 tors. eta vs tors. theta energy: -73.369 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -824.523498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.523498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.723498 (E_RNA) where: Base-Base interactions energy: -456.771 where: short stacking energy: -207.467 Base-Backbone interact. energy: 2.162 local terms energy: -242.113904 where: bonds (distance) C4'-P energy: -49.618 bonds (distance) P-C4' energy: -52.871 flat angles C4'-P-C4' energy: -52.057 flat angles P-C4'-P energy: -32.748 tors. eta vs tors. theta energy: -54.820 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -749.935847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -749.935847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.335847 (E_RNA) where: Base-Base interactions energy: -396.506 where: short stacking energy: -157.394 Base-Backbone interact. energy: 0.729 local terms energy: -224.559518 where: bonds (distance) C4'-P energy: -52.571 bonds (distance) P-C4' energy: -48.136 flat angles C4'-P-C4' energy: -59.010 flat angles P-C4'-P energy: -26.169 tors. eta vs tors. theta energy: -38.673 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -719.717342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.717342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.917342 (E_RNA) where: Base-Base interactions energy: -386.127 where: short stacking energy: -158.941 Base-Backbone interact. energy: 0.184 local terms energy: -205.974388 where: bonds (distance) C4'-P energy: -31.177 bonds (distance) P-C4' energy: -55.506 flat angles C4'-P-C4' energy: -42.381 flat angles P-C4'-P energy: -38.151 tors. eta vs tors. theta energy: -38.760 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -661.177714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.177714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.177714 (E_RNA) where: Base-Base interactions energy: -362.651 where: short stacking energy: -157.210 Base-Backbone interact. energy: 0.607 local terms energy: -173.133736 where: bonds (distance) C4'-P energy: -40.226 bonds (distance) P-C4' energy: -45.699 flat angles C4'-P-C4' energy: -35.052 flat angles P-C4'-P energy: -22.921 tors. eta vs tors. theta energy: -29.236 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -1114.185393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1114.185393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.585393 (E_RNA) where: Base-Base interactions energy: -675.555 where: short stacking energy: -282.510 Base-Backbone interact. energy: -1.487 local terms energy: -307.543280 where: bonds (distance) C4'-P energy: -57.352 bonds (distance) P-C4' energy: -51.658 flat angles C4'-P-C4' energy: -71.268 flat angles P-C4'-P energy: -46.651 tors. eta vs tors. theta energy: -80.614 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -1036.299196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1036.299196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -908.499196 (E_RNA) where: Base-Base interactions energy: -626.726 where: short stacking energy: -264.386 Base-Backbone interact. energy: -0.715 local terms energy: -281.057580 where: bonds (distance) C4'-P energy: -51.481 bonds (distance) P-C4' energy: -53.167 flat angles C4'-P-C4' energy: -61.062 flat angles P-C4'-P energy: -45.357 tors. eta vs tors. theta energy: -69.991 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -1028.465758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1028.465758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.665758 (E_RNA) where: Base-Base interactions energy: -622.587 where: short stacking energy: -256.517 Base-Backbone interact. energy: -1.712 local terms energy: -276.367430 where: bonds (distance) C4'-P energy: -52.061 bonds (distance) P-C4' energy: -52.868 flat angles C4'-P-C4' energy: -57.088 flat angles P-C4'-P energy: -42.610 tors. eta vs tors. theta energy: -71.741 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -968.309837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -968.309837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -840.509837 (E_RNA) where: Base-Base interactions energy: -550.898 where: short stacking energy: -244.005 Base-Backbone interact. energy: 0.306 local terms energy: -289.918184 where: bonds (distance) C4'-P energy: -45.044 bonds (distance) P-C4' energy: -54.603 flat angles C4'-P-C4' energy: -67.912 flat angles P-C4'-P energy: -44.717 tors. eta vs tors. theta energy: -77.642 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -904.606172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.606172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.006172 (E_RNA) where: Base-Base interactions energy: -503.457 where: short stacking energy: -232.850 Base-Backbone interact. energy: 0.207 local terms energy: -271.755953 where: bonds (distance) C4'-P energy: -51.145 bonds (distance) P-C4' energy: -53.641 flat angles C4'-P-C4' energy: -52.716 flat angles P-C4'-P energy: -38.925 tors. eta vs tors. theta energy: -75.329 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -877.460691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.460691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.260691 (E_RNA) where: Base-Base interactions energy: -505.777 where: short stacking energy: -227.528 Base-Backbone interact. energy: 2.745 local terms energy: -250.228733 where: bonds (distance) C4'-P energy: -50.114 bonds (distance) P-C4' energy: -49.781 flat angles C4'-P-C4' energy: -59.321 flat angles P-C4'-P energy: -30.295 tors. eta vs tors. theta energy: -60.718 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -788.320242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -788.320242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.120242 (E_RNA) where: Base-Base interactions energy: -445.196 where: short stacking energy: -177.178 Base-Backbone interact. energy: -0.476 local terms energy: -218.448214 where: bonds (distance) C4'-P energy: -47.053 bonds (distance) P-C4' energy: -41.303 flat angles C4'-P-C4' energy: -44.610 flat angles P-C4'-P energy: -37.886 tors. eta vs tors. theta energy: -47.597 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -836.578259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.578259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.378259 (E_RNA) where: Base-Base interactions energy: -477.340 where: short stacking energy: -204.524 Base-Backbone interact. energy: 1.586 local terms energy: -236.624351 where: bonds (distance) C4'-P energy: -43.180 bonds (distance) P-C4' energy: -50.386 flat angles C4'-P-C4' energy: -52.499 flat angles P-C4'-P energy: -37.940 tors. eta vs tors. theta energy: -52.620 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -750.601606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.601606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.801606 (E_RNA) where: Base-Base interactions energy: -424.511 where: short stacking energy: -174.154 Base-Backbone interact. energy: 0.610 local terms energy: -198.900376 where: bonds (distance) C4'-P energy: -43.998 bonds (distance) P-C4' energy: -54.586 flat angles C4'-P-C4' energy: -34.243 flat angles P-C4'-P energy: -29.922 tors. eta vs tors. theta energy: -36.151 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -690.086077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.086077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.886077 (E_RNA) where: Base-Base interactions energy: -379.170 where: short stacking energy: -160.603 Base-Backbone interact. energy: 2.205 local terms energy: -188.921082 where: bonds (distance) C4'-P energy: -42.465 bonds (distance) P-C4' energy: -40.324 flat angles C4'-P-C4' energy: -44.650 flat angles P-C4'-P energy: -31.185 tors. eta vs tors. theta energy: -30.297 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -1091.344292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.344292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.544292 (E_RNA) where: Base-Base interactions energy: -661.767 where: short stacking energy: -267.599 Base-Backbone interact. energy: -1.048 local terms energy: -300.729428 where: bonds (distance) C4'-P energy: -50.642 bonds (distance) P-C4' energy: -55.778 flat angles C4'-P-C4' energy: -66.058 flat angles P-C4'-P energy: -45.168 tors. eta vs tors. theta energy: -83.083 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -1043.750614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.750614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -915.950614 (E_RNA) where: Base-Base interactions energy: -643.141 where: short stacking energy: -270.067 Base-Backbone interact. energy: -0.904 local terms energy: -271.905816 where: bonds (distance) C4'-P energy: -38.258 bonds (distance) P-C4' energy: -55.675 flat angles C4'-P-C4' energy: -58.567 flat angles P-C4'-P energy: -42.972 tors. eta vs tors. theta energy: -76.433 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -1019.026859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.026859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.426859 (E_RNA) where: Base-Base interactions energy: -604.620 where: short stacking energy: -262.067 Base-Backbone interact. energy: -1.406 local terms energy: -283.401308 where: bonds (distance) C4'-P energy: -46.471 bonds (distance) P-C4' energy: -56.932 flat angles C4'-P-C4' energy: -62.903 flat angles P-C4'-P energy: -46.290 tors. eta vs tors. theta energy: -70.806 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -961.827519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -961.827519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.227519 (E_RNA) where: Base-Base interactions energy: -572.181 where: short stacking energy: -265.513 Base-Backbone interact. energy: -0.414 local terms energy: -259.632601 where: bonds (distance) C4'-P energy: -43.839 bonds (distance) P-C4' energy: -47.458 flat angles C4'-P-C4' energy: -58.602 flat angles P-C4'-P energy: -33.324 tors. eta vs tors. theta energy: -76.410 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -878.743232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.743232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.143232 (E_RNA) where: Base-Base interactions energy: -493.124 where: short stacking energy: -206.062 Base-Backbone interact. energy: -0.204 local terms energy: -255.815754 where: bonds (distance) C4'-P energy: -43.819 bonds (distance) P-C4' energy: -50.231 flat angles C4'-P-C4' energy: -56.012 flat angles P-C4'-P energy: -39.554 tors. eta vs tors. theta energy: -66.200 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -838.496888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.496888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.696888 (E_RNA) where: Base-Base interactions energy: -463.928 where: short stacking energy: -222.308 Base-Backbone interact. energy: -0.190 local terms energy: -246.579011 where: bonds (distance) C4'-P energy: -47.959 bonds (distance) P-C4' energy: -53.896 flat angles C4'-P-C4' energy: -51.124 flat angles P-C4'-P energy: -28.429 tors. eta vs tors. theta energy: -65.171 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -836.716400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.716400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.116400 (E_RNA) where: Base-Base interactions energy: -462.664 where: short stacking energy: -210.256 Base-Backbone interact. energy: 0.190 local terms energy: -244.642459 where: bonds (distance) C4'-P energy: -38.911 bonds (distance) P-C4' energy: -49.923 flat angles C4'-P-C4' energy: -58.311 flat angles P-C4'-P energy: -33.384 tors. eta vs tors. theta energy: -64.114 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -824.880975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.880975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.080975 (E_RNA) where: Base-Base interactions energy: -464.608 where: short stacking energy: -196.857 Base-Backbone interact. energy: -0.910 local terms energy: -231.563023 where: bonds (distance) C4'-P energy: -46.674 bonds (distance) P-C4' energy: -50.435 flat angles C4'-P-C4' energy: -54.897 flat angles P-C4'-P energy: -27.177 tors. eta vs tors. theta energy: -52.380 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -762.385965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.385965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.385965 (E_RNA) where: Base-Base interactions energy: -442.186 where: short stacking energy: -205.193 Base-Backbone interact. energy: 1.451 local terms energy: -195.651067 where: bonds (distance) C4'-P energy: -36.949 bonds (distance) P-C4' energy: -40.077 flat angles C4'-P-C4' energy: -47.312 flat angles P-C4'-P energy: -19.833 tors. eta vs tors. theta energy: -51.480 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -673.682868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.682868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.682868 (E_RNA) where: Base-Base interactions energy: -338.129 where: short stacking energy: -139.753 Base-Backbone interact. energy: -0.647 local terms energy: -217.907382 where: bonds (distance) C4'-P energy: -45.518 bonds (distance) P-C4' energy: -58.657 flat angles C4'-P-C4' energy: -47.548 flat angles P-C4'-P energy: -29.130 tors. eta vs tors. theta energy: -37.053 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -1094.541608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1094.541608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.941608 (E_RNA) where: Base-Base interactions energy: -644.804 where: short stacking energy: -277.142 Base-Backbone interact. energy: -1.295 local terms energy: -318.842754 where: bonds (distance) C4'-P energy: -49.288 bonds (distance) P-C4' energy: -59.822 flat angles C4'-P-C4' energy: -70.337 flat angles P-C4'-P energy: -50.982 tors. eta vs tors. theta energy: -88.414 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -1048.449543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1048.449543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.049543 (E_RNA) where: Base-Base interactions energy: -649.131 where: short stacking energy: -258.123 Base-Backbone interact. energy: -1.228 local terms energy: -275.690527 where: bonds (distance) C4'-P energy: -56.265 bonds (distance) P-C4' energy: -43.857 flat angles C4'-P-C4' energy: -60.122 flat angles P-C4'-P energy: -44.768 tors. eta vs tors. theta energy: -70.678 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -948.479072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -948.479072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.679072 (E_RNA) where: Base-Base interactions energy: -536.032 where: short stacking energy: -246.772 Base-Backbone interact. energy: -0.608 local terms energy: -284.038494 where: bonds (distance) C4'-P energy: -53.009 bonds (distance) P-C4' energy: -51.756 flat angles C4'-P-C4' energy: -55.159 flat angles P-C4'-P energy: -44.947 tors. eta vs tors. theta energy: -79.168 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -988.836748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -988.836748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -861.036748 (E_RNA) where: Base-Base interactions energy: -581.503 where: short stacking energy: -251.550 Base-Backbone interact. energy: -0.728 local terms energy: -278.806112 where: bonds (distance) C4'-P energy: -53.284 bonds (distance) P-C4' energy: -48.229 flat angles C4'-P-C4' energy: -61.672 flat angles P-C4'-P energy: -43.435 tors. eta vs tors. theta energy: -72.186 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -866.228145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.228145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.228145 (E_RNA) where: Base-Base interactions energy: -495.099 where: short stacking energy: -211.644 Base-Backbone interact. energy: -0.743 local terms energy: -244.386174 where: bonds (distance) C4'-P energy: -51.153 bonds (distance) P-C4' energy: -42.648 flat angles C4'-P-C4' energy: -55.978 flat angles P-C4'-P energy: -35.841 tors. eta vs tors. theta energy: -58.766 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -858.807085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.807085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.007085 (E_RNA) where: Base-Base interactions energy: -470.836 where: short stacking energy: -218.133 Base-Backbone interact. energy: -0.333 local terms energy: -259.838308 where: bonds (distance) C4'-P energy: -56.394 bonds (distance) P-C4' energy: -56.244 flat angles C4'-P-C4' energy: -56.002 flat angles P-C4'-P energy: -34.781 tors. eta vs tors. theta energy: -56.418 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -845.431958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.431958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.431958 (E_RNA) where: Base-Base interactions energy: -487.232 where: short stacking energy: -220.162 Base-Backbone interact. energy: 2.655 local terms energy: -234.855362 where: bonds (distance) C4'-P energy: -55.234 bonds (distance) P-C4' energy: -43.529 flat angles C4'-P-C4' energy: -48.292 flat angles P-C4'-P energy: -29.682 tors. eta vs tors. theta energy: -58.119 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -864.584973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -864.584973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.584973 (E_RNA) where: Base-Base interactions energy: -479.752 where: short stacking energy: -218.131 Base-Backbone interact. energy: 0.575 local terms energy: -259.407903 where: bonds (distance) C4'-P energy: -52.218 bonds (distance) P-C4' energy: -49.713 flat angles C4'-P-C4' energy: -54.949 flat angles P-C4'-P energy: -33.083 tors. eta vs tors. theta energy: -69.445 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -754.136577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -754.136577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.336577 (E_RNA) where: Base-Base interactions energy: -419.373 where: short stacking energy: -188.970 Base-Backbone interact. energy: -0.617 local terms energy: -206.346013 where: bonds (distance) C4'-P energy: -37.336 bonds (distance) P-C4' energy: -37.401 flat angles C4'-P-C4' energy: -58.956 flat angles P-C4'-P energy: -27.661 tors. eta vs tors. theta energy: -44.991 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -673.370657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.370657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.170657 (E_RNA) where: Base-Base interactions energy: -366.071 where: short stacking energy: -140.166 Base-Backbone interact. energy: 2.800 local terms energy: -185.899808 where: bonds (distance) C4'-P energy: -37.533 bonds (distance) P-C4' energy: -40.331 flat angles C4'-P-C4' energy: -46.444 flat angles P-C4'-P energy: -31.962 tors. eta vs tors. theta energy: -29.630 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -1103.572918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1103.572918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -973.972918 (E_RNA) where: Base-Base interactions energy: -659.395 where: short stacking energy: -276.092 Base-Backbone interact. energy: -0.789 local terms energy: -313.789050 where: bonds (distance) C4'-P energy: -66.659 bonds (distance) P-C4' energy: -57.282 flat angles C4'-P-C4' energy: -62.528 flat angles P-C4'-P energy: -45.927 tors. eta vs tors. theta energy: -81.393 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -1054.722685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1054.722685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.922685 (E_RNA) where: Base-Base interactions energy: -644.714 where: short stacking energy: -256.295 Base-Backbone interact. energy: 2.946 local terms energy: -285.154924 where: bonds (distance) C4'-P energy: -57.258 bonds (distance) P-C4' energy: -52.099 flat angles C4'-P-C4' energy: -62.136 flat angles P-C4'-P energy: -48.055 tors. eta vs tors. theta energy: -65.605 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -994.682505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.682505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -865.082505 (E_RNA) where: Base-Base interactions energy: -570.272 where: short stacking energy: -259.714 Base-Backbone interact. energy: -1.374 local terms energy: -293.436667 where: bonds (distance) C4'-P energy: -54.879 bonds (distance) P-C4' energy: -58.269 flat angles C4'-P-C4' energy: -59.706 flat angles P-C4'-P energy: -43.663 tors. eta vs tors. theta energy: -76.920 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -993.884431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -993.884431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.884431 (E_RNA) where: Base-Base interactions energy: -603.962 where: short stacking energy: -252.575 Base-Backbone interact. energy: 0.427 local terms energy: -264.349103 where: bonds (distance) C4'-P energy: -47.097 bonds (distance) P-C4' energy: -54.858 flat angles C4'-P-C4' energy: -50.338 flat angles P-C4'-P energy: -43.696 tors. eta vs tors. theta energy: -68.361 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -891.815602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -891.815602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.215602 (E_RNA) where: Base-Base interactions energy: -510.647 where: short stacking energy: -210.276 Base-Backbone interact. energy: -1.126 local terms energy: -250.442438 where: bonds (distance) C4'-P energy: -51.473 bonds (distance) P-C4' energy: -37.821 flat angles C4'-P-C4' energy: -56.221 flat angles P-C4'-P energy: -43.676 tors. eta vs tors. theta energy: -61.250 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -882.237335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -882.237335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.837335 (E_RNA) where: Base-Base interactions energy: -502.076 where: short stacking energy: -197.124 Base-Backbone interact. energy: -1.060 local terms energy: -256.701525 where: bonds (distance) C4'-P energy: -51.825 bonds (distance) P-C4' energy: -45.780 flat angles C4'-P-C4' energy: -55.782 flat angles P-C4'-P energy: -37.273 tors. eta vs tors. theta energy: -66.042 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -829.962735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.962735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.162735 (E_RNA) where: Base-Base interactions energy: -467.918 where: short stacking energy: -199.451 Base-Backbone interact. energy: 0.821 local terms energy: -235.065610 where: bonds (distance) C4'-P energy: -44.814 bonds (distance) P-C4' energy: -42.377 flat angles C4'-P-C4' energy: -63.164 flat angles P-C4'-P energy: -31.963 tors. eta vs tors. theta energy: -52.748 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -850.216869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.216869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.416869 (E_RNA) where: Base-Base interactions energy: -471.579 where: short stacking energy: -202.204 Base-Backbone interact. energy: 0.576 local terms energy: -251.413587 where: bonds (distance) C4'-P energy: -58.229 bonds (distance) P-C4' energy: -43.547 flat angles C4'-P-C4' energy: -42.673 flat angles P-C4'-P energy: -35.445 tors. eta vs tors. theta energy: -71.519 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -681.027995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.027995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.827995 (E_RNA) where: Base-Base interactions energy: -361.976 where: short stacking energy: -155.510 Base-Backbone interact. energy: -1.021 local terms energy: -193.831241 where: bonds (distance) C4'-P energy: -38.220 bonds (distance) P-C4' energy: -45.183 flat angles C4'-P-C4' energy: -52.748 flat angles P-C4'-P energy: -21.550 tors. eta vs tors. theta energy: -36.131 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -669.444165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.444165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.444165 (E_RNA) where: Base-Base interactions energy: -348.920 where: short stacking energy: -132.820 Base-Backbone interact. energy: 0.074 local terms energy: -194.598282 where: bonds (distance) C4'-P energy: -39.946 bonds (distance) P-C4' energy: -55.695 flat angles C4'-P-C4' energy: -45.086 flat angles P-C4'-P energy: -22.792 tors. eta vs tors. theta energy: -31.079 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -1073.291366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.291366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -947.291366 (E_RNA) where: Base-Base interactions energy: -647.470 where: short stacking energy: -258.785 Base-Backbone interact. energy: -1.359 local terms energy: -298.461755 where: bonds (distance) C4'-P energy: -56.855 bonds (distance) P-C4' energy: -57.756 flat angles C4'-P-C4' energy: -64.943 flat angles P-C4'-P energy: -46.334 tors. eta vs tors. theta energy: -72.574 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -1076.726320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.726320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -947.126320 (E_RNA) where: Base-Base interactions energy: -642.625 where: short stacking energy: -265.302 Base-Backbone interact. energy: -1.564 local terms energy: -302.937836 where: bonds (distance) C4'-P energy: -51.957 bonds (distance) P-C4' energy: -59.230 flat angles C4'-P-C4' energy: -66.742 flat angles P-C4'-P energy: -37.729 tors. eta vs tors. theta energy: -87.280 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -1013.438574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1013.438574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.638574 (E_RNA) where: Base-Base interactions energy: -601.399 where: short stacking energy: -257.844 Base-Backbone interact. energy: -0.646 local terms energy: -283.593440 where: bonds (distance) C4'-P energy: -55.752 bonds (distance) P-C4' energy: -57.011 flat angles C4'-P-C4' energy: -55.147 flat angles P-C4'-P energy: -47.347 tors. eta vs tors. theta energy: -68.337 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -954.072619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -954.072619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.472619 (E_RNA) where: Base-Base interactions energy: -556.521 where: short stacking energy: -237.031 Base-Backbone interact. energy: -0.748 local terms energy: -267.204195 where: bonds (distance) C4'-P energy: -46.589 bonds (distance) P-C4' energy: -61.126 flat angles C4'-P-C4' energy: -56.509 flat angles P-C4'-P energy: -31.775 tors. eta vs tors. theta energy: -71.205 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -919.066066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -919.066066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.066066 (E_RNA) where: Base-Base interactions energy: -511.482 where: short stacking energy: -225.925 Base-Backbone interact. energy: 0.604 local terms energy: -282.187786 where: bonds (distance) C4'-P energy: -52.945 bonds (distance) P-C4' energy: -49.786 flat angles C4'-P-C4' energy: -69.488 flat angles P-C4'-P energy: -44.531 tors. eta vs tors. theta energy: -65.438 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -893.907125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.907125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -764.307125 (E_RNA) where: Base-Base interactions energy: -507.280 where: short stacking energy: -228.980 Base-Backbone interact. energy: -1.176 local terms energy: -255.851077 where: bonds (distance) C4'-P energy: -48.131 bonds (distance) P-C4' energy: -49.306 flat angles C4'-P-C4' energy: -59.056 flat angles P-C4'-P energy: -37.134 tors. eta vs tors. theta energy: -62.224 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -863.736771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -863.736771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.736771 (E_RNA) where: Base-Base interactions energy: -494.095 where: short stacking energy: -202.121 Base-Backbone interact. energy: -0.698 local terms energy: -242.943214 where: bonds (distance) C4'-P energy: -41.751 bonds (distance) P-C4' energy: -51.984 flat angles C4'-P-C4' energy: -48.871 flat angles P-C4'-P energy: -39.806 tors. eta vs tors. theta energy: -60.532 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -794.163275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.163275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.563275 (E_RNA) where: Base-Base interactions energy: -438.118 where: short stacking energy: -182.574 Base-Backbone interact. energy: -0.693 local terms energy: -225.752021 where: bonds (distance) C4'-P energy: -48.660 bonds (distance) P-C4' energy: -52.102 flat angles C4'-P-C4' energy: -52.225 flat angles P-C4'-P energy: -28.719 tors. eta vs tors. theta energy: -44.045 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -709.265545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.265545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.665545 (E_RNA) where: Base-Base interactions energy: -375.969 where: short stacking energy: -170.775 Base-Backbone interact. energy: 2.469 local terms energy: -215.165319 where: bonds (distance) C4'-P energy: -46.328 bonds (distance) P-C4' energy: -46.090 flat angles C4'-P-C4' energy: -49.939 flat angles P-C4'-P energy: -30.254 tors. eta vs tors. theta energy: -42.555 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -657.882560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.882560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.282560 (E_RNA) where: Base-Base interactions energy: -335.311 where: short stacking energy: -142.329 Base-Backbone interact. energy: -0.697 local terms energy: -192.274049 where: bonds (distance) C4'-P energy: -44.203 bonds (distance) P-C4' energy: -48.193 flat angles C4'-P-C4' energy: -50.621 flat angles P-C4'-P energy: -24.751 tors. eta vs tors. theta energy: -24.506 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -1071.567461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1071.567461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -943.767461 (E_RNA) where: Base-Base interactions energy: -639.896 where: short stacking energy: -257.219 Base-Backbone interact. energy: -3.020 local terms energy: -300.851734 where: bonds (distance) C4'-P energy: -49.048 bonds (distance) P-C4' energy: -58.047 flat angles C4'-P-C4' energy: -70.044 flat angles P-C4'-P energy: -47.546 tors. eta vs tors. theta energy: -76.166 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -1085.135919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.135919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -957.335919 (E_RNA) where: Base-Base interactions energy: -654.337 where: short stacking energy: -264.053 Base-Backbone interact. energy: -0.439 local terms energy: -302.559844 where: bonds (distance) C4'-P energy: -59.254 bonds (distance) P-C4' energy: -54.548 flat angles C4'-P-C4' energy: -59.846 flat angles P-C4'-P energy: -42.345 tors. eta vs tors. theta energy: -86.566 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -988.778406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -988.778406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -864.578406 (E_RNA) where: Base-Base interactions energy: -587.662 where: short stacking energy: -255.334 Base-Backbone interact. energy: -1.616 local terms energy: -275.300931 where: bonds (distance) C4'-P energy: -50.954 bonds (distance) P-C4' energy: -48.529 flat angles C4'-P-C4' energy: -50.294 flat angles P-C4'-P energy: -44.097 tors. eta vs tors. theta energy: -81.427 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -959.781529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.781529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.981529 (E_RNA) where: Base-Base interactions energy: -561.903 where: short stacking energy: -254.587 Base-Backbone interact. energy: -1.044 local terms energy: -269.034266 where: bonds (distance) C4'-P energy: -48.168 bonds (distance) P-C4' energy: -48.170 flat angles C4'-P-C4' energy: -60.598 flat angles P-C4'-P energy: -36.871 tors. eta vs tors. theta energy: -75.227 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -918.335831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -918.335831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.735831 (E_RNA) where: Base-Base interactions energy: -519.045 where: short stacking energy: -230.332 Base-Backbone interact. energy: -0.644 local terms energy: -269.046694 where: bonds (distance) C4'-P energy: -55.244 bonds (distance) P-C4' energy: -49.127 flat angles C4'-P-C4' energy: -53.796 flat angles P-C4'-P energy: -40.711 tors. eta vs tors. theta energy: -70.168 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -876.426465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -876.426465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.426465 (E_RNA) where: Base-Base interactions energy: -502.121 where: short stacking energy: -225.590 Base-Backbone interact. energy: -1.939 local terms energy: -246.366778 where: bonds (distance) C4'-P energy: -48.330 bonds (distance) P-C4' energy: -54.447 flat angles C4'-P-C4' energy: -54.564 flat angles P-C4'-P energy: -31.593 tors. eta vs tors. theta energy: -57.433 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -870.484802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -870.484802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.884802 (E_RNA) where: Base-Base interactions energy: -487.155 where: short stacking energy: -214.688 Base-Backbone interact. energy: 0.849 local terms energy: -254.579459 where: bonds (distance) C4'-P energy: -45.126 bonds (distance) P-C4' energy: -54.729 flat angles C4'-P-C4' energy: -59.240 flat angles P-C4'-P energy: -29.340 tors. eta vs tors. theta energy: -66.145 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -798.179345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.179345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.579345 (E_RNA) where: Base-Base interactions energy: -444.369 where: short stacking energy: -192.156 Base-Backbone interact. energy: -1.161 local terms energy: -223.049759 where: bonds (distance) C4'-P energy: -50.860 bonds (distance) P-C4' energy: -53.758 flat angles C4'-P-C4' energy: -35.826 flat angles P-C4'-P energy: -30.342 tors. eta vs tors. theta energy: -52.264 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -707.536534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.536534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.936534 (E_RNA) where: Base-Base interactions energy: -373.522 where: short stacking energy: -171.574 Base-Backbone interact. energy: -0.536 local terms energy: -203.878413 where: bonds (distance) C4'-P energy: -40.840 bonds (distance) P-C4' energy: -57.829 flat angles C4'-P-C4' energy: -49.891 flat angles P-C4'-P energy: -22.161 tors. eta vs tors. theta energy: -33.157 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -687.448977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.448977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.848977 (E_RNA) where: Base-Base interactions energy: -351.433 where: short stacking energy: -146.970 Base-Backbone interact. energy: 1.309 local terms energy: -216.724562 where: bonds (distance) C4'-P energy: -55.392 bonds (distance) P-C4' energy: -48.343 flat angles C4'-P-C4' energy: -43.657 flat angles P-C4'-P energy: -26.237 tors. eta vs tors. theta energy: -43.096 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -1093.792583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1093.792583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -965.992583 (E_RNA) where: Base-Base interactions energy: -664.685 where: short stacking energy: -275.358 Base-Backbone interact. energy: -1.399 local terms energy: -299.908802 where: bonds (distance) C4'-P energy: -54.113 bonds (distance) P-C4' energy: -53.883 flat angles C4'-P-C4' energy: -62.717 flat angles P-C4'-P energy: -42.853 tors. eta vs tors. theta energy: -86.343 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -1052.111368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.111368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.511368 (E_RNA) where: Base-Base interactions energy: -640.338 where: short stacking energy: -263.020 Base-Backbone interact. energy: 3.744 local terms energy: -285.918184 where: bonds (distance) C4'-P energy: -55.558 bonds (distance) P-C4' energy: -52.051 flat angles C4'-P-C4' energy: -59.625 flat angles P-C4'-P energy: -43.096 tors. eta vs tors. theta energy: -75.588 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -1031.419002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.419002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -903.619002 (E_RNA) where: Base-Base interactions energy: -593.283 where: short stacking energy: -258.520 Base-Backbone interact. energy: -0.140 local terms energy: -310.195490 where: bonds (distance) C4'-P energy: -63.689 bonds (distance) P-C4' energy: -61.669 flat angles C4'-P-C4' energy: -61.518 flat angles P-C4'-P energy: -45.872 tors. eta vs tors. theta energy: -77.449 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -960.042156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.042156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -835.842156 (E_RNA) where: Base-Base interactions energy: -568.038 where: short stacking energy: -260.761 Base-Backbone interact. energy: -0.117 local terms energy: -267.686764 where: bonds (distance) C4'-P energy: -43.566 bonds (distance) P-C4' energy: -47.427 flat angles C4'-P-C4' energy: -51.194 flat angles P-C4'-P energy: -47.443 tors. eta vs tors. theta energy: -78.057 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -900.982045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -900.982045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.382045 (E_RNA) where: Base-Base interactions energy: -509.466 where: short stacking energy: -236.447 Base-Backbone interact. energy: -0.497 local terms energy: -261.418929 where: bonds (distance) C4'-P energy: -54.599 bonds (distance) P-C4' energy: -38.180 flat angles C4'-P-C4' energy: -58.621 flat angles P-C4'-P energy: -40.161 tors. eta vs tors. theta energy: -69.857 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -892.044212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -892.044212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.844212 (E_RNA) where: Base-Base interactions energy: -501.200 where: short stacking energy: -223.274 Base-Backbone interact. energy: -0.413 local terms energy: -266.231406 where: bonds (distance) C4'-P energy: -43.063 bonds (distance) P-C4' energy: -53.945 flat angles C4'-P-C4' energy: -65.458 flat angles P-C4'-P energy: -34.857 tors. eta vs tors. theta energy: -68.908 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -858.063956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.063956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.063956 (E_RNA) where: Base-Base interactions energy: -489.888 where: short stacking energy: -211.554 Base-Backbone interact. energy: 0.473 local terms energy: -242.649849 where: bonds (distance) C4'-P energy: -47.886 bonds (distance) P-C4' energy: -54.789 flat angles C4'-P-C4' energy: -55.356 flat angles P-C4'-P energy: -30.782 tors. eta vs tors. theta energy: -53.838 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -776.963753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.963753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.363753 (E_RNA) where: Base-Base interactions energy: -437.810 where: short stacking energy: -173.951 Base-Backbone interact. energy: -0.680 local terms energy: -208.873681 where: bonds (distance) C4'-P energy: -46.989 bonds (distance) P-C4' energy: -40.037 flat angles C4'-P-C4' energy: -47.745 flat angles P-C4'-P energy: -28.261 tors. eta vs tors. theta energy: -45.842 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -706.388749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.388749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.588749 (E_RNA) where: Base-Base interactions energy: -383.402 where: short stacking energy: -141.791 Base-Backbone interact. energy: 0.093 local terms energy: -195.279971 where: bonds (distance) C4'-P energy: -44.976 bonds (distance) P-C4' energy: -50.093 flat angles C4'-P-C4' energy: -41.572 flat angles P-C4'-P energy: -27.226 tors. eta vs tors. theta energy: -31.413 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -660.569612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.569612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.369612 (E_RNA) where: Base-Base interactions energy: -347.700 where: short stacking energy: -142.744 Base-Backbone interact. energy: 0.760 local terms energy: -189.429411 where: bonds (distance) C4'-P energy: -40.340 bonds (distance) P-C4' energy: -41.128 flat angles C4'-P-C4' energy: -49.964 flat angles P-C4'-P energy: -24.615 tors. eta vs tors. theta energy: -33.382 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -1089.473653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.473653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -959.873653 (E_RNA) where: Base-Base interactions energy: -663.084 where: short stacking energy: -268.052 Base-Backbone interact. energy: -0.709 local terms energy: -296.079933 where: bonds (distance) C4'-P energy: -58.103 bonds (distance) P-C4' energy: -51.595 flat angles C4'-P-C4' energy: -63.735 flat angles P-C4'-P energy: -43.201 tors. eta vs tors. theta energy: -79.446 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -1047.630184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.630184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -921.630184 (E_RNA) where: Base-Base interactions energy: -628.260 where: short stacking energy: -263.509 Base-Backbone interact. energy: -0.700 local terms energy: -292.670675 where: bonds (distance) C4'-P energy: -53.171 bonds (distance) P-C4' energy: -59.904 flat angles C4'-P-C4' energy: -64.058 flat angles P-C4'-P energy: -40.330 tors. eta vs tors. theta energy: -75.207 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -1019.221578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.221578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -891.421578 (E_RNA) where: Base-Base interactions energy: -589.127 where: short stacking energy: -255.696 Base-Backbone interact. energy: -1.156 local terms energy: -301.138651 where: bonds (distance) C4'-P energy: -45.386 bonds (distance) P-C4' energy: -60.705 flat angles C4'-P-C4' energy: -65.002 flat angles P-C4'-P energy: -46.132 tors. eta vs tors. theta energy: -83.913 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -962.003414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -962.003414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.403414 (E_RNA) where: Base-Base interactions energy: -571.448 where: short stacking energy: -258.054 Base-Backbone interact. energy: 0.744 local terms energy: -261.699392 where: bonds (distance) C4'-P energy: -40.650 bonds (distance) P-C4' energy: -53.276 flat angles C4'-P-C4' energy: -55.434 flat angles P-C4'-P energy: -38.550 tors. eta vs tors. theta energy: -73.789 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -880.601664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.601664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.001664 (E_RNA) where: Base-Base interactions energy: -498.170 where: short stacking energy: -227.348 Base-Backbone interact. energy: -2.389 local terms energy: -250.442416 where: bonds (distance) C4'-P energy: -39.139 bonds (distance) P-C4' energy: -55.165 flat angles C4'-P-C4' energy: -52.320 flat angles P-C4'-P energy: -43.217 tors. eta vs tors. theta energy: -60.601 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -894.623073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.623073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.823073 (E_RNA) where: Base-Base interactions energy: -506.987 where: short stacking energy: -227.347 Base-Backbone interact. energy: 0.108 local terms energy: -259.943906 where: bonds (distance) C4'-P energy: -47.410 bonds (distance) P-C4' energy: -51.953 flat angles C4'-P-C4' energy: -55.021 flat angles P-C4'-P energy: -40.229 tors. eta vs tors. theta energy: -65.331 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -840.986588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.986588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.786588 (E_RNA) where: Base-Base interactions energy: -486.013 where: short stacking energy: -215.125 Base-Backbone interact. energy: -1.269 local terms energy: -229.504780 where: bonds (distance) C4'-P energy: -40.613 bonds (distance) P-C4' energy: -44.147 flat angles C4'-P-C4' energy: -57.589 flat angles P-C4'-P energy: -29.176 tors. eta vs tors. theta energy: -57.980 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -797.237913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.237913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.437913 (E_RNA) where: Base-Base interactions energy: -460.437 where: short stacking energy: -203.007 Base-Backbone interact. energy: 0.992 local terms energy: -209.992427 where: bonds (distance) C4'-P energy: -32.438 bonds (distance) P-C4' energy: -50.567 flat angles C4'-P-C4' energy: -39.385 flat angles P-C4'-P energy: -36.829 tors. eta vs tors. theta energy: -50.772 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -683.304742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.304742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.504742 (E_RNA) where: Base-Base interactions energy: -340.768 where: short stacking energy: -139.199 Base-Backbone interact. energy: -1.281 local terms energy: -213.456319 where: bonds (distance) C4'-P energy: -53.433 bonds (distance) P-C4' energy: -52.544 flat angles C4'-P-C4' energy: -46.441 flat angles P-C4'-P energy: -31.921 tors. eta vs tors. theta energy: -29.117 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -665.057312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.057312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.057312 (E_RNA) where: Base-Base interactions energy: -343.858 where: short stacking energy: -146.027 Base-Backbone interact. energy: 0.085 local terms energy: -195.284905 where: bonds (distance) C4'-P energy: -35.181 bonds (distance) P-C4' energy: -46.456 flat angles C4'-P-C4' energy: -55.836 flat angles P-C4'-P energy: -25.575 tors. eta vs tors. theta energy: -32.237 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -1092.952399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1092.952399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.352399 (E_RNA) where: Base-Base interactions energy: -670.773 where: short stacking energy: -268.217 Base-Backbone interact. energy: -0.175 local terms energy: -292.404188 where: bonds (distance) C4'-P energy: -50.042 bonds (distance) P-C4' energy: -54.717 flat angles C4'-P-C4' energy: -63.605 flat angles P-C4'-P energy: -39.968 tors. eta vs tors. theta energy: -84.072 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -1054.455168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1054.455168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.655168 (E_RNA) where: Base-Base interactions energy: -625.951 where: short stacking energy: -262.407 Base-Backbone interact. energy: -0.569 local terms energy: -300.135605 where: bonds (distance) C4'-P energy: -55.939 bonds (distance) P-C4' energy: -61.354 flat angles C4'-P-C4' energy: -62.497 flat angles P-C4'-P energy: -43.767 tors. eta vs tors. theta energy: -76.579 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -1012.409105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1012.409105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.409105 (E_RNA) where: Base-Base interactions energy: -600.431 where: short stacking energy: -270.968 Base-Backbone interact. energy: -0.174 local terms energy: -285.804092 where: bonds (distance) C4'-P energy: -47.284 bonds (distance) P-C4' energy: -50.396 flat angles C4'-P-C4' energy: -64.243 flat angles P-C4'-P energy: -33.822 tors. eta vs tors. theta energy: -90.059 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -977.926542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.926542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -851.926542 (E_RNA) where: Base-Base interactions energy: -575.200 where: short stacking energy: -252.747 Base-Backbone interact. energy: -1.524 local terms energy: -275.202934 where: bonds (distance) C4'-P energy: -45.905 bonds (distance) P-C4' energy: -48.664 flat angles C4'-P-C4' energy: -65.646 flat angles P-C4'-P energy: -41.780 tors. eta vs tors. theta energy: -73.208 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -928.967132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -928.967132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.367132 (E_RNA) where: Base-Base interactions energy: -533.510 where: short stacking energy: -243.297 Base-Backbone interact. energy: 0.366 local terms energy: -266.222861 where: bonds (distance) C4'-P energy: -45.714 bonds (distance) P-C4' energy: -54.132 flat angles C4'-P-C4' energy: -56.757 flat angles P-C4'-P energy: -43.551 tors. eta vs tors. theta energy: -66.069 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -893.356075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.356075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.556075 (E_RNA) where: Base-Base interactions energy: -491.823 where: short stacking energy: -224.350 Base-Backbone interact. energy: -0.611 local terms energy: -273.122455 where: bonds (distance) C4'-P energy: -57.294 bonds (distance) P-C4' energy: -52.807 flat angles C4'-P-C4' energy: -56.279 flat angles P-C4'-P energy: -39.645 tors. eta vs tors. theta energy: -67.097 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -810.135384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.135384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.335384 (E_RNA) where: Base-Base interactions energy: -462.541 where: short stacking energy: -201.346 Base-Backbone interact. energy: -1.328 local terms energy: -218.466062 where: bonds (distance) C4'-P energy: -46.869 bonds (distance) P-C4' energy: -38.131 flat angles C4'-P-C4' energy: -44.477 flat angles P-C4'-P energy: -39.240 tors. eta vs tors. theta energy: -49.749 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -789.062572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.062572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.862572 (E_RNA) where: Base-Base interactions energy: -442.113 where: short stacking energy: -196.598 Base-Backbone interact. energy: -0.111 local terms energy: -222.638364 where: bonds (distance) C4'-P energy: -52.057 bonds (distance) P-C4' energy: -57.809 flat angles C4'-P-C4' energy: -38.281 flat angles P-C4'-P energy: -29.268 tors. eta vs tors. theta energy: -45.224 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -702.215013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.215013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.615013 (E_RNA) where: Base-Base interactions energy: -368.650 where: short stacking energy: -160.722 Base-Backbone interact. energy: 0.036 local terms energy: -213.000963 where: bonds (distance) C4'-P energy: -42.988 bonds (distance) P-C4' energy: -42.340 flat angles C4'-P-C4' energy: -59.226 flat angles P-C4'-P energy: -28.016 tors. eta vs tors. theta energy: -40.431 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -718.038928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.038928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.238928 (E_RNA) where: Base-Base interactions energy: -377.400 where: short stacking energy: -151.158 Base-Backbone interact. energy: -0.966 local terms energy: -211.873630 where: bonds (distance) C4'-P energy: -42.407 bonds (distance) P-C4' energy: -48.279 flat angles C4'-P-C4' energy: -50.733 flat angles P-C4'-P energy: -30.780 tors. eta vs tors. theta energy: -39.675 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -1090.889077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1090.889077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.289077 (E_RNA) where: Base-Base interactions energy: -671.922 where: short stacking energy: -278.271 Base-Backbone interact. energy: -1.677 local terms energy: -287.690530 where: bonds (distance) C4'-P energy: -54.285 bonds (distance) P-C4' energy: -50.559 flat angles C4'-P-C4' energy: -64.462 flat angles P-C4'-P energy: -36.024 tors. eta vs tors. theta energy: -82.360 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -1060.762768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.762768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -932.962768 (E_RNA) where: Base-Base interactions energy: -653.036 where: short stacking energy: -257.385 Base-Backbone interact. energy: -1.168 local terms energy: -278.759462 where: bonds (distance) C4'-P energy: -50.601 bonds (distance) P-C4' energy: -51.727 flat angles C4'-P-C4' energy: -62.095 flat angles P-C4'-P energy: -41.590 tors. eta vs tors. theta energy: -72.747 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -1015.263410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1015.263410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.663410 (E_RNA) where: Base-Base interactions energy: -595.173 where: short stacking energy: -264.813 Base-Backbone interact. energy: 0.409 local terms energy: -290.899697 where: bonds (distance) C4'-P energy: -53.415 bonds (distance) P-C4' energy: -46.552 flat angles C4'-P-C4' energy: -66.917 flat angles P-C4'-P energy: -44.950 tors. eta vs tors. theta energy: -79.064 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -981.332470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -981.332470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.532470 (E_RNA) where: Base-Base interactions energy: -567.441 where: short stacking energy: -253.081 Base-Backbone interact. energy: -0.447 local terms energy: -285.644298 where: bonds (distance) C4'-P energy: -51.789 bonds (distance) P-C4' energy: -54.621 flat angles C4'-P-C4' energy: -60.207 flat angles P-C4'-P energy: -39.357 tors. eta vs tors. theta energy: -79.670 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -920.235013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.235013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.235013 (E_RNA) where: Base-Base interactions energy: -532.956 where: short stacking energy: -231.059 Base-Backbone interact. energy: 0.381 local terms energy: -261.660141 where: bonds (distance) C4'-P energy: -54.188 bonds (distance) P-C4' energy: -50.136 flat angles C4'-P-C4' energy: -51.409 flat angles P-C4'-P energy: -39.428 tors. eta vs tors. theta energy: -66.500 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -904.977943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.977943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.177943 (E_RNA) where: Base-Base interactions energy: -510.720 where: short stacking energy: -242.228 Base-Backbone interact. energy: -1.003 local terms energy: -265.454914 where: bonds (distance) C4'-P energy: -52.504 bonds (distance) P-C4' energy: -38.423 flat angles C4'-P-C4' energy: -57.276 flat angles P-C4'-P energy: -44.141 tors. eta vs tors. theta energy: -73.111 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -803.011938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.011938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.411938 (E_RNA) where: Base-Base interactions energy: -427.107 where: short stacking energy: -187.776 Base-Backbone interact. energy: -0.920 local terms energy: -245.384863 where: bonds (distance) C4'-P energy: -55.320 bonds (distance) P-C4' energy: -59.010 flat angles C4'-P-C4' energy: -53.020 flat angles P-C4'-P energy: -27.471 tors. eta vs tors. theta energy: -50.564 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -820.135067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.135067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.335067 (E_RNA) where: Base-Base interactions energy: -458.160 where: short stacking energy: -196.846 Base-Backbone interact. energy: -0.136 local terms energy: -234.038668 where: bonds (distance) C4'-P energy: -47.205 bonds (distance) P-C4' energy: -53.459 flat angles C4'-P-C4' energy: -48.417 flat angles P-C4'-P energy: -37.770 tors. eta vs tors. theta energy: -47.187 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -697.627929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.627929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.427929 (E_RNA) where: Base-Base interactions energy: -379.797 where: short stacking energy: -172.068 Base-Backbone interact. energy: 1.226 local terms energy: -194.856381 where: bonds (distance) C4'-P energy: -47.121 bonds (distance) P-C4' energy: -34.924 flat angles C4'-P-C4' energy: -45.297 flat angles P-C4'-P energy: -29.999 tors. eta vs tors. theta energy: -37.516 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -688.575803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.575803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.975803 (E_RNA) where: Base-Base interactions energy: -363.357 where: short stacking energy: -151.894 Base-Backbone interact. energy: -0.996 local terms energy: -194.622450 where: bonds (distance) C4'-P energy: -52.093 bonds (distance) P-C4' energy: -44.247 flat angles C4'-P-C4' energy: -47.900 flat angles P-C4'-P energy: -29.206 tors. eta vs tors. theta energy: -21.177 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -1090.938391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1090.938391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.938391 (E_RNA) where: Base-Base interactions energy: -656.863 where: short stacking energy: -280.003 Base-Backbone interact. energy: -0.556 local terms energy: -307.519337 where: bonds (distance) C4'-P energy: -57.903 bonds (distance) P-C4' energy: -57.682 flat angles C4'-P-C4' energy: -61.000 flat angles P-C4'-P energy: -47.915 tors. eta vs tors. theta energy: -83.019 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -1050.878363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1050.878363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.878363 (E_RNA) where: Base-Base interactions energy: -644.828 where: short stacking energy: -273.517 Base-Backbone interact. energy: -1.823 local terms energy: -278.227926 where: bonds (distance) C4'-P energy: -43.842 bonds (distance) P-C4' energy: -53.795 flat angles C4'-P-C4' energy: -58.424 flat angles P-C4'-P energy: -42.406 tors. eta vs tors. theta energy: -79.760 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -1021.877716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.877716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -894.077716 (E_RNA) where: Base-Base interactions energy: -612.627 where: short stacking energy: -283.969 Base-Backbone interact. energy: 0.181 local terms energy: -281.631993 where: bonds (distance) C4'-P energy: -57.193 bonds (distance) P-C4' energy: -47.021 flat angles C4'-P-C4' energy: -55.801 flat angles P-C4'-P energy: -39.858 tors. eta vs tors. theta energy: -81.760 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -988.400132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -988.400132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.600132 (E_RNA) where: Base-Base interactions energy: -577.825 where: short stacking energy: -272.470 Base-Backbone interact. energy: -0.270 local terms energy: -282.505434 where: bonds (distance) C4'-P energy: -49.368 bonds (distance) P-C4' energy: -53.514 flat angles C4'-P-C4' energy: -59.898 flat angles P-C4'-P energy: -38.720 tors. eta vs tors. theta energy: -81.005 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -898.650115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.650115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.650115 (E_RNA) where: Base-Base interactions energy: -503.179 where: short stacking energy: -219.650 Base-Backbone interact. energy: -2.990 local terms energy: -266.481631 where: bonds (distance) C4'-P energy: -49.561 bonds (distance) P-C4' energy: -55.226 flat angles C4'-P-C4' energy: -59.342 flat angles P-C4'-P energy: -36.326 tors. eta vs tors. theta energy: -66.027 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -864.504200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -864.504200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.904200 (E_RNA) where: Base-Base interactions energy: -497.019 where: short stacking energy: -214.380 Base-Backbone interact. energy: 2.358 local terms energy: -240.244022 where: bonds (distance) C4'-P energy: -51.354 bonds (distance) P-C4' energy: -43.547 flat angles C4'-P-C4' energy: -54.860 flat angles P-C4'-P energy: -27.509 tors. eta vs tors. theta energy: -62.974 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -820.006871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.006871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.806871 (E_RNA) where: Base-Base interactions energy: -455.566 where: short stacking energy: -199.908 Base-Backbone interact. energy: 0.338 local terms energy: -240.579353 where: bonds (distance) C4'-P energy: -51.379 bonds (distance) P-C4' energy: -53.103 flat angles C4'-P-C4' energy: -49.232 flat angles P-C4'-P energy: -26.805 tors. eta vs tors. theta energy: -60.060 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -776.767583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.767583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.567583 (E_RNA) where: Base-Base interactions energy: -412.440 where: short stacking energy: -179.039 Base-Backbone interact. energy: -3.368 local terms energy: -236.759554 where: bonds (distance) C4'-P energy: -51.167 bonds (distance) P-C4' energy: -49.276 flat angles C4'-P-C4' energy: -51.308 flat angles P-C4'-P energy: -38.190 tors. eta vs tors. theta energy: -46.819 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -689.152792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.152792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.952792 (E_RNA) where: Base-Base interactions energy: -370.148 where: short stacking energy: -153.632 Base-Backbone interact. energy: -0.070 local terms energy: -194.734902 where: bonds (distance) C4'-P energy: -37.186 bonds (distance) P-C4' energy: -54.090 flat angles C4'-P-C4' energy: -45.713 flat angles P-C4'-P energy: -32.471 tors. eta vs tors. theta energy: -25.276 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -651.715734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.715734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.915734 (E_RNA) where: Base-Base interactions energy: -360.590 where: short stacking energy: -145.694 Base-Backbone interact. energy: -2.232 local terms energy: -170.093900 where: bonds (distance) C4'-P energy: -44.331 bonds (distance) P-C4' energy: -33.678 flat angles C4'-P-C4' energy: -49.573 flat angles P-C4'-P energy: -16.344 tors. eta vs tors. theta energy: -26.169 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -1097.241925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1097.241925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -969.441925 (E_RNA) where: Base-Base interactions energy: -660.228 where: short stacking energy: -279.735 Base-Backbone interact. energy: -1.750 local terms energy: -307.464120 where: bonds (distance) C4'-P energy: -59.131 bonds (distance) P-C4' energy: -59.268 flat angles C4'-P-C4' energy: -65.056 flat angles P-C4'-P energy: -37.483 tors. eta vs tors. theta energy: -86.526 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -1057.542872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.542872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.942872 (E_RNA) where: Base-Base interactions energy: -628.097 where: short stacking energy: -249.687 Base-Backbone interact. energy: -1.154 local terms energy: -298.691799 where: bonds (distance) C4'-P energy: -48.463 bonds (distance) P-C4' energy: -62.216 flat angles C4'-P-C4' energy: -67.445 flat angles P-C4'-P energy: -45.525 tors. eta vs tors. theta energy: -75.043 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -1030.675074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1030.675074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.075074 (E_RNA) where: Base-Base interactions energy: -605.878 where: short stacking energy: -272.764 Base-Backbone interact. energy: -0.486 local terms energy: -294.711341 where: bonds (distance) C4'-P energy: -56.743 bonds (distance) P-C4' energy: -49.957 flat angles C4'-P-C4' energy: -65.004 flat angles P-C4'-P energy: -42.962 tors. eta vs tors. theta energy: -80.045 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -958.590482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -958.590482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -828.990482 (E_RNA) where: Base-Base interactions energy: -559.017 where: short stacking energy: -240.524 Base-Backbone interact. energy: 0.075 local terms energy: -270.048304 where: bonds (distance) C4'-P energy: -58.802 bonds (distance) P-C4' energy: -51.439 flat angles C4'-P-C4' energy: -54.019 flat angles P-C4'-P energy: -38.131 tors. eta vs tors. theta energy: -67.657 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -906.189461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -906.189461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.389461 (E_RNA) where: Base-Base interactions energy: -512.067 where: short stacking energy: -228.094 Base-Backbone interact. energy: -1.788 local terms energy: -264.534272 where: bonds (distance) C4'-P energy: -49.971 bonds (distance) P-C4' energy: -53.175 flat angles C4'-P-C4' energy: -51.398 flat angles P-C4'-P energy: -41.556 tors. eta vs tors. theta energy: -68.434 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -859.778506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -859.778506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.978506 (E_RNA) where: Base-Base interactions energy: -491.922 where: short stacking energy: -217.427 Base-Backbone interact. energy: -0.191 local terms energy: -239.866256 where: bonds (distance) C4'-P energy: -59.160 bonds (distance) P-C4' energy: -50.213 flat angles C4'-P-C4' energy: -43.919 flat angles P-C4'-P energy: -37.548 tors. eta vs tors. theta energy: -49.027 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -811.433626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -811.433626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.233626 (E_RNA) where: Base-Base interactions energy: -462.798 where: short stacking energy: -199.532 Base-Backbone interact. energy: -2.288 local terms energy: -222.147314 where: bonds (distance) C4'-P energy: -34.887 bonds (distance) P-C4' energy: -55.484 flat angles C4'-P-C4' energy: -47.665 flat angles P-C4'-P energy: -29.813 tors. eta vs tors. theta energy: -54.299 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -720.724141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.724141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.124142 (E_RNA) where: Base-Base interactions energy: -369.955 where: short stacking energy: -148.724 Base-Backbone interact. energy: -1.254 local terms energy: -219.915042 where: bonds (distance) C4'-P energy: -48.054 bonds (distance) P-C4' energy: -38.976 flat angles C4'-P-C4' energy: -58.855 flat angles P-C4'-P energy: -30.130 tors. eta vs tors. theta energy: -43.900 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -756.725456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.725456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.525456 (E_RNA) where: Base-Base interactions energy: -419.290 where: short stacking energy: -177.384 Base-Backbone interact. energy: -1.551 local terms energy: -211.684970 where: bonds (distance) C4'-P energy: -40.694 bonds (distance) P-C4' energy: -43.235 flat angles C4'-P-C4' energy: -48.216 flat angles P-C4'-P energy: -38.031 tors. eta vs tors. theta energy: -41.510 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -661.670236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.670236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.870236 (E_RNA) where: Base-Base interactions energy: -363.978 where: short stacking energy: -150.033 Base-Backbone interact. energy: 1.233 local terms energy: -180.125163 where: bonds (distance) C4'-P energy: -42.181 bonds (distance) P-C4' energy: -46.911 flat angles C4'-P-C4' energy: -48.715 flat angles P-C4'-P energy: -15.449 tors. eta vs tors. theta energy: -26.869 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -1100.407573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1100.407573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -970.807573 (E_RNA) where: Base-Base interactions energy: -660.100 where: short stacking energy: -279.220 Base-Backbone interact. energy: -0.459 local terms energy: -310.249013 where: bonds (distance) C4'-P energy: -57.809 bonds (distance) P-C4' energy: -61.497 flat angles C4'-P-C4' energy: -61.420 flat angles P-C4'-P energy: -45.241 tors. eta vs tors. theta energy: -84.282 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -1040.081611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.081611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -912.281611 (E_RNA) where: Base-Base interactions energy: -631.751 where: short stacking energy: -245.745 Base-Backbone interact. energy: -0.457 local terms energy: -280.074028 where: bonds (distance) C4'-P energy: -46.662 bonds (distance) P-C4' energy: -54.923 flat angles C4'-P-C4' energy: -53.788 flat angles P-C4'-P energy: -38.960 tors. eta vs tors. theta energy: -85.740 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -1002.459487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1002.459487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.859487 (E_RNA) where: Base-Base interactions energy: -583.072 where: short stacking energy: -261.490 Base-Backbone interact. energy: -0.626 local terms energy: -289.161641 where: bonds (distance) C4'-P energy: -56.916 bonds (distance) P-C4' energy: -52.424 flat angles C4'-P-C4' energy: -59.512 flat angles P-C4'-P energy: -40.397 tors. eta vs tors. theta energy: -79.912 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -913.313597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -913.313597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.513597 (E_RNA) where: Base-Base interactions energy: -496.934 where: short stacking energy: -229.785 Base-Backbone interact. energy: -0.174 local terms energy: -288.405133 where: bonds (distance) C4'-P energy: -61.610 bonds (distance) P-C4' energy: -53.794 flat angles C4'-P-C4' energy: -54.810 flat angles P-C4'-P energy: -45.249 tors. eta vs tors. theta energy: -72.942 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -904.304067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.304067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.304067 (E_RNA) where: Base-Base interactions energy: -500.364 where: short stacking energy: -208.151 Base-Backbone interact. energy: 1.650 local terms energy: -279.590181 where: bonds (distance) C4'-P energy: -60.258 bonds (distance) P-C4' energy: -55.992 flat angles C4'-P-C4' energy: -56.233 flat angles P-C4'-P energy: -41.247 tors. eta vs tors. theta energy: -65.861 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -892.544101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -892.544101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.944101 (E_RNA) where: Base-Base interactions energy: -495.159 where: short stacking energy: -230.140 Base-Backbone interact. energy: -0.151 local terms energy: -267.633397 where: bonds (distance) C4'-P energy: -42.714 bonds (distance) P-C4' energy: -61.521 flat angles C4'-P-C4' energy: -51.509 flat angles P-C4'-P energy: -33.838 tors. eta vs tors. theta energy: -78.051 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -823.982574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -823.982574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.982574 (E_RNA) where: Base-Base interactions energy: -462.980 where: short stacking energy: -190.746 Base-Backbone interact. energy: -0.554 local terms energy: -234.448367 where: bonds (distance) C4'-P energy: -42.983 bonds (distance) P-C4' energy: -62.197 flat angles C4'-P-C4' energy: -37.835 flat angles P-C4'-P energy: -38.049 tors. eta vs tors. theta energy: -53.384 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -769.020853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.020853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -641.220853 (E_RNA) where: Base-Base interactions energy: -406.841 where: short stacking energy: -189.059 Base-Backbone interact. energy: -0.047 local terms energy: -234.332384 where: bonds (distance) C4'-P energy: -57.669 bonds (distance) P-C4' energy: -48.146 flat angles C4'-P-C4' energy: -49.149 flat angles P-C4'-P energy: -28.576 tors. eta vs tors. theta energy: -50.793 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -762.578413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.578413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -634.778413 (E_RNA) where: Base-Base interactions energy: -405.260 where: short stacking energy: -167.125 Base-Backbone interact. energy: -0.453 local terms energy: -229.065023 where: bonds (distance) C4'-P energy: -40.027 bonds (distance) P-C4' energy: -57.062 flat angles C4'-P-C4' energy: -56.245 flat angles P-C4'-P energy: -28.368 tors. eta vs tors. theta energy: -47.364 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -654.627236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.627236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.427236 (E_RNA) where: Base-Base interactions energy: -337.132 where: short stacking energy: -130.709 Base-Backbone interact. energy: -1.899 local terms energy: -191.396587 where: bonds (distance) C4'-P energy: -46.519 bonds (distance) P-C4' energy: -39.316 flat angles C4'-P-C4' energy: -42.093 flat angles P-C4'-P energy: -33.956 tors. eta vs tors. theta energy: -29.512 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -1089.385085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.385085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.585085 (E_RNA) where: Base-Base interactions energy: -652.852 where: short stacking energy: -276.384 Base-Backbone interact. energy: -0.613 local terms energy: -308.119507 where: bonds (distance) C4'-P energy: -55.545 bonds (distance) P-C4' energy: -61.111 flat angles C4'-P-C4' energy: -55.636 flat angles P-C4'-P energy: -49.384 tors. eta vs tors. theta energy: -86.444 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -1035.029550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.029550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.229550 (E_RNA) where: Base-Base interactions energy: -624.618 where: short stacking energy: -280.357 Base-Backbone interact. energy: -0.645 local terms energy: -281.965933 where: bonds (distance) C4'-P energy: -49.476 bonds (distance) P-C4' energy: -49.340 flat angles C4'-P-C4' energy: -61.198 flat angles P-C4'-P energy: -36.855 tors. eta vs tors. theta energy: -85.096 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -1020.511708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.511708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -892.711708 (E_RNA) where: Base-Base interactions energy: -610.494 where: short stacking energy: -260.398 Base-Backbone interact. energy: 1.789 local terms energy: -284.006858 where: bonds (distance) C4'-P energy: -38.917 bonds (distance) P-C4' energy: -56.068 flat angles C4'-P-C4' energy: -66.762 flat angles P-C4'-P energy: -45.436 tors. eta vs tors. theta energy: -76.823 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -904.344207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.344207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.544207 (E_RNA) where: Base-Base interactions energy: -500.551 where: short stacking energy: -214.683 Base-Backbone interact. energy: -0.568 local terms energy: -275.425405 where: bonds (distance) C4'-P energy: -49.589 bonds (distance) P-C4' energy: -55.389 flat angles C4'-P-C4' energy: -66.950 flat angles P-C4'-P energy: -37.594 tors. eta vs tors. theta energy: -65.904 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -901.763685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -901.763685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -773.963685 (E_RNA) where: Base-Base interactions energy: -516.974 where: short stacking energy: -235.718 Base-Backbone interact. energy: -0.528 local terms energy: -256.461348 where: bonds (distance) C4'-P energy: -48.985 bonds (distance) P-C4' energy: -42.459 flat angles C4'-P-C4' energy: -58.072 flat angles P-C4'-P energy: -31.509 tors. eta vs tors. theta energy: -75.436 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -898.612977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.612977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.012977 (E_RNA) where: Base-Base interactions energy: -508.560 where: short stacking energy: -220.584 Base-Backbone interact. energy: -0.852 local terms energy: -259.600633 where: bonds (distance) C4'-P energy: -41.835 bonds (distance) P-C4' energy: -55.710 flat angles C4'-P-C4' energy: -53.497 flat angles P-C4'-P energy: -35.596 tors. eta vs tors. theta energy: -72.963 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -842.887607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -842.887607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.887607 (E_RNA) where: Base-Base interactions energy: -490.833 where: short stacking energy: -209.930 Base-Backbone interact. energy: -0.232 local terms energy: -225.821755 where: bonds (distance) C4'-P energy: -39.208 bonds (distance) P-C4' energy: -35.840 flat angles C4'-P-C4' energy: -56.456 flat angles P-C4'-P energy: -37.311 tors. eta vs tors. theta energy: -57.007 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -791.090487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.090487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.890487 (E_RNA) where: Base-Base interactions energy: -445.347 where: short stacking energy: -198.746 Base-Backbone interact. energy: -0.699 local terms energy: -220.844301 where: bonds (distance) C4'-P energy: -37.002 bonds (distance) P-C4' energy: -50.642 flat angles C4'-P-C4' energy: -47.955 flat angles P-C4'-P energy: -34.387 tors. eta vs tors. theta energy: -50.858 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -691.882355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.882355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.082355 (E_RNA) where: Base-Base interactions energy: -349.830 where: short stacking energy: -140.094 Base-Backbone interact. energy: -0.442 local terms energy: -213.809516 where: bonds (distance) C4'-P energy: -48.887 bonds (distance) P-C4' energy: -52.197 flat angles C4'-P-C4' energy: -44.049 flat angles P-C4'-P energy: -35.714 tors. eta vs tors. theta energy: -32.962 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -647.794685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.794685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.794685 (E_RNA) where: Base-Base interactions energy: -332.145 where: short stacking energy: -135.316 Base-Backbone interact. energy: -0.395 local terms energy: -189.254084 where: bonds (distance) C4'-P energy: -45.191 bonds (distance) P-C4' energy: -46.640 flat angles C4'-P-C4' energy: -48.648 flat angles P-C4'-P energy: -19.436 tors. eta vs tors. theta energy: -29.341 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -1098.153071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1098.153071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -968.553071 (E_RNA) where: Base-Base interactions energy: -652.979 where: short stacking energy: -269.752 Base-Backbone interact. energy: -0.308 local terms energy: -315.266531 where: bonds (distance) C4'-P energy: -60.356 bonds (distance) P-C4' energy: -56.028 flat angles C4'-P-C4' energy: -63.787 flat angles P-C4'-P energy: -51.705 tors. eta vs tors. theta energy: -83.391 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -1044.295250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1044.295250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -918.295250 (E_RNA) where: Base-Base interactions energy: -629.830 where: short stacking energy: -276.445 Base-Backbone interact. energy: -0.455 local terms energy: -288.010458 where: bonds (distance) C4'-P energy: -54.087 bonds (distance) P-C4' energy: -50.789 flat angles C4'-P-C4' energy: -59.370 flat angles P-C4'-P energy: -36.262 tors. eta vs tors. theta energy: -87.503 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -1015.735372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1015.735372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.935372 (E_RNA) where: Base-Base interactions energy: -593.043 where: short stacking energy: -236.273 Base-Backbone interact. energy: -0.799 local terms energy: -294.093264 where: bonds (distance) C4'-P energy: -61.472 bonds (distance) P-C4' energy: -61.576 flat angles C4'-P-C4' energy: -63.388 flat angles P-C4'-P energy: -40.511 tors. eta vs tors. theta energy: -67.146 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -937.931140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.931140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -811.931140 (E_RNA) where: Base-Base interactions energy: -541.780 where: short stacking energy: -235.998 Base-Backbone interact. energy: -0.198 local terms energy: -269.952736 where: bonds (distance) C4'-P energy: -57.117 bonds (distance) P-C4' energy: -48.718 flat angles C4'-P-C4' energy: -53.004 flat angles P-C4'-P energy: -47.010 tors. eta vs tors. theta energy: -64.104 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -918.423467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -918.423467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.823467 (E_RNA) where: Base-Base interactions energy: -521.975 where: short stacking energy: -233.938 Base-Backbone interact. energy: -0.653 local terms energy: -266.194620 where: bonds (distance) C4'-P energy: -51.884 bonds (distance) P-C4' energy: -52.190 flat angles C4'-P-C4' energy: -56.918 flat angles P-C4'-P energy: -39.582 tors. eta vs tors. theta energy: -65.621 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -880.100143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.100143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.900143 (E_RNA) where: Base-Base interactions energy: -504.120 where: short stacking energy: -217.847 Base-Backbone interact. energy: -0.155 local terms energy: -251.624716 where: bonds (distance) C4'-P energy: -46.905 bonds (distance) P-C4' energy: -50.276 flat angles C4'-P-C4' energy: -57.698 flat angles P-C4'-P energy: -35.234 tors. eta vs tors. theta energy: -61.512 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -824.449199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.449199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.249199 (E_RNA) where: Base-Base interactions energy: -458.525 where: short stacking energy: -190.557 Base-Backbone interact. energy: 0.140 local terms energy: -241.864559 where: bonds (distance) C4'-P energy: -51.260 bonds (distance) P-C4' energy: -55.024 flat angles C4'-P-C4' energy: -52.482 flat angles P-C4'-P energy: -42.410 tors. eta vs tors. theta energy: -40.689 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -810.138128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.138128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.738128 (E_RNA) where: Base-Base interactions energy: -453.906 where: short stacking energy: -201.418 Base-Backbone interact. energy: 1.786 local terms energy: -235.617439 where: bonds (distance) C4'-P energy: -38.638 bonds (distance) P-C4' energy: -52.198 flat angles C4'-P-C4' energy: -54.187 flat angles P-C4'-P energy: -36.198 tors. eta vs tors. theta energy: -54.396 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -688.179486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.179486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.579486 (E_RNA) where: Base-Base interactions energy: -366.408 where: short stacking energy: -143.372 Base-Backbone interact. energy: 1.943 local terms energy: -194.114914 where: bonds (distance) C4'-P energy: -35.590 bonds (distance) P-C4' energy: -43.534 flat angles C4'-P-C4' energy: -46.162 flat angles P-C4'-P energy: -34.174 tors. eta vs tors. theta energy: -34.655 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -673.155294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.155294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.155294 (E_RNA) where: Base-Base interactions energy: -343.187 where: short stacking energy: -139.632 Base-Backbone interact. energy: 2.553 local terms energy: -206.521250 where: bonds (distance) C4'-P energy: -48.039 bonds (distance) P-C4' energy: -42.849 flat angles C4'-P-C4' energy: -45.917 flat angles P-C4'-P energy: -39.148 tors. eta vs tors. theta energy: -30.569 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -1093.240384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1093.240384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.640384 (E_RNA) where: Base-Base interactions energy: -646.362 where: short stacking energy: -270.515 Base-Backbone interact. energy: -0.558 local terms energy: -316.720395 where: bonds (distance) C4'-P energy: -60.788 bonds (distance) P-C4' energy: -60.046 flat angles C4'-P-C4' energy: -62.288 flat angles P-C4'-P energy: -45.777 tors. eta vs tors. theta energy: -87.821 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -1045.022740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.022740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.022740 (E_RNA) where: Base-Base interactions energy: -618.369 where: short stacking energy: -288.812 Base-Backbone interact. energy: -0.547 local terms energy: -300.106622 where: bonds (distance) C4'-P energy: -53.913 bonds (distance) P-C4' energy: -56.378 flat angles C4'-P-C4' energy: -57.858 flat angles P-C4'-P energy: -42.142 tors. eta vs tors. theta energy: -89.816 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -1034.948773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1034.948773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.148773 (E_RNA) where: Base-Base interactions energy: -635.826 where: short stacking energy: -236.359 Base-Backbone interact. energy: -1.637 local terms energy: -269.686235 where: bonds (distance) C4'-P energy: -52.979 bonds (distance) P-C4' energy: -49.517 flat angles C4'-P-C4' energy: -57.543 flat angles P-C4'-P energy: -39.820 tors. eta vs tors. theta energy: -69.826 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -927.674304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.674304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -798.074304 (E_RNA) where: Base-Base interactions energy: -527.008 where: short stacking energy: -242.370 Base-Backbone interact. energy: -2.006 local terms energy: -269.060730 where: bonds (distance) C4'-P energy: -53.168 bonds (distance) P-C4' energy: -55.760 flat angles C4'-P-C4' energy: -54.187 flat angles P-C4'-P energy: -38.568 tors. eta vs tors. theta energy: -67.377 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -922.447176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.447176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.647176 (E_RNA) where: Base-Base interactions energy: -534.091 where: short stacking energy: -246.299 Base-Backbone interact. energy: 0.954 local terms energy: -261.510260 where: bonds (distance) C4'-P energy: -46.033 bonds (distance) P-C4' energy: -47.051 flat angles C4'-P-C4' energy: -53.092 flat angles P-C4'-P energy: -34.146 tors. eta vs tors. theta energy: -81.188 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -890.699330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -890.699330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.499330 (E_RNA) where: Base-Base interactions energy: -501.082 where: short stacking energy: -234.267 Base-Backbone interact. energy: -1.232 local terms energy: -264.185565 where: bonds (distance) C4'-P energy: -48.259 bonds (distance) P-C4' energy: -56.985 flat angles C4'-P-C4' energy: -52.048 flat angles P-C4'-P energy: -31.733 tors. eta vs tors. theta energy: -75.161 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -848.719295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.719295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.919295 (E_RNA) where: Base-Base interactions energy: -501.467 where: short stacking energy: -209.509 Base-Backbone interact. energy: -0.939 local terms energy: -227.514215 where: bonds (distance) C4'-P energy: -44.390 bonds (distance) P-C4' energy: -48.825 flat angles C4'-P-C4' energy: -48.426 flat angles P-C4'-P energy: -34.957 tors. eta vs tors. theta energy: -50.916 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -784.885988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.885988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.085988 (E_RNA) where: Base-Base interactions energy: -418.963 where: short stacking energy: -179.354 Base-Backbone interact. energy: -0.664 local terms energy: -237.458196 where: bonds (distance) C4'-P energy: -55.890 bonds (distance) P-C4' energy: -40.730 flat angles C4'-P-C4' energy: -57.042 flat angles P-C4'-P energy: -34.789 tors. eta vs tors. theta energy: -49.008 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -689.610140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.610140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.610140 (E_RNA) where: Base-Base interactions energy: -362.651 where: short stacking energy: -158.945 Base-Backbone interact. energy: -0.958 local terms energy: -200.001821 where: bonds (distance) C4'-P energy: -50.412 bonds (distance) P-C4' energy: -51.749 flat angles C4'-P-C4' energy: -49.733 flat angles P-C4'-P energy: -18.403 tors. eta vs tors. theta energy: -29.704 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -703.992338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.992338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.792338 (E_RNA) where: Base-Base interactions energy: -390.650 where: short stacking energy: -162.368 Base-Backbone interact. energy: -1.377 local terms energy: -187.765824 where: bonds (distance) C4'-P energy: -39.199 bonds (distance) P-C4' energy: -49.844 flat angles C4'-P-C4' energy: -46.353 flat angles P-C4'-P energy: -18.160 tors. eta vs tors. theta energy: -34.211 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -1081.055787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1081.055787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -951.455787 (E_RNA) where: Base-Base interactions energy: -663.537 where: short stacking energy: -278.299 Base-Backbone interact. energy: -0.361 local terms energy: -287.558085 where: bonds (distance) C4'-P energy: -52.295 bonds (distance) P-C4' energy: -53.063 flat angles C4'-P-C4' energy: -55.425 flat angles P-C4'-P energy: -40.933 tors. eta vs tors. theta energy: -85.843 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -1055.002525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.002525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -925.402525 (E_RNA) where: Base-Base interactions energy: -627.466 where: short stacking energy: -283.845 Base-Backbone interact. energy: -0.999 local terms energy: -296.937173 where: bonds (distance) C4'-P energy: -52.396 bonds (distance) P-C4' energy: -61.829 flat angles C4'-P-C4' energy: -61.662 flat angles P-C4'-P energy: -40.075 tors. eta vs tors. theta energy: -80.974 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -1037.536248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.536248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.936248 (E_RNA) where: Base-Base interactions energy: -635.764 where: short stacking energy: -236.395 Base-Backbone interact. energy: -2.857 local terms energy: -269.314907 where: bonds (distance) C4'-P energy: -47.373 bonds (distance) P-C4' energy: -61.123 flat angles C4'-P-C4' energy: -49.815 flat angles P-C4'-P energy: -40.058 tors. eta vs tors. theta energy: -70.946 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -941.640565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -941.640565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -817.440565 (E_RNA) where: Base-Base interactions energy: -544.029 where: short stacking energy: -255.281 Base-Backbone interact. energy: -1.186 local terms energy: -272.225096 where: bonds (distance) C4'-P energy: -47.112 bonds (distance) P-C4' energy: -55.699 flat angles C4'-P-C4' energy: -55.953 flat angles P-C4'-P energy: -32.125 tors. eta vs tors. theta energy: -81.336 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -888.743426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -888.743426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.943426 (E_RNA) where: Base-Base interactions energy: -496.450 where: short stacking energy: -221.755 Base-Backbone interact. energy: -0.550 local terms energy: -263.944205 where: bonds (distance) C4'-P energy: -46.368 bonds (distance) P-C4' energy: -56.895 flat angles C4'-P-C4' energy: -61.664 flat angles P-C4'-P energy: -37.003 tors. eta vs tors. theta energy: -62.014 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -886.730005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -886.730005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.130005 (E_RNA) where: Base-Base interactions energy: -503.178 where: short stacking energy: -233.441 Base-Backbone interact. energy: -1.052 local terms energy: -252.900101 where: bonds (distance) C4'-P energy: -51.706 bonds (distance) P-C4' energy: -44.393 flat angles C4'-P-C4' energy: -56.384 flat angles P-C4'-P energy: -33.500 tors. eta vs tors. theta energy: -66.917 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -855.609665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.609665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.609665 (E_RNA) where: Base-Base interactions energy: -477.312 where: short stacking energy: -208.919 Base-Backbone interact. energy: -3.301 local terms energy: -248.996726 where: bonds (distance) C4'-P energy: -51.003 bonds (distance) P-C4' energy: -46.598 flat angles C4'-P-C4' energy: -55.211 flat angles P-C4'-P energy: -33.600 tors. eta vs tors. theta energy: -62.585 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -836.366991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.366991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.566991 (E_RNA) where: Base-Base interactions energy: -481.126 where: short stacking energy: -211.577 Base-Backbone interact. energy: 4.810 local terms energy: -232.251350 where: bonds (distance) C4'-P energy: -41.725 bonds (distance) P-C4' energy: -45.091 flat angles C4'-P-C4' energy: -50.283 flat angles P-C4'-P energy: -35.265 tors. eta vs tors. theta energy: -59.887 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -731.404747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.404747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.404747 (E_RNA) where: Base-Base interactions energy: -396.338 where: short stacking energy: -171.830 Base-Backbone interact. energy: 0.558 local terms energy: -209.624938 where: bonds (distance) C4'-P energy: -45.031 bonds (distance) P-C4' energy: -46.511 flat angles C4'-P-C4' energy: -53.076 flat angles P-C4'-P energy: -27.444 tors. eta vs tors. theta energy: -37.563 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -663.930340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.930340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.530340 (E_RNA) where: Base-Base interactions energy: -354.569 where: short stacking energy: -139.436 Base-Backbone interact. energy: 0.148 local terms energy: -187.109080 where: bonds (distance) C4'-P energy: -44.663 bonds (distance) P-C4' energy: -41.990 flat angles C4'-P-C4' energy: -43.342 flat angles P-C4'-P energy: -33.491 tors. eta vs tors. theta energy: -23.623 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -1067.697827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.697827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -938.097827 (E_RNA) where: Base-Base interactions energy: -631.830 where: short stacking energy: -268.405 Base-Backbone interact. energy: 0.022 local terms energy: -306.289700 where: bonds (distance) C4'-P energy: -60.863 bonds (distance) P-C4' energy: -62.182 flat angles C4'-P-C4' energy: -65.851 flat angles P-C4'-P energy: -42.441 tors. eta vs tors. theta energy: -74.952 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -1036.982751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1036.982751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -909.182751 (E_RNA) where: Base-Base interactions energy: -608.753 where: short stacking energy: -253.863 Base-Backbone interact. energy: -1.100 local terms energy: -299.330188 where: bonds (distance) C4'-P energy: -46.691 bonds (distance) P-C4' energy: -58.236 flat angles C4'-P-C4' energy: -66.492 flat angles P-C4'-P energy: -47.833 tors. eta vs tors. theta energy: -80.078 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -1039.125854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.125854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.125854 (E_RNA) where: Base-Base interactions energy: -635.329 where: short stacking energy: -258.159 Base-Backbone interact. energy: 2.750 local terms energy: -280.546059 where: bonds (distance) C4'-P energy: -48.420 bonds (distance) P-C4' energy: -50.244 flat angles C4'-P-C4' energy: -59.092 flat angles P-C4'-P energy: -42.457 tors. eta vs tors. theta energy: -80.333 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -969.345021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -969.345021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -839.745021 (E_RNA) where: Base-Base interactions energy: -567.815 where: short stacking energy: -249.351 Base-Backbone interact. energy: -0.621 local terms energy: -271.308638 where: bonds (distance) C4'-P energy: -50.158 bonds (distance) P-C4' energy: -55.990 flat angles C4'-P-C4' energy: -52.174 flat angles P-C4'-P energy: -39.294 tors. eta vs tors. theta energy: -73.693 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -876.989214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -876.989214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.389214 (E_RNA) where: Base-Base interactions energy: -479.742 where: short stacking energy: -215.620 Base-Backbone interact. energy: -0.934 local terms energy: -266.713054 where: bonds (distance) C4'-P energy: -51.938 bonds (distance) P-C4' energy: -53.089 flat angles C4'-P-C4' energy: -60.531 flat angles P-C4'-P energy: -42.425 tors. eta vs tors. theta energy: -58.730 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -867.456525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -867.456525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.456525 (E_RNA) where: Base-Base interactions energy: -489.943 where: short stacking energy: -210.418 Base-Backbone interact. energy: -0.968 local terms energy: -250.545258 where: bonds (distance) C4'-P energy: -46.711 bonds (distance) P-C4' energy: -50.040 flat angles C4'-P-C4' energy: -52.830 flat angles P-C4'-P energy: -39.798 tors. eta vs tors. theta energy: -61.166 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -863.055319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -863.055319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -733.455319 (E_RNA) where: Base-Base interactions energy: -481.612 where: short stacking energy: -200.160 Base-Backbone interact. energy: 0.264 local terms energy: -252.107116 where: bonds (distance) C4'-P energy: -37.481 bonds (distance) P-C4' energy: -54.022 flat angles C4'-P-C4' energy: -59.352 flat angles P-C4'-P energy: -36.623 tors. eta vs tors. theta energy: -64.629 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -869.562158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.562158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.562158 (E_RNA) where: Base-Base interactions energy: -503.114 where: short stacking energy: -216.232 Base-Backbone interact. energy: -0.747 local terms energy: -239.701722 where: bonds (distance) C4'-P energy: -41.738 bonds (distance) P-C4' energy: -47.882 flat angles C4'-P-C4' energy: -53.322 flat angles P-C4'-P energy: -33.276 tors. eta vs tors. theta energy: -63.484 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -752.719113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.719113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.719113 (E_RNA) where: Base-Base interactions energy: -409.170 where: short stacking energy: -181.027 Base-Backbone interact. energy: -1.034 local terms energy: -216.514623 where: bonds (distance) C4'-P energy: -46.872 bonds (distance) P-C4' energy: -41.584 flat angles C4'-P-C4' energy: -50.659 flat angles P-C4'-P energy: -30.820 tors. eta vs tors. theta energy: -46.581 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -662.675379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.675379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.675379 (E_RNA) where: Base-Base interactions energy: -342.603 where: short stacking energy: -131.865 Base-Backbone interact. energy: -1.070 local terms energy: -202.002783 where: bonds (distance) C4'-P energy: -46.537 bonds (distance) P-C4' energy: -57.887 flat angles C4'-P-C4' energy: -46.754 flat angles P-C4'-P energy: -32.066 tors. eta vs tors. theta energy: -18.759 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -1078.433178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.433178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -948.833178 (E_RNA) where: Base-Base interactions energy: -641.486 where: short stacking energy: -282.571 Base-Backbone interact. energy: 0.177 local terms energy: -307.524683 where: bonds (distance) C4'-P energy: -49.837 bonds (distance) P-C4' energy: -62.218 flat angles C4'-P-C4' energy: -68.743 flat angles P-C4'-P energy: -47.100 tors. eta vs tors. theta energy: -79.626 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -1047.042891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.042891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -917.442891 (E_RNA) where: Base-Base interactions energy: -619.890 where: short stacking energy: -288.987 Base-Backbone interact. energy: -1.567 local terms energy: -295.985728 where: bonds (distance) C4'-P energy: -54.319 bonds (distance) P-C4' energy: -58.465 flat angles C4'-P-C4' energy: -61.109 flat angles P-C4'-P energy: -44.719 tors. eta vs tors. theta energy: -77.374 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -1016.003656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.003656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.403656 (E_RNA) where: Base-Base interactions energy: -609.554 where: short stacking energy: -251.961 Base-Backbone interact. energy: 6.657 local terms energy: -283.506658 where: bonds (distance) C4'-P energy: -49.314 bonds (distance) P-C4' energy: -48.010 flat angles C4'-P-C4' energy: -65.298 flat angles P-C4'-P energy: -43.485 tors. eta vs tors. theta energy: -77.399 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -941.775216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -941.775216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.775216 (E_RNA) where: Base-Base interactions energy: -542.467 where: short stacking energy: -245.349 Base-Backbone interact. energy: 0.028 local terms energy: -273.336689 where: bonds (distance) C4'-P energy: -52.634 bonds (distance) P-C4' energy: -57.531 flat angles C4'-P-C4' energy: -48.614 flat angles P-C4'-P energy: -43.565 tors. eta vs tors. theta energy: -70.993 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -917.972390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -917.972390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.172390 (E_RNA) where: Base-Base interactions energy: -496.170 where: short stacking energy: -222.019 Base-Backbone interact. energy: -1.724 local terms energy: -292.278984 where: bonds (distance) C4'-P energy: -52.551 bonds (distance) P-C4' energy: -57.903 flat angles C4'-P-C4' energy: -65.114 flat angles P-C4'-P energy: -50.302 tors. eta vs tors. theta energy: -66.410 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -871.496584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.496584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.896584 (E_RNA) where: Base-Base interactions energy: -469.563 where: short stacking energy: -228.807 Base-Backbone interact. energy: -0.267 local terms energy: -272.066339 where: bonds (distance) C4'-P energy: -42.536 bonds (distance) P-C4' energy: -48.912 flat angles C4'-P-C4' energy: -67.778 flat angles P-C4'-P energy: -40.427 tors. eta vs tors. theta energy: -72.414 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -874.452189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -874.452189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.452189 (E_RNA) where: Base-Base interactions energy: -499.373 where: short stacking energy: -215.924 Base-Backbone interact. energy: -0.845 local terms energy: -248.234374 where: bonds (distance) C4'-P energy: -40.924 bonds (distance) P-C4' energy: -52.513 flat angles C4'-P-C4' energy: -52.555 flat angles P-C4'-P energy: -30.540 tors. eta vs tors. theta energy: -71.702 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -764.386650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -764.386650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.386650 (E_RNA) where: Base-Base interactions energy: -436.927 where: short stacking energy: -183.479 Base-Backbone interact. energy: -0.477 local terms energy: -200.982785 where: bonds (distance) C4'-P energy: -48.878 bonds (distance) P-C4' energy: -47.337 flat angles C4'-P-C4' energy: -47.256 flat angles P-C4'-P energy: -14.118 tors. eta vs tors. theta energy: -43.394 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -727.685641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.685641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.085641 (E_RNA) where: Base-Base interactions energy: -368.439 where: short stacking energy: -154.667 Base-Backbone interact. energy: 0.049 local terms energy: -229.695868 where: bonds (distance) C4'-P energy: -57.221 bonds (distance) P-C4' energy: -51.691 flat angles C4'-P-C4' energy: -42.962 flat angles P-C4'-P energy: -37.178 tors. eta vs tors. theta energy: -40.644 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -703.884636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.884636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.284636 (E_RNA) where: Base-Base interactions energy: -375.322 where: short stacking energy: -154.626 Base-Backbone interact. energy: 2.457 local terms energy: -201.419783 where: bonds (distance) C4'-P energy: -42.893 bonds (distance) P-C4' energy: -52.604 flat angles C4'-P-C4' energy: -39.271 flat angles P-C4'-P energy: -30.199 tors. eta vs tors. theta energy: -36.453 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -1098.922859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1098.922859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -969.322859 (E_RNA) where: Base-Base interactions energy: -678.544 where: short stacking energy: -290.089 Base-Backbone interact. energy: -0.073 local terms energy: -290.704953 where: bonds (distance) C4'-P energy: -58.486 bonds (distance) P-C4' energy: -48.217 flat angles C4'-P-C4' energy: -62.177 flat angles P-C4'-P energy: -34.471 tors. eta vs tors. theta energy: -87.353 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -1043.396179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.396179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -915.596179 (E_RNA) where: Base-Base interactions energy: -616.776 where: short stacking energy: -268.520 Base-Backbone interact. energy: -0.918 local terms energy: -297.901580 where: bonds (distance) C4'-P energy: -50.565 bonds (distance) P-C4' energy: -62.068 flat angles C4'-P-C4' energy: -60.491 flat angles P-C4'-P energy: -45.196 tors. eta vs tors. theta energy: -79.582 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -1017.945265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1017.945265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -890.145265 (E_RNA) where: Base-Base interactions energy: -621.670 where: short stacking energy: -246.997 Base-Backbone interact. energy: -1.246 local terms energy: -267.229375 where: bonds (distance) C4'-P energy: -52.896 bonds (distance) P-C4' energy: -46.788 flat angles C4'-P-C4' energy: -59.759 flat angles P-C4'-P energy: -35.476 tors. eta vs tors. theta energy: -72.310 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -918.135824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -918.135824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.335824 (E_RNA) where: Base-Base interactions energy: -513.942 where: short stacking energy: -229.842 Base-Backbone interact. energy: -0.696 local terms energy: -275.698432 where: bonds (distance) C4'-P energy: -48.012 bonds (distance) P-C4' energy: -51.211 flat angles C4'-P-C4' energy: -63.770 flat angles P-C4'-P energy: -39.361 tors. eta vs tors. theta energy: -73.345 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -887.193914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.193914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.193914 (E_RNA) where: Base-Base interactions energy: -492.107 where: short stacking energy: -209.136 Base-Backbone interact. energy: -1.236 local terms energy: -267.851199 where: bonds (distance) C4'-P energy: -56.083 bonds (distance) P-C4' energy: -62.376 flat angles C4'-P-C4' energy: -57.196 flat angles P-C4'-P energy: -31.593 tors. eta vs tors. theta energy: -60.604 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -881.482322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -881.482322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.682322 (E_RNA) where: Base-Base interactions energy: -496.912 where: short stacking energy: -220.119 Base-Backbone interact. energy: -0.151 local terms energy: -256.620234 where: bonds (distance) C4'-P energy: -54.843 bonds (distance) P-C4' energy: -51.516 flat angles C4'-P-C4' energy: -48.751 flat angles P-C4'-P energy: -43.407 tors. eta vs tors. theta energy: -58.103 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -814.178580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.178580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.578580 (E_RNA) where: Base-Base interactions energy: -453.129 where: short stacking energy: -196.182 Base-Backbone interact. energy: -0.430 local terms energy: -231.019585 where: bonds (distance) C4'-P energy: -45.660 bonds (distance) P-C4' energy: -48.940 flat angles C4'-P-C4' energy: -54.476 flat angles P-C4'-P energy: -29.812 tors. eta vs tors. theta energy: -52.131 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -778.166241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.166241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.366241 (E_RNA) where: Base-Base interactions energy: -419.494 where: short stacking energy: -173.036 Base-Backbone interact. energy: -0.887 local terms energy: -229.984883 where: bonds (distance) C4'-P energy: -51.463 bonds (distance) P-C4' energy: -49.948 flat angles C4'-P-C4' energy: -58.302 flat angles P-C4'-P energy: -30.559 tors. eta vs tors. theta energy: -39.712 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -694.095087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.095087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.495087 (E_RNA) where: Base-Base interactions energy: -373.958 where: short stacking energy: -154.756 Base-Backbone interact. energy: -1.822 local terms energy: -188.714717 where: bonds (distance) C4'-P energy: -38.263 bonds (distance) P-C4' energy: -38.287 flat angles C4'-P-C4' energy: -50.862 flat angles P-C4'-P energy: -25.813 tors. eta vs tors. theta energy: -35.490 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -650.789529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.789529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.789529 (E_RNA) where: Base-Base interactions energy: -333.461 where: short stacking energy: -135.209 Base-Backbone interact. energy: 1.211 local terms energy: -192.540033 where: bonds (distance) C4'-P energy: -39.588 bonds (distance) P-C4' energy: -44.110 flat angles C4'-P-C4' energy: -41.856 flat angles P-C4'-P energy: -34.900 tors. eta vs tors. theta energy: -32.085 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -1109.208861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1109.208861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -981.408861 (E_RNA) where: Base-Base interactions energy: -674.391 where: short stacking energy: -288.082 Base-Backbone interact. energy: -0.668 local terms energy: -306.350336 where: bonds (distance) C4'-P energy: -58.000 bonds (distance) P-C4' energy: -58.653 flat angles C4'-P-C4' energy: -55.136 flat angles P-C4'-P energy: -44.532 tors. eta vs tors. theta energy: -90.028 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -1037.391964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.391964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.791964 (E_RNA) where: Base-Base interactions energy: -621.923 where: short stacking energy: -271.669 Base-Backbone interact. energy: -1.338 local terms energy: -284.530958 where: bonds (distance) C4'-P energy: -49.715 bonds (distance) P-C4' energy: -47.561 flat angles C4'-P-C4' energy: -64.540 flat angles P-C4'-P energy: -41.670 tors. eta vs tors. theta energy: -81.045 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -1010.901119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.901119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.701119 (E_RNA) where: Base-Base interactions energy: -613.281 where: short stacking energy: -242.976 Base-Backbone interact. energy: 2.784 local terms energy: -276.204322 where: bonds (distance) C4'-P energy: -49.841 bonds (distance) P-C4' energy: -53.101 flat angles C4'-P-C4' energy: -59.799 flat angles P-C4'-P energy: -42.016 tors. eta vs tors. theta energy: -71.447 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -964.710467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.710467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.910467 (E_RNA) where: Base-Base interactions energy: -551.013 where: short stacking energy: -246.056 Base-Backbone interact. energy: -0.947 local terms energy: -284.950151 where: bonds (distance) C4'-P energy: -61.208 bonds (distance) P-C4' energy: -49.655 flat angles C4'-P-C4' energy: -57.042 flat angles P-C4'-P energy: -42.963 tors. eta vs tors. theta energy: -74.081 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -880.774329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.774329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.974329 (E_RNA) where: Base-Base interactions energy: -500.046 where: short stacking energy: -220.946 Base-Backbone interact. energy: 0.243 local terms energy: -253.171427 where: bonds (distance) C4'-P energy: -50.289 bonds (distance) P-C4' energy: -54.563 flat angles C4'-P-C4' energy: -54.302 flat angles P-C4'-P energy: -33.432 tors. eta vs tors. theta energy: -60.585 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -881.875122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -881.875122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.275122 (E_RNA) where: Base-Base interactions energy: -500.332 where: short stacking energy: -226.691 Base-Backbone interact. energy: -0.984 local terms energy: -250.959913 where: bonds (distance) C4'-P energy: -48.156 bonds (distance) P-C4' energy: -48.277 flat angles C4'-P-C4' energy: -54.729 flat angles P-C4'-P energy: -32.657 tors. eta vs tors. theta energy: -67.140 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -840.997873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.997873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.797873 (E_RNA) where: Base-Base interactions energy: -463.106 where: short stacking energy: -214.269 Base-Backbone interact. energy: -0.606 local terms energy: -253.086431 where: bonds (distance) C4'-P energy: -51.962 bonds (distance) P-C4' energy: -56.459 flat angles C4'-P-C4' energy: -45.477 flat angles P-C4'-P energy: -33.448 tors. eta vs tors. theta energy: -65.740 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -766.898033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.898033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.898033 (E_RNA) where: Base-Base interactions energy: -431.108 where: short stacking energy: -174.386 Base-Backbone interact. energy: 0.967 local terms energy: -210.756511 where: bonds (distance) C4'-P energy: -41.200 bonds (distance) P-C4' energy: -41.873 flat angles C4'-P-C4' energy: -48.291 flat angles P-C4'-P energy: -30.423 tors. eta vs tors. theta energy: -48.969 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -769.180952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.180952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.580952 (E_RNA) where: Base-Base interactions energy: -427.805 where: short stacking energy: -173.185 Base-Backbone interact. energy: 1.442 local terms energy: -213.217710 where: bonds (distance) C4'-P energy: -48.855 bonds (distance) P-C4' energy: -46.715 flat angles C4'-P-C4' energy: -46.546 flat angles P-C4'-P energy: -32.835 tors. eta vs tors. theta energy: -38.267 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -673.665394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.665394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.265394 (E_RNA) where: Base-Base interactions energy: -355.490 where: short stacking energy: -150.818 Base-Backbone interact. energy: -1.371 local terms energy: -194.404740 where: bonds (distance) C4'-P energy: -41.290 bonds (distance) P-C4' energy: -41.335 flat angles C4'-P-C4' energy: -52.085 flat angles P-C4'-P energy: -29.410 tors. eta vs tors. theta energy: -30.284 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -1091.396390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.396390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.796390 (E_RNA) where: Base-Base interactions energy: -659.392 where: short stacking energy: -274.521 Base-Backbone interact. energy: -0.653 local terms energy: -301.751088 where: bonds (distance) C4'-P energy: -48.034 bonds (distance) P-C4' energy: -57.562 flat angles C4'-P-C4' energy: -65.008 flat angles P-C4'-P energy: -46.012 tors. eta vs tors. theta energy: -85.135 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -1030.315822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1030.315822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.715822 (E_RNA) where: Base-Base interactions energy: -602.374 where: short stacking energy: -273.820 Base-Backbone interact. energy: -0.624 local terms energy: -297.717844 where: bonds (distance) C4'-P energy: -59.109 bonds (distance) P-C4' energy: -52.550 flat angles C4'-P-C4' energy: -58.382 flat angles P-C4'-P energy: -43.871 tors. eta vs tors. theta energy: -83.807 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -1035.163922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.163922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.963922 (E_RNA) where: Base-Base interactions energy: -630.033 where: short stacking energy: -243.653 Base-Backbone interact. energy: 2.076 local terms energy: -283.006694 where: bonds (distance) C4'-P energy: -51.549 bonds (distance) P-C4' energy: -54.104 flat angles C4'-P-C4' energy: -63.808 flat angles P-C4'-P energy: -36.212 tors. eta vs tors. theta energy: -77.334 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -938.672680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -938.672680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -810.872680 (E_RNA) where: Base-Base interactions energy: -535.058 where: short stacking energy: -242.393 Base-Backbone interact. energy: -0.881 local terms energy: -274.933703 where: bonds (distance) C4'-P energy: -47.263 bonds (distance) P-C4' energy: -57.845 flat angles C4'-P-C4' energy: -54.213 flat angles P-C4'-P energy: -42.553 tors. eta vs tors. theta energy: -73.059 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -896.004190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.004190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.404190 (E_RNA) where: Base-Base interactions energy: -506.353 where: short stacking energy: -224.090 Base-Backbone interact. energy: 1.678 local terms energy: -261.728960 where: bonds (distance) C4'-P energy: -57.081 bonds (distance) P-C4' energy: -55.136 flat angles C4'-P-C4' energy: -51.074 flat angles P-C4'-P energy: -36.738 tors. eta vs tors. theta energy: -61.700 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -897.702153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.702153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.902153 (E_RNA) where: Base-Base interactions energy: -486.020 where: short stacking energy: -226.194 Base-Backbone interact. energy: -1.487 local terms energy: -282.394964 where: bonds (distance) C4'-P energy: -54.387 bonds (distance) P-C4' energy: -58.091 flat angles C4'-P-C4' energy: -52.772 flat angles P-C4'-P energy: -41.463 tors. eta vs tors. theta energy: -75.681 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -819.743239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.743239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.143239 (E_RNA) where: Base-Base interactions energy: -440.702 where: short stacking energy: -195.093 Base-Backbone interact. energy: 1.769 local terms energy: -251.209691 where: bonds (distance) C4'-P energy: -49.715 bonds (distance) P-C4' energy: -51.713 flat angles C4'-P-C4' energy: -51.501 flat angles P-C4'-P energy: -39.530 tors. eta vs tors. theta energy: -58.751 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -810.705059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.705059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.905059 (E_RNA) where: Base-Base interactions energy: -453.887 where: short stacking energy: -194.794 Base-Backbone interact. energy: -0.492 local terms energy: -228.525307 where: bonds (distance) C4'-P energy: -51.002 bonds (distance) P-C4' energy: -53.436 flat angles C4'-P-C4' energy: -44.958 flat angles P-C4'-P energy: -36.386 tors. eta vs tors. theta energy: -42.743 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -711.836944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.836944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.636944 (E_RNA) where: Base-Base interactions energy: -386.529 where: short stacking energy: -160.348 Base-Backbone interact. energy: -1.199 local terms energy: -199.908262 where: bonds (distance) C4'-P energy: -46.186 bonds (distance) P-C4' energy: -39.449 flat angles C4'-P-C4' energy: -51.725 flat angles P-C4'-P energy: -31.170 tors. eta vs tors. theta energy: -31.378 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -745.983979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.983979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.783979 (E_RNA) where: Base-Base interactions energy: -421.779 where: short stacking energy: -178.145 Base-Backbone interact. energy: -0.703 local terms energy: -208.301953 where: bonds (distance) C4'-P energy: -26.141 bonds (distance) P-C4' energy: -56.668 flat angles C4'-P-C4' energy: -51.699 flat angles P-C4'-P energy: -27.950 tors. eta vs tors. theta energy: -45.845 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 102 Temperature: 0.900000 Total energy: -1087.996113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.996113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.396113 (E_RNA) where: Base-Base interactions energy: -650.382 where: short stacking energy: -268.743 Base-Backbone interact. energy: -0.428 local terms energy: -307.586649 where: bonds (distance) C4'-P energy: -64.149 bonds (distance) P-C4' energy: -52.883 flat angles C4'-P-C4' energy: -62.729 flat angles P-C4'-P energy: -48.057 tors. eta vs tors. theta energy: -79.768 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 102 Temperature: 0.950000 Total energy: -1047.350590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.350590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -917.750590 (E_RNA) where: Base-Base interactions energy: -625.810 where: short stacking energy: -279.760 Base-Backbone interact. energy: 0.579 local terms energy: -292.519164 where: bonds (distance) C4'-P energy: -58.308 bonds (distance) P-C4' energy: -50.410 flat angles C4'-P-C4' energy: -57.244 flat angles P-C4'-P energy: -49.404 tors. eta vs tors. theta energy: -77.153 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 102 Temperature: 1.000000 Total energy: -1041.756345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.756345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.956345 (E_RNA) where: Base-Base interactions energy: -628.011 where: short stacking energy: -266.017 Base-Backbone interact. energy: -2.161 local terms energy: -283.784056 where: bonds (distance) C4'-P energy: -53.442 bonds (distance) P-C4' energy: -51.865 flat angles C4'-P-C4' energy: -58.794 flat angles P-C4'-P energy: -42.069 tors. eta vs tors. theta energy: -77.613 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 102 Temperature: 1.050000 Total energy: -917.561983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -917.561983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.761983 (E_RNA) where: Base-Base interactions energy: -518.340 where: short stacking energy: -223.576 Base-Backbone interact. energy: -1.710 local terms energy: -269.711808 where: bonds (distance) C4'-P energy: -48.851 bonds (distance) P-C4' energy: -53.034 flat angles C4'-P-C4' energy: -53.469 flat angles P-C4'-P energy: -37.232 tors. eta vs tors. theta energy: -77.126 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 102 Temperature: 1.100000 Total energy: -893.264589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.264589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.664589 (E_RNA) where: Base-Base interactions energy: -490.295 where: short stacking energy: -220.130 Base-Backbone interact. energy: 1.891 local terms energy: -275.260918 where: bonds (distance) C4'-P energy: -51.261 bonds (distance) P-C4' energy: -59.697 flat angles C4'-P-C4' energy: -55.718 flat angles P-C4'-P energy: -39.714 tors. eta vs tors. theta energy: -68.871 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 102 Temperature: 1.150000 Total energy: -887.112363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.112363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.512363 (E_RNA) where: Base-Base interactions energy: -511.022 where: short stacking energy: -245.653 Base-Backbone interact. energy: -0.090 local terms energy: -246.400329 where: bonds (distance) C4'-P energy: -44.582 bonds (distance) P-C4' energy: -42.558 flat angles C4'-P-C4' energy: -58.553 flat angles P-C4'-P energy: -30.070 tors. eta vs tors. theta energy: -70.637 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 102 Temperature: 1.200000 Total energy: -835.789847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.789847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.789847 (E_RNA) where: Base-Base interactions energy: -479.219 where: short stacking energy: -204.681 Base-Backbone interact. energy: 0.462 local terms energy: -231.032598 where: bonds (distance) C4'-P energy: -38.986 bonds (distance) P-C4' energy: -52.906 flat angles C4'-P-C4' energy: -56.964 flat angles P-C4'-P energy: -33.242 tors. eta vs tors. theta energy: -48.935 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 102 Temperature: 1.250000 Total energy: -805.654897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -805.654897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.054897 (E_RNA) where: Base-Base interactions energy: -448.825 where: short stacking energy: -190.221 Base-Backbone interact. energy: -0.677 local terms energy: -226.553199 where: bonds (distance) C4'-P energy: -47.430 bonds (distance) P-C4' energy: -40.287 flat angles C4'-P-C4' energy: -46.703 flat angles P-C4'-P energy: -38.448 tors. eta vs tors. theta energy: -53.685 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 102 Temperature: 1.300000 Total energy: -772.080859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.080859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.480859 (E_RNA) where: Base-Base interactions energy: -433.723 where: short stacking energy: -184.078 Base-Backbone interact. energy: -0.007 local terms energy: -208.750901 where: bonds (distance) C4'-P energy: -29.452 bonds (distance) P-C4' energy: -44.470 flat angles C4'-P-C4' energy: -53.283 flat angles P-C4'-P energy: -34.783 tors. eta vs tors. theta energy: -46.763 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 102 Temperature: 1.350000 Total energy: -678.487887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.487887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.487887 (E_RNA) where: Base-Base interactions energy: -349.386 where: short stacking energy: -137.281 Base-Backbone interact. energy: -1.052 local terms energy: -202.049940 where: bonds (distance) C4'-P energy: -52.164 bonds (distance) P-C4' energy: -46.972 flat angles C4'-P-C4' energy: -54.456 flat angles P-C4'-P energy: -25.705 tors. eta vs tors. theta energy: -22.752 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 103 Temperature: 0.900000 Total energy: -1090.759524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1090.759524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.159524 (E_RNA) where: Base-Base interactions energy: -656.005 where: short stacking energy: -276.126 Base-Backbone interact. energy: -0.512 local terms energy: -304.642406 where: bonds (distance) C4'-P energy: -57.593 bonds (distance) P-C4' energy: -61.131 flat angles C4'-P-C4' energy: -58.707 flat angles P-C4'-P energy: -46.591 tors. eta vs tors. theta energy: -80.620 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 103 Temperature: 0.950000 Total energy: -1066.675451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1066.675451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -938.875451 (E_RNA) where: Base-Base interactions energy: -627.158 where: short stacking energy: -271.864 Base-Backbone interact. energy: -0.542 local terms energy: -311.175118 where: bonds (distance) C4'-P energy: -54.042 bonds (distance) P-C4' energy: -57.744 flat angles C4'-P-C4' energy: -60.315 flat angles P-C4'-P energy: -49.179 tors. eta vs tors. theta energy: -89.894 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 103 Temperature: 1.000000 Total energy: -1038.384124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.384124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -908.784124 (E_RNA) where: Base-Base interactions energy: -627.878 where: short stacking energy: -235.585 Base-Backbone interact. energy: -1.769 local terms energy: -279.137992 where: bonds (distance) C4'-P energy: -44.735 bonds (distance) P-C4' energy: -63.203 flat angles C4'-P-C4' energy: -59.265 flat angles P-C4'-P energy: -38.895 tors. eta vs tors. theta energy: -73.040 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 103 Temperature: 1.050000 Total energy: -932.680311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -932.680311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -804.880311 (E_RNA) where: Base-Base interactions energy: -547.309 where: short stacking energy: -248.769 Base-Backbone interact. energy: -0.909 local terms energy: -256.662745 where: bonds (distance) C4'-P energy: -43.422 bonds (distance) P-C4' energy: -49.234 flat angles C4'-P-C4' energy: -59.586 flat angles P-C4'-P energy: -32.531 tors. eta vs tors. theta energy: -71.889 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 103 Temperature: 1.100000 Total energy: -893.281434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.281434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.481434 (E_RNA) where: Base-Base interactions energy: -504.074 where: short stacking energy: -238.452 Base-Backbone interact. energy: -0.789 local terms energy: -260.618212 where: bonds (distance) C4'-P energy: -43.246 bonds (distance) P-C4' energy: -48.091 flat angles C4'-P-C4' energy: -53.231 flat angles P-C4'-P energy: -46.355 tors. eta vs tors. theta energy: -69.694 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 103 Temperature: 1.150000 Total energy: -878.309002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.309002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.309002 (E_RNA) where: Base-Base interactions energy: -508.003 where: short stacking energy: -220.872 Base-Backbone interact. energy: 0.440 local terms energy: -244.745716 where: bonds (distance) C4'-P energy: -44.781 bonds (distance) P-C4' energy: -39.590 flat angles C4'-P-C4' energy: -63.614 flat angles P-C4'-P energy: -29.971 tors. eta vs tors. theta energy: -66.790 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 103 Temperature: 1.200000 Total energy: -826.207346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.207346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.207346 (E_RNA) where: Base-Base interactions energy: -457.261 where: short stacking energy: -203.425 Base-Backbone interact. energy: -0.629 local terms energy: -251.316612 where: bonds (distance) C4'-P energy: -52.008 bonds (distance) P-C4' energy: -50.323 flat angles C4'-P-C4' energy: -61.845 flat angles P-C4'-P energy: -30.419 tors. eta vs tors. theta energy: -56.721 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 103 Temperature: 1.250000 Total energy: -814.304055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.304055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.504055 (E_RNA) where: Base-Base interactions energy: -453.386 where: short stacking energy: -184.395 Base-Backbone interact. energy: 1.253 local terms energy: -234.371105 where: bonds (distance) C4'-P energy: -48.874 bonds (distance) P-C4' energy: -52.511 flat angles C4'-P-C4' energy: -54.333 flat angles P-C4'-P energy: -25.159 tors. eta vs tors. theta energy: -53.493 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 103 Temperature: 1.300000 Total energy: -734.143366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.143366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.543366 (E_RNA) where: Base-Base interactions energy: -392.553 where: short stacking energy: -169.386 Base-Backbone interact. energy: 0.617 local terms energy: -212.607195 where: bonds (distance) C4'-P energy: -50.189 bonds (distance) P-C4' energy: -39.083 flat angles C4'-P-C4' energy: -52.106 flat angles P-C4'-P energy: -29.134 tors. eta vs tors. theta energy: -42.095 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 103 Temperature: 1.350000 Total energy: -713.468023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.468023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.668023 (E_RNA) where: Base-Base interactions energy: -379.587 where: short stacking energy: -157.048 Base-Backbone interact. energy: -0.761 local terms energy: -205.319998 where: bonds (distance) C4'-P energy: -36.252 bonds (distance) P-C4' energy: -49.811 flat angles C4'-P-C4' energy: -52.876 flat angles P-C4'-P energy: -30.442 tors. eta vs tors. theta energy: -35.939 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 104 Temperature: 0.900000 Total energy: -1091.766140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.766140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.166140 (E_RNA) where: Base-Base interactions energy: -651.747 where: short stacking energy: -288.928 Base-Backbone interact. energy: -0.581 local terms energy: -309.838044 where: bonds (distance) C4'-P energy: -54.150 bonds (distance) P-C4' energy: -55.538 flat angles C4'-P-C4' energy: -64.685 flat angles P-C4'-P energy: -48.047 tors. eta vs tors. theta energy: -87.419 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 104 Temperature: 0.950000 Total energy: -1043.925922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.925922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -916.125922 (E_RNA) where: Base-Base interactions energy: -629.306 where: short stacking energy: -272.089 Base-Backbone interact. energy: 1.007 local terms energy: -287.827671 where: bonds (distance) C4'-P energy: -45.726 bonds (distance) P-C4' energy: -59.533 flat angles C4'-P-C4' energy: -61.641 flat angles P-C4'-P energy: -35.145 tors. eta vs tors. theta energy: -85.783 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 104 Temperature: 1.000000 Total energy: -1065.280284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1065.280284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.280284 (E_RNA) where: Base-Base interactions energy: -647.732 where: short stacking energy: -253.004 Base-Backbone interact. energy: 1.274 local terms energy: -292.822103 where: bonds (distance) C4'-P energy: -59.495 bonds (distance) P-C4' energy: -63.095 flat angles C4'-P-C4' energy: -64.344 flat angles P-C4'-P energy: -28.572 tors. eta vs tors. theta energy: -77.316 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 104 Temperature: 1.050000 Total energy: -939.206411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -939.206411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.606411 (E_RNA) where: Base-Base interactions energy: -537.403 where: short stacking energy: -250.089 Base-Backbone interact. energy: -0.907 local terms energy: -271.295869 where: bonds (distance) C4'-P energy: -47.105 bonds (distance) P-C4' energy: -49.334 flat angles C4'-P-C4' energy: -59.592 flat angles P-C4'-P energy: -39.727 tors. eta vs tors. theta energy: -75.536 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 104 Temperature: 1.100000 Total energy: -877.011618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.011618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.011618 (E_RNA) where: Base-Base interactions energy: -501.161 where: short stacking energy: -223.822 Base-Backbone interact. energy: 0.431 local terms energy: -250.282053 where: bonds (distance) C4'-P energy: -43.028 bonds (distance) P-C4' energy: -52.908 flat angles C4'-P-C4' energy: -58.540 flat angles P-C4'-P energy: -34.489 tors. eta vs tors. theta energy: -61.317 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 104 Temperature: 1.150000 Total energy: -870.095403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -870.095403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.095403 (E_RNA) where: Base-Base interactions energy: -494.437 where: short stacking energy: -224.536 Base-Backbone interact. energy: -0.425 local terms energy: -249.233030 where: bonds (distance) C4'-P energy: -42.074 bonds (distance) P-C4' energy: -46.900 flat angles C4'-P-C4' energy: -59.417 flat angles P-C4'-P energy: -39.868 tors. eta vs tors. theta energy: -60.974 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 104 Temperature: 1.200000 Total energy: -840.844770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.844770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.044770 (E_RNA) where: Base-Base interactions energy: -482.322 where: short stacking energy: -191.453 Base-Backbone interact. energy: -1.540 local terms energy: -229.182389 where: bonds (distance) C4'-P energy: -49.193 bonds (distance) P-C4' energy: -44.008 flat angles C4'-P-C4' energy: -50.982 flat angles P-C4'-P energy: -32.357 tors. eta vs tors. theta energy: -52.643 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 104 Temperature: 1.250000 Total energy: -786.357280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.357280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -660.357280 (E_RNA) where: Base-Base interactions energy: -438.824 where: short stacking energy: -186.498 Base-Backbone interact. energy: 1.019 local terms energy: -222.552603 where: bonds (distance) C4'-P energy: -49.261 bonds (distance) P-C4' energy: -36.767 flat angles C4'-P-C4' energy: -51.431 flat angles P-C4'-P energy: -36.584 tors. eta vs tors. theta energy: -48.509 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 104 Temperature: 1.300000 Total energy: -730.695714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.695714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.895714 (E_RNA) where: Base-Base interactions energy: -400.629 where: short stacking energy: -171.000 Base-Backbone interact. energy: -0.754 local terms energy: -201.512723 where: bonds (distance) C4'-P energy: -49.433 bonds (distance) P-C4' energy: -46.554 flat angles C4'-P-C4' energy: -37.266 flat angles P-C4'-P energy: -34.064 tors. eta vs tors. theta energy: -34.197 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 104 Temperature: 1.350000 Total energy: -676.367487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.367487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.367487 (E_RNA) where: Base-Base interactions energy: -380.277 where: short stacking energy: -157.571 Base-Backbone interact. energy: 1.866 local terms energy: -171.956006 where: bonds (distance) C4'-P energy: -36.752 bonds (distance) P-C4' energy: -35.283 flat angles C4'-P-C4' energy: -36.990 flat angles P-C4'-P energy: -25.528 tors. eta vs tors. theta energy: -37.403 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 105 Temperature: 0.900000 Total energy: -1086.212781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.212781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.412781 (E_RNA) where: Base-Base interactions energy: -647.055 where: short stacking energy: -271.895 Base-Backbone interact. energy: -1.193 local terms energy: -310.164912 where: bonds (distance) C4'-P energy: -67.328 bonds (distance) P-C4' energy: -51.214 flat angles C4'-P-C4' energy: -64.674 flat angles P-C4'-P energy: -46.458 tors. eta vs tors. theta energy: -80.491 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 105 Temperature: 0.950000 Total energy: -1058.478757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.478757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.878757 (E_RNA) where: Base-Base interactions energy: -632.922 where: short stacking energy: -283.035 Base-Backbone interact. energy: -0.188 local terms energy: -295.768427 where: bonds (distance) C4'-P energy: -46.083 bonds (distance) P-C4' energy: -60.511 flat angles C4'-P-C4' energy: -61.605 flat angles P-C4'-P energy: -42.724 tors. eta vs tors. theta energy: -84.845 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 105 Temperature: 1.000000 Total energy: -1035.230537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.230537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.630537 (E_RNA) where: Base-Base interactions energy: -628.741 where: short stacking energy: -246.660 Base-Backbone interact. energy: -1.357 local terms energy: -275.532376 where: bonds (distance) C4'-P energy: -51.353 bonds (distance) P-C4' energy: -43.819 flat angles C4'-P-C4' energy: -61.480 flat angles P-C4'-P energy: -40.958 tors. eta vs tors. theta energy: -77.923 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 105 Temperature: 1.050000 Total energy: -947.849597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -947.849597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.049597 (E_RNA) where: Base-Base interactions energy: -542.051 where: short stacking energy: -241.998 Base-Backbone interact. energy: -1.395 local terms energy: -276.603107 where: bonds (distance) C4'-P energy: -59.131 bonds (distance) P-C4' energy: -47.096 flat angles C4'-P-C4' energy: -56.836 flat angles P-C4'-P energy: -35.301 tors. eta vs tors. theta energy: -78.239 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 105 Temperature: 1.100000 Total energy: -879.088727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.088727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.088727 (E_RNA) where: Base-Base interactions energy: -482.319 where: short stacking energy: -220.769 Base-Backbone interact. energy: 1.177 local terms energy: -271.947497 where: bonds (distance) C4'-P energy: -51.640 bonds (distance) P-C4' energy: -55.158 flat angles C4'-P-C4' energy: -56.087 flat angles P-C4'-P energy: -41.068 tors. eta vs tors. theta energy: -67.995 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 105 Temperature: 1.150000 Total energy: -838.529657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.529657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.729657 (E_RNA) where: Base-Base interactions energy: -475.958 where: short stacking energy: -205.823 Base-Backbone interact. energy: -0.048 local terms energy: -243.724075 where: bonds (distance) C4'-P energy: -41.685 bonds (distance) P-C4' energy: -62.494 flat angles C4'-P-C4' energy: -43.582 flat angles P-C4'-P energy: -38.949 tors. eta vs tors. theta energy: -57.014 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 105 Temperature: 1.200000 Total energy: -860.940759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.940759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -733.140759 (E_RNA) where: Base-Base interactions energy: -471.089 where: short stacking energy: -209.913 Base-Backbone interact. energy: -0.692 local terms energy: -261.360437 where: bonds (distance) C4'-P energy: -50.836 bonds (distance) P-C4' energy: -50.146 flat angles C4'-P-C4' energy: -53.174 flat angles P-C4'-P energy: -41.170 tors. eta vs tors. theta energy: -66.035 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 105 Temperature: 1.250000 Total energy: -748.744800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.744800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.544800 (E_RNA) where: Base-Base interactions energy: -419.759 where: short stacking energy: -168.198 Base-Backbone interact. energy: 0.254 local terms energy: -205.040110 where: bonds (distance) C4'-P energy: -39.230 bonds (distance) P-C4' energy: -51.091 flat angles C4'-P-C4' energy: -44.217 flat angles P-C4'-P energy: -26.850 tors. eta vs tors. theta energy: -43.651 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 105 Temperature: 1.300000 Total energy: -776.238162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.238162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.638162 (E_RNA) where: Base-Base interactions energy: -414.429 where: short stacking energy: -185.501 Base-Backbone interact. energy: -1.224 local terms energy: -230.986014 where: bonds (distance) C4'-P energy: -47.810 bonds (distance) P-C4' energy: -41.604 flat angles C4'-P-C4' energy: -51.660 flat angles P-C4'-P energy: -35.673 tors. eta vs tors. theta energy: -54.239 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 105 Temperature: 1.350000 Total energy: -674.929146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.929146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.329146 (E_RNA) where: Base-Base interactions energy: -363.350 where: short stacking energy: -147.715 Base-Backbone interact. energy: 0.220 local terms energy: -182.198523 where: bonds (distance) C4'-P energy: -43.125 bonds (distance) P-C4' energy: -49.158 flat angles C4'-P-C4' energy: -42.524 flat angles P-C4'-P energy: -15.820 tors. eta vs tors. theta energy: -31.571 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 106 Temperature: 0.900000 Total energy: -1081.619914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1081.619914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.019914 (E_RNA) where: Base-Base interactions energy: -656.346 where: short stacking energy: -283.012 Base-Backbone interact. energy: -0.575 local terms energy: -295.098926 where: bonds (distance) C4'-P energy: -56.472 bonds (distance) P-C4' energy: -50.576 flat angles C4'-P-C4' energy: -61.118 flat angles P-C4'-P energy: -44.330 tors. eta vs tors. theta energy: -82.603 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 106 Temperature: 0.950000 Total energy: -1034.939611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1034.939611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.339611 (E_RNA) where: Base-Base interactions energy: -607.127 where: short stacking energy: -271.396 Base-Backbone interact. energy: 0.327 local terms energy: -298.539704 where: bonds (distance) C4'-P energy: -56.729 bonds (distance) P-C4' energy: -58.486 flat angles C4'-P-C4' energy: -60.644 flat angles P-C4'-P energy: -43.166 tors. eta vs tors. theta energy: -79.515 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 106 Temperature: 1.000000 Total energy: -1034.681650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1034.681650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -908.681650 (E_RNA) where: Base-Base interactions energy: -635.694 where: short stacking energy: -231.401 Base-Backbone interact. energy: -2.349 local terms energy: -270.638831 where: bonds (distance) C4'-P energy: -53.898 bonds (distance) P-C4' energy: -48.988 flat angles C4'-P-C4' energy: -63.768 flat angles P-C4'-P energy: -31.284 tors. eta vs tors. theta energy: -72.701 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 106 Temperature: 1.050000 Total energy: -932.422349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -932.422349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -804.622349 (E_RNA) where: Base-Base interactions energy: -527.562 where: short stacking energy: -220.209 Base-Backbone interact. energy: 2.882 local terms energy: -279.941604 where: bonds (distance) C4'-P energy: -52.865 bonds (distance) P-C4' energy: -55.672 flat angles C4'-P-C4' energy: -58.082 flat angles P-C4'-P energy: -42.936 tors. eta vs tors. theta energy: -70.386 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 106 Temperature: 1.100000 Total energy: -887.063677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.063677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.463677 (E_RNA) where: Base-Base interactions energy: -490.744 where: short stacking energy: -216.915 Base-Backbone interact. energy: -0.464 local terms energy: -266.255266 where: bonds (distance) C4'-P energy: -36.556 bonds (distance) P-C4' energy: -55.156 flat angles C4'-P-C4' energy: -58.325 flat angles P-C4'-P energy: -44.477 tors. eta vs tors. theta energy: -71.741 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 106 Temperature: 1.150000 Total energy: -872.852949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.852949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.052949 (E_RNA) where: Base-Base interactions energy: -485.359 where: short stacking energy: -214.631 Base-Backbone interact. energy: 0.344 local terms energy: -260.037581 where: bonds (distance) C4'-P energy: -58.358 bonds (distance) P-C4' energy: -50.757 flat angles C4'-P-C4' energy: -54.198 flat angles P-C4'-P energy: -34.132 tors. eta vs tors. theta energy: -62.593 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 106 Temperature: 1.200000 Total energy: -828.542518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -828.542518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.942518 (E_RNA) where: Base-Base interactions energy: -461.302 where: short stacking energy: -208.900 Base-Backbone interact. energy: 0.717 local terms energy: -238.358274 where: bonds (distance) C4'-P energy: -46.943 bonds (distance) P-C4' energy: -50.733 flat angles C4'-P-C4' energy: -53.328 flat angles P-C4'-P energy: -30.954 tors. eta vs tors. theta energy: -56.401 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 106 Temperature: 1.250000 Total energy: -736.714596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.714596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.914596 (E_RNA) where: Base-Base interactions energy: -408.619 where: short stacking energy: -162.979 Base-Backbone interact. energy: 0.004 local terms energy: -200.299866 where: bonds (distance) C4'-P energy: -44.643 bonds (distance) P-C4' energy: -45.997 flat angles C4'-P-C4' energy: -50.461 flat angles P-C4'-P energy: -24.641 tors. eta vs tors. theta energy: -34.557 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 106 Temperature: 1.300000 Total energy: -770.534528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.534528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.734528 (E_RNA) where: Base-Base interactions energy: -431.812 where: short stacking energy: -187.854 Base-Backbone interact. energy: 0.892 local terms energy: -211.814545 where: bonds (distance) C4'-P energy: -41.974 bonds (distance) P-C4' energy: -47.654 flat angles C4'-P-C4' energy: -43.211 flat angles P-C4'-P energy: -36.162 tors. eta vs tors. theta energy: -42.815 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 106 Temperature: 1.350000 Total energy: -666.948801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.948801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.348801 (E_RNA) where: Base-Base interactions energy: -355.907 where: short stacking energy: -152.667 Base-Backbone interact. energy: 6.432 local terms energy: -187.873412 where: bonds (distance) C4'-P energy: -37.015 bonds (distance) P-C4' energy: -48.835 flat angles C4'-P-C4' energy: -44.134 flat angles P-C4'-P energy: -26.395 tors. eta vs tors. theta energy: -31.494 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 107 Temperature: 0.900000 Total energy: -1092.469973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1092.469973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.869973 (E_RNA) where: Base-Base interactions energy: -658.323 where: short stacking energy: -272.422 Base-Backbone interact. energy: -2.108 local terms energy: -302.438005 where: bonds (distance) C4'-P energy: -61.939 bonds (distance) P-C4' energy: -53.456 flat angles C4'-P-C4' energy: -58.041 flat angles P-C4'-P energy: -47.142 tors. eta vs tors. theta energy: -81.860 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 107 Temperature: 0.950000 Total energy: -1062.728036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1062.728036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -934.928036 (E_RNA) where: Base-Base interactions energy: -664.616 where: short stacking energy: -251.789 Base-Backbone interact. energy: 0.820 local terms energy: -271.132846 where: bonds (distance) C4'-P energy: -53.769 bonds (distance) P-C4' energy: -45.516 flat angles C4'-P-C4' energy: -61.637 flat angles P-C4'-P energy: -38.634 tors. eta vs tors. theta energy: -71.576 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 107 Temperature: 1.000000 Total energy: -1026.011860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.011860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.811860 (E_RNA) where: Base-Base interactions energy: -610.788 where: short stacking energy: -262.403 Base-Backbone interact. energy: -0.430 local terms energy: -290.594167 where: bonds (distance) C4'-P energy: -55.305 bonds (distance) P-C4' energy: -49.612 flat angles C4'-P-C4' energy: -57.072 flat angles P-C4'-P energy: -44.938 tors. eta vs tors. theta energy: -83.667 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 107 Temperature: 1.050000 Total energy: -925.366272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -925.366272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -795.766272 (E_RNA) where: Base-Base interactions energy: -528.693 where: short stacking energy: -233.652 Base-Backbone interact. energy: -0.513 local terms energy: -266.560896 where: bonds (distance) C4'-P energy: -52.924 bonds (distance) P-C4' energy: -50.268 flat angles C4'-P-C4' energy: -54.839 flat angles P-C4'-P energy: -36.778 tors. eta vs tors. theta energy: -71.752 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 107 Temperature: 1.100000 Total energy: -884.934990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.934990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.734990 (E_RNA) where: Base-Base interactions energy: -486.152 where: short stacking energy: -213.092 Base-Backbone interact. energy: -0.490 local terms energy: -274.093271 where: bonds (distance) C4'-P energy: -50.700 bonds (distance) P-C4' energy: -59.026 flat angles C4'-P-C4' energy: -53.715 flat angles P-C4'-P energy: -41.825 tors. eta vs tors. theta energy: -68.826 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 107 Temperature: 1.150000 Total energy: -854.214990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -854.214990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.614990 (E_RNA) where: Base-Base interactions energy: -489.020 where: short stacking energy: -214.858 Base-Backbone interact. energy: 3.014 local terms energy: -238.609773 where: bonds (distance) C4'-P energy: -45.289 bonds (distance) P-C4' energy: -51.290 flat angles C4'-P-C4' energy: -53.606 flat angles P-C4'-P energy: -31.403 tors. eta vs tors. theta energy: -57.022 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 107 Temperature: 1.200000 Total energy: -831.623217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.623217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.023217 (E_RNA) where: Base-Base interactions energy: -458.457 where: short stacking energy: -202.517 Base-Backbone interact. energy: -0.983 local terms energy: -242.582905 where: bonds (distance) C4'-P energy: -47.389 bonds (distance) P-C4' energy: -59.228 flat angles C4'-P-C4' energy: -50.814 flat angles P-C4'-P energy: -33.693 tors. eta vs tors. theta energy: -51.460 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 107 Temperature: 1.250000 Total energy: -779.283974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.283974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.483974 (E_RNA) where: Base-Base interactions energy: -422.555 where: short stacking energy: -187.741 Base-Backbone interact. energy: -0.239 local terms energy: -228.689817 where: bonds (distance) C4'-P energy: -43.363 bonds (distance) P-C4' energy: -45.116 flat angles C4'-P-C4' energy: -55.161 flat angles P-C4'-P energy: -34.547 tors. eta vs tors. theta energy: -50.502 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 107 Temperature: 1.300000 Total energy: -778.922429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.922429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.922429 (E_RNA) where: Base-Base interactions energy: -428.542 where: short stacking energy: -171.317 Base-Backbone interact. energy: 0.226 local terms energy: -224.606593 where: bonds (distance) C4'-P energy: -40.975 bonds (distance) P-C4' energy: -56.726 flat angles C4'-P-C4' energy: -52.957 flat angles P-C4'-P energy: -33.466 tors. eta vs tors. theta energy: -40.482 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 107 Temperature: 1.350000 Total energy: -659.054738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.054738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.854738 (E_RNA) where: Base-Base interactions energy: -334.543 where: short stacking energy: -132.693 Base-Backbone interact. energy: 0.816 local terms energy: -201.127648 where: bonds (distance) C4'-P energy: -52.809 bonds (distance) P-C4' energy: -51.446 flat angles C4'-P-C4' energy: -47.133 flat angles P-C4'-P energy: -21.147 tors. eta vs tors. theta energy: -28.593 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 108 Temperature: 0.900000 Total energy: -1095.111023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.111023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -967.311023 (E_RNA) where: Base-Base interactions energy: -658.047 where: short stacking energy: -276.750 Base-Backbone interact. energy: -1.133 local terms energy: -308.131145 where: bonds (distance) C4'-P energy: -60.264 bonds (distance) P-C4' energy: -54.762 flat angles C4'-P-C4' energy: -62.263 flat angles P-C4'-P energy: -47.138 tors. eta vs tors. theta energy: -83.704 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 108 Temperature: 0.950000 Total energy: -1052.491040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.491040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.291040 (E_RNA) where: Base-Base interactions energy: -651.025 where: short stacking energy: -248.979 Base-Backbone interact. energy: 1.508 local terms energy: -278.773694 where: bonds (distance) C4'-P energy: -57.833 bonds (distance) P-C4' energy: -49.293 flat angles C4'-P-C4' energy: -60.806 flat angles P-C4'-P energy: -40.748 tors. eta vs tors. theta energy: -70.094 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 108 Temperature: 1.000000 Total energy: -1031.893532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.893532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.893532 (E_RNA) where: Base-Base interactions energy: -604.824 where: short stacking energy: -266.193 Base-Backbone interact. energy: -0.770 local terms energy: -300.299667 where: bonds (distance) C4'-P energy: -60.675 bonds (distance) P-C4' energy: -60.731 flat angles C4'-P-C4' energy: -61.035 flat angles P-C4'-P energy: -41.874 tors. eta vs tors. theta energy: -75.985 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 108 Temperature: 1.050000 Total energy: -950.735670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -950.735670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.535670 (E_RNA) where: Base-Base interactions energy: -553.818 where: short stacking energy: -265.789 Base-Backbone interact. energy: 1.035 local terms energy: -273.753337 where: bonds (distance) C4'-P energy: -42.651 bonds (distance) P-C4' energy: -57.161 flat angles C4'-P-C4' energy: -55.092 flat angles P-C4'-P energy: -36.304 tors. eta vs tors. theta energy: -82.544 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 108 Temperature: 1.100000 Total energy: -876.853404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -876.853404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.853404 (E_RNA) where: Base-Base interactions energy: -489.177 where: short stacking energy: -227.434 Base-Backbone interact. energy: -0.436 local terms energy: -261.240594 where: bonds (distance) C4'-P energy: -43.378 bonds (distance) P-C4' energy: -58.424 flat angles C4'-P-C4' energy: -58.039 flat angles P-C4'-P energy: -33.503 tors. eta vs tors. theta energy: -67.896 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 108 Temperature: 1.150000 Total energy: -864.296863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -864.296863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.496863 (E_RNA) where: Base-Base interactions energy: -476.441 where: short stacking energy: -210.404 Base-Backbone interact. energy: -0.500 local terms energy: -259.555291 where: bonds (distance) C4'-P energy: -46.346 bonds (distance) P-C4' energy: -54.627 flat angles C4'-P-C4' energy: -52.340 flat angles P-C4'-P energy: -37.310 tors. eta vs tors. theta energy: -68.933 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 108 Temperature: 1.200000 Total energy: -840.448419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.448419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.648419 (E_RNA) where: Base-Base interactions energy: -482.063 where: short stacking energy: -220.614 Base-Backbone interact. energy: -1.750 local terms energy: -228.835698 where: bonds (distance) C4'-P energy: -39.512 bonds (distance) P-C4' energy: -52.300 flat angles C4'-P-C4' energy: -54.934 flat angles P-C4'-P energy: -23.038 tors. eta vs tors. theta energy: -59.052 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 108 Temperature: 1.250000 Total energy: -829.632435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.632435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.032435 (E_RNA) where: Base-Base interactions energy: -457.549 where: short stacking energy: -196.224 Base-Backbone interact. energy: -0.729 local terms energy: -241.754677 where: bonds (distance) C4'-P energy: -53.553 bonds (distance) P-C4' energy: -45.827 flat angles C4'-P-C4' energy: -56.001 flat angles P-C4'-P energy: -40.906 tors. eta vs tors. theta energy: -45.467 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 108 Temperature: 1.300000 Total energy: -768.762752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.762752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.962752 (E_RNA) where: Base-Base interactions energy: -422.541 where: short stacking energy: -185.589 Base-Backbone interact. energy: 1.928 local terms energy: -220.349382 where: bonds (distance) C4'-P energy: -44.584 bonds (distance) P-C4' energy: -51.420 flat angles C4'-P-C4' energy: -43.664 flat angles P-C4'-P energy: -37.912 tors. eta vs tors. theta energy: -42.769 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 108 Temperature: 1.350000 Total energy: -670.395966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -670.395966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.395966 (E_RNA) where: Base-Base interactions energy: -359.724 where: short stacking energy: -147.657 Base-Backbone interact. energy: -0.523 local terms energy: -184.148074 where: bonds (distance) C4'-P energy: -27.680 bonds (distance) P-C4' energy: -45.739 flat angles C4'-P-C4' energy: -48.203 flat angles P-C4'-P energy: -33.568 tors. eta vs tors. theta energy: -28.958 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 109 Temperature: 0.900000 Total energy: -1094.455915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1094.455915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.655915 (E_RNA) where: Base-Base interactions energy: -664.373 where: short stacking energy: -277.495 Base-Backbone interact. energy: -1.362 local terms energy: -300.920592 where: bonds (distance) C4'-P energy: -56.215 bonds (distance) P-C4' energy: -56.366 flat angles C4'-P-C4' energy: -62.397 flat angles P-C4'-P energy: -38.398 tors. eta vs tors. theta energy: -87.545 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 109 Temperature: 0.950000 Total energy: -1049.092901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1049.092901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.492901 (E_RNA) where: Base-Base interactions energy: -631.384 where: short stacking energy: -258.834 Base-Backbone interact. energy: 0.767 local terms energy: -288.876073 where: bonds (distance) C4'-P energy: -53.108 bonds (distance) P-C4' energy: -62.052 flat angles C4'-P-C4' energy: -58.622 flat angles P-C4'-P energy: -38.988 tors. eta vs tors. theta energy: -76.107 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 109 Temperature: 1.000000 Total energy: -1051.041795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.041795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.241795 (E_RNA) where: Base-Base interactions energy: -633.948 where: short stacking energy: -268.661 Base-Backbone interact. energy: -0.246 local terms energy: -289.047526 where: bonds (distance) C4'-P energy: -48.519 bonds (distance) P-C4' energy: -49.063 flat angles C4'-P-C4' energy: -64.762 flat angles P-C4'-P energy: -47.033 tors. eta vs tors. theta energy: -79.671 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 109 Temperature: 1.050000 Total energy: -931.369226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -931.369226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -803.569226 (E_RNA) where: Base-Base interactions energy: -521.038 where: short stacking energy: -237.383 Base-Backbone interact. energy: -1.895 local terms energy: -280.636080 where: bonds (distance) C4'-P energy: -57.909 bonds (distance) P-C4' energy: -52.702 flat angles C4'-P-C4' energy: -58.169 flat angles P-C4'-P energy: -37.265 tors. eta vs tors. theta energy: -74.592 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 109 Temperature: 1.100000 Total energy: -873.636133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -873.636133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.636133 (E_RNA) where: Base-Base interactions energy: -484.309 where: short stacking energy: -201.534 Base-Backbone interact. energy: -1.041 local terms energy: -262.286625 where: bonds (distance) C4'-P energy: -50.189 bonds (distance) P-C4' energy: -53.952 flat angles C4'-P-C4' energy: -55.307 flat angles P-C4'-P energy: -43.876 tors. eta vs tors. theta energy: -58.962 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 109 Temperature: 1.150000 Total energy: -879.980424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.980424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.380424 (E_RNA) where: Base-Base interactions energy: -488.464 where: short stacking energy: -201.247 Base-Backbone interact. energy: -1.265 local terms energy: -260.651412 where: bonds (distance) C4'-P energy: -41.499 bonds (distance) P-C4' energy: -55.911 flat angles C4'-P-C4' energy: -62.065 flat angles P-C4'-P energy: -38.618 tors. eta vs tors. theta energy: -62.558 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 109 Temperature: 1.200000 Total energy: -836.624630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.624630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.024630 (E_RNA) where: Base-Base interactions energy: -468.913 where: short stacking energy: -190.271 Base-Backbone interact. energy: 2.098 local terms energy: -240.209594 where: bonds (distance) C4'-P energy: -49.006 bonds (distance) P-C4' energy: -49.015 flat angles C4'-P-C4' energy: -44.480 flat angles P-C4'-P energy: -40.818 tors. eta vs tors. theta energy: -56.890 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 109 Temperature: 1.250000 Total energy: -815.964607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.964607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.364607 (E_RNA) where: Base-Base interactions energy: -447.118 where: short stacking energy: -192.837 Base-Backbone interact. energy: 2.038 local terms energy: -241.284988 where: bonds (distance) C4'-P energy: -41.574 bonds (distance) P-C4' energy: -47.557 flat angles C4'-P-C4' energy: -58.167 flat angles P-C4'-P energy: -36.439 tors. eta vs tors. theta energy: -57.548 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 109 Temperature: 1.300000 Total energy: -808.026253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -808.026253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.426253 (E_RNA) where: Base-Base interactions energy: -451.609 where: short stacking energy: -205.055 Base-Backbone interact. energy: -1.227 local terms energy: -225.590485 where: bonds (distance) C4'-P energy: -34.450 bonds (distance) P-C4' energy: -41.270 flat angles C4'-P-C4' energy: -57.664 flat angles P-C4'-P energy: -31.453 tors. eta vs tors. theta energy: -60.753 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 109 Temperature: 1.350000 Total energy: -672.610546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.610546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.410546 (E_RNA) where: Base-Base interactions energy: -367.612 where: short stacking energy: -148.025 Base-Backbone interact. energy: -0.885 local terms energy: -179.913358 where: bonds (distance) C4'-P energy: -36.399 bonds (distance) P-C4' energy: -49.447 flat angles C4'-P-C4' energy: -41.355 flat angles P-C4'-P energy: -22.255 tors. eta vs tors. theta energy: -30.458 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 110 Temperature: 0.900000 Total energy: -1078.058031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.058031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -948.458031 (E_RNA) where: Base-Base interactions energy: -648.083 where: short stacking energy: -254.878 Base-Backbone interact. energy: -1.156 local terms energy: -299.219287 where: bonds (distance) C4'-P energy: -58.545 bonds (distance) P-C4' energy: -57.091 flat angles C4'-P-C4' energy: -61.615 flat angles P-C4'-P energy: -44.217 tors. eta vs tors. theta energy: -77.750 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 110 Temperature: 0.950000 Total energy: -1076.429325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.429325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -948.629325 (E_RNA) where: Base-Base interactions energy: -648.218 where: short stacking energy: -270.164 Base-Backbone interact. energy: -1.021 local terms energy: -299.390128 where: bonds (distance) C4'-P energy: -60.422 bonds (distance) P-C4' energy: -53.029 flat angles C4'-P-C4' energy: -60.783 flat angles P-C4'-P energy: -41.075 tors. eta vs tors. theta energy: -84.081 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 110 Temperature: 1.000000 Total energy: -995.514889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -995.514889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -865.914889 (E_RNA) where: Base-Base interactions energy: -577.927 where: short stacking energy: -264.535 Base-Backbone interact. energy: -1.326 local terms energy: -286.662390 where: bonds (distance) C4'-P energy: -43.342 bonds (distance) P-C4' energy: -69.920 flat angles C4'-P-C4' energy: -49.846 flat angles P-C4'-P energy: -43.937 tors. eta vs tors. theta energy: -79.618 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 110 Temperature: 1.050000 Total energy: -997.615286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.615286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.615286 (E_RNA) where: Base-Base interactions energy: -602.424 where: short stacking energy: -261.886 Base-Backbone interact. energy: -0.869 local terms energy: -268.322075 where: bonds (distance) C4'-P energy: -47.295 bonds (distance) P-C4' energy: -44.613 flat angles C4'-P-C4' energy: -57.302 flat angles P-C4'-P energy: -39.655 tors. eta vs tors. theta energy: -79.457 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 110 Temperature: 1.100000 Total energy: -887.012391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.012391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.012391 (E_RNA) where: Base-Base interactions energy: -507.246 where: short stacking energy: -231.060 Base-Backbone interact. energy: -1.005 local terms energy: -252.762099 where: bonds (distance) C4'-P energy: -46.838 bonds (distance) P-C4' energy: -41.705 flat angles C4'-P-C4' energy: -50.854 flat angles P-C4'-P energy: -41.546 tors. eta vs tors. theta energy: -71.818 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 110 Temperature: 1.150000 Total energy: -860.043630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.043630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.843630 (E_RNA) where: Base-Base interactions energy: -475.332 where: short stacking energy: -207.810 Base-Backbone interact. energy: -0.243 local terms energy: -260.268475 where: bonds (distance) C4'-P energy: -51.104 bonds (distance) P-C4' energy: -54.613 flat angles C4'-P-C4' energy: -50.557 flat angles P-C4'-P energy: -41.739 tors. eta vs tors. theta energy: -62.255 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 110 Temperature: 1.200000 Total energy: -839.772038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -839.772038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.372038 (E_RNA) where: Base-Base interactions energy: -472.384 where: short stacking energy: -208.750 Base-Backbone interact. energy: -0.243 local terms energy: -244.744869 where: bonds (distance) C4'-P energy: -53.187 bonds (distance) P-C4' energy: -48.753 flat angles C4'-P-C4' energy: -45.797 flat angles P-C4'-P energy: -39.977 tors. eta vs tors. theta energy: -57.031 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 110 Temperature: 1.250000 Total energy: -796.807457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -796.807457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.007457 (E_RNA) where: Base-Base interactions energy: -441.337 where: short stacking energy: -196.662 Base-Backbone interact. energy: -1.016 local terms energy: -226.654895 where: bonds (distance) C4'-P energy: -61.117 bonds (distance) P-C4' energy: -38.509 flat angles C4'-P-C4' energy: -45.263 flat angles P-C4'-P energy: -31.323 tors. eta vs tors. theta energy: -50.444 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 110 Temperature: 1.300000 Total energy: -825.731494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -825.731494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.731494 (E_RNA) where: Base-Base interactions energy: -458.831 where: short stacking energy: -203.332 Base-Backbone interact. energy: 0.372 local terms energy: -241.272227 where: bonds (distance) C4'-P energy: -44.111 bonds (distance) P-C4' energy: -50.119 flat angles C4'-P-C4' energy: -51.613 flat angles P-C4'-P energy: -37.575 tors. eta vs tors. theta energy: -57.855 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 110 Temperature: 1.350000 Total energy: -653.717092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.717092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.517092 (E_RNA) where: Base-Base interactions energy: -337.371 where: short stacking energy: -129.426 Base-Backbone interact. energy: 0.163 local terms energy: -192.309611 where: bonds (distance) C4'-P energy: -44.828 bonds (distance) P-C4' energy: -44.635 flat angles C4'-P-C4' energy: -47.265 flat angles P-C4'-P energy: -29.723 tors. eta vs tors. theta energy: -25.859 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 111 Temperature: 0.900000 Total energy: -1082.184172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1082.184172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.584172 (E_RNA) where: Base-Base interactions energy: -661.824 where: short stacking energy: -258.599 Base-Backbone interact. energy: -1.184 local terms energy: -289.576273 where: bonds (distance) C4'-P energy: -61.417 bonds (distance) P-C4' energy: -47.370 flat angles C4'-P-C4' energy: -56.027 flat angles P-C4'-P energy: -43.376 tors. eta vs tors. theta energy: -81.386 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 111 Temperature: 0.950000 Total energy: -1079.053118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1079.053118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.053118 (E_RNA) where: Base-Base interactions energy: -648.588 where: short stacking energy: -288.465 Base-Backbone interact. energy: -0.643 local terms energy: -303.821443 where: bonds (distance) C4'-P energy: -45.067 bonds (distance) P-C4' energy: -59.980 flat angles C4'-P-C4' energy: -73.282 flat angles P-C4'-P energy: -37.564 tors. eta vs tors. theta energy: -87.929 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 111 Temperature: 1.000000 Total energy: -990.669875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -990.669875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.469875 (E_RNA) where: Base-Base interactions energy: -581.971 where: short stacking energy: -253.136 Base-Backbone interact. energy: -0.030 local terms energy: -284.469163 where: bonds (distance) C4'-P energy: -54.101 bonds (distance) P-C4' energy: -60.098 flat angles C4'-P-C4' energy: -51.387 flat angles P-C4'-P energy: -38.806 tors. eta vs tors. theta energy: -80.077 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 111 Temperature: 1.050000 Total energy: -1016.009014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.009014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.409014 (E_RNA) where: Base-Base interactions energy: -594.220 where: short stacking energy: -271.929 Base-Backbone interact. energy: -1.384 local terms energy: -290.805565 where: bonds (distance) C4'-P energy: -48.765 bonds (distance) P-C4' energy: -51.274 flat angles C4'-P-C4' energy: -61.074 flat angles P-C4'-P energy: -47.654 tors. eta vs tors. theta energy: -82.038 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 111 Temperature: 1.100000 Total energy: -885.898458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -885.898458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.898458 (E_RNA) where: Base-Base interactions energy: -498.190 where: short stacking energy: -218.756 Base-Backbone interact. energy: -0.611 local terms energy: -261.097354 where: bonds (distance) C4'-P energy: -58.525 bonds (distance) P-C4' energy: -46.997 flat angles C4'-P-C4' energy: -55.496 flat angles P-C4'-P energy: -37.081 tors. eta vs tors. theta energy: -62.998 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 111 Temperature: 1.150000 Total energy: -888.586124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -888.586124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.786124 (E_RNA) where: Base-Base interactions energy: -490.418 where: short stacking energy: -216.316 Base-Backbone interact. energy: -0.564 local terms energy: -269.804503 where: bonds (distance) C4'-P energy: -47.253 bonds (distance) P-C4' energy: -54.657 flat angles C4'-P-C4' energy: -58.489 flat angles P-C4'-P energy: -40.940 tors. eta vs tors. theta energy: -68.465 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 111 Temperature: 1.200000 Total energy: -819.474116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.474116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.474116 (E_RNA) where: Base-Base interactions energy: -454.897 where: short stacking energy: -195.221 Base-Backbone interact. energy: 0.474 local terms energy: -239.050387 where: bonds (distance) C4'-P energy: -48.391 bonds (distance) P-C4' energy: -56.750 flat angles C4'-P-C4' energy: -49.099 flat angles P-C4'-P energy: -37.488 tors. eta vs tors. theta energy: -47.323 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 111 Temperature: 1.250000 Total energy: -835.344318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.344318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.344318 (E_RNA) where: Base-Base interactions energy: -477.501 where: short stacking energy: -200.012 Base-Backbone interact. energy: -0.495 local terms energy: -231.348939 where: bonds (distance) C4'-P energy: -41.545 bonds (distance) P-C4' energy: -46.512 flat angles C4'-P-C4' energy: -49.210 flat angles P-C4'-P energy: -33.181 tors. eta vs tors. theta energy: -60.901 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 111 Temperature: 1.300000 Total energy: -751.321366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.321366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.521366 (E_RNA) where: Base-Base interactions energy: -429.819 where: short stacking energy: -183.072 Base-Backbone interact. energy: -0.617 local terms energy: -202.085416 where: bonds (distance) C4'-P energy: -38.310 bonds (distance) P-C4' energy: -53.640 flat angles C4'-P-C4' energy: -55.232 flat angles P-C4'-P energy: -19.193 tors. eta vs tors. theta energy: -35.711 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 111 Temperature: 1.350000 Total energy: -693.020324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.020324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.020324 (E_RNA) where: Base-Base interactions energy: -368.457 where: short stacking energy: -144.837 Base-Backbone interact. energy: 2.485 local terms energy: -210.048335 where: bonds (distance) C4'-P energy: -44.450 bonds (distance) P-C4' energy: -52.323 flat angles C4'-P-C4' energy: -47.036 flat angles P-C4'-P energy: -25.653 tors. eta vs tors. theta energy: -40.587 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 112 Temperature: 0.900000 Total energy: -1102.589920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.589920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.989920 (E_RNA) where: Base-Base interactions energy: -666.743 where: short stacking energy: -278.342 Base-Backbone interact. energy: -0.518 local terms energy: -305.728957 where: bonds (distance) C4'-P energy: -56.686 bonds (distance) P-C4' energy: -55.639 flat angles C4'-P-C4' energy: -62.904 flat angles P-C4'-P energy: -50.463 tors. eta vs tors. theta energy: -80.038 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 112 Temperature: 0.950000 Total energy: -1055.634598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.634598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.834598 (E_RNA) where: Base-Base interactions energy: -637.523 where: short stacking energy: -240.217 Base-Backbone interact. energy: -0.198 local terms energy: -290.113801 where: bonds (distance) C4'-P energy: -53.752 bonds (distance) P-C4' energy: -57.099 flat angles C4'-P-C4' energy: -66.257 flat angles P-C4'-P energy: -39.723 tors. eta vs tors. theta energy: -73.282 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 112 Temperature: 1.000000 Total energy: -1015.549903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1015.549903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.749903 (E_RNA) where: Base-Base interactions energy: -600.190 where: short stacking energy: -253.733 Base-Backbone interact. energy: 0.301 local terms energy: -287.860832 where: bonds (distance) C4'-P energy: -46.634 bonds (distance) P-C4' energy: -54.263 flat angles C4'-P-C4' energy: -66.333 flat angles P-C4'-P energy: -39.564 tors. eta vs tors. theta energy: -81.067 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 112 Temperature: 1.050000 Total energy: -975.973205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.973205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.973205 (E_RNA) where: Base-Base interactions energy: -568.222 where: short stacking energy: -246.657 Base-Backbone interact. energy: -0.773 local terms energy: -280.978075 where: bonds (distance) C4'-P energy: -47.120 bonds (distance) P-C4' energy: -60.850 flat angles C4'-P-C4' energy: -62.689 flat angles P-C4'-P energy: -29.158 tors. eta vs tors. theta energy: -81.161 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 112 Temperature: 1.100000 Total energy: -912.481814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -912.481814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.881814 (E_RNA) where: Base-Base interactions energy: -509.489 where: short stacking energy: -227.584 Base-Backbone interact. energy: -0.263 local terms energy: -273.129397 where: bonds (distance) C4'-P energy: -55.039 bonds (distance) P-C4' energy: -51.752 flat angles C4'-P-C4' energy: -58.433 flat angles P-C4'-P energy: -36.155 tors. eta vs tors. theta energy: -71.751 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 112 Temperature: 1.150000 Total energy: -884.148375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.148375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.548375 (E_RNA) where: Base-Base interactions energy: -490.329 where: short stacking energy: -223.947 Base-Backbone interact. energy: -0.936 local terms energy: -263.283810 where: bonds (distance) C4'-P energy: -57.313 bonds (distance) P-C4' energy: -50.418 flat angles C4'-P-C4' energy: -54.842 flat angles P-C4'-P energy: -34.013 tors. eta vs tors. theta energy: -66.698 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 112 Temperature: 1.200000 Total energy: -822.389910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.389910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.989910 (E_RNA) where: Base-Base interactions energy: -462.828 where: short stacking energy: -214.403 Base-Backbone interact. energy: -0.602 local terms energy: -236.559992 where: bonds (distance) C4'-P energy: -50.075 bonds (distance) P-C4' energy: -40.793 flat angles C4'-P-C4' energy: -45.673 flat angles P-C4'-P energy: -38.687 tors. eta vs tors. theta energy: -61.331 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 112 Temperature: 1.250000 Total energy: -799.172076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.172076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.372076 (E_RNA) where: Base-Base interactions energy: -431.794 where: short stacking energy: -209.154 Base-Backbone interact. energy: -0.246 local terms energy: -248.331974 where: bonds (distance) C4'-P energy: -52.095 bonds (distance) P-C4' energy: -53.588 flat angles C4'-P-C4' energy: -48.789 flat angles P-C4'-P energy: -34.784 tors. eta vs tors. theta energy: -59.077 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 112 Temperature: 1.300000 Total energy: -768.201191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.201191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.801191 (E_RNA) where: Base-Base interactions energy: -424.989 where: short stacking energy: -192.934 Base-Backbone interact. energy: 1.196 local terms energy: -222.008486 where: bonds (distance) C4'-P energy: -40.687 bonds (distance) P-C4' energy: -45.726 flat angles C4'-P-C4' energy: -55.203 flat angles P-C4'-P energy: -30.233 tors. eta vs tors. theta energy: -50.160 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 112 Temperature: 1.350000 Total energy: -721.988506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.988506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.788506 (E_RNA) where: Base-Base interactions energy: -399.045 where: short stacking energy: -177.889 Base-Backbone interact. energy: 2.530 local terms energy: -201.273695 where: bonds (distance) C4'-P energy: -38.677 bonds (distance) P-C4' energy: -51.219 flat angles C4'-P-C4' energy: -43.154 flat angles P-C4'-P energy: -26.479 tors. eta vs tors. theta energy: -41.745 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 113 Temperature: 0.900000 Total energy: -1100.177335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1100.177335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.377335 (E_RNA) where: Base-Base interactions energy: -668.104 where: short stacking energy: -275.381 Base-Backbone interact. energy: -0.697 local terms energy: -303.576004 where: bonds (distance) C4'-P energy: -45.417 bonds (distance) P-C4' energy: -59.959 flat angles C4'-P-C4' energy: -65.957 flat angles P-C4'-P energy: -42.945 tors. eta vs tors. theta energy: -89.297 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 113 Temperature: 0.950000 Total energy: -1040.554463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.554463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.954463 (E_RNA) where: Base-Base interactions energy: -629.019 where: short stacking energy: -250.807 Base-Backbone interact. energy: -1.172 local terms energy: -280.762958 where: bonds (distance) C4'-P energy: -55.573 bonds (distance) P-C4' energy: -58.024 flat angles C4'-P-C4' energy: -51.076 flat angles P-C4'-P energy: -42.265 tors. eta vs tors. theta energy: -73.825 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 113 Temperature: 1.000000 Total energy: -1012.662794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1012.662794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -884.862794 (E_RNA) where: Base-Base interactions energy: -575.097 where: short stacking energy: -258.377 Base-Backbone interact. energy: 0.412 local terms energy: -310.177841 where: bonds (distance) C4'-P energy: -61.055 bonds (distance) P-C4' energy: -57.683 flat angles C4'-P-C4' energy: -61.699 flat angles P-C4'-P energy: -43.821 tors. eta vs tors. theta energy: -85.921 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 113 Temperature: 1.050000 Total energy: -949.318844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -949.318844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -821.518844 (E_RNA) where: Base-Base interactions energy: -557.765 where: short stacking energy: -243.859 Base-Backbone interact. energy: -1.096 local terms energy: -262.657916 where: bonds (distance) C4'-P energy: -46.869 bonds (distance) P-C4' energy: -47.083 flat angles C4'-P-C4' energy: -55.201 flat angles P-C4'-P energy: -45.926 tors. eta vs tors. theta energy: -67.579 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 113 Temperature: 1.100000 Total energy: -918.345311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -918.345311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.545311 (E_RNA) where: Base-Base interactions energy: -530.025 where: short stacking energy: -253.901 Base-Backbone interact. energy: -0.209 local terms energy: -260.311602 where: bonds (distance) C4'-P energy: -40.779 bonds (distance) P-C4' energy: -45.774 flat angles C4'-P-C4' energy: -56.468 flat angles P-C4'-P energy: -41.338 tors. eta vs tors. theta energy: -75.953 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 113 Temperature: 1.150000 Total energy: -894.024486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.024486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.824486 (E_RNA) where: Base-Base interactions energy: -515.863 where: short stacking energy: -212.193 Base-Backbone interact. energy: -3.116 local terms energy: -250.845768 where: bonds (distance) C4'-P energy: -49.153 bonds (distance) P-C4' energy: -44.625 flat angles C4'-P-C4' energy: -64.266 flat angles P-C4'-P energy: -37.279 tors. eta vs tors. theta energy: -55.523 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 113 Temperature: 1.200000 Total energy: -825.089901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -825.089901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.689901 (E_RNA) where: Base-Base interactions energy: -475.243 where: short stacking energy: -218.831 Base-Backbone interact. energy: -0.316 local terms energy: -227.131012 where: bonds (distance) C4'-P energy: -43.905 bonds (distance) P-C4' energy: -40.193 flat angles C4'-P-C4' energy: -45.101 flat angles P-C4'-P energy: -37.897 tors. eta vs tors. theta energy: -60.036 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 113 Temperature: 1.250000 Total energy: -819.357958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.357958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.357958 (E_RNA) where: Base-Base interactions energy: -445.222 where: short stacking energy: -202.359 Base-Backbone interact. energy: 0.408 local terms energy: -248.543955 where: bonds (distance) C4'-P energy: -52.021 bonds (distance) P-C4' energy: -37.747 flat angles C4'-P-C4' energy: -56.544 flat angles P-C4'-P energy: -45.052 tors. eta vs tors. theta energy: -57.180 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 113 Temperature: 1.300000 Total energy: -781.961293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.961293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.961293 (E_RNA) where: Base-Base interactions energy: -450.302 where: short stacking energy: -186.356 Base-Backbone interact. energy: 1.261 local terms energy: -215.919865 where: bonds (distance) C4'-P energy: -47.030 bonds (distance) P-C4' energy: -46.935 flat angles C4'-P-C4' energy: -39.998 flat angles P-C4'-P energy: -38.333 tors. eta vs tors. theta energy: -43.624 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 113 Temperature: 1.350000 Total energy: -680.749520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.749520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.349520 (E_RNA) where: Base-Base interactions energy: -358.983 where: short stacking energy: -138.875 Base-Backbone interact. energy: -0.474 local terms energy: -198.892573 where: bonds (distance) C4'-P energy: -48.441 bonds (distance) P-C4' energy: -43.912 flat angles C4'-P-C4' energy: -52.382 flat angles P-C4'-P energy: -29.034 tors. eta vs tors. theta energy: -25.123 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 114 Temperature: 0.900000 Total energy: -1089.675573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.675573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.075573 (E_RNA) where: Base-Base interactions energy: -656.055 where: short stacking energy: -288.573 Base-Backbone interact. energy: -1.442 local terms energy: -302.579302 where: bonds (distance) C4'-P energy: -46.713 bonds (distance) P-C4' energy: -59.513 flat angles C4'-P-C4' energy: -65.267 flat angles P-C4'-P energy: -40.430 tors. eta vs tors. theta energy: -90.657 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 114 Temperature: 0.950000 Total energy: -1036.994343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1036.994343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.394343 (E_RNA) where: Base-Base interactions energy: -624.258 where: short stacking energy: -244.897 Base-Backbone interact. energy: -0.926 local terms energy: -282.210005 where: bonds (distance) C4'-P energy: -54.644 bonds (distance) P-C4' energy: -58.757 flat angles C4'-P-C4' energy: -61.362 flat angles P-C4'-P energy: -35.960 tors. eta vs tors. theta energy: -71.487 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 114 Temperature: 1.000000 Total energy: -1025.079967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.079967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.279967 (E_RNA) where: Base-Base interactions energy: -601.417 where: short stacking energy: -249.791 Base-Backbone interact. energy: -0.653 local terms energy: -295.209616 where: bonds (distance) C4'-P energy: -58.250 bonds (distance) P-C4' energy: -46.540 flat angles C4'-P-C4' energy: -61.228 flat angles P-C4'-P energy: -45.931 tors. eta vs tors. theta energy: -83.261 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 114 Temperature: 1.050000 Total energy: -964.220282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.220282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.420282 (E_RNA) where: Base-Base interactions energy: -559.846 where: short stacking energy: -249.037 Base-Backbone interact. energy: -0.401 local terms energy: -276.174014 where: bonds (distance) C4'-P energy: -57.805 bonds (distance) P-C4' energy: -51.368 flat angles C4'-P-C4' energy: -61.085 flat angles P-C4'-P energy: -33.914 tors. eta vs tors. theta energy: -72.003 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 114 Temperature: 1.100000 Total energy: -915.046821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -915.046821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.046821 (E_RNA) where: Base-Base interactions energy: -513.279 where: short stacking energy: -226.276 Base-Backbone interact. energy: -0.233 local terms energy: -275.534827 where: bonds (distance) C4'-P energy: -53.550 bonds (distance) P-C4' energy: -50.620 flat angles C4'-P-C4' energy: -58.207 flat angles P-C4'-P energy: -39.887 tors. eta vs tors. theta energy: -73.270 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 114 Temperature: 1.150000 Total energy: -878.182833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.182833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.382833 (E_RNA) where: Base-Base interactions energy: -499.278 where: short stacking energy: -227.344 Base-Backbone interact. energy: -1.133 local terms energy: -249.971523 where: bonds (distance) C4'-P energy: -54.300 bonds (distance) P-C4' energy: -58.549 flat angles C4'-P-C4' energy: -43.348 flat angles P-C4'-P energy: -27.384 tors. eta vs tors. theta energy: -66.391 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 114 Temperature: 1.200000 Total energy: -799.627729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.627729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.427729 (E_RNA) where: Base-Base interactions energy: -445.625 where: short stacking energy: -210.336 Base-Backbone interact. energy: -0.035 local terms energy: -229.768194 where: bonds (distance) C4'-P energy: -43.670 bonds (distance) P-C4' energy: -38.144 flat angles C4'-P-C4' energy: -58.667 flat angles P-C4'-P energy: -38.016 tors. eta vs tors. theta energy: -51.271 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 114 Temperature: 1.250000 Total energy: -817.899867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -817.899867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.099867 (E_RNA) where: Base-Base interactions energy: -452.721 where: short stacking energy: -186.371 Base-Backbone interact. energy: -0.029 local terms energy: -237.349985 where: bonds (distance) C4'-P energy: -51.384 bonds (distance) P-C4' energy: -51.044 flat angles C4'-P-C4' energy: -47.212 flat angles P-C4'-P energy: -37.693 tors. eta vs tors. theta energy: -50.017 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 114 Temperature: 1.300000 Total energy: -759.947585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.947585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.547585 (E_RNA) where: Base-Base interactions energy: -411.200 where: short stacking energy: -176.628 Base-Backbone interact. energy: 0.116 local terms energy: -226.463373 where: bonds (distance) C4'-P energy: -53.043 bonds (distance) P-C4' energy: -48.646 flat angles C4'-P-C4' energy: -53.238 flat angles P-C4'-P energy: -24.931 tors. eta vs tors. theta energy: -46.604 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 114 Temperature: 1.350000 Total energy: -659.648279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.648279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.848279 (E_RNA) where: Base-Base interactions energy: -350.845 where: short stacking energy: -134.385 Base-Backbone interact. energy: -1.079 local terms energy: -188.923924 where: bonds (distance) C4'-P energy: -48.188 bonds (distance) P-C4' energy: -30.376 flat angles C4'-P-C4' energy: -49.574 flat angles P-C4'-P energy: -32.501 tors. eta vs tors. theta energy: -28.284 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 115 Temperature: 0.900000 Total energy: -1080.260245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1080.260245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -950.660245 (E_RNA) where: Base-Base interactions energy: -647.744 where: short stacking energy: -279.976 Base-Backbone interact. energy: -0.513 local terms energy: -302.402957 where: bonds (distance) C4'-P energy: -57.093 bonds (distance) P-C4' energy: -53.042 flat angles C4'-P-C4' energy: -63.668 flat angles P-C4'-P energy: -46.114 tors. eta vs tors. theta energy: -82.486 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 115 Temperature: 0.950000 Total energy: -1035.709640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.709640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -909.709640 (E_RNA) where: Base-Base interactions energy: -625.962 where: short stacking energy: -257.748 Base-Backbone interact. energy: -0.778 local terms energy: -282.969551 where: bonds (distance) C4'-P energy: -61.861 bonds (distance) P-C4' energy: -50.851 flat angles C4'-P-C4' energy: -58.789 flat angles P-C4'-P energy: -39.412 tors. eta vs tors. theta energy: -72.057 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 115 Temperature: 1.000000 Total energy: -1026.768543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.768543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.768543 (E_RNA) where: Base-Base interactions energy: -608.782 where: short stacking energy: -267.950 Base-Backbone interact. energy: -0.831 local terms energy: -291.156442 where: bonds (distance) C4'-P energy: -56.170 bonds (distance) P-C4' energy: -50.576 flat angles C4'-P-C4' energy: -63.988 flat angles P-C4'-P energy: -42.836 tors. eta vs tors. theta energy: -77.587 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 115 Temperature: 1.050000 Total energy: -966.050803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.050803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -840.050803 (E_RNA) where: Base-Base interactions energy: -556.271 where: short stacking energy: -261.932 Base-Backbone interact. energy: -1.512 local terms energy: -282.268486 where: bonds (distance) C4'-P energy: -49.678 bonds (distance) P-C4' energy: -57.836 flat angles C4'-P-C4' energy: -62.565 flat angles P-C4'-P energy: -36.771 tors. eta vs tors. theta energy: -75.418 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 115 Temperature: 1.100000 Total energy: -870.375164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -870.375164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.375164 (E_RNA) where: Base-Base interactions energy: -489.130 where: short stacking energy: -209.045 Base-Backbone interact. energy: -1.082 local terms energy: -254.162652 where: bonds (distance) C4'-P energy: -50.462 bonds (distance) P-C4' energy: -50.337 flat angles C4'-P-C4' energy: -58.506 flat angles P-C4'-P energy: -38.721 tors. eta vs tors. theta energy: -56.137 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 115 Temperature: 1.150000 Total energy: -871.471435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.471435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.871435 (E_RNA) where: Base-Base interactions energy: -487.599 where: short stacking energy: -219.118 Base-Backbone interact. energy: -0.415 local terms energy: -253.856785 where: bonds (distance) C4'-P energy: -38.049 bonds (distance) P-C4' energy: -56.266 flat angles C4'-P-C4' energy: -61.871 flat angles P-C4'-P energy: -37.874 tors. eta vs tors. theta energy: -59.796 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 115 Temperature: 1.200000 Total energy: -829.427801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.427801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.627801 (E_RNA) where: Base-Base interactions energy: -453.731 where: short stacking energy: -195.061 Base-Backbone interact. energy: 1.352 local terms energy: -249.248709 where: bonds (distance) C4'-P energy: -48.753 bonds (distance) P-C4' energy: -45.483 flat angles C4'-P-C4' energy: -49.708 flat angles P-C4'-P energy: -45.258 tors. eta vs tors. theta energy: -60.046 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 115 Temperature: 1.250000 Total energy: -813.521848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.521848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.721848 (E_RNA) where: Base-Base interactions energy: -463.637 where: short stacking energy: -193.299 Base-Backbone interact. energy: 0.602 local terms energy: -231.687205 where: bonds (distance) C4'-P energy: -55.189 bonds (distance) P-C4' energy: -28.853 flat angles C4'-P-C4' energy: -48.679 flat angles P-C4'-P energy: -33.701 tors. eta vs tors. theta energy: -65.266 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 115 Temperature: 1.300000 Total energy: -758.143403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.143403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.143403 (E_RNA) where: Base-Base interactions energy: -427.862 where: short stacking energy: -194.163 Base-Backbone interact. energy: 0.966 local terms energy: -205.247860 where: bonds (distance) C4'-P energy: -33.579 bonds (distance) P-C4' energy: -42.394 flat angles C4'-P-C4' energy: -53.274 flat angles P-C4'-P energy: -24.650 tors. eta vs tors. theta energy: -51.351 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 115 Temperature: 1.350000 Total energy: -693.636188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.636188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.036188 (E_RNA) where: Base-Base interactions energy: -361.924 where: short stacking energy: -146.850 Base-Backbone interact. energy: 2.012 local terms energy: -204.124411 where: bonds (distance) C4'-P energy: -41.797 bonds (distance) P-C4' energy: -57.654 flat angles C4'-P-C4' energy: -38.791 flat angles P-C4'-P energy: -27.187 tors. eta vs tors. theta energy: -38.696 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 116 Temperature: 0.900000 Total energy: -1100.659052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1100.659052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -971.059052 (E_RNA) where: Base-Base interactions energy: -656.511 where: short stacking energy: -268.730 Base-Backbone interact. energy: -0.660 local terms energy: -313.888172 where: bonds (distance) C4'-P energy: -56.247 bonds (distance) P-C4' energy: -64.556 flat angles C4'-P-C4' energy: -67.659 flat angles P-C4'-P energy: -39.312 tors. eta vs tors. theta energy: -86.115 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 116 Temperature: 0.950000 Total energy: -1047.125611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.125611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.325611 (E_RNA) where: Base-Base interactions energy: -625.361 where: short stacking energy: -250.599 Base-Backbone interact. energy: -2.980 local terms energy: -290.984245 where: bonds (distance) C4'-P energy: -57.591 bonds (distance) P-C4' energy: -51.475 flat angles C4'-P-C4' energy: -59.942 flat angles P-C4'-P energy: -47.870 tors. eta vs tors. theta energy: -74.107 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 116 Temperature: 1.000000 Total energy: -1008.809745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.809745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.209745 (E_RNA) where: Base-Base interactions energy: -597.372 where: short stacking energy: -263.631 Base-Backbone interact. energy: -0.288 local terms energy: -281.549757 where: bonds (distance) C4'-P energy: -39.722 bonds (distance) P-C4' energy: -54.170 flat angles C4'-P-C4' energy: -66.125 flat angles P-C4'-P energy: -43.065 tors. eta vs tors. theta energy: -78.467 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 116 Temperature: 1.050000 Total energy: -983.594323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -983.594323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.794323 (E_RNA) where: Base-Base interactions energy: -570.748 where: short stacking energy: -252.262 Base-Backbone interact. energy: 1.965 local terms energy: -287.011043 where: bonds (distance) C4'-P energy: -56.662 bonds (distance) P-C4' energy: -51.496 flat angles C4'-P-C4' energy: -56.372 flat angles P-C4'-P energy: -41.630 tors. eta vs tors. theta energy: -80.851 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 116 Temperature: 1.100000 Total energy: -907.201291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.201291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.401291 (E_RNA) where: Base-Base interactions energy: -522.253 where: short stacking energy: -225.326 Base-Backbone interact. energy: -0.768 local terms energy: -256.380487 where: bonds (distance) C4'-P energy: -53.375 bonds (distance) P-C4' energy: -46.653 flat angles C4'-P-C4' energy: -50.857 flat angles P-C4'-P energy: -42.311 tors. eta vs tors. theta energy: -63.185 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 116 Temperature: 1.150000 Total energy: -862.393791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.393791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.593791 (E_RNA) where: Base-Base interactions energy: -500.466 where: short stacking energy: -230.077 Base-Backbone interact. energy: 1.001 local terms energy: -235.129501 where: bonds (distance) C4'-P energy: -39.584 bonds (distance) P-C4' energy: -46.630 flat angles C4'-P-C4' energy: -47.772 flat angles P-C4'-P energy: -40.691 tors. eta vs tors. theta energy: -60.453 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 116 Temperature: 1.200000 Total energy: -833.938377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.938377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.938377 (E_RNA) where: Base-Base interactions energy: -463.892 where: short stacking energy: -191.847 Base-Backbone interact. energy: -0.737 local terms energy: -243.308913 where: bonds (distance) C4'-P energy: -47.810 bonds (distance) P-C4' energy: -45.267 flat angles C4'-P-C4' energy: -57.969 flat angles P-C4'-P energy: -33.899 tors. eta vs tors. theta energy: -58.363 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 116 Temperature: 1.250000 Total energy: -848.915826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.915826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.315826 (E_RNA) where: Base-Base interactions energy: -472.810 where: short stacking energy: -204.267 Base-Backbone interact. energy: -1.613 local terms energy: -244.892341 where: bonds (distance) C4'-P energy: -44.358 bonds (distance) P-C4' energy: -61.661 flat angles C4'-P-C4' energy: -47.244 flat angles P-C4'-P energy: -29.398 tors. eta vs tors. theta energy: -62.231 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 116 Temperature: 1.300000 Total energy: -753.998070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.998070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.198070 (E_RNA) where: Base-Base interactions energy: -408.328 where: short stacking energy: -164.308 Base-Backbone interact. energy: -1.314 local terms energy: -216.556009 where: bonds (distance) C4'-P energy: -46.055 bonds (distance) P-C4' energy: -50.331 flat angles C4'-P-C4' energy: -42.212 flat angles P-C4'-P energy: -38.605 tors. eta vs tors. theta energy: -39.353 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 116 Temperature: 1.350000 Total energy: -656.984162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.984162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.184162 (E_RNA) where: Base-Base interactions energy: -339.358 where: short stacking energy: -129.690 Base-Backbone interact. energy: -1.082 local terms energy: -188.744137 where: bonds (distance) C4'-P energy: -31.689 bonds (distance) P-C4' energy: -41.179 flat angles C4'-P-C4' energy: -49.846 flat angles P-C4'-P energy: -36.245 tors. eta vs tors. theta energy: -29.785 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 117 Temperature: 0.900000 Total energy: -1085.710565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.710565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.110565 (E_RNA) where: Base-Base interactions energy: -663.227 where: short stacking energy: -273.781 Base-Backbone interact. energy: -0.583 local terms energy: -292.300650 where: bonds (distance) C4'-P energy: -57.083 bonds (distance) P-C4' energy: -48.462 flat angles C4'-P-C4' energy: -62.368 flat angles P-C4'-P energy: -39.459 tors. eta vs tors. theta energy: -84.929 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 117 Temperature: 0.950000 Total energy: -1063.438235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.438235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -935.638235 (E_RNA) where: Base-Base interactions energy: -632.161 where: short stacking energy: -285.480 Base-Backbone interact. energy: -0.916 local terms energy: -302.561749 where: bonds (distance) C4'-P energy: -57.865 bonds (distance) P-C4' energy: -52.260 flat angles C4'-P-C4' energy: -65.465 flat angles P-C4'-P energy: -42.894 tors. eta vs tors. theta energy: -84.078 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 117 Temperature: 1.000000 Total energy: -1021.247155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.247155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -898.847155 (E_RNA) where: Base-Base interactions energy: -620.665 where: short stacking energy: -222.063 Base-Backbone interact. energy: 0.780 local terms energy: -278.962426 where: bonds (distance) C4'-P energy: -46.605 bonds (distance) P-C4' energy: -55.137 flat angles C4'-P-C4' energy: -65.071 flat angles P-C4'-P energy: -44.801 tors. eta vs tors. theta energy: -67.349 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 117 Temperature: 1.050000 Total energy: -983.733496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -983.733496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -854.133496 (E_RNA) where: Base-Base interactions energy: -579.112 where: short stacking energy: -234.001 Base-Backbone interact. energy: -0.648 local terms energy: -274.373946 where: bonds (distance) C4'-P energy: -45.616 bonds (distance) P-C4' energy: -58.971 flat angles C4'-P-C4' energy: -58.592 flat angles P-C4'-P energy: -38.764 tors. eta vs tors. theta energy: -72.430 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 117 Temperature: 1.100000 Total energy: -885.891971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -885.891971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.891971 (E_RNA) where: Base-Base interactions energy: -499.809 where: short stacking energy: -217.341 Base-Backbone interact. energy: 0.116 local terms energy: -260.198855 where: bonds (distance) C4'-P energy: -56.243 bonds (distance) P-C4' energy: -51.823 flat angles C4'-P-C4' energy: -58.467 flat angles P-C4'-P energy: -32.108 tors. eta vs tors. theta energy: -61.558 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 117 Temperature: 1.150000 Total energy: -832.791760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.791760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.791760 (E_RNA) where: Base-Base interactions energy: -479.204 where: short stacking energy: -215.876 Base-Backbone interact. energy: 0.641 local terms energy: -228.228436 where: bonds (distance) C4'-P energy: -46.395 bonds (distance) P-C4' energy: -44.420 flat angles C4'-P-C4' energy: -39.861 flat angles P-C4'-P energy: -40.094 tors. eta vs tors. theta energy: -57.459 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 117 Temperature: 1.200000 Total energy: -858.160674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.160674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.360674 (E_RNA) where: Base-Base interactions energy: -465.277 where: short stacking energy: -200.963 Base-Backbone interact. energy: -1.413 local terms energy: -263.670687 where: bonds (distance) C4'-P energy: -52.501 bonds (distance) P-C4' energy: -59.014 flat angles C4'-P-C4' energy: -48.846 flat angles P-C4'-P energy: -38.288 tors. eta vs tors. theta energy: -65.022 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 117 Temperature: 1.250000 Total energy: -850.377492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.377492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -726.177492 (E_RNA) where: Base-Base interactions energy: -479.787 where: short stacking energy: -210.417 Base-Backbone interact. energy: -0.439 local terms energy: -245.950647 where: bonds (distance) C4'-P energy: -55.835 bonds (distance) P-C4' energy: -37.952 flat angles C4'-P-C4' energy: -52.439 flat angles P-C4'-P energy: -37.709 tors. eta vs tors. theta energy: -62.016 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 117 Temperature: 1.300000 Total energy: -786.083521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.083521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.483521 (E_RNA) where: Base-Base interactions energy: -427.174 where: short stacking energy: -171.151 Base-Backbone interact. energy: -0.523 local terms energy: -228.786554 where: bonds (distance) C4'-P energy: -47.786 bonds (distance) P-C4' energy: -53.043 flat angles C4'-P-C4' energy: -54.182 flat angles P-C4'-P energy: -28.766 tors. eta vs tors. theta energy: -45.010 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 117 Temperature: 1.350000 Total energy: -681.654537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.654537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.454537 (E_RNA) where: Base-Base interactions energy: -362.271 where: short stacking energy: -149.632 Base-Backbone interact. energy: -0.899 local terms energy: -194.284803 where: bonds (distance) C4'-P energy: -41.793 bonds (distance) P-C4' energy: -50.122 flat angles C4'-P-C4' energy: -44.914 flat angles P-C4'-P energy: -28.719 tors. eta vs tors. theta energy: -28.737 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 118 Temperature: 0.900000 Total energy: -1088.800547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1088.800547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.000547 (E_RNA) where: Base-Base interactions energy: -647.416 where: short stacking energy: -267.512 Base-Backbone interact. energy: -1.076 local terms energy: -312.508574 where: bonds (distance) C4'-P energy: -56.691 bonds (distance) P-C4' energy: -64.221 flat angles C4'-P-C4' energy: -66.506 flat angles P-C4'-P energy: -44.775 tors. eta vs tors. theta energy: -80.316 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 118 Temperature: 0.950000 Total energy: -1060.100754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.100754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -932.300754 (E_RNA) where: Base-Base interactions energy: -637.244 where: short stacking energy: -270.593 Base-Backbone interact. energy: -0.024 local terms energy: -295.032441 where: bonds (distance) C4'-P energy: -52.511 bonds (distance) P-C4' energy: -54.313 flat angles C4'-P-C4' energy: -60.727 flat angles P-C4'-P energy: -41.362 tors. eta vs tors. theta energy: -86.120 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 118 Temperature: 1.000000 Total energy: -1020.316785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.316785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -892.516785 (E_RNA) where: Base-Base interactions energy: -614.009 where: short stacking energy: -260.274 Base-Backbone interact. energy: -0.802 local terms energy: -277.705875 where: bonds (distance) C4'-P energy: -48.861 bonds (distance) P-C4' energy: -55.269 flat angles C4'-P-C4' energy: -57.197 flat angles P-C4'-P energy: -36.192 tors. eta vs tors. theta energy: -80.187 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 118 Temperature: 1.050000 Total energy: -1009.754093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.754093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.954093 (E_RNA) where: Base-Base interactions energy: -601.433 where: short stacking energy: -241.390 Base-Backbone interact. energy: -0.822 local terms energy: -279.699367 where: bonds (distance) C4'-P energy: -52.125 bonds (distance) P-C4' energy: -44.983 flat angles C4'-P-C4' energy: -63.503 flat angles P-C4'-P energy: -43.810 tors. eta vs tors. theta energy: -75.280 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 118 Temperature: 1.100000 Total energy: -884.586384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.586384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.786384 (E_RNA) where: Base-Base interactions energy: -504.269 where: short stacking energy: -216.982 Base-Backbone interact. energy: -2.456 local terms energy: -250.061085 where: bonds (distance) C4'-P energy: -47.572 bonds (distance) P-C4' energy: -56.367 flat angles C4'-P-C4' energy: -55.473 flat angles P-C4'-P energy: -33.512 tors. eta vs tors. theta energy: -57.138 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 118 Temperature: 1.150000 Total energy: -852.056155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -852.056155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.456155 (E_RNA) where: Base-Base interactions energy: -486.525 where: short stacking energy: -215.424 Base-Backbone interact. energy: -2.761 local terms energy: -233.169516 where: bonds (distance) C4'-P energy: -41.669 bonds (distance) P-C4' energy: -42.676 flat angles C4'-P-C4' energy: -58.034 flat angles P-C4'-P energy: -37.083 tors. eta vs tors. theta energy: -53.708 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 118 Temperature: 1.200000 Total energy: -859.247098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -859.247098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.647098 (E_RNA) where: Base-Base interactions energy: -483.346 where: short stacking energy: -203.759 Base-Backbone interact. energy: 0.628 local terms energy: -246.928300 where: bonds (distance) C4'-P energy: -50.953 bonds (distance) P-C4' energy: -50.469 flat angles C4'-P-C4' energy: -62.344 flat angles P-C4'-P energy: -28.836 tors. eta vs tors. theta energy: -54.326 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 118 Temperature: 1.250000 Total energy: -825.861261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -825.861261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.861261 (E_RNA) where: Base-Base interactions energy: -460.048 where: short stacking energy: -204.138 Base-Backbone interact. energy: -1.178 local terms energy: -238.635163 where: bonds (distance) C4'-P energy: -44.888 bonds (distance) P-C4' energy: -43.696 flat angles C4'-P-C4' energy: -54.035 flat angles P-C4'-P energy: -38.736 tors. eta vs tors. theta energy: -57.281 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 118 Temperature: 1.300000 Total energy: -700.804758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.804758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.004758 (E_RNA) where: Base-Base interactions energy: -361.628 where: short stacking energy: -133.196 Base-Backbone interact. energy: 0.750 local terms energy: -212.126980 where: bonds (distance) C4'-P energy: -58.485 bonds (distance) P-C4' energy: -44.181 flat angles C4'-P-C4' energy: -40.322 flat angles P-C4'-P energy: -34.599 tors. eta vs tors. theta energy: -34.540 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 118 Temperature: 1.350000 Total energy: -752.234384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.234384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -631.634384 (E_RNA) where: Base-Base interactions energy: -415.423 where: short stacking energy: -185.479 Base-Backbone interact. energy: 1.884 local terms energy: -218.095246 where: bonds (distance) C4'-P energy: -43.892 bonds (distance) P-C4' energy: -43.953 flat angles C4'-P-C4' energy: -45.244 flat angles P-C4'-P energy: -32.808 tors. eta vs tors. theta energy: -52.199 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 119 Temperature: 0.900000 Total energy: -1105.021266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1105.021266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.421266 (E_RNA) where: Base-Base interactions energy: -657.251 where: short stacking energy: -268.381 Base-Backbone interact. energy: -0.547 local terms energy: -317.623271 where: bonds (distance) C4'-P energy: -60.575 bonds (distance) P-C4' energy: -60.954 flat angles C4'-P-C4' energy: -60.762 flat angles P-C4'-P energy: -47.127 tors. eta vs tors. theta energy: -88.205 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 119 Temperature: 0.950000 Total energy: -1058.771428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.771428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -929.171428 (E_RNA) where: Base-Base interactions energy: -648.553 where: short stacking energy: -274.957 Base-Backbone interact. energy: -0.488 local terms energy: -280.130319 where: bonds (distance) C4'-P energy: -53.417 bonds (distance) P-C4' energy: -54.123 flat angles C4'-P-C4' energy: -57.873 flat angles P-C4'-P energy: -41.853 tors. eta vs tors. theta energy: -72.864 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 119 Temperature: 1.000000 Total energy: -1016.395041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.395041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.795041 (E_RNA) where: Base-Base interactions energy: -587.803 where: short stacking energy: -258.632 Base-Backbone interact. energy: 2.152 local terms energy: -301.144209 where: bonds (distance) C4'-P energy: -61.043 bonds (distance) P-C4' energy: -53.045 flat angles C4'-P-C4' energy: -67.004 flat angles P-C4'-P energy: -40.882 tors. eta vs tors. theta energy: -79.170 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 119 Temperature: 1.050000 Total energy: -999.153992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.153992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.353992 (E_RNA) where: Base-Base interactions energy: -614.871 where: short stacking energy: -256.592 Base-Backbone interact. energy: -1.274 local terms energy: -255.209334 where: bonds (distance) C4'-P energy: -37.925 bonds (distance) P-C4' energy: -52.599 flat angles C4'-P-C4' energy: -56.879 flat angles P-C4'-P energy: -36.112 tors. eta vs tors. theta energy: -71.694 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 119 Temperature: 1.100000 Total energy: -916.724814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -916.724814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.924814 (E_RNA) where: Base-Base interactions energy: -530.080 where: short stacking energy: -230.827 Base-Backbone interact. energy: 0.535 local terms energy: -259.379429 where: bonds (distance) C4'-P energy: -45.729 bonds (distance) P-C4' energy: -60.076 flat angles C4'-P-C4' energy: -55.030 flat angles P-C4'-P energy: -27.409 tors. eta vs tors. theta energy: -71.136 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 119 Temperature: 1.150000 Total energy: -856.446997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.446997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.446997 (E_RNA) where: Base-Base interactions energy: -476.085 where: short stacking energy: -208.318 Base-Backbone interact. energy: -0.087 local terms energy: -254.274453 where: bonds (distance) C4'-P energy: -47.609 bonds (distance) P-C4' energy: -49.695 flat angles C4'-P-C4' energy: -55.120 flat angles P-C4'-P energy: -42.198 tors. eta vs tors. theta energy: -59.651 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 119 Temperature: 1.200000 Total energy: -855.155804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.155804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.155804 (E_RNA) where: Base-Base interactions energy: -468.258 where: short stacking energy: -195.221 Base-Backbone interact. energy: -0.832 local terms energy: -260.065494 where: bonds (distance) C4'-P energy: -46.428 bonds (distance) P-C4' energy: -57.806 flat angles C4'-P-C4' energy: -61.492 flat angles P-C4'-P energy: -33.198 tors. eta vs tors. theta energy: -61.141 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 119 Temperature: 1.250000 Total energy: -802.919582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -802.919582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.119582 (E_RNA) where: Base-Base interactions energy: -437.303 where: short stacking energy: -192.477 Base-Backbone interact. energy: 0.076 local terms energy: -237.892439 where: bonds (distance) C4'-P energy: -45.583 bonds (distance) P-C4' energy: -57.284 flat angles C4'-P-C4' energy: -45.264 flat angles P-C4'-P energy: -33.948 tors. eta vs tors. theta energy: -55.814 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 119 Temperature: 1.300000 Total energy: -733.386598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -733.386598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.386598 (E_RNA) where: Base-Base interactions energy: -401.907 where: short stacking energy: -167.850 Base-Backbone interact. energy: -0.080 local terms energy: -205.399704 where: bonds (distance) C4'-P energy: -43.177 bonds (distance) P-C4' energy: -48.292 flat angles C4'-P-C4' energy: -49.181 flat angles P-C4'-P energy: -24.398 tors. eta vs tors. theta energy: -40.351 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 119 Temperature: 1.350000 Total energy: -742.837332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.837332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.037332 (E_RNA) where: Base-Base interactions energy: -408.247 where: short stacking energy: -159.812 Base-Backbone interact. energy: -0.930 local terms energy: -205.860154 where: bonds (distance) C4'-P energy: -51.846 bonds (distance) P-C4' energy: -49.597 flat angles C4'-P-C4' energy: -39.690 flat angles P-C4'-P energy: -21.683 tors. eta vs tors. theta energy: -43.044 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 120 Temperature: 0.900000 Total energy: -1089.753008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.753008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.753008 (E_RNA) where: Base-Base interactions energy: -649.426 where: short stacking energy: -288.061 Base-Backbone interact. energy: -0.518 local terms energy: -313.808646 where: bonds (distance) C4'-P energy: -60.956 bonds (distance) P-C4' energy: -59.454 flat angles C4'-P-C4' energy: -63.294 flat angles P-C4'-P energy: -45.723 tors. eta vs tors. theta energy: -84.382 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 120 Temperature: 0.950000 Total energy: -1029.519780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1029.519780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.719780 (E_RNA) where: Base-Base interactions energy: -604.613 where: short stacking energy: -254.528 Base-Backbone interact. energy: -0.800 local terms energy: -296.306495 where: bonds (distance) C4'-P energy: -62.049 bonds (distance) P-C4' energy: -54.661 flat angles C4'-P-C4' energy: -60.962 flat angles P-C4'-P energy: -41.230 tors. eta vs tors. theta energy: -77.405 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 120 Temperature: 1.000000 Total energy: -1013.745523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1013.745523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.745523 (E_RNA) where: Base-Base interactions energy: -601.590 where: short stacking energy: -262.890 Base-Backbone interact. energy: 0.836 local terms energy: -286.991699 where: bonds (distance) C4'-P energy: -60.416 bonds (distance) P-C4' energy: -52.040 flat angles C4'-P-C4' energy: -58.359 flat angles P-C4'-P energy: -42.063 tors. eta vs tors. theta energy: -74.114 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 120 Temperature: 1.050000 Total energy: -1012.669913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1012.669913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.669913 (E_RNA) where: Base-Base interactions energy: -606.980 where: short stacking energy: -241.573 Base-Backbone interact. energy: -1.126 local terms energy: -278.564013 where: bonds (distance) C4'-P energy: -45.996 bonds (distance) P-C4' energy: -58.858 flat angles C4'-P-C4' energy: -61.310 flat angles P-C4'-P energy: -38.085 tors. eta vs tors. theta energy: -74.314 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 120 Temperature: 1.100000 Total energy: -940.159453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -940.159453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.359453 (E_RNA) where: Base-Base interactions energy: -538.808 where: short stacking energy: -242.079 Base-Backbone interact. energy: -1.651 local terms energy: -271.900531 where: bonds (distance) C4'-P energy: -46.378 bonds (distance) P-C4' energy: -57.252 flat angles C4'-P-C4' energy: -58.419 flat angles P-C4'-P energy: -39.100 tors. eta vs tors. theta energy: -70.752 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 120 Temperature: 1.150000 Total energy: -863.872802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -863.872802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.272802 (E_RNA) where: Base-Base interactions energy: -484.895 where: short stacking energy: -220.017 Base-Backbone interact. energy: -0.104 local terms energy: -258.274391 where: bonds (distance) C4'-P energy: -50.108 bonds (distance) P-C4' energy: -47.773 flat angles C4'-P-C4' energy: -58.696 flat angles P-C4'-P energy: -40.838 tors. eta vs tors. theta energy: -60.860 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 120 Temperature: 1.200000 Total energy: -846.494504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.494504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.694504 (E_RNA) where: Base-Base interactions energy: -490.459 where: short stacking energy: -218.846 Base-Backbone interact. energy: -0.589 local terms energy: -227.646148 where: bonds (distance) C4'-P energy: -40.895 bonds (distance) P-C4' energy: -36.747 flat angles C4'-P-C4' energy: -49.190 flat angles P-C4'-P energy: -36.159 tors. eta vs tors. theta energy: -64.655 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 120 Temperature: 1.250000 Total energy: -838.509539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.509539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.709539 (E_RNA) where: Base-Base interactions energy: -455.466 where: short stacking energy: -195.720 Base-Backbone interact. energy: 0.939 local terms energy: -256.182721 where: bonds (distance) C4'-P energy: -49.414 bonds (distance) P-C4' energy: -51.089 flat angles C4'-P-C4' energy: -54.686 flat angles P-C4'-P energy: -45.039 tors. eta vs tors. theta energy: -55.955 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 120 Temperature: 1.300000 Total energy: -719.634224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.634224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.634224 (E_RNA) where: Base-Base interactions energy: -390.501 where: short stacking energy: -159.015 Base-Backbone interact. energy: -0.486 local terms energy: -202.647102 where: bonds (distance) C4'-P energy: -49.727 bonds (distance) P-C4' energy: -50.756 flat angles C4'-P-C4' energy: -37.738 flat angles P-C4'-P energy: -29.592 tors. eta vs tors. theta energy: -34.833 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 120 Temperature: 1.350000 Total energy: -709.717041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.717041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.917041 (E_RNA) where: Base-Base interactions energy: -387.929 where: short stacking energy: -170.143 Base-Backbone interact. energy: 1.219 local terms energy: -195.207450 where: bonds (distance) C4'-P energy: -53.968 bonds (distance) P-C4' energy: -39.260 flat angles C4'-P-C4' energy: -42.808 flat angles P-C4'-P energy: -30.173 tors. eta vs tors. theta energy: -28.999 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 121 Temperature: 0.900000 Total energy: -1083.450685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.450685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.650685 (E_RNA) where: Base-Base interactions energy: -669.929 where: short stacking energy: -271.760 Base-Backbone interact. energy: -0.576 local terms energy: -285.145063 where: bonds (distance) C4'-P energy: -52.015 bonds (distance) P-C4' energy: -58.601 flat angles C4'-P-C4' energy: -56.788 flat angles P-C4'-P energy: -39.901 tors. eta vs tors. theta energy: -77.840 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 121 Temperature: 0.950000 Total energy: -1055.924230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.924230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -929.924230 (E_RNA) where: Base-Base interactions energy: -628.965 where: short stacking energy: -280.927 Base-Backbone interact. energy: -0.919 local terms energy: -300.040198 where: bonds (distance) C4'-P energy: -59.768 bonds (distance) P-C4' energy: -60.643 flat angles C4'-P-C4' energy: -57.309 flat angles P-C4'-P energy: -41.564 tors. eta vs tors. theta energy: -80.756 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 121 Temperature: 1.000000 Total energy: -1036.551679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1036.551679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -906.951679 (E_RNA) where: Base-Base interactions energy: -607.430 where: short stacking energy: -258.059 Base-Backbone interact. energy: 0.204 local terms energy: -299.725159 where: bonds (distance) C4'-P energy: -53.536 bonds (distance) P-C4' energy: -56.490 flat angles C4'-P-C4' energy: -62.757 flat angles P-C4'-P energy: -45.345 tors. eta vs tors. theta energy: -81.598 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 121 Temperature: 1.050000 Total energy: -965.155263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.155263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -839.155263 (E_RNA) where: Base-Base interactions energy: -552.990 where: short stacking energy: -253.156 Base-Backbone interact. energy: -2.018 local terms energy: -284.147985 where: bonds (distance) C4'-P energy: -49.546 bonds (distance) P-C4' energy: -59.948 flat angles C4'-P-C4' energy: -58.209 flat angles P-C4'-P energy: -42.996 tors. eta vs tors. theta energy: -73.450 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 121 Temperature: 1.100000 Total energy: -971.094622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -971.094622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.494622 (E_RNA) where: Base-Base interactions energy: -571.693 where: short stacking energy: -230.220 Base-Backbone interact. energy: -0.779 local terms energy: -269.022628 where: bonds (distance) C4'-P energy: -47.657 bonds (distance) P-C4' energy: -47.090 flat angles C4'-P-C4' energy: -62.559 flat angles P-C4'-P energy: -42.314 tors. eta vs tors. theta energy: -69.403 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 121 Temperature: 1.150000 Total energy: -862.962025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.962025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.162025 (E_RNA) where: Base-Base interactions energy: -456.066 where: short stacking energy: -194.863 Base-Backbone interact. energy: -0.599 local terms energy: -278.497310 where: bonds (distance) C4'-P energy: -60.628 bonds (distance) P-C4' energy: -62.180 flat angles C4'-P-C4' energy: -57.420 flat angles P-C4'-P energy: -33.207 tors. eta vs tors. theta energy: -65.063 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 121 Temperature: 1.200000 Total energy: -846.225290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.225290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.425290 (E_RNA) where: Base-Base interactions energy: -478.676 where: short stacking energy: -218.258 Base-Backbone interact. energy: -0.726 local terms energy: -239.023240 where: bonds (distance) C4'-P energy: -39.427 bonds (distance) P-C4' energy: -43.721 flat angles C4'-P-C4' energy: -51.834 flat angles P-C4'-P energy: -29.267 tors. eta vs tors. theta energy: -74.774 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 121 Temperature: 1.250000 Total energy: -821.152436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -821.152436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.352436 (E_RNA) where: Base-Base interactions energy: -451.164 where: short stacking energy: -206.855 Base-Backbone interact. energy: -0.881 local terms energy: -241.307810 where: bonds (distance) C4'-P energy: -52.539 bonds (distance) P-C4' energy: -39.714 flat angles C4'-P-C4' energy: -51.598 flat angles P-C4'-P energy: -30.534 tors. eta vs tors. theta energy: -66.922 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 121 Temperature: 1.300000 Total energy: -769.568208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.568208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.568208 (E_RNA) where: Base-Base interactions energy: -420.740 where: short stacking energy: -172.419 Base-Backbone interact. energy: -0.595 local terms energy: -222.233143 where: bonds (distance) C4'-P energy: -39.250 bonds (distance) P-C4' energy: -46.419 flat angles C4'-P-C4' energy: -50.843 flat angles P-C4'-P energy: -38.006 tors. eta vs tors. theta energy: -47.715 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 121 Temperature: 1.350000 Total energy: -724.641041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.641041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.241041 (E_RNA) where: Base-Base interactions energy: -416.527 where: short stacking energy: -176.300 Base-Backbone interact. energy: 0.278 local terms energy: -185.992503 where: bonds (distance) C4'-P energy: -33.339 bonds (distance) P-C4' energy: -45.197 flat angles C4'-P-C4' energy: -45.472 flat angles P-C4'-P energy: -24.650 tors. eta vs tors. theta energy: -37.336 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 122 Temperature: 0.900000 Total energy: -1104.351204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1104.351204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -976.551204 (E_RNA) where: Base-Base interactions energy: -659.227 where: short stacking energy: -266.932 Base-Backbone interact. energy: -0.949 local terms energy: -316.375505 where: bonds (distance) C4'-P energy: -63.805 bonds (distance) P-C4' energy: -58.367 flat angles C4'-P-C4' energy: -61.162 flat angles P-C4'-P energy: -48.472 tors. eta vs tors. theta energy: -84.570 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 122 Temperature: 0.950000 Total energy: -1049.013477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1049.013477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.413477 (E_RNA) where: Base-Base interactions energy: -617.157 where: short stacking energy: -285.231 Base-Backbone interact. energy: 0.109 local terms energy: -302.366276 where: bonds (distance) C4'-P energy: -44.373 bonds (distance) P-C4' energy: -60.448 flat angles C4'-P-C4' energy: -65.025 flat angles P-C4'-P energy: -47.436 tors. eta vs tors. theta energy: -85.084 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 122 Temperature: 1.000000 Total energy: -1028.157331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1028.157331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -902.157331 (E_RNA) where: Base-Base interactions energy: -611.451 where: short stacking energy: -262.973 Base-Backbone interact. energy: -0.716 local terms energy: -289.990727 where: bonds (distance) C4'-P energy: -55.651 bonds (distance) P-C4' energy: -60.283 flat angles C4'-P-C4' energy: -56.917 flat angles P-C4'-P energy: -38.386 tors. eta vs tors. theta energy: -78.754 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 122 Temperature: 1.050000 Total energy: -987.339454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.339454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.539454 (E_RNA) where: Base-Base interactions energy: -600.114 where: short stacking energy: -247.900 Base-Backbone interact. energy: 0.445 local terms energy: -259.870341 where: bonds (distance) C4'-P energy: -46.085 bonds (distance) P-C4' energy: -47.901 flat angles C4'-P-C4' energy: -56.295 flat angles P-C4'-P energy: -34.966 tors. eta vs tors. theta energy: -74.624 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 122 Temperature: 1.100000 Total energy: -973.339972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -973.339972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.739972 (E_RNA) where: Base-Base interactions energy: -574.809 where: short stacking energy: -230.038 Base-Backbone interact. energy: 0.905 local terms energy: -269.836326 where: bonds (distance) C4'-P energy: -47.566 bonds (distance) P-C4' energy: -48.748 flat angles C4'-P-C4' energy: -60.892 flat angles P-C4'-P energy: -44.805 tors. eta vs tors. theta energy: -67.825 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 122 Temperature: 1.150000 Total energy: -871.260763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.260763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.660763 (E_RNA) where: Base-Base interactions energy: -505.855 where: short stacking energy: -216.325 Base-Backbone interact. energy: -1.706 local terms energy: -234.099791 where: bonds (distance) C4'-P energy: -37.041 bonds (distance) P-C4' energy: -50.759 flat angles C4'-P-C4' energy: -56.932 flat angles P-C4'-P energy: -27.879 tors. eta vs tors. theta energy: -61.489 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 122 Temperature: 1.200000 Total energy: -857.961484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -857.961484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.361484 (E_RNA) where: Base-Base interactions energy: -480.982 where: short stacking energy: -198.943 Base-Backbone interact. energy: -1.673 local terms energy: -245.706517 where: bonds (distance) C4'-P energy: -43.391 bonds (distance) P-C4' energy: -48.441 flat angles C4'-P-C4' energy: -56.308 flat angles P-C4'-P energy: -35.944 tors. eta vs tors. theta energy: -61.622 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 122 Temperature: 1.250000 Total energy: -829.851779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.851779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.651779 (E_RNA) where: Base-Base interactions energy: -455.354 where: short stacking energy: -212.374 Base-Backbone interact. energy: 0.100 local terms energy: -250.397086 where: bonds (distance) C4'-P energy: -50.492 bonds (distance) P-C4' energy: -52.480 flat angles C4'-P-C4' energy: -50.594 flat angles P-C4'-P energy: -36.704 tors. eta vs tors. theta energy: -60.126 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 122 Temperature: 1.300000 Total energy: -783.712124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.712124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.112124 (E_RNA) where: Base-Base interactions energy: -452.112 where: short stacking energy: -164.431 Base-Backbone interact. energy: 0.844 local terms energy: -202.843389 where: bonds (distance) C4'-P energy: -42.728 bonds (distance) P-C4' energy: -39.903 flat angles C4'-P-C4' energy: -49.090 flat angles P-C4'-P energy: -28.760 tors. eta vs tors. theta energy: -42.362 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 122 Temperature: 1.350000 Total energy: -713.019457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.019457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.219457 (E_RNA) where: Base-Base interactions energy: -380.846 where: short stacking energy: -171.471 Base-Backbone interact. energy: 1.087 local terms energy: -205.460126 where: bonds (distance) C4'-P energy: -38.717 bonds (distance) P-C4' energy: -48.498 flat angles C4'-P-C4' energy: -52.114 flat angles P-C4'-P energy: -24.281 tors. eta vs tors. theta energy: -41.850 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 123 Temperature: 0.900000 Total energy: -1105.773163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1105.773163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -976.173163 (E_RNA) where: Base-Base interactions energy: -672.727 where: short stacking energy: -267.356 Base-Backbone interact. energy: -0.657 local terms energy: -302.788952 where: bonds (distance) C4'-P energy: -53.912 bonds (distance) P-C4' energy: -62.508 flat angles C4'-P-C4' energy: -63.256 flat angles P-C4'-P energy: -38.966 tors. eta vs tors. theta energy: -84.148 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 123 Temperature: 0.950000 Total energy: -1041.945840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.945840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -912.345840 (E_RNA) where: Base-Base interactions energy: -608.283 where: short stacking energy: -280.578 Base-Backbone interact. energy: -0.185 local terms energy: -303.877124 where: bonds (distance) C4'-P energy: -52.382 bonds (distance) P-C4' energy: -63.249 flat angles C4'-P-C4' energy: -56.500 flat angles P-C4'-P energy: -44.166 tors. eta vs tors. theta energy: -87.580 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 123 Temperature: 1.000000 Total energy: -1015.530161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1015.530161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.930161 (E_RNA) where: Base-Base interactions energy: -607.277 where: short stacking energy: -257.007 Base-Backbone interact. energy: -1.618 local terms energy: -277.035447 where: bonds (distance) C4'-P energy: -47.265 bonds (distance) P-C4' energy: -55.134 flat angles C4'-P-C4' energy: -58.605 flat angles P-C4'-P energy: -39.940 tors. eta vs tors. theta energy: -76.092 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 123 Temperature: 1.050000 Total energy: -991.708597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -991.708597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -863.908597 (E_RNA) where: Base-Base interactions energy: -586.294 where: short stacking energy: -242.713 Base-Backbone interact. energy: 2.367 local terms energy: -279.982129 where: bonds (distance) C4'-P energy: -57.465 bonds (distance) P-C4' energy: -57.906 flat angles C4'-P-C4' energy: -57.816 flat angles P-C4'-P energy: -35.958 tors. eta vs tors. theta energy: -70.837 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 123 Temperature: 1.100000 Total energy: -988.251649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -988.251649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.451649 (E_RNA) where: Base-Base interactions energy: -590.123 where: short stacking energy: -258.107 Base-Backbone interact. energy: 0.839 local terms energy: -271.166819 where: bonds (distance) C4'-P energy: -48.597 bonds (distance) P-C4' energy: -46.177 flat angles C4'-P-C4' energy: -58.564 flat angles P-C4'-P energy: -41.625 tors. eta vs tors. theta energy: -76.204 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 123 Temperature: 1.150000 Total energy: -888.196986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -888.196986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.596986 (E_RNA) where: Base-Base interactions energy: -485.307 where: short stacking energy: -221.130 Base-Backbone interact. energy: -0.289 local terms energy: -273.000315 where: bonds (distance) C4'-P energy: -54.384 bonds (distance) P-C4' energy: -53.386 flat angles C4'-P-C4' energy: -51.704 flat angles P-C4'-P energy: -36.177 tors. eta vs tors. theta energy: -77.348 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 123 Temperature: 1.200000 Total energy: -880.023748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.023748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.223748 (E_RNA) where: Base-Base interactions energy: -497.607 where: short stacking energy: -228.165 Base-Backbone interact. energy: -1.340 local terms energy: -262.277313 where: bonds (distance) C4'-P energy: -52.089 bonds (distance) P-C4' energy: -42.658 flat angles C4'-P-C4' energy: -58.127 flat angles P-C4'-P energy: -45.267 tors. eta vs tors. theta energy: -64.137 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 123 Temperature: 1.250000 Total energy: -834.780491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.780491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.980491 (E_RNA) where: Base-Base interactions energy: -496.560 where: short stacking energy: -221.571 Base-Backbone interact. energy: -0.740 local terms energy: -209.680928 where: bonds (distance) C4'-P energy: -38.223 bonds (distance) P-C4' energy: -44.041 flat angles C4'-P-C4' energy: -37.995 flat angles P-C4'-P energy: -25.921 tors. eta vs tors. theta energy: -63.502 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 123 Temperature: 1.300000 Total energy: -826.875667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.875667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.875667 (E_RNA) where: Base-Base interactions energy: -490.937 where: short stacking energy: -200.687 Base-Backbone interact. energy: -0.680 local terms energy: -209.258339 where: bonds (distance) C4'-P energy: -29.004 bonds (distance) P-C4' energy: -38.046 flat angles C4'-P-C4' energy: -56.697 flat angles P-C4'-P energy: -37.070 tors. eta vs tors. theta energy: -48.441 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 123 Temperature: 1.350000 Total energy: -719.144037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.144037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.744037 (E_RNA) where: Base-Base interactions energy: -389.412 where: short stacking energy: -159.983 Base-Backbone interact. energy: 0.722 local terms energy: -208.053980 where: bonds (distance) C4'-P energy: -46.135 bonds (distance) P-C4' energy: -44.011 flat angles C4'-P-C4' energy: -52.311 flat angles P-C4'-P energy: -30.782 tors. eta vs tors. theta energy: -34.814 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 124 Temperature: 0.900000 Total energy: -1112.960373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1112.960373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.360373 (E_RNA) where: Base-Base interactions energy: -679.534 where: short stacking energy: -270.155 Base-Backbone interact. energy: 0.350 local terms energy: -304.176265 where: bonds (distance) C4'-P energy: -55.249 bonds (distance) P-C4' energy: -62.033 flat angles C4'-P-C4' energy: -64.090 flat angles P-C4'-P energy: -40.667 tors. eta vs tors. theta energy: -82.137 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 124 Temperature: 0.950000 Total energy: -1040.539007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.539007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -916.339007 (E_RNA) where: Base-Base interactions energy: -610.214 where: short stacking energy: -276.916 Base-Backbone interact. energy: -1.564 local terms energy: -304.560892 where: bonds (distance) C4'-P energy: -55.880 bonds (distance) P-C4' energy: -55.600 flat angles C4'-P-C4' energy: -59.046 flat angles P-C4'-P energy: -43.794 tors. eta vs tors. theta energy: -90.241 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 124 Temperature: 1.000000 Total energy: -1032.956511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1032.956511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.156511 (E_RNA) where: Base-Base interactions energy: -610.252 where: short stacking energy: -248.925 Base-Backbone interact. energy: 0.993 local terms energy: -295.897694 where: bonds (distance) C4'-P energy: -51.292 bonds (distance) P-C4' energy: -59.102 flat angles C4'-P-C4' energy: -65.082 flat angles P-C4'-P energy: -45.281 tors. eta vs tors. theta energy: -75.140 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 124 Temperature: 1.050000 Total energy: -996.449726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.449726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.849726 (E_RNA) where: Base-Base interactions energy: -584.354 where: short stacking energy: -254.602 Base-Backbone interact. energy: 1.177 local terms energy: -283.672423 where: bonds (distance) C4'-P energy: -60.585 bonds (distance) P-C4' energy: -54.155 flat angles C4'-P-C4' energy: -56.684 flat angles P-C4'-P energy: -35.908 tors. eta vs tors. theta energy: -76.340 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 124 Temperature: 1.100000 Total energy: -944.016307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -944.016307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.416307 (E_RNA) where: Base-Base interactions energy: -545.279 where: short stacking energy: -227.869 Base-Backbone interact. energy: 1.027 local terms energy: -279.164755 where: bonds (distance) C4'-P energy: -53.113 bonds (distance) P-C4' energy: -51.750 flat angles C4'-P-C4' energy: -58.244 flat angles P-C4'-P energy: -48.603 tors. eta vs tors. theta energy: -67.454 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 124 Temperature: 1.150000 Total energy: -860.138234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.138234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.138234 (E_RNA) where: Base-Base interactions energy: -486.973 where: short stacking energy: -211.725 Base-Backbone interact. energy: -0.430 local terms energy: -246.735143 where: bonds (distance) C4'-P energy: -55.348 bonds (distance) P-C4' energy: -41.352 flat angles C4'-P-C4' energy: -56.977 flat angles P-C4'-P energy: -32.091 tors. eta vs tors. theta energy: -60.968 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 124 Temperature: 1.200000 Total energy: -853.554574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.554574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.954574 (E_RNA) where: Base-Base interactions energy: -495.647 where: short stacking energy: -212.401 Base-Backbone interact. energy: 0.556 local terms energy: -228.863795 where: bonds (distance) C4'-P energy: -41.846 bonds (distance) P-C4' energy: -48.236 flat angles C4'-P-C4' energy: -47.496 flat angles P-C4'-P energy: -31.845 tors. eta vs tors. theta energy: -59.442 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 124 Temperature: 1.250000 Total energy: -822.863592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.863592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.263592 (E_RNA) where: Base-Base interactions energy: -469.367 where: short stacking energy: -207.614 Base-Backbone interact. energy: -1.117 local terms energy: -231.779388 where: bonds (distance) C4'-P energy: -46.686 bonds (distance) P-C4' energy: -56.258 flat angles C4'-P-C4' energy: -42.945 flat angles P-C4'-P energy: -33.540 tors. eta vs tors. theta energy: -52.350 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 124 Temperature: 1.300000 Total energy: -778.525460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.525460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.525460 (E_RNA) where: Base-Base interactions energy: -428.721 where: short stacking energy: -179.785 Base-Backbone interact. energy: -1.552 local terms energy: -222.253303 where: bonds (distance) C4'-P energy: -42.594 bonds (distance) P-C4' energy: -49.995 flat angles C4'-P-C4' energy: -52.928 flat angles P-C4'-P energy: -36.288 tors. eta vs tors. theta energy: -40.448 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 124 Temperature: 1.350000 Total energy: -717.459487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.459487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.659487 (E_RNA) where: Base-Base interactions energy: -369.673 where: short stacking energy: -146.327 Base-Backbone interact. energy: -1.040 local terms energy: -218.947186 where: bonds (distance) C4'-P energy: -37.511 bonds (distance) P-C4' energy: -53.833 flat angles C4'-P-C4' energy: -48.055 flat angles P-C4'-P energy: -38.220 tors. eta vs tors. theta energy: -41.328 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 125 Temperature: 0.900000 Total energy: -1087.912686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.912686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.312686 (E_RNA) where: Base-Base interactions energy: -659.094 where: short stacking energy: -280.980 Base-Backbone interact. energy: 0.882 local terms energy: -300.100704 where: bonds (distance) C4'-P energy: -52.532 bonds (distance) P-C4' energy: -55.468 flat angles C4'-P-C4' energy: -67.562 flat angles P-C4'-P energy: -44.241 tors. eta vs tors. theta energy: -80.298 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 125 Temperature: 0.950000 Total energy: -1071.322841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1071.322841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.322841 (E_RNA) where: Base-Base interactions energy: -662.343 where: short stacking energy: -271.139 Base-Backbone interact. energy: -0.073 local terms energy: -282.906864 where: bonds (distance) C4'-P energy: -60.941 bonds (distance) P-C4' energy: -50.114 flat angles C4'-P-C4' energy: -52.374 flat angles P-C4'-P energy: -38.599 tors. eta vs tors. theta energy: -80.879 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 125 Temperature: 1.000000 Total energy: -1014.452256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.452256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -890.252256 (E_RNA) where: Base-Base interactions energy: -624.255 where: short stacking energy: -253.791 Base-Backbone interact. energy: -0.997 local terms energy: -264.999819 where: bonds (distance) C4'-P energy: -52.354 bonds (distance) P-C4' energy: -49.248 flat angles C4'-P-C4' energy: -58.074 flat angles P-C4'-P energy: -36.085 tors. eta vs tors. theta energy: -69.238 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 125 Temperature: 1.050000 Total energy: -1003.547817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1003.547817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -873.947817 (E_RNA) where: Base-Base interactions energy: -576.795 where: short stacking energy: -251.066 Base-Backbone interact. energy: -1.090 local terms energy: -296.062755 where: bonds (distance) C4'-P energy: -55.847 bonds (distance) P-C4' energy: -58.834 flat angles C4'-P-C4' energy: -62.749 flat angles P-C4'-P energy: -44.659 tors. eta vs tors. theta energy: -73.974 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 125 Temperature: 1.100000 Total energy: -955.245595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -955.245595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -825.645595 (E_RNA) where: Base-Base interactions energy: -555.569 where: short stacking energy: -224.621 Base-Backbone interact. energy: 1.256 local terms energy: -271.332424 where: bonds (distance) C4'-P energy: -54.939 bonds (distance) P-C4' energy: -47.719 flat angles C4'-P-C4' energy: -62.887 flat angles P-C4'-P energy: -39.561 tors. eta vs tors. theta energy: -66.226 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 125 Temperature: 1.150000 Total energy: -884.051294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.051294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.251294 (E_RNA) where: Base-Base interactions energy: -507.328 where: short stacking energy: -235.799 Base-Backbone interact. energy: -0.838 local terms energy: -248.085205 where: bonds (distance) C4'-P energy: -41.627 bonds (distance) P-C4' energy: -49.597 flat angles C4'-P-C4' energy: -57.514 flat angles P-C4'-P energy: -27.714 tors. eta vs tors. theta energy: -71.633 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 125 Temperature: 1.200000 Total energy: -851.591567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -851.591567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.791567 (E_RNA) where: Base-Base interactions energy: -491.799 where: short stacking energy: -208.819 Base-Backbone interact. energy: -0.298 local terms energy: -231.694944 where: bonds (distance) C4'-P energy: -42.313 bonds (distance) P-C4' energy: -40.270 flat angles C4'-P-C4' energy: -56.099 flat angles P-C4'-P energy: -34.359 tors. eta vs tors. theta energy: -58.654 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 125 Temperature: 1.250000 Total energy: -808.373364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -808.373364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.773364 (E_RNA) where: Base-Base interactions energy: -452.429 where: short stacking energy: -192.756 Base-Backbone interact. energy: -1.417 local terms energy: -224.927505 where: bonds (distance) C4'-P energy: -46.083 bonds (distance) P-C4' energy: -47.238 flat angles C4'-P-C4' energy: -48.056 flat angles P-C4'-P energy: -38.108 tors. eta vs tors. theta energy: -45.443 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 125 Temperature: 1.300000 Total energy: -748.509167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.509167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.109167 (E_RNA) where: Base-Base interactions energy: -411.502 where: short stacking energy: -156.295 Base-Backbone interact. energy: -0.159 local terms energy: -214.448064 where: bonds (distance) C4'-P energy: -46.587 bonds (distance) P-C4' energy: -47.534 flat angles C4'-P-C4' energy: -43.064 flat angles P-C4'-P energy: -38.212 tors. eta vs tors. theta energy: -39.051 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 125 Temperature: 1.350000 Total energy: -755.745786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.745786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.945786 (E_RNA) where: Base-Base interactions energy: -396.376 where: short stacking energy: -176.352 Base-Backbone interact. energy: -0.423 local terms energy: -240.147064 where: bonds (distance) C4'-P energy: -50.654 bonds (distance) P-C4' energy: -58.446 flat angles C4'-P-C4' energy: -49.593 flat angles P-C4'-P energy: -36.290 tors. eta vs tors. theta energy: -45.164 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 126 Temperature: 0.900000 Total energy: -1089.084067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.084067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.884067 (E_RNA) where: Base-Base interactions energy: -664.727 where: short stacking energy: -260.403 Base-Backbone interact. energy: -0.601 local terms energy: -299.555984 where: bonds (distance) C4'-P energy: -57.519 bonds (distance) P-C4' energy: -63.594 flat angles C4'-P-C4' energy: -56.958 flat angles P-C4'-P energy: -46.943 tors. eta vs tors. theta energy: -74.542 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 126 Temperature: 0.950000 Total energy: -1067.917269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.917269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.117269 (E_RNA) where: Base-Base interactions energy: -641.422 where: short stacking energy: -269.956 Base-Backbone interact. energy: -0.534 local terms energy: -298.161619 where: bonds (distance) C4'-P energy: -59.974 bonds (distance) P-C4' energy: -49.635 flat angles C4'-P-C4' energy: -63.854 flat angles P-C4'-P energy: -39.085 tors. eta vs tors. theta energy: -85.613 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 126 Temperature: 1.000000 Total energy: -1005.181201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.181201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -875.581201 (E_RNA) where: Base-Base interactions energy: -603.799 where: short stacking energy: -250.153 Base-Backbone interact. energy: -1.190 local terms energy: -270.592106 where: bonds (distance) C4'-P energy: -48.926 bonds (distance) P-C4' energy: -47.873 flat angles C4'-P-C4' energy: -54.833 flat angles P-C4'-P energy: -42.293 tors. eta vs tors. theta energy: -76.666 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 126 Temperature: 1.050000 Total energy: -998.198790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -998.198790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -868.598790 (E_RNA) where: Base-Base interactions energy: -583.196 where: short stacking energy: -232.503 Base-Backbone interact. energy: 1.506 local terms energy: -286.908631 where: bonds (distance) C4'-P energy: -52.510 bonds (distance) P-C4' energy: -62.650 flat angles C4'-P-C4' energy: -54.040 flat angles P-C4'-P energy: -40.287 tors. eta vs tors. theta energy: -77.420 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 126 Temperature: 1.100000 Total energy: -934.223787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -934.223787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -806.423787 (E_RNA) where: Base-Base interactions energy: -523.266 where: short stacking energy: -231.109 Base-Backbone interact. energy: -1.274 local terms energy: -281.883460 where: bonds (distance) C4'-P energy: -51.738 bonds (distance) P-C4' energy: -54.225 flat angles C4'-P-C4' energy: -59.684 flat angles P-C4'-P energy: -36.843 tors. eta vs tors. theta energy: -79.393 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 126 Temperature: 1.150000 Total energy: -935.833434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -935.833434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.833434 (E_RNA) where: Base-Base interactions energy: -528.101 where: short stacking energy: -235.005 Base-Backbone interact. energy: -0.725 local terms energy: -281.006850 where: bonds (distance) C4'-P energy: -53.416 bonds (distance) P-C4' energy: -51.191 flat angles C4'-P-C4' energy: -57.441 flat angles P-C4'-P energy: -45.529 tors. eta vs tors. theta energy: -73.429 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 126 Temperature: 1.200000 Total energy: -850.517623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.517623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.517623 (E_RNA) where: Base-Base interactions energy: -497.506 where: short stacking energy: -222.364 Base-Backbone interact. energy: -0.981 local terms energy: -226.029781 where: bonds (distance) C4'-P energy: -46.840 bonds (distance) P-C4' energy: -46.724 flat angles C4'-P-C4' energy: -51.258 flat angles P-C4'-P energy: -23.228 tors. eta vs tors. theta energy: -57.980 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 126 Temperature: 1.250000 Total energy: -815.063935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.063935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.263935 (E_RNA) where: Base-Base interactions energy: -450.004 where: short stacking energy: -199.118 Base-Backbone interact. energy: -0.142 local terms energy: -237.117273 where: bonds (distance) C4'-P energy: -51.175 bonds (distance) P-C4' energy: -50.168 flat angles C4'-P-C4' energy: -44.055 flat angles P-C4'-P energy: -35.585 tors. eta vs tors. theta energy: -56.134 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 126 Temperature: 1.300000 Total energy: -723.313769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -723.313769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.313769 (E_RNA) where: Base-Base interactions energy: -370.903 where: short stacking energy: -143.934 Base-Backbone interact. energy: -0.392 local terms energy: -226.018425 where: bonds (distance) C4'-P energy: -56.239 bonds (distance) P-C4' energy: -56.275 flat angles C4'-P-C4' energy: -52.923 flat angles P-C4'-P energy: -20.887 tors. eta vs tors. theta energy: -39.695 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 126 Temperature: 1.350000 Total energy: -721.055584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.055584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.855584 (E_RNA) where: Base-Base interactions energy: -394.533 where: short stacking energy: -160.616 Base-Backbone interact. energy: -0.418 local terms energy: -201.904013 where: bonds (distance) C4'-P energy: -43.229 bonds (distance) P-C4' energy: -49.702 flat angles C4'-P-C4' energy: -42.529 flat angles P-C4'-P energy: -25.776 tors. eta vs tors. theta energy: -40.669 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 127 Temperature: 0.900000 Total energy: -1096.405438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.405438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -970.405438 (E_RNA) where: Base-Base interactions energy: -681.859 where: short stacking energy: -258.727 Base-Backbone interact. energy: 0.527 local terms energy: -289.074104 where: bonds (distance) C4'-P energy: -56.618 bonds (distance) P-C4' energy: -61.433 flat angles C4'-P-C4' energy: -60.860 flat angles P-C4'-P energy: -32.968 tors. eta vs tors. theta energy: -77.195 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 127 Temperature: 0.950000 Total energy: -1040.609029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.609029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.009029 (E_RNA) where: Base-Base interactions energy: -616.534 where: short stacking energy: -264.429 Base-Backbone interact. energy: -1.660 local terms energy: -292.814612 where: bonds (distance) C4'-P energy: -52.544 bonds (distance) P-C4' energy: -56.168 flat angles C4'-P-C4' energy: -58.387 flat angles P-C4'-P energy: -44.542 tors. eta vs tors. theta energy: -81.173 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 127 Temperature: 1.000000 Total energy: -1051.838933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.838933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.238933 (E_RNA) where: Base-Base interactions energy: -627.633 where: short stacking energy: -273.862 Base-Backbone interact. energy: 0.542 local terms energy: -295.148202 where: bonds (distance) C4'-P energy: -49.686 bonds (distance) P-C4' energy: -63.364 flat angles C4'-P-C4' energy: -60.774 flat angles P-C4'-P energy: -39.188 tors. eta vs tors. theta energy: -82.136 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 127 Temperature: 1.050000 Total energy: -985.517678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.517678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.517678 (E_RNA) where: Base-Base interactions energy: -574.603 where: short stacking energy: -254.499 Base-Backbone interact. energy: -0.139 local terms energy: -284.776306 where: bonds (distance) C4'-P energy: -52.626 bonds (distance) P-C4' energy: -52.047 flat angles C4'-P-C4' energy: -57.197 flat angles P-C4'-P energy: -43.099 tors. eta vs tors. theta energy: -79.807 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 127 Temperature: 1.100000 Total energy: -914.307717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -914.307717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.307717 (E_RNA) where: Base-Base interactions energy: -522.367 where: short stacking energy: -226.494 Base-Backbone interact. energy: 1.433 local terms energy: -267.373756 where: bonds (distance) C4'-P energy: -44.728 bonds (distance) P-C4' energy: -49.019 flat angles C4'-P-C4' energy: -58.453 flat angles P-C4'-P energy: -42.759 tors. eta vs tors. theta energy: -72.415 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 127 Temperature: 1.150000 Total energy: -975.004643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.004643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -847.204643 (E_RNA) where: Base-Base interactions energy: -552.619 where: short stacking energy: -255.024 Base-Backbone interact. energy: -1.094 local terms energy: -293.491872 where: bonds (distance) C4'-P energy: -53.891 bonds (distance) P-C4' energy: -54.589 flat angles C4'-P-C4' energy: -56.595 flat angles P-C4'-P energy: -49.988 tors. eta vs tors. theta energy: -78.428 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 127 Temperature: 1.200000 Total energy: -844.860645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -844.860645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.460645 (E_RNA) where: Base-Base interactions energy: -469.346 where: short stacking energy: -199.323 Base-Backbone interact. energy: -1.282 local terms energy: -251.832688 where: bonds (distance) C4'-P energy: -49.667 bonds (distance) P-C4' energy: -57.304 flat angles C4'-P-C4' energy: -46.330 flat angles P-C4'-P energy: -35.763 tors. eta vs tors. theta energy: -62.768 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 127 Temperature: 1.250000 Total energy: -812.386112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.386112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.986112 (E_RNA) where: Base-Base interactions energy: -447.715 where: short stacking energy: -193.486 Base-Backbone interact. energy: -0.756 local terms energy: -241.515326 where: bonds (distance) C4'-P energy: -56.153 bonds (distance) P-C4' energy: -47.054 flat angles C4'-P-C4' energy: -51.853 flat angles P-C4'-P energy: -32.823 tors. eta vs tors. theta energy: -53.632 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 127 Temperature: 1.300000 Total energy: -688.988597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.988597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.588597 (E_RNA) where: Base-Base interactions energy: -357.726 where: short stacking energy: -146.845 Base-Backbone interact. energy: -1.332 local terms energy: -216.531209 where: bonds (distance) C4'-P energy: -54.909 bonds (distance) P-C4' energy: -53.411 flat angles C4'-P-C4' energy: -46.720 flat angles P-C4'-P energy: -30.745 tors. eta vs tors. theta energy: -30.746 Dist. restrs. and SS energy: -113.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 127 Temperature: 1.350000 Total energy: -706.032859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.032859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.832859 (E_RNA) where: Base-Base interactions energy: -386.881 where: short stacking energy: -157.402 Base-Backbone interact. energy: 0.615 local terms energy: -204.566467 where: bonds (distance) C4'-P energy: -50.762 bonds (distance) P-C4' energy: -53.091 flat angles C4'-P-C4' energy: -47.230 flat angles P-C4'-P energy: -15.379 tors. eta vs tors. theta energy: -38.105 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 128 Temperature: 0.900000 Total energy: -1054.492427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1054.492427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.892427 (E_RNA) where: Base-Base interactions energy: -622.979 where: short stacking energy: -270.509 Base-Backbone interact. energy: -0.499 local terms energy: -301.414238 where: bonds (distance) C4'-P energy: -56.200 bonds (distance) P-C4' energy: -58.475 flat angles C4'-P-C4' energy: -61.571 flat angles P-C4'-P energy: -44.087 tors. eta vs tors. theta energy: -81.081 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 128 Temperature: 0.950000 Total energy: -1083.008048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.008048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -957.008048 (E_RNA) where: Base-Base interactions energy: -670.910 where: short stacking energy: -265.569 Base-Backbone interact. energy: -1.464 local terms energy: -284.634153 where: bonds (distance) C4'-P energy: -60.690 bonds (distance) P-C4' energy: -49.476 flat angles C4'-P-C4' energy: -58.039 flat angles P-C4'-P energy: -39.825 tors. eta vs tors. theta energy: -76.603 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 128 Temperature: 1.000000 Total energy: -1043.463480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.463480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.863480 (E_RNA) where: Base-Base interactions energy: -615.414 where: short stacking energy: -254.407 Base-Backbone interact. energy: -0.550 local terms energy: -297.899260 where: bonds (distance) C4'-P energy: -54.800 bonds (distance) P-C4' energy: -56.262 flat angles C4'-P-C4' energy: -64.725 flat angles P-C4'-P energy: -41.018 tors. eta vs tors. theta energy: -81.094 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 128 Temperature: 1.050000 Total energy: -1012.608601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1012.608601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.608601 (E_RNA) where: Base-Base interactions energy: -602.748 where: short stacking energy: -262.971 Base-Backbone interact. energy: 1.410 local terms energy: -285.270565 where: bonds (distance) C4'-P energy: -55.285 bonds (distance) P-C4' energy: -57.421 flat angles C4'-P-C4' energy: -54.376 flat angles P-C4'-P energy: -40.021 tors. eta vs tors. theta energy: -78.166 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 128 Temperature: 1.100000 Total energy: -921.821955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.821955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.021955 (E_RNA) where: Base-Base interactions energy: -527.240 where: short stacking energy: -221.295 Base-Backbone interact. energy: -1.805 local terms energy: -264.977103 where: bonds (distance) C4'-P energy: -39.349 bonds (distance) P-C4' energy: -55.121 flat angles C4'-P-C4' energy: -59.218 flat angles P-C4'-P energy: -38.077 tors. eta vs tors. theta energy: -73.212 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 128 Temperature: 1.150000 Total energy: -893.276624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.276624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.276624 (E_RNA) where: Base-Base interactions energy: -502.731 where: short stacking energy: -230.822 Base-Backbone interact. energy: -0.740 local terms energy: -263.804851 where: bonds (distance) C4'-P energy: -52.250 bonds (distance) P-C4' energy: -61.220 flat angles C4'-P-C4' energy: -57.600 flat angles P-C4'-P energy: -32.894 tors. eta vs tors. theta energy: -59.842 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 128 Temperature: 1.200000 Total energy: -849.684095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.684095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.484095 (E_RNA) where: Base-Base interactions energy: -469.888 where: short stacking energy: -196.851 Base-Backbone interact. energy: -0.090 local terms energy: -255.506092 where: bonds (distance) C4'-P energy: -52.272 bonds (distance) P-C4' energy: -56.648 flat angles C4'-P-C4' energy: -54.811 flat angles P-C4'-P energy: -30.504 tors. eta vs tors. theta energy: -61.270 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 128 Temperature: 1.250000 Total energy: -799.370340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.370340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.370340 (E_RNA) where: Base-Base interactions energy: -452.941 where: short stacking energy: -201.533 Base-Backbone interact. energy: -0.302 local terms energy: -220.128003 where: bonds (distance) C4'-P energy: -35.750 bonds (distance) P-C4' energy: -35.137 flat angles C4'-P-C4' energy: -49.601 flat angles P-C4'-P energy: -32.408 tors. eta vs tors. theta energy: -67.232 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 128 Temperature: 1.300000 Total energy: -685.488084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.488084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.488084 (E_RNA) where: Base-Base interactions energy: -378.926 where: short stacking energy: -151.115 Base-Backbone interact. energy: -1.490 local terms energy: -179.072062 where: bonds (distance) C4'-P energy: -46.219 bonds (distance) P-C4' energy: -44.716 flat angles C4'-P-C4' energy: -35.668 flat angles P-C4'-P energy: -23.554 tors. eta vs tors. theta energy: -28.916 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 128 Temperature: 1.350000 Total energy: -681.078491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.078491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.078491 (E_RNA) where: Base-Base interactions energy: -345.260 where: short stacking energy: -143.526 Base-Backbone interact. energy: -0.042 local terms energy: -209.776271 where: bonds (distance) C4'-P energy: -51.363 bonds (distance) P-C4' energy: -56.983 flat angles C4'-P-C4' energy: -47.253 flat angles P-C4'-P energy: -20.183 tors. eta vs tors. theta energy: -33.994 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 129 Temperature: 0.900000 Total energy: -1061.177512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.177512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -935.177512 (E_RNA) where: Base-Base interactions energy: -639.176 where: short stacking energy: -264.063 Base-Backbone interact. energy: -0.985 local terms energy: -295.016137 where: bonds (distance) C4'-P energy: -59.844 bonds (distance) P-C4' energy: -48.607 flat angles C4'-P-C4' energy: -63.896 flat angles P-C4'-P energy: -43.461 tors. eta vs tors. theta energy: -79.208 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 129 Temperature: 0.950000 Total energy: -1068.035261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.035261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.235261 (E_RNA) where: Base-Base interactions energy: -641.887 where: short stacking energy: -259.464 Base-Backbone interact. energy: -0.145 local terms energy: -298.203725 where: bonds (distance) C4'-P energy: -50.750 bonds (distance) P-C4' energy: -58.208 flat angles C4'-P-C4' energy: -66.335 flat angles P-C4'-P energy: -39.965 tors. eta vs tors. theta energy: -82.946 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 129 Temperature: 1.000000 Total energy: -1038.874103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.874103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -909.274103 (E_RNA) where: Base-Base interactions energy: -635.667 where: short stacking energy: -246.173 Base-Backbone interact. energy: -1.182 local terms energy: -272.424356 where: bonds (distance) C4'-P energy: -52.231 bonds (distance) P-C4' energy: -53.711 flat angles C4'-P-C4' energy: -53.583 flat angles P-C4'-P energy: -37.417 tors. eta vs tors. theta energy: -75.482 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 129 Temperature: 1.050000 Total energy: -987.668905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.668905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.868905 (E_RNA) where: Base-Base interactions energy: -582.355 where: short stacking energy: -261.185 Base-Backbone interact. energy: -0.748 local terms energy: -276.765882 where: bonds (distance) C4'-P energy: -58.978 bonds (distance) P-C4' energy: -42.278 flat angles C4'-P-C4' energy: -56.137 flat angles P-C4'-P energy: -39.937 tors. eta vs tors. theta energy: -79.436 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 129 Temperature: 1.100000 Total energy: -916.795594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -916.795594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.795594 (E_RNA) where: Base-Base interactions energy: -520.694 where: short stacking energy: -229.227 Base-Backbone interact. energy: 0.226 local terms energy: -270.327632 where: bonds (distance) C4'-P energy: -54.998 bonds (distance) P-C4' energy: -52.126 flat angles C4'-P-C4' energy: -58.227 flat angles P-C4'-P energy: -31.437 tors. eta vs tors. theta energy: -73.539 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 129 Temperature: 1.150000 Total energy: -896.445021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.445021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.845021 (E_RNA) where: Base-Base interactions energy: -510.711 where: short stacking energy: -234.552 Base-Backbone interact. energy: 1.869 local terms energy: -258.002536 where: bonds (distance) C4'-P energy: -43.884 bonds (distance) P-C4' energy: -48.614 flat angles C4'-P-C4' energy: -57.504 flat angles P-C4'-P energy: -46.275 tors. eta vs tors. theta energy: -61.725 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 129 Temperature: 1.200000 Total energy: -873.399802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -873.399802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.199802 (E_RNA) where: Base-Base interactions energy: -506.742 where: short stacking energy: -213.010 Base-Backbone interact. energy: -1.321 local terms energy: -241.136938 where: bonds (distance) C4'-P energy: -42.226 bonds (distance) P-C4' energy: -41.140 flat angles C4'-P-C4' energy: -60.666 flat angles P-C4'-P energy: -33.265 tors. eta vs tors. theta energy: -63.839 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 129 Temperature: 1.250000 Total energy: -822.125368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.125368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.925368 (E_RNA) where: Base-Base interactions energy: -458.780 where: short stacking energy: -209.935 Base-Backbone interact. energy: 0.580 local terms energy: -239.725423 where: bonds (distance) C4'-P energy: -44.314 bonds (distance) P-C4' energy: -52.872 flat angles C4'-P-C4' energy: -57.000 flat angles P-C4'-P energy: -27.643 tors. eta vs tors. theta energy: -57.897 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 129 Temperature: 1.300000 Total energy: -699.456859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.456859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.656859 (E_RNA) where: Base-Base interactions energy: -380.576 where: short stacking energy: -161.576 Base-Backbone interact. energy: -0.508 local terms energy: -190.573315 where: bonds (distance) C4'-P energy: -38.851 bonds (distance) P-C4' energy: -45.009 flat angles C4'-P-C4' energy: -39.458 flat angles P-C4'-P energy: -35.927 tors. eta vs tors. theta energy: -31.329 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 129 Temperature: 1.350000 Total energy: -669.814567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.814567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.214567 (E_RNA) where: Base-Base interactions energy: -349.823 where: short stacking energy: -143.381 Base-Backbone interact. energy: 3.180 local terms energy: -193.572070 where: bonds (distance) C4'-P energy: -41.088 bonds (distance) P-C4' energy: -52.733 flat angles C4'-P-C4' energy: -47.012 flat angles P-C4'-P energy: -31.792 tors. eta vs tors. theta energy: -20.948 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 130 Temperature: 0.900000 Total energy: -1089.932199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.932199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.332199 (E_RNA) where: Base-Base interactions energy: -663.919 where: short stacking energy: -268.011 Base-Backbone interact. energy: -0.604 local terms energy: -295.809414 where: bonds (distance) C4'-P energy: -58.423 bonds (distance) P-C4' energy: -58.271 flat angles C4'-P-C4' energy: -64.502 flat angles P-C4'-P energy: -34.811 tors. eta vs tors. theta energy: -79.804 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 130 Temperature: 0.950000 Total energy: -1021.256998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.256998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -891.656998 (E_RNA) where: Base-Base interactions energy: -609.540 where: short stacking energy: -255.809 Base-Backbone interact. energy: -0.638 local terms energy: -281.478788 where: bonds (distance) C4'-P energy: -45.776 bonds (distance) P-C4' energy: -60.878 flat angles C4'-P-C4' energy: -61.363 flat angles P-C4'-P energy: -35.914 tors. eta vs tors. theta energy: -77.548 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 130 Temperature: 1.000000 Total energy: -1031.881801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.881801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -904.081801 (E_RNA) where: Base-Base interactions energy: -624.088 where: short stacking energy: -242.475 Base-Backbone interact. energy: -1.769 local terms energy: -278.225183 where: bonds (distance) C4'-P energy: -54.484 bonds (distance) P-C4' energy: -57.641 flat angles C4'-P-C4' energy: -54.086 flat angles P-C4'-P energy: -40.170 tors. eta vs tors. theta energy: -71.845 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 130 Temperature: 1.050000 Total energy: -990.538142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -990.538142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.938142 (E_RNA) where: Base-Base interactions energy: -594.464 where: short stacking energy: -264.960 Base-Backbone interact. energy: -0.171 local terms energy: -266.303016 where: bonds (distance) C4'-P energy: -40.048 bonds (distance) P-C4' energy: -45.901 flat angles C4'-P-C4' energy: -58.717 flat angles P-C4'-P energy: -42.009 tors. eta vs tors. theta energy: -79.628 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 130 Temperature: 1.100000 Total energy: -890.896799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -890.896799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.296799 (E_RNA) where: Base-Base interactions energy: -503.975 where: short stacking energy: -219.709 Base-Backbone interact. energy: 0.025 local terms energy: -257.346788 where: bonds (distance) C4'-P energy: -47.949 bonds (distance) P-C4' energy: -57.814 flat angles C4'-P-C4' energy: -49.232 flat angles P-C4'-P energy: -42.620 tors. eta vs tors. theta energy: -59.732 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 130 Temperature: 1.150000 Total energy: -844.581477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -844.581477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.381477 (E_RNA) where: Base-Base interactions energy: -467.588 where: short stacking energy: -211.841 Base-Backbone interact. energy: 0.543 local terms energy: -253.336639 where: bonds (distance) C4'-P energy: -53.638 bonds (distance) P-C4' energy: -47.880 flat angles C4'-P-C4' energy: -59.016 flat angles P-C4'-P energy: -36.767 tors. eta vs tors. theta energy: -56.035 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 130 Temperature: 1.200000 Total energy: -863.770935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -863.770935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.370935 (E_RNA) where: Base-Base interactions energy: -497.042 where: short stacking energy: -226.335 Base-Backbone interact. energy: -0.792 local terms energy: -243.537681 where: bonds (distance) C4'-P energy: -47.263 bonds (distance) P-C4' energy: -48.402 flat angles C4'-P-C4' energy: -55.757 flat angles P-C4'-P energy: -32.317 tors. eta vs tors. theta energy: -59.799 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 130 Temperature: 1.250000 Total energy: -831.474821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.474821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.074821 (E_RNA) where: Base-Base interactions energy: -465.461 where: short stacking energy: -201.106 Base-Backbone interact. energy: -1.104 local terms energy: -242.509412 where: bonds (distance) C4'-P energy: -46.443 bonds (distance) P-C4' energy: -41.453 flat angles C4'-P-C4' energy: -64.531 flat angles P-C4'-P energy: -27.820 tors. eta vs tors. theta energy: -62.261 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 130 Temperature: 1.300000 Total energy: -710.076581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -710.076581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.476581 (E_RNA) where: Base-Base interactions energy: -384.902 where: short stacking energy: -162.172 Base-Backbone interact. energy: -1.120 local terms energy: -194.454227 where: bonds (distance) C4'-P energy: -45.765 bonds (distance) P-C4' energy: -42.692 flat angles C4'-P-C4' energy: -39.742 flat angles P-C4'-P energy: -30.418 tors. eta vs tors. theta energy: -35.837 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 130 Temperature: 1.350000 Total energy: -732.229993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.229993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.229993 (E_RNA) where: Base-Base interactions energy: -391.107 where: short stacking energy: -161.262 Base-Backbone interact. energy: 1.051 local terms energy: -216.174065 where: bonds (distance) C4'-P energy: -47.503 bonds (distance) P-C4' energy: -49.391 flat angles C4'-P-C4' energy: -52.267 flat angles P-C4'-P energy: -29.493 tors. eta vs tors. theta energy: -37.520 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 131 Temperature: 0.900000 Total energy: -1076.305144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.305144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -946.705144 (E_RNA) where: Base-Base interactions energy: -657.347 where: short stacking energy: -268.465 Base-Backbone interact. energy: -0.737 local terms energy: -288.620718 where: bonds (distance) C4'-P energy: -60.847 bonds (distance) P-C4' energy: -53.249 flat angles C4'-P-C4' energy: -60.972 flat angles P-C4'-P energy: -39.705 tors. eta vs tors. theta energy: -73.848 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 131 Temperature: 0.950000 Total energy: -1079.763071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1079.763071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -950.163071 (E_RNA) where: Base-Base interactions energy: -662.245 where: short stacking energy: -265.197 Base-Backbone interact. energy: -2.935 local terms energy: -284.982795 where: bonds (distance) C4'-P energy: -46.239 bonds (distance) P-C4' energy: -55.354 flat angles C4'-P-C4' energy: -61.692 flat angles P-C4'-P energy: -40.154 tors. eta vs tors. theta energy: -81.544 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 131 Temperature: 1.000000 Total energy: -993.147721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -993.147721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.147721 (E_RNA) where: Base-Base interactions energy: -602.304 where: short stacking energy: -245.952 Base-Backbone interact. energy: -0.337 local terms energy: -264.506410 where: bonds (distance) C4'-P energy: -57.456 bonds (distance) P-C4' energy: -44.048 flat angles C4'-P-C4' energy: -54.221 flat angles P-C4'-P energy: -37.979 tors. eta vs tors. theta energy: -70.802 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 131 Temperature: 1.050000 Total energy: -971.578982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -971.578982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.978982 (E_RNA) where: Base-Base interactions energy: -580.723 where: short stacking energy: -248.567 Base-Backbone interact. energy: -0.188 local terms energy: -261.068518 where: bonds (distance) C4'-P energy: -48.421 bonds (distance) P-C4' energy: -51.418 flat angles C4'-P-C4' energy: -55.156 flat angles P-C4'-P energy: -34.787 tors. eta vs tors. theta energy: -71.286 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 131 Temperature: 1.100000 Total energy: -909.075369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -909.075369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.475369 (E_RNA) where: Base-Base interactions energy: -509.737 where: short stacking energy: -228.911 Base-Backbone interact. energy: 2.906 local terms energy: -272.644022 where: bonds (distance) C4'-P energy: -48.464 bonds (distance) P-C4' energy: -56.441 flat angles C4'-P-C4' energy: -58.304 flat angles P-C4'-P energy: -47.040 tors. eta vs tors. theta energy: -62.394 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 131 Temperature: 1.150000 Total energy: -855.247805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.247805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.647805 (E_RNA) where: Base-Base interactions energy: -497.700 where: short stacking energy: -214.876 Base-Backbone interact. energy: -0.578 local terms energy: -236.370686 where: bonds (distance) C4'-P energy: -42.604 bonds (distance) P-C4' energy: -39.917 flat angles C4'-P-C4' energy: -59.531 flat angles P-C4'-P energy: -31.164 tors. eta vs tors. theta energy: -63.156 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 131 Temperature: 1.200000 Total energy: -832.848320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.848320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.048320 (E_RNA) where: Base-Base interactions energy: -470.850 where: short stacking energy: -213.177 Base-Backbone interact. energy: -0.519 local terms energy: -233.679245 where: bonds (distance) C4'-P energy: -59.845 bonds (distance) P-C4' energy: -35.767 flat angles C4'-P-C4' energy: -51.830 flat angles P-C4'-P energy: -28.517 tors. eta vs tors. theta energy: -57.720 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 131 Temperature: 1.250000 Total energy: -772.461763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.461763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.861763 (E_RNA) where: Base-Base interactions energy: -429.608 where: short stacking energy: -175.162 Base-Backbone interact. energy: 0.055 local terms energy: -222.308990 where: bonds (distance) C4'-P energy: -38.184 bonds (distance) P-C4' energy: -34.171 flat angles C4'-P-C4' energy: -54.641 flat angles P-C4'-P energy: -42.895 tors. eta vs tors. theta energy: -52.417 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 131 Temperature: 1.300000 Total energy: -757.950676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -757.950676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.150676 (E_RNA) where: Base-Base interactions energy: -401.701 where: short stacking energy: -171.723 Base-Backbone interact. energy: 0.910 local terms energy: -229.360365 where: bonds (distance) C4'-P energy: -42.339 bonds (distance) P-C4' energy: -47.865 flat angles C4'-P-C4' energy: -54.382 flat angles P-C4'-P energy: -33.768 tors. eta vs tors. theta energy: -51.006 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 131 Temperature: 1.350000 Total energy: -734.795137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.795137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.595137 (E_RNA) where: Base-Base interactions energy: -418.811 where: short stacking energy: -167.496 Base-Backbone interact. energy: -1.118 local terms energy: -190.666346 where: bonds (distance) C4'-P energy: -30.068 bonds (distance) P-C4' energy: -49.787 flat angles C4'-P-C4' energy: -45.645 flat angles P-C4'-P energy: -27.595 tors. eta vs tors. theta energy: -37.572 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 132 Temperature: 0.900000 Total energy: -1074.078080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1074.078080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -951.678080 (E_RNA) where: Base-Base interactions energy: -648.265 where: short stacking energy: -254.866 Base-Backbone interact. energy: -2.280 local terms energy: -301.133186 where: bonds (distance) C4'-P energy: -54.446 bonds (distance) P-C4' energy: -55.730 flat angles C4'-P-C4' energy: -60.982 flat angles P-C4'-P energy: -48.247 tors. eta vs tors. theta energy: -81.729 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 132 Temperature: 0.950000 Total energy: -1078.634319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.634319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.034319 (E_RNA) where: Base-Base interactions energy: -652.116 where: short stacking energy: -270.910 Base-Backbone interact. energy: -0.658 local terms energy: -296.260922 where: bonds (distance) C4'-P energy: -49.802 bonds (distance) P-C4' energy: -55.295 flat angles C4'-P-C4' energy: -62.353 flat angles P-C4'-P energy: -46.327 tors. eta vs tors. theta energy: -82.484 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 132 Temperature: 1.000000 Total energy: -997.416010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.416010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -869.616010 (E_RNA) where: Base-Base interactions energy: -575.005 where: short stacking energy: -254.987 Base-Backbone interact. energy: -0.891 local terms energy: -293.719878 where: bonds (distance) C4'-P energy: -66.219 bonds (distance) P-C4' energy: -51.484 flat angles C4'-P-C4' energy: -60.558 flat angles P-C4'-P energy: -43.727 tors. eta vs tors. theta energy: -71.731 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 132 Temperature: 1.050000 Total energy: -980.526716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.526716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -852.726716 (E_RNA) where: Base-Base interactions energy: -585.693 where: short stacking energy: -239.755 Base-Backbone interact. energy: -2.544 local terms energy: -264.489930 where: bonds (distance) C4'-P energy: -42.420 bonds (distance) P-C4' energy: -53.368 flat angles C4'-P-C4' energy: -60.068 flat angles P-C4'-P energy: -37.812 tors. eta vs tors. theta energy: -70.821 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 132 Temperature: 1.100000 Total energy: -889.753153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.753153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.953153 (E_RNA) where: Base-Base interactions energy: -491.494 where: short stacking energy: -222.045 Base-Backbone interact. energy: 0.112 local terms energy: -270.570600 where: bonds (distance) C4'-P energy: -53.745 bonds (distance) P-C4' energy: -52.272 flat angles C4'-P-C4' energy: -59.852 flat angles P-C4'-P energy: -39.811 tors. eta vs tors. theta energy: -64.891 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 132 Temperature: 1.150000 Total energy: -921.391436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.391436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.791436 (E_RNA) where: Base-Base interactions energy: -524.501 where: short stacking energy: -235.015 Base-Backbone interact. energy: -1.761 local terms energy: -265.529770 where: bonds (distance) C4'-P energy: -49.668 bonds (distance) P-C4' energy: -51.268 flat angles C4'-P-C4' energy: -57.418 flat angles P-C4'-P energy: -34.024 tors. eta vs tors. theta energy: -73.152 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 132 Temperature: 1.200000 Total energy: -864.613974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -864.613974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.613974 (E_RNA) where: Base-Base interactions energy: -491.457 where: short stacking energy: -198.639 Base-Backbone interact. energy: 0.193 local terms energy: -247.349914 where: bonds (distance) C4'-P energy: -49.423 bonds (distance) P-C4' energy: -51.421 flat angles C4'-P-C4' energy: -53.523 flat angles P-C4'-P energy: -32.407 tors. eta vs tors. theta energy: -60.575 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 132 Temperature: 1.250000 Total energy: -807.795520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -807.795520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.195520 (E_RNA) where: Base-Base interactions energy: -458.957 where: short stacking energy: -196.507 Base-Backbone interact. energy: -0.848 local terms energy: -218.390630 where: bonds (distance) C4'-P energy: -39.004 bonds (distance) P-C4' energy: -44.026 flat angles C4'-P-C4' energy: -52.212 flat angles P-C4'-P energy: -29.225 tors. eta vs tors. theta energy: -53.924 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 132 Temperature: 1.300000 Total energy: -730.334998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.334998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.134998 (E_RNA) where: Base-Base interactions energy: -384.772 where: short stacking energy: -164.570 Base-Backbone interact. energy: -0.854 local terms energy: -220.508842 where: bonds (distance) C4'-P energy: -44.998 bonds (distance) P-C4' energy: -45.159 flat angles C4'-P-C4' energy: -60.768 flat angles P-C4'-P energy: -22.716 tors. eta vs tors. theta energy: -46.869 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 132 Temperature: 1.350000 Total energy: -789.973372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.973372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.773372 (E_RNA) where: Base-Base interactions energy: -423.020 where: short stacking energy: -190.034 Base-Backbone interact. energy: -0.372 local terms energy: -242.381880 where: bonds (distance) C4'-P energy: -48.290 bonds (distance) P-C4' energy: -51.686 flat angles C4'-P-C4' energy: -51.124 flat angles P-C4'-P energy: -37.352 tors. eta vs tors. theta energy: -53.930 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 133 Temperature: 0.900000 Total energy: -1082.637565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1082.637565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.037565 (E_RNA) where: Base-Base interactions energy: -655.377 where: short stacking energy: -261.383 Base-Backbone interact. energy: -4.794 local terms energy: -292.865895 where: bonds (distance) C4'-P energy: -54.957 bonds (distance) P-C4' energy: -53.470 flat angles C4'-P-C4' energy: -60.656 flat angles P-C4'-P energy: -45.746 tors. eta vs tors. theta energy: -78.037 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 133 Temperature: 0.950000 Total energy: -1075.254086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1075.254086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -951.054086 (E_RNA) where: Base-Base interactions energy: -650.453 where: short stacking energy: -274.283 Base-Backbone interact. energy: -0.290 local terms energy: -300.310683 where: bonds (distance) C4'-P energy: -58.196 bonds (distance) P-C4' energy: -51.972 flat angles C4'-P-C4' energy: -61.310 flat angles P-C4'-P energy: -43.550 tors. eta vs tors. theta energy: -85.282 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 133 Temperature: 1.000000 Total energy: -1018.303885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1018.303885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -888.703885 (E_RNA) where: Base-Base interactions energy: -595.393 where: short stacking energy: -257.841 Base-Backbone interact. energy: -1.033 local terms energy: -292.277040 where: bonds (distance) C4'-P energy: -54.434 bonds (distance) P-C4' energy: -59.481 flat angles C4'-P-C4' energy: -60.096 flat angles P-C4'-P energy: -41.940 tors. eta vs tors. theta energy: -76.326 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 133 Temperature: 1.050000 Total energy: -1013.177075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1013.177075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.177075 (E_RNA) where: Base-Base interactions energy: -605.603 where: short stacking energy: -254.197 Base-Backbone interact. energy: 2.173 local terms energy: -283.746448 where: bonds (distance) C4'-P energy: -56.594 bonds (distance) P-C4' energy: -51.175 flat angles C4'-P-C4' energy: -64.279 flat angles P-C4'-P energy: -39.315 tors. eta vs tors. theta energy: -72.384 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 133 Temperature: 1.100000 Total energy: -929.437085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -929.437085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -801.637085 (E_RNA) where: Base-Base interactions energy: -533.418 where: short stacking energy: -226.329 Base-Backbone interact. energy: -0.443 local terms energy: -267.775603 where: bonds (distance) C4'-P energy: -60.351 bonds (distance) P-C4' energy: -42.174 flat angles C4'-P-C4' energy: -55.369 flat angles P-C4'-P energy: -43.472 tors. eta vs tors. theta energy: -66.409 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 133 Temperature: 1.150000 Total energy: -889.169649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.169649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.569649 (E_RNA) where: Base-Base interactions energy: -509.131 where: short stacking energy: -218.433 Base-Backbone interact. energy: -0.508 local terms energy: -249.930852 where: bonds (distance) C4'-P energy: -46.871 bonds (distance) P-C4' energy: -54.700 flat angles C4'-P-C4' energy: -49.402 flat angles P-C4'-P energy: -36.641 tors. eta vs tors. theta energy: -62.317 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 133 Temperature: 1.200000 Total energy: -861.736067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -861.736067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.136067 (E_RNA) where: Base-Base interactions energy: -494.434 where: short stacking energy: -207.518 Base-Backbone interact. energy: 0.423 local terms energy: -238.125438 where: bonds (distance) C4'-P energy: -44.671 bonds (distance) P-C4' energy: -39.612 flat angles C4'-P-C4' energy: -44.318 flat angles P-C4'-P energy: -45.135 tors. eta vs tors. theta energy: -64.390 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 133 Temperature: 1.250000 Total energy: -809.290598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -809.290598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.490598 (E_RNA) where: Base-Base interactions energy: -450.165 where: short stacking energy: -199.737 Base-Backbone interact. energy: -0.433 local terms energy: -230.892130 where: bonds (distance) C4'-P energy: -47.565 bonds (distance) P-C4' energy: -37.034 flat angles C4'-P-C4' energy: -55.170 flat angles P-C4'-P energy: -32.225 tors. eta vs tors. theta energy: -58.899 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 133 Temperature: 1.300000 Total energy: -714.132929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.132929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.132929 (E_RNA) where: Base-Base interactions energy: -375.971 where: short stacking energy: -163.694 Base-Backbone interact. energy: -1.116 local terms energy: -211.046267 where: bonds (distance) C4'-P energy: -45.236 bonds (distance) P-C4' energy: -42.055 flat angles C4'-P-C4' energy: -52.184 flat angles P-C4'-P energy: -39.923 tors. eta vs tors. theta energy: -31.649 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 133 Temperature: 1.350000 Total energy: -733.369553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -733.369553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.969553 (E_RNA) where: Base-Base interactions energy: -401.601 where: short stacking energy: -172.817 Base-Backbone interact. energy: 2.390 local terms energy: -211.758572 where: bonds (distance) C4'-P energy: -38.373 bonds (distance) P-C4' energy: -49.726 flat angles C4'-P-C4' energy: -47.223 flat angles P-C4'-P energy: -24.469 tors. eta vs tors. theta energy: -51.968 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 134 Temperature: 0.900000 Total energy: -1104.888860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1104.888860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -977.088860 (E_RNA) where: Base-Base interactions energy: -673.954 where: short stacking energy: -273.943 Base-Backbone interact. energy: -1.159 local terms energy: -301.975244 where: bonds (distance) C4'-P energy: -52.391 bonds (distance) P-C4' energy: -56.598 flat angles C4'-P-C4' energy: -69.256 flat angles P-C4'-P energy: -41.579 tors. eta vs tors. theta energy: -82.151 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 134 Temperature: 0.950000 Total energy: -1058.775779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.775779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.975779 (E_RNA) where: Base-Base interactions energy: -640.646 where: short stacking energy: -260.619 Base-Backbone interact. energy: -1.444 local terms energy: -288.885856 where: bonds (distance) C4'-P energy: -50.106 bonds (distance) P-C4' energy: -52.124 flat angles C4'-P-C4' energy: -58.076 flat angles P-C4'-P energy: -48.605 tors. eta vs tors. theta energy: -79.975 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 134 Temperature: 1.000000 Total energy: -1004.808401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.808401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -875.208401 (E_RNA) where: Base-Base interactions energy: -583.836 where: short stacking energy: -250.482 Base-Backbone interact. energy: 0.311 local terms energy: -291.683666 where: bonds (distance) C4'-P energy: -56.197 bonds (distance) P-C4' energy: -54.521 flat angles C4'-P-C4' energy: -59.864 flat angles P-C4'-P energy: -42.797 tors. eta vs tors. theta energy: -78.305 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 134 Temperature: 1.050000 Total energy: -1016.746902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.746902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -888.946902 (E_RNA) where: Base-Base interactions energy: -597.535 where: short stacking energy: -252.737 Base-Backbone interact. energy: -1.146 local terms energy: -290.265956 where: bonds (distance) C4'-P energy: -56.742 bonds (distance) P-C4' energy: -53.578 flat angles C4'-P-C4' energy: -61.444 flat angles P-C4'-P energy: -39.883 tors. eta vs tors. theta energy: -78.618 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 134 Temperature: 1.100000 Total energy: -940.247158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -940.247158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.247158 (E_RNA) where: Base-Base interactions energy: -551.735 where: short stacking energy: -243.158 Base-Backbone interact. energy: -1.122 local terms energy: -261.389912 where: bonds (distance) C4'-P energy: -40.773 bonds (distance) P-C4' energy: -44.826 flat angles C4'-P-C4' energy: -62.652 flat angles P-C4'-P energy: -36.096 tors. eta vs tors. theta energy: -77.044 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 134 Temperature: 1.150000 Total energy: -874.785859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -874.785859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.185859 (E_RNA) where: Base-Base interactions energy: -489.947 where: short stacking energy: -207.814 Base-Backbone interact. energy: -0.592 local terms energy: -254.646386 where: bonds (distance) C4'-P energy: -38.683 bonds (distance) P-C4' energy: -55.798 flat angles C4'-P-C4' energy: -56.968 flat angles P-C4'-P energy: -40.568 tors. eta vs tors. theta energy: -62.629 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 134 Temperature: 1.200000 Total energy: -851.245859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -851.245859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.045859 (E_RNA) where: Base-Base interactions energy: -474.399 where: short stacking energy: -213.635 Base-Backbone interact. energy: 2.634 local terms energy: -255.280697 where: bonds (distance) C4'-P energy: -48.694 bonds (distance) P-C4' energy: -47.192 flat angles C4'-P-C4' energy: -57.999 flat angles P-C4'-P energy: -39.931 tors. eta vs tors. theta energy: -61.465 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 134 Temperature: 1.250000 Total energy: -807.577667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -807.577667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.577667 (E_RNA) where: Base-Base interactions energy: -448.788 where: short stacking energy: -198.714 Base-Backbone interact. energy: -0.325 local terms energy: -232.464251 where: bonds (distance) C4'-P energy: -37.467 bonds (distance) P-C4' energy: -48.713 flat angles C4'-P-C4' energy: -54.043 flat angles P-C4'-P energy: -30.977 tors. eta vs tors. theta energy: -61.264 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 134 Temperature: 1.300000 Total energy: -732.052871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.052871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.052871 (E_RNA) where: Base-Base interactions energy: -397.741 where: short stacking energy: -162.452 Base-Backbone interact. energy: -2.288 local terms energy: -206.023869 where: bonds (distance) C4'-P energy: -40.071 bonds (distance) P-C4' energy: -48.732 flat angles C4'-P-C4' energy: -47.041 flat angles P-C4'-P energy: -31.208 tors. eta vs tors. theta energy: -38.973 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 134 Temperature: 1.350000 Total energy: -726.616923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.616923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.616923 (E_RNA) where: Base-Base interactions energy: -388.275 where: short stacking energy: -147.661 Base-Backbone interact. energy: 3.260 local terms energy: -215.601964 where: bonds (distance) C4'-P energy: -46.967 bonds (distance) P-C4' energy: -37.180 flat angles C4'-P-C4' energy: -55.783 flat angles P-C4'-P energy: -35.115 tors. eta vs tors. theta energy: -40.558 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 135 Temperature: 0.900000 Total energy: -1099.298833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1099.298833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -969.698833 (E_RNA) where: Base-Base interactions energy: -680.321 where: short stacking energy: -271.321 Base-Backbone interact. energy: 1.492 local terms energy: -290.869520 where: bonds (distance) C4'-P energy: -51.026 bonds (distance) P-C4' energy: -53.875 flat angles C4'-P-C4' energy: -65.572 flat angles P-C4'-P energy: -40.125 tors. eta vs tors. theta energy: -80.271 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 135 Temperature: 0.950000 Total energy: -1079.731925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1079.731925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -950.131925 (E_RNA) where: Base-Base interactions energy: -637.159 where: short stacking energy: -266.852 Base-Backbone interact. energy: -0.145 local terms energy: -312.828604 where: bonds (distance) C4'-P energy: -52.770 bonds (distance) P-C4' energy: -66.201 flat angles C4'-P-C4' energy: -60.790 flat angles P-C4'-P energy: -51.916 tors. eta vs tors. theta energy: -81.151 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 135 Temperature: 1.000000 Total energy: -1006.720031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.720031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -878.920031 (E_RNA) where: Base-Base interactions energy: -588.143 where: short stacking energy: -247.406 Base-Backbone interact. energy: -0.760 local terms energy: -290.016154 where: bonds (distance) C4'-P energy: -55.912 bonds (distance) P-C4' energy: -57.114 flat angles C4'-P-C4' energy: -54.915 flat angles P-C4'-P energy: -45.413 tors. eta vs tors. theta energy: -76.663 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 135 Temperature: 1.050000 Total energy: -999.433108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.433108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -873.433108 (E_RNA) where: Base-Base interactions energy: -601.719 where: short stacking energy: -252.030 Base-Backbone interact. energy: -2.056 local terms energy: -269.658376 where: bonds (distance) C4'-P energy: -56.117 bonds (distance) P-C4' energy: -42.024 flat angles C4'-P-C4' energy: -59.805 flat angles P-C4'-P energy: -37.582 tors. eta vs tors. theta energy: -74.130 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 135 Temperature: 1.100000 Total energy: -936.353144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -936.353144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -806.753144 (E_RNA) where: Base-Base interactions energy: -542.985 where: short stacking energy: -244.842 Base-Backbone interact. energy: -1.533 local terms energy: -262.234360 where: bonds (distance) C4'-P energy: -51.369 bonds (distance) P-C4' energy: -58.591 flat angles C4'-P-C4' energy: -51.855 flat angles P-C4'-P energy: -27.059 tors. eta vs tors. theta energy: -73.361 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 135 Temperature: 1.150000 Total energy: -889.445826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.445826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.645826 (E_RNA) where: Base-Base interactions energy: -503.458 where: short stacking energy: -232.896 Base-Backbone interact. energy: -1.165 local terms energy: -257.022592 where: bonds (distance) C4'-P energy: -53.912 bonds (distance) P-C4' energy: -49.018 flat angles C4'-P-C4' energy: -60.233 flat angles P-C4'-P energy: -34.961 tors. eta vs tors. theta energy: -58.898 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 135 Temperature: 1.200000 Total energy: -870.593460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -870.593460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.993460 (E_RNA) where: Base-Base interactions energy: -486.688 where: short stacking energy: -213.849 Base-Backbone interact. energy: 0.528 local terms energy: -254.833308 where: bonds (distance) C4'-P energy: -42.263 bonds (distance) P-C4' energy: -41.412 flat angles C4'-P-C4' energy: -58.022 flat angles P-C4'-P energy: -40.664 tors. eta vs tors. theta energy: -72.472 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 135 Temperature: 1.250000 Total energy: -792.944523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -792.944523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.544523 (E_RNA) where: Base-Base interactions energy: -431.144 where: short stacking energy: -170.693 Base-Backbone interact. energy: -1.063 local terms energy: -238.337511 where: bonds (distance) C4'-P energy: -45.950 bonds (distance) P-C4' energy: -48.916 flat angles C4'-P-C4' energy: -47.161 flat angles P-C4'-P energy: -41.790 tors. eta vs tors. theta energy: -54.521 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 135 Temperature: 1.300000 Total energy: -729.809917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.809917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.009917 (E_RNA) where: Base-Base interactions energy: -386.700 where: short stacking energy: -169.990 Base-Backbone interact. energy: 0.763 local terms energy: -216.072820 where: bonds (distance) C4'-P energy: -47.196 bonds (distance) P-C4' energy: -49.349 flat angles C4'-P-C4' energy: -47.236 flat angles P-C4'-P energy: -31.494 tors. eta vs tors. theta energy: -40.799 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 135 Temperature: 1.350000 Total energy: -738.152903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.152903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.952903 (E_RNA) where: Base-Base interactions energy: -402.184 where: short stacking energy: -167.975 Base-Backbone interact. energy: 0.274 local terms energy: -212.042858 where: bonds (distance) C4'-P energy: -37.477 bonds (distance) P-C4' energy: -42.769 flat angles C4'-P-C4' energy: -50.248 flat angles P-C4'-P energy: -30.762 tors. eta vs tors. theta energy: -50.786 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 136 Temperature: 0.900000 Total energy: -1113.787101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1113.787101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.187101 (E_RNA) where: Base-Base interactions energy: -675.516 where: short stacking energy: -274.030 Base-Backbone interact. energy: 0.140 local terms energy: -308.811674 where: bonds (distance) C4'-P energy: -64.478 bonds (distance) P-C4' energy: -55.148 flat angles C4'-P-C4' energy: -60.877 flat angles P-C4'-P energy: -42.197 tors. eta vs tors. theta energy: -86.112 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 136 Temperature: 0.950000 Total energy: -1075.900237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1075.900237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -948.100237 (E_RNA) where: Base-Base interactions energy: -663.568 where: short stacking energy: -248.542 Base-Backbone interact. energy: -2.147 local terms energy: -282.385521 where: bonds (distance) C4'-P energy: -46.769 bonds (distance) P-C4' energy: -48.807 flat angles C4'-P-C4' energy: -60.000 flat angles P-C4'-P energy: -46.463 tors. eta vs tors. theta energy: -80.346 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 136 Temperature: 1.000000 Total energy: -1032.629435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1032.629435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -904.829435 (E_RNA) where: Base-Base interactions energy: -597.385 where: short stacking energy: -266.481 Base-Backbone interact. energy: -0.218 local terms energy: -307.226224 where: bonds (distance) C4'-P energy: -50.720 bonds (distance) P-C4' energy: -59.126 flat angles C4'-P-C4' energy: -64.974 flat angles P-C4'-P energy: -41.727 tors. eta vs tors. theta energy: -90.678 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 136 Temperature: 1.050000 Total energy: -980.906195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.906195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -851.306195 (E_RNA) where: Base-Base interactions energy: -577.637 where: short stacking energy: -249.236 Base-Backbone interact. energy: -0.374 local terms energy: -273.295797 where: bonds (distance) C4'-P energy: -58.163 bonds (distance) P-C4' energy: -50.550 flat angles C4'-P-C4' energy: -49.147 flat angles P-C4'-P energy: -37.403 tors. eta vs tors. theta energy: -78.033 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 136 Temperature: 1.100000 Total energy: -910.650622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -910.650622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.850622 (E_RNA) where: Base-Base interactions energy: -506.862 where: short stacking energy: -229.855 Base-Backbone interact. energy: -0.286 local terms energy: -275.702495 where: bonds (distance) C4'-P energy: -48.304 bonds (distance) P-C4' energy: -55.850 flat angles C4'-P-C4' energy: -59.147 flat angles P-C4'-P energy: -44.476 tors. eta vs tors. theta energy: -67.925 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 136 Temperature: 1.150000 Total energy: -892.235025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -892.235025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.035025 (E_RNA) where: Base-Base interactions energy: -526.456 where: short stacking energy: -224.735 Base-Backbone interact. energy: 0.152 local terms energy: -241.731163 where: bonds (distance) C4'-P energy: -44.224 bonds (distance) P-C4' energy: -38.953 flat angles C4'-P-C4' energy: -58.137 flat angles P-C4'-P energy: -38.397 tors. eta vs tors. theta energy: -62.020 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 136 Temperature: 1.200000 Total energy: -845.970514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.970514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.570514 (E_RNA) where: Base-Base interactions energy: -475.749 where: short stacking energy: -200.329 Base-Backbone interact. energy: -1.633 local terms energy: -246.188673 where: bonds (distance) C4'-P energy: -48.938 bonds (distance) P-C4' energy: -46.044 flat angles C4'-P-C4' energy: -62.518 flat angles P-C4'-P energy: -31.887 tors. eta vs tors. theta energy: -56.802 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 136 Temperature: 1.250000 Total energy: -810.434976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.434976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.434976 (E_RNA) where: Base-Base interactions energy: -483.554 where: short stacking energy: -205.064 Base-Backbone interact. energy: -1.332 local terms energy: -199.548893 where: bonds (distance) C4'-P energy: -32.341 bonds (distance) P-C4' energy: -41.032 flat angles C4'-P-C4' energy: -45.748 flat angles P-C4'-P energy: -26.860 tors. eta vs tors. theta energy: -53.567 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 136 Temperature: 1.300000 Total energy: -748.263208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.263208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.463208 (E_RNA) where: Base-Base interactions energy: -392.555 where: short stacking energy: -161.079 Base-Backbone interact. energy: 0.090 local terms energy: -227.998119 where: bonds (distance) C4'-P energy: -43.958 bonds (distance) P-C4' energy: -52.103 flat angles C4'-P-C4' energy: -50.241 flat angles P-C4'-P energy: -43.816 tors. eta vs tors. theta energy: -37.880 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 136 Temperature: 1.350000 Total energy: -703.672465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.672465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.872465 (E_RNA) where: Base-Base interactions energy: -384.638 where: short stacking energy: -162.178 Base-Backbone interact. energy: 0.386 local terms energy: -191.619835 where: bonds (distance) C4'-P energy: -38.096 bonds (distance) P-C4' energy: -41.462 flat angles C4'-P-C4' energy: -47.576 flat angles P-C4'-P energy: -24.445 tors. eta vs tors. theta energy: -40.042 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 137 Temperature: 0.900000 Total energy: -1104.789082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1104.789082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.789082 (E_RNA) where: Base-Base interactions energy: -661.897 where: short stacking energy: -277.489 Base-Backbone interact. energy: -0.611 local terms energy: -316.281568 where: bonds (distance) C4'-P energy: -61.570 bonds (distance) P-C4' energy: -59.784 flat angles C4'-P-C4' energy: -66.901 flat angles P-C4'-P energy: -42.619 tors. eta vs tors. theta energy: -85.408 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 137 Temperature: 0.950000 Total energy: -1061.352356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.352356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.752356 (E_RNA) where: Base-Base interactions energy: -632.710 where: short stacking energy: -262.419 Base-Backbone interact. energy: -0.766 local terms energy: -298.277043 where: bonds (distance) C4'-P energy: -60.066 bonds (distance) P-C4' energy: -55.565 flat angles C4'-P-C4' energy: -57.617 flat angles P-C4'-P energy: -42.588 tors. eta vs tors. theta energy: -82.441 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 137 Temperature: 1.000000 Total energy: -1035.828863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.828863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.628863 (E_RNA) where: Base-Base interactions energy: -622.480 where: short stacking energy: -240.428 Base-Backbone interact. energy: -1.888 local terms energy: -287.261069 where: bonds (distance) C4'-P energy: -52.462 bonds (distance) P-C4' energy: -57.435 flat angles C4'-P-C4' energy: -58.344 flat angles P-C4'-P energy: -42.013 tors. eta vs tors. theta energy: -77.006 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 137 Temperature: 1.050000 Total energy: -991.935768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -991.935768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -864.135768 (E_RNA) where: Base-Base interactions energy: -567.829 where: short stacking energy: -253.064 Base-Backbone interact. energy: -0.644 local terms energy: -295.663050 where: bonds (distance) C4'-P energy: -47.148 bonds (distance) P-C4' energy: -57.939 flat angles C4'-P-C4' energy: -65.194 flat angles P-C4'-P energy: -45.494 tors. eta vs tors. theta energy: -79.888 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 137 Temperature: 1.100000 Total energy: -899.978099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -899.978099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.378099 (E_RNA) where: Base-Base interactions energy: -493.185 where: short stacking energy: -218.266 Base-Backbone interact. energy: 0.043 local terms energy: -277.235738 where: bonds (distance) C4'-P energy: -51.407 bonds (distance) P-C4' energy: -62.824 flat angles C4'-P-C4' energy: -56.988 flat angles P-C4'-P energy: -41.906 tors. eta vs tors. theta energy: -64.111 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 137 Temperature: 1.150000 Total energy: -925.757727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -925.757727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.957727 (E_RNA) where: Base-Base interactions energy: -523.344 where: short stacking energy: -212.438 Base-Backbone interact. energy: -0.449 local terms energy: -274.165397 where: bonds (distance) C4'-P energy: -53.074 bonds (distance) P-C4' energy: -55.708 flat angles C4'-P-C4' energy: -54.192 flat angles P-C4'-P energy: -36.925 tors. eta vs tors. theta energy: -74.266 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 137 Temperature: 1.200000 Total energy: -824.481193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.481193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.081193 (E_RNA) where: Base-Base interactions energy: -453.637 where: short stacking energy: -194.166 Base-Backbone interact. energy: 0.559 local terms energy: -249.002472 where: bonds (distance) C4'-P energy: -52.868 bonds (distance) P-C4' energy: -44.369 flat angles C4'-P-C4' energy: -55.088 flat angles P-C4'-P energy: -43.274 tors. eta vs tors. theta energy: -53.404 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 137 Temperature: 1.250000 Total energy: -773.455132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -773.455132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.455132 (E_RNA) where: Base-Base interactions energy: -414.564 where: short stacking energy: -177.408 Base-Backbone interact. energy: 0.422 local terms energy: -233.313291 where: bonds (distance) C4'-P energy: -47.989 bonds (distance) P-C4' energy: -39.396 flat angles C4'-P-C4' energy: -54.433 flat angles P-C4'-P energy: -42.889 tors. eta vs tors. theta energy: -48.606 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 137 Temperature: 1.300000 Total energy: -818.235443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.235443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.635443 (E_RNA) where: Base-Base interactions energy: -457.806 where: short stacking energy: -196.465 Base-Backbone interact. energy: -1.340 local terms energy: -229.489972 where: bonds (distance) C4'-P energy: -47.405 bonds (distance) P-C4' energy: -37.595 flat angles C4'-P-C4' energy: -48.799 flat angles P-C4'-P energy: -32.917 tors. eta vs tors. theta energy: -62.774 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 137 Temperature: 1.350000 Total energy: -710.544822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -710.544822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.944822 (E_RNA) where: Base-Base interactions energy: -370.433 where: short stacking energy: -157.003 Base-Backbone interact. energy: 0.074 local terms energy: -210.586449 where: bonds (distance) C4'-P energy: -49.347 bonds (distance) P-C4' energy: -59.751 flat angles C4'-P-C4' energy: -33.777 flat angles P-C4'-P energy: -32.613 tors. eta vs tors. theta energy: -35.100 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 138 Temperature: 0.900000 Total energy: -1090.038424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1090.038424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.438424 (E_RNA) where: Base-Base interactions energy: -646.760 where: short stacking energy: -283.420 Base-Backbone interact. energy: -0.556 local terms energy: -313.122535 where: bonds (distance) C4'-P energy: -57.143 bonds (distance) P-C4' energy: -64.492 flat angles C4'-P-C4' energy: -61.194 flat angles P-C4'-P energy: -42.745 tors. eta vs tors. theta energy: -87.549 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 138 Temperature: 0.950000 Total energy: -1065.309183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1065.309183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -935.709183 (E_RNA) where: Base-Base interactions energy: -634.914 where: short stacking energy: -280.175 Base-Backbone interact. energy: -0.027 local terms energy: -300.767566 where: bonds (distance) C4'-P energy: -49.033 bonds (distance) P-C4' energy: -54.488 flat angles C4'-P-C4' energy: -65.755 flat angles P-C4'-P energy: -42.585 tors. eta vs tors. theta energy: -88.908 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 138 Temperature: 1.000000 Total energy: -1024.565678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1024.565678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -896.765678 (E_RNA) where: Base-Base interactions energy: -620.675 where: short stacking energy: -228.699 Base-Backbone interact. energy: -1.765 local terms energy: -274.326360 where: bonds (distance) C4'-P energy: -48.668 bonds (distance) P-C4' energy: -51.631 flat angles C4'-P-C4' energy: -66.168 flat angles P-C4'-P energy: -36.575 tors. eta vs tors. theta energy: -71.283 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 138 Temperature: 1.050000 Total energy: -967.912217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -967.912217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.712217 (E_RNA) where: Base-Base interactions energy: -576.525 where: short stacking energy: -241.644 Base-Backbone interact. energy: 1.270 local terms energy: -268.457361 where: bonds (distance) C4'-P energy: -53.557 bonds (distance) P-C4' energy: -52.100 flat angles C4'-P-C4' energy: -56.591 flat angles P-C4'-P energy: -34.189 tors. eta vs tors. theta energy: -72.021 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 138 Temperature: 1.100000 Total energy: -953.320040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -953.320040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -825.520040 (E_RNA) where: Base-Base interactions energy: -556.219 where: short stacking energy: -231.325 Base-Backbone interact. energy: -0.944 local terms energy: -268.356660 where: bonds (distance) C4'-P energy: -49.199 bonds (distance) P-C4' energy: -50.178 flat angles C4'-P-C4' energy: -57.004 flat angles P-C4'-P energy: -35.176 tors. eta vs tors. theta energy: -76.799 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 138 Temperature: 1.150000 Total energy: -865.920511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -865.920511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.520511 (E_RNA) where: Base-Base interactions energy: -474.068 where: short stacking energy: -204.453 Base-Backbone interact. energy: -0.660 local terms energy: -268.792478 where: bonds (distance) C4'-P energy: -46.387 bonds (distance) P-C4' energy: -55.596 flat angles C4'-P-C4' energy: -61.137 flat angles P-C4'-P energy: -38.836 tors. eta vs tors. theta energy: -66.837 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 138 Temperature: 1.200000 Total energy: -833.466636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.466636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.666636 (E_RNA) where: Base-Base interactions energy: -463.282 where: short stacking energy: -195.252 Base-Backbone interact. energy: -0.928 local terms energy: -241.456773 where: bonds (distance) C4'-P energy: -51.659 bonds (distance) P-C4' energy: -54.744 flat angles C4'-P-C4' energy: -52.294 flat angles P-C4'-P energy: -31.500 tors. eta vs tors. theta energy: -51.261 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 138 Temperature: 1.250000 Total energy: -800.579321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.579321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.979321 (E_RNA) where: Base-Base interactions energy: -434.670 where: short stacking energy: -193.114 Base-Backbone interact. energy: -0.498 local terms energy: -235.810735 where: bonds (distance) C4'-P energy: -38.770 bonds (distance) P-C4' energy: -44.213 flat angles C4'-P-C4' energy: -56.414 flat angles P-C4'-P energy: -38.217 tors. eta vs tors. theta energy: -58.197 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 138 Temperature: 1.300000 Total energy: -791.655738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.655738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.855738 (E_RNA) where: Base-Base interactions energy: -445.948 where: short stacking energy: -191.131 Base-Backbone interact. energy: 1.728 local terms energy: -219.636274 where: bonds (distance) C4'-P energy: -46.751 bonds (distance) P-C4' energy: -49.990 flat angles C4'-P-C4' energy: -42.784 flat angles P-C4'-P energy: -23.630 tors. eta vs tors. theta energy: -56.481 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 138 Temperature: 1.350000 Total energy: -676.878676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.878676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.478676 (E_RNA) where: Base-Base interactions energy: -356.275 where: short stacking energy: -146.849 Base-Backbone interact. energy: 1.967 local terms energy: -200.171232 where: bonds (distance) C4'-P energy: -45.592 bonds (distance) P-C4' energy: -46.371 flat angles C4'-P-C4' energy: -49.968 flat angles P-C4'-P energy: -22.265 tors. eta vs tors. theta energy: -35.975 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 139 Temperature: 0.900000 Total energy: -1072.454703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1072.454703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -942.854703 (E_RNA) where: Base-Base interactions energy: -643.139 where: short stacking energy: -278.630 Base-Backbone interact. energy: -0.619 local terms energy: -299.096901 where: bonds (distance) C4'-P energy: -51.102 bonds (distance) P-C4' energy: -45.657 flat angles C4'-P-C4' energy: -69.800 flat angles P-C4'-P energy: -45.359 tors. eta vs tors. theta energy: -87.179 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 139 Temperature: 0.950000 Total energy: -1079.981857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1079.981857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.181857 (E_RNA) where: Base-Base interactions energy: -644.381 where: short stacking energy: -264.031 Base-Backbone interact. energy: -0.713 local terms energy: -307.088269 where: bonds (distance) C4'-P energy: -52.777 bonds (distance) P-C4' energy: -59.273 flat angles C4'-P-C4' energy: -64.717 flat angles P-C4'-P energy: -43.879 tors. eta vs tors. theta energy: -86.441 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 139 Temperature: 1.000000 Total energy: -1016.897712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.897712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.097712 (E_RNA) where: Base-Base interactions energy: -623.361 where: short stacking energy: -239.716 Base-Backbone interact. energy: -2.498 local terms energy: -263.238537 where: bonds (distance) C4'-P energy: -51.587 bonds (distance) P-C4' energy: -49.273 flat angles C4'-P-C4' energy: -55.792 flat angles P-C4'-P energy: -37.625 tors. eta vs tors. theta energy: -68.962 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 139 Temperature: 1.050000 Total energy: -974.790991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -974.790991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.190991 (E_RNA) where: Base-Base interactions energy: -582.492 where: short stacking energy: -253.947 Base-Backbone interact. energy: 2.380 local terms energy: -265.078440 where: bonds (distance) C4'-P energy: -51.670 bonds (distance) P-C4' energy: -49.215 flat angles C4'-P-C4' energy: -62.883 flat angles P-C4'-P energy: -37.199 tors. eta vs tors. theta energy: -64.112 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 139 Temperature: 1.100000 Total energy: -925.761299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -925.761299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.961299 (E_RNA) where: Base-Base interactions energy: -528.515 where: short stacking energy: -228.464 Base-Backbone interact. energy: -1.268 local terms energy: -268.178241 where: bonds (distance) C4'-P energy: -59.208 bonds (distance) P-C4' energy: -52.179 flat angles C4'-P-C4' energy: -53.769 flat angles P-C4'-P energy: -36.297 tors. eta vs tors. theta energy: -66.726 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 139 Temperature: 1.150000 Total energy: -876.281054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -876.281054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.481054 (E_RNA) where: Base-Base interactions energy: -501.858 where: short stacking energy: -231.672 Base-Backbone interact. energy: -1.733 local terms energy: -244.890058 where: bonds (distance) C4'-P energy: -44.557 bonds (distance) P-C4' energy: -53.458 flat angles C4'-P-C4' energy: -52.415 flat angles P-C4'-P energy: -35.390 tors. eta vs tors. theta energy: -59.069 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 139 Temperature: 1.200000 Total energy: -827.075871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.075871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.475871 (E_RNA) where: Base-Base interactions energy: -466.524 where: short stacking energy: -203.102 Base-Backbone interact. energy: -1.045 local terms energy: -229.906385 where: bonds (distance) C4'-P energy: -46.250 bonds (distance) P-C4' energy: -51.435 flat angles C4'-P-C4' energy: -49.019 flat angles P-C4'-P energy: -44.006 tors. eta vs tors. theta energy: -39.197 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 139 Temperature: 1.250000 Total energy: -831.401906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.401906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.801906 (E_RNA) where: Base-Base interactions energy: -458.936 where: short stacking energy: -198.035 Base-Backbone interact. energy: -0.482 local terms energy: -242.383485 where: bonds (distance) C4'-P energy: -48.340 bonds (distance) P-C4' energy: -51.894 flat angles C4'-P-C4' energy: -51.062 flat angles P-C4'-P energy: -28.726 tors. eta vs tors. theta energy: -62.361 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 139 Temperature: 1.300000 Total energy: -798.797048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.797048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.797048 (E_RNA) where: Base-Base interactions energy: -444.134 where: short stacking energy: -196.531 Base-Backbone interact. energy: 0.845 local terms energy: -229.507730 where: bonds (distance) C4'-P energy: -37.420 bonds (distance) P-C4' energy: -39.875 flat angles C4'-P-C4' energy: -47.481 flat angles P-C4'-P energy: -39.306 tors. eta vs tors. theta energy: -65.425 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 139 Temperature: 1.350000 Total energy: -672.794753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.794753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.794753 (E_RNA) where: Base-Base interactions energy: -349.016 where: short stacking energy: -146.026 Base-Backbone interact. energy: 4.950 local terms energy: -202.727960 where: bonds (distance) C4'-P energy: -48.517 bonds (distance) P-C4' energy: -48.052 flat angles C4'-P-C4' energy: -49.470 flat angles P-C4'-P energy: -34.125 tors. eta vs tors. theta energy: -22.564 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 140 Temperature: 0.900000 Total energy: -1083.363653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.363653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.763653 (E_RNA) where: Base-Base interactions energy: -657.913 where: short stacking energy: -279.269 Base-Backbone interact. energy: -0.734 local terms energy: -295.116583 where: bonds (distance) C4'-P energy: -55.486 bonds (distance) P-C4' energy: -51.517 flat angles C4'-P-C4' energy: -63.167 flat angles P-C4'-P energy: -38.044 tors. eta vs tors. theta energy: -86.903 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 140 Temperature: 0.950000 Total energy: -1064.692308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.692308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -936.892308 (E_RNA) where: Base-Base interactions energy: -636.769 where: short stacking energy: -276.300 Base-Backbone interact. energy: -0.296 local terms energy: -299.827314 where: bonds (distance) C4'-P energy: -55.196 bonds (distance) P-C4' energy: -49.187 flat angles C4'-P-C4' energy: -57.859 flat angles P-C4'-P energy: -53.182 tors. eta vs tors. theta energy: -84.403 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 140 Temperature: 1.000000 Total energy: -987.622977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.622977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.822977 (E_RNA) where: Base-Base interactions energy: -579.529 where: short stacking energy: -257.152 Base-Backbone interact. energy: 0.267 local terms energy: -280.560721 where: bonds (distance) C4'-P energy: -58.094 bonds (distance) P-C4' energy: -52.832 flat angles C4'-P-C4' energy: -56.447 flat angles P-C4'-P energy: -43.118 tors. eta vs tors. theta energy: -70.070 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 140 Temperature: 1.050000 Total energy: -1014.699471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.699471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -888.699471 (E_RNA) where: Base-Base interactions energy: -632.713 where: short stacking energy: -248.613 Base-Backbone interact. energy: -1.510 local terms energy: -254.476211 where: bonds (distance) C4'-P energy: -48.844 bonds (distance) P-C4' energy: -43.569 flat angles C4'-P-C4' energy: -49.889 flat angles P-C4'-P energy: -40.991 tors. eta vs tors. theta energy: -71.182 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 140 Temperature: 1.100000 Total energy: -902.552807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -902.552807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.952807 (E_RNA) where: Base-Base interactions energy: -503.556 where: short stacking energy: -230.744 Base-Backbone interact. energy: -0.388 local terms energy: -269.008471 where: bonds (distance) C4'-P energy: -51.638 bonds (distance) P-C4' energy: -54.751 flat angles C4'-P-C4' energy: -57.230 flat angles P-C4'-P energy: -40.316 tors. eta vs tors. theta energy: -65.074 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 140 Temperature: 1.150000 Total energy: -888.485512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -888.485512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -764.285512 (E_RNA) where: Base-Base interactions energy: -514.310 where: short stacking energy: -216.291 Base-Backbone interact. energy: -0.915 local terms energy: -249.060618 where: bonds (distance) C4'-P energy: -47.843 bonds (distance) P-C4' energy: -45.276 flat angles C4'-P-C4' energy: -56.726 flat angles P-C4'-P energy: -36.247 tors. eta vs tors. theta energy: -62.968 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 140 Temperature: 1.200000 Total energy: -858.133157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.133157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.133157 (E_RNA) where: Base-Base interactions energy: -460.698 where: short stacking energy: -197.320 Base-Backbone interact. energy: 5.198 local terms energy: -276.633773 where: bonds (distance) C4'-P energy: -50.155 bonds (distance) P-C4' energy: -53.918 flat angles C4'-P-C4' energy: -64.568 flat angles P-C4'-P energy: -44.126 tors. eta vs tors. theta energy: -63.866 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 140 Temperature: 1.250000 Total energy: -789.204194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.204194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.204194 (E_RNA) where: Base-Base interactions energy: -432.391 where: short stacking energy: -189.008 Base-Backbone interact. energy: -0.703 local terms energy: -230.110085 where: bonds (distance) C4'-P energy: -44.422 bonds (distance) P-C4' energy: -54.278 flat angles C4'-P-C4' energy: -51.454 flat angles P-C4'-P energy: -22.478 tors. eta vs tors. theta energy: -57.478 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 140 Temperature: 1.300000 Total energy: -801.121854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -801.121854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.321854 (E_RNA) where: Base-Base interactions energy: -432.185 where: short stacking energy: -180.661 Base-Backbone interact. energy: -1.254 local terms energy: -239.882856 where: bonds (distance) C4'-P energy: -39.685 bonds (distance) P-C4' energy: -48.894 flat angles C4'-P-C4' energy: -52.564 flat angles P-C4'-P energy: -40.070 tors. eta vs tors. theta energy: -58.670 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 140 Temperature: 1.350000 Total energy: -700.075708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.075708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.075708 (E_RNA) where: Base-Base interactions energy: -383.628 where: short stacking energy: -164.252 Base-Backbone interact. energy: 1.770 local terms energy: -192.217077 where: bonds (distance) C4'-P energy: -47.180 bonds (distance) P-C4' energy: -49.758 flat angles C4'-P-C4' energy: -31.813 flat angles P-C4'-P energy: -31.711 tors. eta vs tors. theta energy: -31.755 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 141 Temperature: 0.900000 Total energy: -1070.551343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1070.551343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -942.751343 (E_RNA) where: Base-Base interactions energy: -650.350 where: short stacking energy: -271.908 Base-Backbone interact. energy: -0.602 local terms energy: -291.798596 where: bonds (distance) C4'-P energy: -53.786 bonds (distance) P-C4' energy: -52.358 flat angles C4'-P-C4' energy: -62.382 flat angles P-C4'-P energy: -40.503 tors. eta vs tors. theta energy: -82.768 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 141 Temperature: 0.950000 Total energy: -1051.420507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.420507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.620507 (E_RNA) where: Base-Base interactions energy: -605.622 where: short stacking energy: -263.658 Base-Backbone interact. energy: -1.245 local terms energy: -316.753782 where: bonds (distance) C4'-P energy: -57.863 bonds (distance) P-C4' energy: -58.913 flat angles C4'-P-C4' energy: -63.532 flat angles P-C4'-P energy: -48.476 tors. eta vs tors. theta energy: -87.970 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 141 Temperature: 1.000000 Total energy: -1020.569179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.569179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -898.169179 (E_RNA) where: Base-Base interactions energy: -626.592 where: short stacking energy: -272.102 Base-Backbone interact. energy: -0.253 local terms energy: -271.324387 where: bonds (distance) C4'-P energy: -46.180 bonds (distance) P-C4' energy: -48.979 flat angles C4'-P-C4' energy: -58.322 flat angles P-C4'-P energy: -44.460 tors. eta vs tors. theta energy: -73.383 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 141 Temperature: 1.050000 Total energy: -1023.910869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.910869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.910869 (E_RNA) where: Base-Base interactions energy: -612.211 where: short stacking energy: -225.666 Base-Backbone interact. energy: -0.367 local terms energy: -285.333417 where: bonds (distance) C4'-P energy: -51.954 bonds (distance) P-C4' energy: -52.886 flat angles C4'-P-C4' energy: -65.301 flat angles P-C4'-P energy: -39.372 tors. eta vs tors. theta energy: -75.821 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 141 Temperature: 1.100000 Total energy: -900.962027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -900.962027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.762027 (E_RNA) where: Base-Base interactions energy: -505.711 where: short stacking energy: -224.685 Base-Backbone interact. energy: -0.419 local terms energy: -270.631346 where: bonds (distance) C4'-P energy: -54.006 bonds (distance) P-C4' energy: -47.227 flat angles C4'-P-C4' energy: -64.287 flat angles P-C4'-P energy: -43.479 tors. eta vs tors. theta energy: -61.633 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 141 Temperature: 1.150000 Total energy: -872.914304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.914304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.114304 (E_RNA) where: Base-Base interactions energy: -498.252 where: short stacking energy: -228.119 Base-Backbone interact. energy: -0.145 local terms energy: -246.717658 where: bonds (distance) C4'-P energy: -46.565 bonds (distance) P-C4' energy: -40.902 flat angles C4'-P-C4' energy: -62.682 flat angles P-C4'-P energy: -37.905 tors. eta vs tors. theta energy: -58.663 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 141 Temperature: 1.200000 Total energy: -854.324385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -854.324385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.324385 (E_RNA) where: Base-Base interactions energy: -491.536 where: short stacking energy: -204.516 Base-Backbone interact. energy: -0.001 local terms energy: -236.786845 where: bonds (distance) C4'-P energy: -52.589 bonds (distance) P-C4' energy: -40.675 flat angles C4'-P-C4' energy: -55.145 flat angles P-C4'-P energy: -24.786 tors. eta vs tors. theta energy: -63.591 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 141 Temperature: 1.250000 Total energy: -799.656218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.656218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.056218 (E_RNA) where: Base-Base interactions energy: -425.183 where: short stacking energy: -174.295 Base-Backbone interact. energy: -1.192 local terms energy: -243.680938 where: bonds (distance) C4'-P energy: -51.749 bonds (distance) P-C4' energy: -52.124 flat angles C4'-P-C4' energy: -48.845 flat angles P-C4'-P energy: -39.634 tors. eta vs tors. theta energy: -51.328 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 141 Temperature: 1.300000 Total energy: -776.576907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.576907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.376907 (E_RNA) where: Base-Base interactions energy: -423.455 where: short stacking energy: -187.440 Base-Backbone interact. energy: -1.050 local terms energy: -227.872120 where: bonds (distance) C4'-P energy: -35.506 bonds (distance) P-C4' energy: -50.927 flat angles C4'-P-C4' energy: -51.842 flat angles P-C4'-P energy: -34.798 tors. eta vs tors. theta energy: -54.800 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 141 Temperature: 1.350000 Total energy: -679.453315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.453315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.053315 (E_RNA) where: Base-Base interactions energy: -364.473 where: short stacking energy: -140.092 Base-Backbone interact. energy: 0.108 local terms energy: -192.687660 where: bonds (distance) C4'-P energy: -42.762 bonds (distance) P-C4' energy: -39.696 flat angles C4'-P-C4' energy: -51.225 flat angles P-C4'-P energy: -30.668 tors. eta vs tors. theta energy: -28.336 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 142 Temperature: 0.900000 Total energy: -1087.353994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.353994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -957.753994 (E_RNA) where: Base-Base interactions energy: -670.048 where: short stacking energy: -277.865 Base-Backbone interact. energy: -0.731 local terms energy: -286.975283 where: bonds (distance) C4'-P energy: -48.046 bonds (distance) P-C4' energy: -56.422 flat angles C4'-P-C4' energy: -65.694 flat angles P-C4'-P energy: -37.862 tors. eta vs tors. theta energy: -78.950 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 142 Temperature: 0.950000 Total energy: -1046.603506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1046.603506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -918.803506 (E_RNA) where: Base-Base interactions energy: -605.960 where: short stacking energy: -269.337 Base-Backbone interact. energy: -0.914 local terms energy: -311.929142 where: bonds (distance) C4'-P energy: -54.447 bonds (distance) P-C4' energy: -58.078 flat angles C4'-P-C4' energy: -66.469 flat angles P-C4'-P energy: -47.230 tors. eta vs tors. theta energy: -85.705 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 142 Temperature: 1.000000 Total energy: -1018.806386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1018.806386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -892.806386 (E_RNA) where: Base-Base interactions energy: -591.470 where: short stacking energy: -257.408 Base-Backbone interact. energy: -2.347 local terms energy: -298.988937 where: bonds (distance) C4'-P energy: -58.170 bonds (distance) P-C4' energy: -53.660 flat angles C4'-P-C4' energy: -63.673 flat angles P-C4'-P energy: -48.213 tors. eta vs tors. theta energy: -75.273 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 142 Temperature: 1.050000 Total energy: -1017.914130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1017.914130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -891.914130 (E_RNA) where: Base-Base interactions energy: -626.789 where: short stacking energy: -235.940 Base-Backbone interact. energy: -1.464 local terms energy: -263.660653 where: bonds (distance) C4'-P energy: -55.031 bonds (distance) P-C4' energy: -44.968 flat angles C4'-P-C4' energy: -57.966 flat angles P-C4'-P energy: -32.277 tors. eta vs tors. theta energy: -73.419 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 142 Temperature: 1.100000 Total energy: -876.271728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -876.271728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.671728 (E_RNA) where: Base-Base interactions energy: -487.844 where: short stacking energy: -212.183 Base-Backbone interact. energy: -1.658 local terms energy: -257.170219 where: bonds (distance) C4'-P energy: -51.463 bonds (distance) P-C4' energy: -47.652 flat angles C4'-P-C4' energy: -60.502 flat angles P-C4'-P energy: -36.965 tors. eta vs tors. theta energy: -60.589 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 142 Temperature: 1.150000 Total energy: -869.448284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.448284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.448284 (E_RNA) where: Base-Base interactions energy: -489.532 where: short stacking energy: -243.213 Base-Backbone interact. energy: 1.325 local terms energy: -255.241523 where: bonds (distance) C4'-P energy: -55.742 bonds (distance) P-C4' energy: -43.956 flat angles C4'-P-C4' energy: -55.272 flat angles P-C4'-P energy: -32.243 tors. eta vs tors. theta energy: -68.029 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 142 Temperature: 1.200000 Total energy: -832.974504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.974504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.374504 (E_RNA) where: Base-Base interactions energy: -469.850 where: short stacking energy: -207.821 Base-Backbone interact. energy: 0.073 local terms energy: -233.597065 where: bonds (distance) C4'-P energy: -39.809 bonds (distance) P-C4' energy: -47.769 flat angles C4'-P-C4' energy: -63.361 flat angles P-C4'-P energy: -27.430 tors. eta vs tors. theta energy: -55.227 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 142 Temperature: 1.250000 Total energy: -810.992337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.992337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.392337 (E_RNA) where: Base-Base interactions energy: -451.203 where: short stacking energy: -198.005 Base-Backbone interact. energy: -0.034 local terms energy: -230.155335 where: bonds (distance) C4'-P energy: -36.952 bonds (distance) P-C4' energy: -55.401 flat angles C4'-P-C4' energy: -38.888 flat angles P-C4'-P energy: -39.379 tors. eta vs tors. theta energy: -59.535 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 142 Temperature: 1.300000 Total energy: -742.092415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.092415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.292415 (E_RNA) where: Base-Base interactions energy: -413.574 where: short stacking energy: -179.498 Base-Backbone interact. energy: -1.147 local terms energy: -199.571581 where: bonds (distance) C4'-P energy: -40.711 bonds (distance) P-C4' energy: -51.569 flat angles C4'-P-C4' energy: -40.294 flat angles P-C4'-P energy: -18.604 tors. eta vs tors. theta energy: -48.395 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 142 Temperature: 1.350000 Total energy: -660.197746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.197746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.597746 (E_RNA) where: Base-Base interactions energy: -344.122 where: short stacking energy: -145.887 Base-Backbone interact. energy: -2.916 local terms energy: -192.560001 where: bonds (distance) C4'-P energy: -47.257 bonds (distance) P-C4' energy: -39.660 flat angles C4'-P-C4' energy: -51.666 flat angles P-C4'-P energy: -29.539 tors. eta vs tors. theta energy: -24.437 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 143 Temperature: 0.900000 Total energy: -1079.364214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1079.364214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.764214 (E_RNA) where: Base-Base interactions energy: -660.781 where: short stacking energy: -278.938 Base-Backbone interact. energy: -1.837 local terms energy: -287.145457 where: bonds (distance) C4'-P energy: -52.774 bonds (distance) P-C4' energy: -43.802 flat angles C4'-P-C4' energy: -64.016 flat angles P-C4'-P energy: -40.268 tors. eta vs tors. theta energy: -86.285 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 143 Temperature: 0.950000 Total energy: -1043.471934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.471934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.871934 (E_RNA) where: Base-Base interactions energy: -618.444 where: short stacking energy: -261.573 Base-Backbone interact. energy: -1.206 local terms energy: -294.222808 where: bonds (distance) C4'-P energy: -48.409 bonds (distance) P-C4' energy: -57.754 flat angles C4'-P-C4' energy: -61.302 flat angles P-C4'-P energy: -48.053 tors. eta vs tors. theta energy: -78.704 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 143 Temperature: 1.000000 Total energy: -1029.387429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1029.387429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.587429 (E_RNA) where: Base-Base interactions energy: -626.879 where: short stacking energy: -275.698 Base-Backbone interact. energy: -1.820 local terms energy: -272.889118 where: bonds (distance) C4'-P energy: -44.808 bonds (distance) P-C4' energy: -57.263 flat angles C4'-P-C4' energy: -64.233 flat angles P-C4'-P energy: -35.902 tors. eta vs tors. theta energy: -70.684 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 143 Temperature: 1.050000 Total energy: -1031.769941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.769941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -903.969941 (E_RNA) where: Base-Base interactions energy: -634.527 where: short stacking energy: -248.677 Base-Backbone interact. energy: -2.298 local terms energy: -267.145317 where: bonds (distance) C4'-P energy: -45.474 bonds (distance) P-C4' energy: -52.431 flat angles C4'-P-C4' energy: -52.899 flat angles P-C4'-P energy: -37.241 tors. eta vs tors. theta energy: -79.101 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 143 Temperature: 1.100000 Total energy: -914.087448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -914.087448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.287448 (E_RNA) where: Base-Base interactions energy: -528.112 where: short stacking energy: -229.964 Base-Backbone interact. energy: -0.428 local terms energy: -257.747771 where: bonds (distance) C4'-P energy: -45.620 bonds (distance) P-C4' energy: -52.021 flat angles C4'-P-C4' energy: -51.144 flat angles P-C4'-P energy: -45.937 tors. eta vs tors. theta energy: -63.025 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 143 Temperature: 1.150000 Total energy: -874.485867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -874.485867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.685867 (E_RNA) where: Base-Base interactions energy: -496.870 where: short stacking energy: -214.598 Base-Backbone interact. energy: -0.077 local terms energy: -249.739409 where: bonds (distance) C4'-P energy: -44.149 bonds (distance) P-C4' energy: -45.835 flat angles C4'-P-C4' energy: -57.818 flat angles P-C4'-P energy: -35.629 tors. eta vs tors. theta energy: -66.309 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 143 Temperature: 1.200000 Total energy: -827.373477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.373477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.573477 (E_RNA) where: Base-Base interactions energy: -455.644 where: short stacking energy: -200.360 Base-Backbone interact. energy: -0.474 local terms energy: -243.455534 where: bonds (distance) C4'-P energy: -43.694 bonds (distance) P-C4' energy: -41.479 flat angles C4'-P-C4' energy: -60.870 flat angles P-C4'-P energy: -42.099 tors. eta vs tors. theta energy: -55.313 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 143 Temperature: 1.250000 Total energy: -843.281498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.281498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.481498 (E_RNA) where: Base-Base interactions energy: -485.981 where: short stacking energy: -203.679 Base-Backbone interact. energy: 2.294 local terms energy: -231.793698 where: bonds (distance) C4'-P energy: -34.639 bonds (distance) P-C4' energy: -51.492 flat angles C4'-P-C4' energy: -55.894 flat angles P-C4'-P energy: -32.273 tors. eta vs tors. theta energy: -57.496 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 143 Temperature: 1.300000 Total energy: -733.828400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -733.828400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.028400 (E_RNA) where: Base-Base interactions energy: -398.894 where: short stacking energy: -183.271 Base-Backbone interact. energy: 1.282 local terms energy: -217.416497 where: bonds (distance) C4'-P energy: -43.337 bonds (distance) P-C4' energy: -41.188 flat angles C4'-P-C4' energy: -57.947 flat angles P-C4'-P energy: -31.885 tors. eta vs tors. theta energy: -43.059 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 143 Temperature: 1.350000 Total energy: -702.265917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.265917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.665917 (E_RNA) where: Base-Base interactions energy: -369.944 where: short stacking energy: -151.208 Base-Backbone interact. energy: -0.136 local terms energy: -202.585439 where: bonds (distance) C4'-P energy: -48.150 bonds (distance) P-C4' energy: -42.965 flat angles C4'-P-C4' energy: -47.362 flat angles P-C4'-P energy: -30.872 tors. eta vs tors. theta energy: -33.236 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 144 Temperature: 0.900000 Total energy: -1088.974872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1088.974872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -959.374872 (E_RNA) where: Base-Base interactions energy: -644.163 where: short stacking energy: -283.213 Base-Backbone interact. energy: 0.636 local terms energy: -315.848142 where: bonds (distance) C4'-P energy: -58.224 bonds (distance) P-C4' energy: -55.166 flat angles C4'-P-C4' energy: -67.980 flat angles P-C4'-P energy: -49.425 tors. eta vs tors. theta energy: -85.052 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 144 Temperature: 0.950000 Total energy: -1040.947558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.947558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.147558 (E_RNA) where: Base-Base interactions energy: -616.072 where: short stacking energy: -275.693 Base-Backbone interact. energy: 0.382 local terms energy: -297.457574 where: bonds (distance) C4'-P energy: -52.590 bonds (distance) P-C4' energy: -64.458 flat angles C4'-P-C4' energy: -53.301 flat angles P-C4'-P energy: -42.287 tors. eta vs tors. theta energy: -84.822 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 144 Temperature: 1.000000 Total energy: -1043.776882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.776882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -915.976882 (E_RNA) where: Base-Base interactions energy: -641.088 where: short stacking energy: -260.328 Base-Backbone interact. energy: 0.967 local terms energy: -275.856275 where: bonds (distance) C4'-P energy: -46.695 bonds (distance) P-C4' energy: -50.372 flat angles C4'-P-C4' energy: -58.563 flat angles P-C4'-P energy: -47.205 tors. eta vs tors. theta energy: -73.021 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 144 Temperature: 1.050000 Total energy: -1000.480706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1000.480706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.480706 (E_RNA) where: Base-Base interactions energy: -599.815 where: short stacking energy: -234.382 Base-Backbone interact. energy: -1.305 local terms energy: -273.360728 where: bonds (distance) C4'-P energy: -47.658 bonds (distance) P-C4' energy: -54.565 flat angles C4'-P-C4' energy: -55.065 flat angles P-C4'-P energy: -40.031 tors. eta vs tors. theta energy: -76.042 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 144 Temperature: 1.100000 Total energy: -922.896489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.896489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.296489 (E_RNA) where: Base-Base interactions energy: -525.719 where: short stacking energy: -230.001 Base-Backbone interact. energy: 1.466 local terms energy: -269.043210 where: bonds (distance) C4'-P energy: -53.115 bonds (distance) P-C4' energy: -52.363 flat angles C4'-P-C4' energy: -52.361 flat angles P-C4'-P energy: -41.105 tors. eta vs tors. theta energy: -70.098 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 144 Temperature: 1.150000 Total energy: -875.937816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.937816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.137816 (E_RNA) where: Base-Base interactions energy: -503.798 where: short stacking energy: -232.999 Base-Backbone interact. energy: 0.125 local terms energy: -244.464918 where: bonds (distance) C4'-P energy: -42.748 bonds (distance) P-C4' energy: -45.812 flat angles C4'-P-C4' energy: -53.792 flat angles P-C4'-P energy: -34.147 tors. eta vs tors. theta energy: -67.966 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 144 Temperature: 1.200000 Total energy: -846.383788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.383788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.583788 (E_RNA) where: Base-Base interactions energy: -475.739 where: short stacking energy: -205.029 Base-Backbone interact. energy: 1.826 local terms energy: -244.670798 where: bonds (distance) C4'-P energy: -47.587 bonds (distance) P-C4' energy: -47.002 flat angles C4'-P-C4' energy: -46.717 flat angles P-C4'-P energy: -44.911 tors. eta vs tors. theta energy: -58.455 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 144 Temperature: 1.250000 Total energy: -816.784299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -816.784299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.784299 (E_RNA) where: Base-Base interactions energy: -444.474 where: short stacking energy: -175.477 Base-Backbone interact. energy: -0.179 local terms energy: -246.131299 where: bonds (distance) C4'-P energy: -44.017 bonds (distance) P-C4' energy: -57.173 flat angles C4'-P-C4' energy: -50.681 flat angles P-C4'-P energy: -33.789 tors. eta vs tors. theta energy: -60.472 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 144 Temperature: 1.300000 Total energy: -728.996589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.996589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.196589 (E_RNA) where: Base-Base interactions energy: -388.925 where: short stacking energy: -156.255 Base-Backbone interact. energy: -2.580 local terms energy: -209.691630 where: bonds (distance) C4'-P energy: -50.596 bonds (distance) P-C4' energy: -39.681 flat angles C4'-P-C4' energy: -48.618 flat angles P-C4'-P energy: -32.923 tors. eta vs tors. theta energy: -37.873 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 144 Temperature: 1.350000 Total energy: -666.157848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.157848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.157848 (E_RNA) where: Base-Base interactions energy: -354.089 where: short stacking energy: -136.544 Base-Backbone interact. energy: -2.070 local terms energy: -183.999433 where: bonds (distance) C4'-P energy: -48.510 bonds (distance) P-C4' energy: -41.434 flat angles C4'-P-C4' energy: -49.280 flat angles P-C4'-P energy: -18.115 tors. eta vs tors. theta energy: -26.660 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 145 Temperature: 0.900000 Total energy: -1094.587538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1094.587538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.987538 (E_RNA) where: Base-Base interactions energy: -664.829 where: short stacking energy: -291.897 Base-Backbone interact. energy: -1.525 local terms energy: -298.633278 where: bonds (distance) C4'-P energy: -52.519 bonds (distance) P-C4' energy: -62.599 flat angles C4'-P-C4' energy: -62.700 flat angles P-C4'-P energy: -35.777 tors. eta vs tors. theta energy: -85.038 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 145 Temperature: 0.950000 Total energy: -1064.515214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.515214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -938.515214 (E_RNA) where: Base-Base interactions energy: -620.532 where: short stacking energy: -270.664 Base-Backbone interact. energy: 0.436 local terms energy: -318.418988 where: bonds (distance) C4'-P energy: -49.235 bonds (distance) P-C4' energy: -68.184 flat angles C4'-P-C4' energy: -69.828 flat angles P-C4'-P energy: -47.314 tors. eta vs tors. theta energy: -83.858 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 145 Temperature: 1.000000 Total energy: -1050.998400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1050.998400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.198400 (E_RNA) where: Base-Base interactions energy: -628.391 where: short stacking energy: -239.053 Base-Backbone interact. energy: -1.470 local terms energy: -293.337525 where: bonds (distance) C4'-P energy: -52.456 bonds (distance) P-C4' energy: -61.270 flat angles C4'-P-C4' energy: -61.940 flat angles P-C4'-P energy: -43.168 tors. eta vs tors. theta energy: -74.504 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 145 Temperature: 1.050000 Total energy: -972.735359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.735359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -844.935359 (E_RNA) where: Base-Base interactions energy: -561.797 where: short stacking energy: -251.121 Base-Backbone interact. energy: 0.076 local terms energy: -283.214548 where: bonds (distance) C4'-P energy: -50.800 bonds (distance) P-C4' energy: -56.690 flat angles C4'-P-C4' energy: -55.479 flat angles P-C4'-P energy: -43.111 tors. eta vs tors. theta energy: -77.135 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 145 Temperature: 1.100000 Total energy: -979.310791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -979.310791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.710791 (E_RNA) where: Base-Base interactions energy: -582.614 where: short stacking energy: -239.517 Base-Backbone interact. energy: -1.365 local terms energy: -265.731524 where: bonds (distance) C4'-P energy: -48.366 bonds (distance) P-C4' energy: -55.881 flat angles C4'-P-C4' energy: -61.016 flat angles P-C4'-P energy: -35.171 tors. eta vs tors. theta energy: -65.298 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 145 Temperature: 1.150000 Total energy: -862.408544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.408544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.008544 (E_RNA) where: Base-Base interactions energy: -494.441 where: short stacking energy: -200.581 Base-Backbone interact. energy: 0.750 local terms energy: -246.317901 where: bonds (distance) C4'-P energy: -48.341 bonds (distance) P-C4' energy: -52.647 flat angles C4'-P-C4' energy: -53.038 flat angles P-C4'-P energy: -39.410 tors. eta vs tors. theta energy: -52.882 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 145 Temperature: 1.200000 Total energy: -843.125680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.125680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.125680 (E_RNA) where: Base-Base interactions energy: -478.163 where: short stacking energy: -218.596 Base-Backbone interact. energy: 0.796 local terms energy: -239.758946 where: bonds (distance) C4'-P energy: -45.576 bonds (distance) P-C4' energy: -45.042 flat angles C4'-P-C4' energy: -58.844 flat angles P-C4'-P energy: -26.980 tors. eta vs tors. theta energy: -63.316 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 145 Temperature: 1.250000 Total energy: -798.868378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.868378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.468378 (E_RNA) where: Base-Base interactions energy: -445.436 where: short stacking energy: -192.714 Base-Backbone interact. energy: -0.730 local terms energy: -230.302637 where: bonds (distance) C4'-P energy: -38.341 bonds (distance) P-C4' energy: -53.650 flat angles C4'-P-C4' energy: -54.751 flat angles P-C4'-P energy: -22.837 tors. eta vs tors. theta energy: -60.724 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 145 Temperature: 1.300000 Total energy: -713.082770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.082770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.282770 (E_RNA) where: Base-Base interactions energy: -368.446 where: short stacking energy: -145.403 Base-Backbone interact. energy: 0.249 local terms energy: -217.086017 where: bonds (distance) C4'-P energy: -49.099 bonds (distance) P-C4' energy: -51.555 flat angles C4'-P-C4' energy: -47.965 flat angles P-C4'-P energy: -38.008 tors. eta vs tors. theta energy: -30.459 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 145 Temperature: 1.350000 Total energy: -663.150479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.150479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.950479 (E_RNA) where: Base-Base interactions energy: -335.033 where: short stacking energy: -155.002 Base-Backbone interact. energy: 0.370 local terms energy: -204.287782 where: bonds (distance) C4'-P energy: -33.868 bonds (distance) P-C4' energy: -47.003 flat angles C4'-P-C4' energy: -43.798 flat angles P-C4'-P energy: -40.037 tors. eta vs tors. theta energy: -39.581 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 146 Temperature: 0.900000 Total energy: -1069.472366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.472366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.872366 (E_RNA) where: Base-Base interactions energy: -644.312 where: short stacking energy: -278.439 Base-Backbone interact. energy: 1.707 local terms energy: -297.267121 where: bonds (distance) C4'-P energy: -49.942 bonds (distance) P-C4' energy: -56.594 flat angles C4'-P-C4' energy: -61.230 flat angles P-C4'-P energy: -51.394 tors. eta vs tors. theta energy: -78.108 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 146 Temperature: 0.950000 Total energy: -1078.197439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.197439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -950.397439 (E_RNA) where: Base-Base interactions energy: -650.470 where: short stacking energy: -285.795 Base-Backbone interact. energy: -0.294 local terms energy: -299.633290 where: bonds (distance) C4'-P energy: -56.473 bonds (distance) P-C4' energy: -57.475 flat angles C4'-P-C4' energy: -60.213 flat angles P-C4'-P energy: -40.266 tors. eta vs tors. theta energy: -85.206 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 146 Temperature: 1.000000 Total energy: -1055.664294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.664294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.064294 (E_RNA) where: Base-Base interactions energy: -640.899 where: short stacking energy: -251.230 Base-Backbone interact. energy: -0.715 local terms energy: -284.450875 where: bonds (distance) C4'-P energy: -49.355 bonds (distance) P-C4' energy: -62.316 flat angles C4'-P-C4' energy: -56.966 flat angles P-C4'-P energy: -37.538 tors. eta vs tors. theta energy: -78.277 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 146 Temperature: 1.050000 Total energy: -938.371171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -938.371171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -808.771171 (E_RNA) where: Base-Base interactions energy: -536.356 where: short stacking energy: -243.775 Base-Backbone interact. energy: -1.029 local terms energy: -271.386016 where: bonds (distance) C4'-P energy: -58.820 bonds (distance) P-C4' energy: -47.838 flat angles C4'-P-C4' energy: -62.144 flat angles P-C4'-P energy: -37.487 tors. eta vs tors. theta energy: -65.098 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 146 Temperature: 1.100000 Total energy: -966.574806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.574806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.774806 (E_RNA) where: Base-Base interactions energy: -553.504 where: short stacking energy: -237.735 Base-Backbone interact. energy: 0.756 local terms energy: -286.026031 where: bonds (distance) C4'-P energy: -55.638 bonds (distance) P-C4' energy: -60.429 flat angles C4'-P-C4' energy: -60.976 flat angles P-C4'-P energy: -35.433 tors. eta vs tors. theta energy: -73.550 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 146 Temperature: 1.150000 Total energy: -877.505682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.505682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.505682 (E_RNA) where: Base-Base interactions energy: -520.615 where: short stacking energy: -221.348 Base-Backbone interact. energy: 0.132 local terms energy: -231.023511 where: bonds (distance) C4'-P energy: -43.262 bonds (distance) P-C4' energy: -49.168 flat angles C4'-P-C4' energy: -51.497 flat angles P-C4'-P energy: -23.470 tors. eta vs tors. theta energy: -63.626 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 146 Temperature: 1.200000 Total energy: -839.576066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -839.576066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.976066 (E_RNA) where: Base-Base interactions energy: -459.204 where: short stacking energy: -210.229 Base-Backbone interact. energy: -1.420 local terms energy: -249.352678 where: bonds (distance) C4'-P energy: -47.033 bonds (distance) P-C4' energy: -48.141 flat angles C4'-P-C4' energy: -49.122 flat angles P-C4'-P energy: -38.643 tors. eta vs tors. theta energy: -66.413 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 146 Temperature: 1.250000 Total energy: -823.173864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -823.173864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.573864 (E_RNA) where: Base-Base interactions energy: -453.462 where: short stacking energy: -196.911 Base-Backbone interact. energy: -0.365 local terms energy: -239.746531 where: bonds (distance) C4'-P energy: -45.657 bonds (distance) P-C4' energy: -33.652 flat angles C4'-P-C4' energy: -61.287 flat angles P-C4'-P energy: -38.476 tors. eta vs tors. theta energy: -60.675 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 146 Temperature: 1.300000 Total energy: -697.265337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.265337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.465337 (E_RNA) where: Base-Base interactions energy: -376.003 where: short stacking energy: -152.086 Base-Backbone interact. energy: 4.269 local terms energy: -197.731492 where: bonds (distance) C4'-P energy: -40.507 bonds (distance) P-C4' energy: -52.450 flat angles C4'-P-C4' energy: -52.805 flat angles P-C4'-P energy: -28.777 tors. eta vs tors. theta energy: -23.193 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 146 Temperature: 1.350000 Total energy: -705.818745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.818745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.018745 (E_RNA) where: Base-Base interactions energy: -377.315 where: short stacking energy: -154.515 Base-Backbone interact. energy: -0.761 local terms energy: -199.942904 where: bonds (distance) C4'-P energy: -43.298 bonds (distance) P-C4' energy: -42.434 flat angles C4'-P-C4' energy: -43.372 flat angles P-C4'-P energy: -31.899 tors. eta vs tors. theta energy: -38.940 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 147 Temperature: 0.900000 Total energy: -1066.369269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1066.369269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -936.769269 (E_RNA) where: Base-Base interactions energy: -634.351 where: short stacking energy: -273.452 Base-Backbone interact. energy: 0.638 local terms energy: -303.056943 where: bonds (distance) C4'-P energy: -57.235 bonds (distance) P-C4' energy: -56.224 flat angles C4'-P-C4' energy: -66.591 flat angles P-C4'-P energy: -43.847 tors. eta vs tors. theta energy: -79.161 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 147 Temperature: 0.950000 Total energy: -1066.159993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1066.159993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -936.559993 (E_RNA) where: Base-Base interactions energy: -630.089 where: short stacking energy: -279.280 Base-Backbone interact. energy: -1.348 local terms energy: -305.122663 where: bonds (distance) C4'-P energy: -52.629 bonds (distance) P-C4' energy: -56.987 flat angles C4'-P-C4' energy: -63.063 flat angles P-C4'-P energy: -46.608 tors. eta vs tors. theta energy: -85.835 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 147 Temperature: 1.000000 Total energy: -1041.255426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.255426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -915.255426 (E_RNA) where: Base-Base interactions energy: -622.475 where: short stacking energy: -240.516 Base-Backbone interact. energy: -2.572 local terms energy: -290.207920 where: bonds (distance) C4'-P energy: -58.223 bonds (distance) P-C4' energy: -53.412 flat angles C4'-P-C4' energy: -62.341 flat angles P-C4'-P energy: -45.483 tors. eta vs tors. theta energy: -70.748 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 147 Temperature: 1.050000 Total energy: -988.768275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -988.768275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.968275 (E_RNA) where: Base-Base interactions energy: -577.109 where: short stacking energy: -252.587 Base-Backbone interact. energy: -0.125 local terms energy: -283.734896 where: bonds (distance) C4'-P energy: -46.327 bonds (distance) P-C4' energy: -60.843 flat angles C4'-P-C4' energy: -66.939 flat angles P-C4'-P energy: -39.358 tors. eta vs tors. theta energy: -70.269 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 147 Temperature: 1.100000 Total energy: -953.656616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -953.656616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -827.656616 (E_RNA) where: Base-Base interactions energy: -562.242 where: short stacking energy: -230.803 Base-Backbone interact. energy: -0.678 local terms energy: -264.737036 where: bonds (distance) C4'-P energy: -48.198 bonds (distance) P-C4' energy: -54.014 flat angles C4'-P-C4' energy: -51.269 flat angles P-C4'-P energy: -41.094 tors. eta vs tors. theta energy: -70.162 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 147 Temperature: 1.150000 Total energy: -879.758634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.758634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.558634 (E_RNA) where: Base-Base interactions energy: -504.090 where: short stacking energy: -216.717 Base-Backbone interact. energy: -1.034 local terms energy: -250.434429 where: bonds (distance) C4'-P energy: -53.491 bonds (distance) P-C4' energy: -44.895 flat angles C4'-P-C4' energy: -57.788 flat angles P-C4'-P energy: -38.818 tors. eta vs tors. theta energy: -55.441 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 147 Temperature: 1.200000 Total energy: -850.691313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.691313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.891313 (E_RNA) where: Base-Base interactions energy: -467.450 where: short stacking energy: -210.790 Base-Backbone interact. energy: 1.012 local terms energy: -256.453931 where: bonds (distance) C4'-P energy: -48.162 bonds (distance) P-C4' energy: -47.384 flat angles C4'-P-C4' energy: -61.153 flat angles P-C4'-P energy: -34.624 tors. eta vs tors. theta energy: -65.131 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 147 Temperature: 1.250000 Total energy: -782.565855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.565855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.365855 (E_RNA) where: Base-Base interactions energy: -426.417 where: short stacking energy: -187.567 Base-Backbone interact. energy: 0.340 local terms energy: -232.289785 where: bonds (distance) C4'-P energy: -49.677 bonds (distance) P-C4' energy: -49.884 flat angles C4'-P-C4' energy: -48.873 flat angles P-C4'-P energy: -33.846 tors. eta vs tors. theta energy: -50.010 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 147 Temperature: 1.300000 Total energy: -699.006569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.006569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.806569 (E_RNA) where: Base-Base interactions energy: -360.373 where: short stacking energy: -144.777 Base-Backbone interact. energy: -1.833 local terms energy: -212.601256 where: bonds (distance) C4'-P energy: -51.620 bonds (distance) P-C4' energy: -53.371 flat angles C4'-P-C4' energy: -41.477 flat angles P-C4'-P energy: -36.426 tors. eta vs tors. theta energy: -29.708 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 147 Temperature: 1.350000 Total energy: -699.817472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.817472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.617472 (E_RNA) where: Base-Base interactions energy: -382.703 where: short stacking energy: -163.955 Base-Backbone interact. energy: -0.817 local terms energy: -192.097093 where: bonds (distance) C4'-P energy: -47.191 bonds (distance) P-C4' energy: -30.479 flat angles C4'-P-C4' energy: -51.637 flat angles P-C4'-P energy: -29.828 tors. eta vs tors. theta energy: -32.962 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 148 Temperature: 0.900000 Total energy: -1066.420814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1066.420814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.420814 (E_RNA) where: Base-Base interactions energy: -646.250 where: short stacking energy: -278.258 Base-Backbone interact. energy: -0.641 local terms energy: -293.530394 where: bonds (distance) C4'-P energy: -66.086 bonds (distance) P-C4' energy: -56.194 flat angles C4'-P-C4' energy: -51.318 flat angles P-C4'-P energy: -36.008 tors. eta vs tors. theta energy: -83.925 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 148 Temperature: 0.950000 Total energy: -1053.816332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.816332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.216332 (E_RNA) where: Base-Base interactions energy: -612.769 where: short stacking energy: -278.857 Base-Backbone interact. energy: -0.749 local terms energy: -310.698522 where: bonds (distance) C4'-P energy: -57.589 bonds (distance) P-C4' energy: -56.665 flat angles C4'-P-C4' energy: -64.362 flat angles P-C4'-P energy: -47.530 tors. eta vs tors. theta energy: -84.552 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 148 Temperature: 1.000000 Total energy: -1036.761060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1036.761060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -908.961060 (E_RNA) where: Base-Base interactions energy: -638.497 where: short stacking energy: -256.618 Base-Backbone interact. energy: 1.813 local terms energy: -272.277192 where: bonds (distance) C4'-P energy: -40.480 bonds (distance) P-C4' energy: -47.436 flat angles C4'-P-C4' energy: -66.005 flat angles P-C4'-P energy: -42.452 tors. eta vs tors. theta energy: -75.905 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 148 Temperature: 1.050000 Total energy: -962.505903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -962.505903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.505903 (E_RNA) where: Base-Base interactions energy: -563.538 where: short stacking energy: -231.227 Base-Backbone interact. energy: -0.513 local terms energy: -272.454554 where: bonds (distance) C4'-P energy: -48.357 bonds (distance) P-C4' energy: -58.124 flat angles C4'-P-C4' energy: -58.087 flat angles P-C4'-P energy: -38.141 tors. eta vs tors. theta energy: -69.745 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 148 Temperature: 1.100000 Total energy: -948.232925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -948.232925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.432925 (E_RNA) where: Base-Base interactions energy: -558.045 where: short stacking energy: -239.864 Base-Backbone interact. energy: -0.385 local terms energy: -262.003003 where: bonds (distance) C4'-P energy: -48.978 bonds (distance) P-C4' energy: -50.296 flat angles C4'-P-C4' energy: -55.805 flat angles P-C4'-P energy: -39.057 tors. eta vs tors. theta energy: -67.868 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 148 Temperature: 1.150000 Total energy: -854.823726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -854.823726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.823726 (E_RNA) where: Base-Base interactions energy: -472.293 where: short stacking energy: -197.480 Base-Backbone interact. energy: -0.471 local terms energy: -256.059454 where: bonds (distance) C4'-P energy: -39.510 bonds (distance) P-C4' energy: -62.249 flat angles C4'-P-C4' energy: -56.915 flat angles P-C4'-P energy: -35.444 tors. eta vs tors. theta energy: -61.942 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 148 Temperature: 1.200000 Total energy: -891.729445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -891.729445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.729445 (E_RNA) where: Base-Base interactions energy: -490.212 where: short stacking energy: -217.472 Base-Backbone interact. energy: -1.237 local terms energy: -274.281068 where: bonds (distance) C4'-P energy: -50.782 bonds (distance) P-C4' energy: -50.938 flat angles C4'-P-C4' energy: -62.407 flat angles P-C4'-P energy: -40.408 tors. eta vs tors. theta energy: -69.745 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 148 Temperature: 1.250000 Total energy: -777.966166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.966166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.566166 (E_RNA) where: Base-Base interactions energy: -431.407 where: short stacking energy: -175.736 Base-Backbone interact. energy: -1.160 local terms energy: -223.000023 where: bonds (distance) C4'-P energy: -42.501 bonds (distance) P-C4' energy: -54.969 flat angles C4'-P-C4' energy: -55.406 flat angles P-C4'-P energy: -29.478 tors. eta vs tors. theta energy: -40.646 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 148 Temperature: 1.300000 Total energy: -686.747578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.747578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.947578 (E_RNA) where: Base-Base interactions energy: -342.934 where: short stacking energy: -131.192 Base-Backbone interact. energy: -0.339 local terms energy: -215.674420 where: bonds (distance) C4'-P energy: -52.287 bonds (distance) P-C4' energy: -43.863 flat angles C4'-P-C4' energy: -56.451 flat angles P-C4'-P energy: -32.264 tors. eta vs tors. theta energy: -30.810 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 148 Temperature: 1.350000 Total energy: -667.043315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.043315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.043315 (E_RNA) where: Base-Base interactions energy: -338.540 where: short stacking energy: -127.586 Base-Backbone interact. energy: -1.750 local terms energy: -200.753727 where: bonds (distance) C4'-P energy: -46.846 bonds (distance) P-C4' energy: -44.767 flat angles C4'-P-C4' energy: -44.429 flat angles P-C4'-P energy: -28.735 tors. eta vs tors. theta energy: -35.976 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 149 Temperature: 0.900000 Total energy: -1082.560328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1082.560328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.960328 (E_RNA) where: Base-Base interactions energy: -647.754 where: short stacking energy: -266.252 Base-Backbone interact. energy: -1.879 local terms energy: -303.326761 where: bonds (distance) C4'-P energy: -61.578 bonds (distance) P-C4' energy: -61.254 flat angles C4'-P-C4' energy: -54.121 flat angles P-C4'-P energy: -46.376 tors. eta vs tors. theta energy: -79.997 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 149 Temperature: 0.950000 Total energy: -1053.910645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.910645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.310646 (E_RNA) where: Base-Base interactions energy: -651.287 where: short stacking energy: -230.694 Base-Backbone interact. energy: -1.091 local terms energy: -271.932894 where: bonds (distance) C4'-P energy: -49.175 bonds (distance) P-C4' energy: -49.424 flat angles C4'-P-C4' energy: -58.433 flat angles P-C4'-P energy: -43.078 tors. eta vs tors. theta energy: -71.824 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 149 Temperature: 1.000000 Total energy: -1025.871402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.871402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -899.871402 (E_RNA) where: Base-Base interactions energy: -607.997 where: short stacking energy: -265.531 Base-Backbone interact. energy: -0.956 local terms energy: -290.918027 where: bonds (distance) C4'-P energy: -57.717 bonds (distance) P-C4' energy: -55.193 flat angles C4'-P-C4' energy: -57.594 flat angles P-C4'-P energy: -39.496 tors. eta vs tors. theta energy: -80.918 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 149 Temperature: 1.050000 Total energy: -994.031230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.031230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.231230 (E_RNA) where: Base-Base interactions energy: -585.477 where: short stacking energy: -255.457 Base-Backbone interact. energy: -0.182 local terms energy: -280.572514 where: bonds (distance) C4'-P energy: -47.271 bonds (distance) P-C4' energy: -50.414 flat angles C4'-P-C4' energy: -57.981 flat angles P-C4'-P energy: -44.280 tors. eta vs tors. theta energy: -80.627 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 149 Temperature: 1.100000 Total energy: -935.462839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -935.462839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.462839 (E_RNA) where: Base-Base interactions energy: -536.706 where: short stacking energy: -229.433 Base-Backbone interact. energy: -0.980 local terms energy: -271.777588 where: bonds (distance) C4'-P energy: -47.859 bonds (distance) P-C4' energy: -64.177 flat angles C4'-P-C4' energy: -57.732 flat angles P-C4'-P energy: -30.144 tors. eta vs tors. theta energy: -71.865 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 149 Temperature: 1.150000 Total energy: -898.235199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.235199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.035199 (E_RNA) where: Base-Base interactions energy: -498.401 where: short stacking energy: -239.846 Base-Backbone interact. energy: -0.654 local terms energy: -274.980974 where: bonds (distance) C4'-P energy: -43.084 bonds (distance) P-C4' energy: -56.343 flat angles C4'-P-C4' energy: -59.828 flat angles P-C4'-P energy: -50.852 tors. eta vs tors. theta energy: -64.873 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 149 Temperature: 1.200000 Total energy: -827.261806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.261806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.061806 (E_RNA) where: Base-Base interactions energy: -453.253 where: short stacking energy: -191.516 Base-Backbone interact. energy: -0.444 local terms energy: -249.364631 where: bonds (distance) C4'-P energy: -49.613 bonds (distance) P-C4' energy: -61.779 flat angles C4'-P-C4' energy: -52.549 flat angles P-C4'-P energy: -28.915 tors. eta vs tors. theta energy: -56.509 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 149 Temperature: 1.250000 Total energy: -831.188455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.188455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.188455 (E_RNA) where: Base-Base interactions energy: -475.790 where: short stacking energy: -210.964 Base-Backbone interact. energy: -1.554 local terms energy: -227.843848 where: bonds (distance) C4'-P energy: -40.858 bonds (distance) P-C4' energy: -48.906 flat angles C4'-P-C4' energy: -48.257 flat angles P-C4'-P energy: -30.669 tors. eta vs tors. theta energy: -59.154 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 149 Temperature: 1.300000 Total energy: -732.586596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.586596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.586596 (E_RNA) where: Base-Base interactions energy: -408.763 where: short stacking energy: -161.869 Base-Backbone interact. energy: -2.307 local terms energy: -195.517052 where: bonds (distance) C4'-P energy: -41.178 bonds (distance) P-C4' energy: -44.659 flat angles C4'-P-C4' energy: -42.628 flat angles P-C4'-P energy: -33.210 tors. eta vs tors. theta energy: -33.841 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 149 Temperature: 1.350000 Total energy: -664.976711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.976711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.776711 (E_RNA) where: Base-Base interactions energy: -350.989 where: short stacking energy: -143.630 Base-Backbone interact. energy: -0.783 local terms energy: -189.004355 where: bonds (distance) C4'-P energy: -45.916 bonds (distance) P-C4' energy: -33.983 flat angles C4'-P-C4' energy: -57.476 flat angles P-C4'-P energy: -24.649 tors. eta vs tors. theta energy: -26.980 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 150 Temperature: 0.900000 Total energy: -1089.737985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.737985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.937985 (E_RNA) where: Base-Base interactions energy: -664.682 where: short stacking energy: -278.869 Base-Backbone interact. energy: 1.051 local terms energy: -298.306502 where: bonds (distance) C4'-P energy: -52.932 bonds (distance) P-C4' energy: -59.118 flat angles C4'-P-C4' energy: -63.149 flat angles P-C4'-P energy: -36.555 tors. eta vs tors. theta energy: -86.552 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 150 Temperature: 0.950000 Total energy: -1047.608014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.608014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -918.008014 (E_RNA) where: Base-Base interactions energy: -643.524 where: short stacking energy: -239.052 Base-Backbone interact. energy: -2.076 local terms energy: -272.407858 where: bonds (distance) C4'-P energy: -46.869 bonds (distance) P-C4' energy: -61.654 flat angles C4'-P-C4' energy: -53.125 flat angles P-C4'-P energy: -37.016 tors. eta vs tors. theta energy: -73.744 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 150 Temperature: 1.000000 Total energy: -1015.913443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1015.913443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -888.113443 (E_RNA) where: Base-Base interactions energy: -607.517 where: short stacking energy: -276.419 Base-Backbone interact. energy: -1.959 local terms energy: -278.636580 where: bonds (distance) C4'-P energy: -49.335 bonds (distance) P-C4' energy: -55.611 flat angles C4'-P-C4' energy: -55.616 flat angles P-C4'-P energy: -35.398 tors. eta vs tors. theta energy: -82.676 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 150 Temperature: 1.050000 Total energy: -1006.417366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.417366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.817366 (E_RNA) where: Base-Base interactions energy: -591.909 where: short stacking energy: -253.991 Base-Backbone interact. energy: -0.695 local terms energy: -284.213345 where: bonds (distance) C4'-P energy: -63.674 bonds (distance) P-C4' energy: -51.461 flat angles C4'-P-C4' energy: -50.890 flat angles P-C4'-P energy: -36.921 tors. eta vs tors. theta energy: -81.267 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 150 Temperature: 1.100000 Total energy: -895.787464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -895.787464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.787464 (E_RNA) where: Base-Base interactions energy: -522.768 where: short stacking energy: -233.147 Base-Backbone interact. energy: 1.717 local terms energy: -248.735836 where: bonds (distance) C4'-P energy: -49.835 bonds (distance) P-C4' energy: -45.059 flat angles C4'-P-C4' energy: -50.571 flat angles P-C4'-P energy: -43.981 tors. eta vs tors. theta energy: -59.289 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 150 Temperature: 1.150000 Total energy: -866.621353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.621353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.021353 (E_RNA) where: Base-Base interactions energy: -480.211 where: short stacking energy: -218.269 Base-Backbone interact. energy: 0.389 local terms energy: -257.199501 where: bonds (distance) C4'-P energy: -50.708 bonds (distance) P-C4' energy: -58.066 flat angles C4'-P-C4' energy: -54.220 flat angles P-C4'-P energy: -35.612 tors. eta vs tors. theta energy: -58.594 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 150 Temperature: 1.200000 Total energy: -864.381428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -864.381428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.381428 (E_RNA) where: Base-Base interactions energy: -483.095 where: short stacking energy: -222.233 Base-Backbone interact. energy: -1.529 local terms energy: -253.756720 where: bonds (distance) C4'-P energy: -42.340 bonds (distance) P-C4' energy: -60.160 flat angles C4'-P-C4' energy: -54.266 flat angles P-C4'-P energy: -34.889 tors. eta vs tors. theta energy: -62.102 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 150 Temperature: 1.250000 Total energy: -824.786154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.786154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.186154 (E_RNA) where: Base-Base interactions energy: -470.870 where: short stacking energy: -205.386 Base-Backbone interact. energy: -1.442 local terms energy: -222.873503 where: bonds (distance) C4'-P energy: -40.959 bonds (distance) P-C4' energy: -41.924 flat angles C4'-P-C4' energy: -50.591 flat angles P-C4'-P energy: -29.054 tors. eta vs tors. theta energy: -60.347 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 150 Temperature: 1.300000 Total energy: -731.553914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.553914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.153914 (E_RNA) where: Base-Base interactions energy: -390.705 where: short stacking energy: -164.457 Base-Backbone interact. energy: -1.809 local terms energy: -216.640184 where: bonds (distance) C4'-P energy: -42.647 bonds (distance) P-C4' energy: -53.741 flat angles C4'-P-C4' energy: -46.925 flat angles P-C4'-P energy: -38.007 tors. eta vs tors. theta energy: -35.321 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 150 Temperature: 1.350000 Total energy: -690.886776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.886776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.686776 (E_RNA) where: Base-Base interactions energy: -378.187 where: short stacking energy: -145.129 Base-Backbone interact. energy: 0.306 local terms energy: -188.806618 where: bonds (distance) C4'-P energy: -28.925 bonds (distance) P-C4' energy: -49.988 flat angles C4'-P-C4' energy: -49.405 flat angles P-C4'-P energy: -22.160 tors. eta vs tors. theta energy: -38.329 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 151 Temperature: 0.900000 Total energy: -1090.968804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1090.968804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.368804 (E_RNA) where: Base-Base interactions energy: -660.231 where: short stacking energy: -274.173 Base-Backbone interact. energy: -2.092 local terms energy: -299.046052 where: bonds (distance) C4'-P energy: -59.344 bonds (distance) P-C4' energy: -58.381 flat angles C4'-P-C4' energy: -59.137 flat angles P-C4'-P energy: -38.650 tors. eta vs tors. theta energy: -83.534 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 151 Temperature: 0.950000 Total energy: -1071.108937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1071.108937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.108937 (E_RNA) where: Base-Base interactions energy: -651.914 where: short stacking energy: -257.038 Base-Backbone interact. energy: -0.029 local terms energy: -293.165718 where: bonds (distance) C4'-P energy: -56.398 bonds (distance) P-C4' energy: -56.070 flat angles C4'-P-C4' energy: -62.400 flat angles P-C4'-P energy: -45.166 tors. eta vs tors. theta energy: -73.131 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 151 Temperature: 1.000000 Total energy: -1021.208141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.208141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -895.208141 (E_RNA) where: Base-Base interactions energy: -606.851 where: short stacking energy: -261.424 Base-Backbone interact. energy: -0.182 local terms energy: -288.175203 where: bonds (distance) C4'-P energy: -56.459 bonds (distance) P-C4' energy: -45.076 flat angles C4'-P-C4' energy: -55.845 flat angles P-C4'-P energy: -40.962 tors. eta vs tors. theta energy: -89.833 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 151 Temperature: 1.050000 Total energy: -987.644535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.644535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -858.044535 (E_RNA) where: Base-Base interactions energy: -576.395 where: short stacking energy: -243.898 Base-Backbone interact. energy: -0.596 local terms energy: -281.053953 where: bonds (distance) C4'-P energy: -52.990 bonds (distance) P-C4' energy: -56.912 flat angles C4'-P-C4' energy: -56.761 flat angles P-C4'-P energy: -39.231 tors. eta vs tors. theta energy: -75.159 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 151 Temperature: 1.100000 Total energy: -862.994999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.994999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.594999 (E_RNA) where: Base-Base interactions energy: -480.720 where: short stacking energy: -225.964 Base-Backbone interact. energy: -0.273 local terms energy: -259.602657 where: bonds (distance) C4'-P energy: -55.307 bonds (distance) P-C4' energy: -50.391 flat angles C4'-P-C4' energy: -54.863 flat angles P-C4'-P energy: -43.077 tors. eta vs tors. theta energy: -55.964 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 151 Temperature: 1.150000 Total energy: -832.555593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.555593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.555593 (E_RNA) where: Base-Base interactions energy: -459.369 where: short stacking energy: -210.748 Base-Backbone interact. energy: 2.325 local terms energy: -249.511015 where: bonds (distance) C4'-P energy: -54.257 bonds (distance) P-C4' energy: -47.251 flat angles C4'-P-C4' energy: -60.114 flat angles P-C4'-P energy: -29.706 tors. eta vs tors. theta energy: -58.183 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 151 Temperature: 1.200000 Total energy: -828.196761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -828.196761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.196761 (E_RNA) where: Base-Base interactions energy: -475.821 where: short stacking energy: -202.364 Base-Backbone interact. energy: 1.059 local terms energy: -227.434982 where: bonds (distance) C4'-P energy: -42.710 bonds (distance) P-C4' energy: -49.078 flat angles C4'-P-C4' energy: -61.271 flat angles P-C4'-P energy: -26.436 tors. eta vs tors. theta energy: -47.940 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 151 Temperature: 1.250000 Total energy: -746.897694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.897694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.697694 (E_RNA) where: Base-Base interactions energy: -419.199 where: short stacking energy: -185.447 Base-Backbone interact. energy: -1.127 local terms energy: -202.372397 where: bonds (distance) C4'-P energy: -44.375 bonds (distance) P-C4' energy: -41.301 flat angles C4'-P-C4' energy: -48.763 flat angles P-C4'-P energy: -25.960 tors. eta vs tors. theta energy: -41.974 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 151 Temperature: 1.300000 Total energy: -831.119295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.119295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.519295 (E_RNA) where: Base-Base interactions energy: -448.333 where: short stacking energy: -208.096 Base-Backbone interact. energy: -0.970 local terms energy: -261.216776 where: bonds (distance) C4'-P energy: -48.095 bonds (distance) P-C4' energy: -40.852 flat angles C4'-P-C4' energy: -58.800 flat angles P-C4'-P energy: -41.568 tors. eta vs tors. theta energy: -71.901 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 151 Temperature: 1.350000 Total energy: -691.625728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.625728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.825728 (E_RNA) where: Base-Base interactions energy: -366.306 where: short stacking energy: -150.216 Base-Backbone interact. energy: -1.381 local terms energy: -196.138440 where: bonds (distance) C4'-P energy: -41.749 bonds (distance) P-C4' energy: -47.760 flat angles C4'-P-C4' energy: -58.264 flat angles P-C4'-P energy: -15.942 tors. eta vs tors. theta energy: -32.423 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 152 Temperature: 0.900000 Total energy: -1103.163807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1103.163807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.363807 (E_RNA) where: Base-Base interactions energy: -662.315 where: short stacking energy: -285.110 Base-Backbone interact. energy: -2.183 local terms energy: -310.866014 where: bonds (distance) C4'-P energy: -50.267 bonds (distance) P-C4' energy: -68.823 flat angles C4'-P-C4' energy: -64.784 flat angles P-C4'-P energy: -40.340 tors. eta vs tors. theta energy: -86.652 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 152 Temperature: 0.950000 Total energy: -1053.263366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.263366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -925.463366 (E_RNA) where: Base-Base interactions energy: -631.980 where: short stacking energy: -244.492 Base-Backbone interact. energy: -1.012 local terms energy: -292.471684 where: bonds (distance) C4'-P energy: -58.292 bonds (distance) P-C4' energy: -58.714 flat angles C4'-P-C4' energy: -54.256 flat angles P-C4'-P energy: -44.148 tors. eta vs tors. theta energy: -77.062 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 152 Temperature: 1.000000 Total energy: -1024.361745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1024.361745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -894.761745 (E_RNA) where: Base-Base interactions energy: -597.403 where: short stacking energy: -257.310 Base-Backbone interact. energy: -0.425 local terms energy: -296.933500 where: bonds (distance) C4'-P energy: -59.462 bonds (distance) P-C4' energy: -52.837 flat angles C4'-P-C4' energy: -62.623 flat angles P-C4'-P energy: -45.290 tors. eta vs tors. theta energy: -76.721 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 152 Temperature: 1.050000 Total energy: -1011.243626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.243626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.643626 (E_RNA) where: Base-Base interactions energy: -592.209 where: short stacking energy: -245.794 Base-Backbone interact. energy: -1.173 local terms energy: -288.261332 where: bonds (distance) C4'-P energy: -52.333 bonds (distance) P-C4' energy: -47.628 flat angles C4'-P-C4' energy: -57.948 flat angles P-C4'-P energy: -41.954 tors. eta vs tors. theta energy: -88.399 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 152 Temperature: 1.100000 Total energy: -858.801684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.801684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.001684 (E_RNA) where: Base-Base interactions energy: -461.829 where: short stacking energy: -203.781 Base-Backbone interact. energy: -1.309 local terms energy: -267.863694 where: bonds (distance) C4'-P energy: -50.134 bonds (distance) P-C4' energy: -55.183 flat angles C4'-P-C4' energy: -61.163 flat angles P-C4'-P energy: -45.644 tors. eta vs tors. theta energy: -55.740 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 152 Temperature: 1.150000 Total energy: -881.323842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -881.323842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.123842 (E_RNA) where: Base-Base interactions energy: -479.761 where: short stacking energy: -215.551 Base-Backbone interact. energy: -0.926 local terms energy: -276.436455 where: bonds (distance) C4'-P energy: -55.531 bonds (distance) P-C4' energy: -52.244 flat angles C4'-P-C4' energy: -61.480 flat angles P-C4'-P energy: -46.620 tors. eta vs tors. theta energy: -60.563 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 152 Temperature: 1.200000 Total energy: -833.170066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.170066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.370066 (E_RNA) where: Base-Base interactions energy: -467.550 where: short stacking energy: -197.742 Base-Backbone interact. energy: 0.536 local terms energy: -238.356065 where: bonds (distance) C4'-P energy: -54.506 bonds (distance) P-C4' energy: -43.347 flat angles C4'-P-C4' energy: -54.913 flat angles P-C4'-P energy: -30.102 tors. eta vs tors. theta energy: -55.488 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 152 Temperature: 1.250000 Total energy: -751.628345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.628345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -625.628345 (E_RNA) where: Base-Base interactions energy: -407.578 where: short stacking energy: -166.636 Base-Backbone interact. energy: -1.020 local terms energy: -217.030161 where: bonds (distance) C4'-P energy: -50.214 bonds (distance) P-C4' energy: -45.866 flat angles C4'-P-C4' energy: -50.190 flat angles P-C4'-P energy: -29.613 tors. eta vs tors. theta energy: -41.148 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 152 Temperature: 1.300000 Total energy: -769.783247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.783247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.383247 (E_RNA) where: Base-Base interactions energy: -419.747 where: short stacking energy: -173.322 Base-Backbone interact. energy: -0.517 local terms energy: -227.118589 where: bonds (distance) C4'-P energy: -42.363 bonds (distance) P-C4' energy: -44.069 flat angles C4'-P-C4' energy: -52.756 flat angles P-C4'-P energy: -31.003 tors. eta vs tors. theta energy: -56.929 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 152 Temperature: 1.350000 Total energy: -681.515522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.515522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.715522 (E_RNA) where: Base-Base interactions energy: -358.277 where: short stacking energy: -153.567 Base-Backbone interact. energy: 0.142 local terms energy: -204.580237 where: bonds (distance) C4'-P energy: -48.319 bonds (distance) P-C4' energy: -46.489 flat angles C4'-P-C4' energy: -44.448 flat angles P-C4'-P energy: -29.063 tors. eta vs tors. theta energy: -36.262 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 153 Temperature: 0.900000 Total energy: -1099.289797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1099.289797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -971.489797 (E_RNA) where: Base-Base interactions energy: -667.337 where: short stacking energy: -272.587 Base-Backbone interact. energy: -0.192 local terms energy: -303.960595 where: bonds (distance) C4'-P energy: -49.687 bonds (distance) P-C4' energy: -56.883 flat angles C4'-P-C4' energy: -66.294 flat angles P-C4'-P energy: -48.781 tors. eta vs tors. theta energy: -82.315 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 153 Temperature: 0.950000 Total energy: -1055.352324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.352324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.552324 (E_RNA) where: Base-Base interactions energy: -635.211 where: short stacking energy: -281.257 Base-Backbone interact. energy: -0.629 local terms energy: -291.712487 where: bonds (distance) C4'-P energy: -58.002 bonds (distance) P-C4' energy: -44.771 flat angles C4'-P-C4' energy: -65.451 flat angles P-C4'-P energy: -43.150 tors. eta vs tors. theta energy: -80.339 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 153 Temperature: 1.000000 Total energy: -1041.221817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.221817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.621817 (E_RNA) where: Base-Base interactions energy: -645.256 where: short stacking energy: -231.507 Base-Backbone interact. energy: -2.762 local terms energy: -263.603965 where: bonds (distance) C4'-P energy: -38.344 bonds (distance) P-C4' energy: -59.440 flat angles C4'-P-C4' energy: -60.044 flat angles P-C4'-P energy: -37.729 tors. eta vs tors. theta energy: -68.047 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 153 Temperature: 1.050000 Total energy: -932.168274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -932.168274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -807.968274 (E_RNA) where: Base-Base interactions energy: -542.718 where: short stacking energy: -245.721 Base-Backbone interact. energy: -1.138 local terms energy: -264.111459 where: bonds (distance) C4'-P energy: -45.885 bonds (distance) P-C4' energy: -58.518 flat angles C4'-P-C4' energy: -48.624 flat angles P-C4'-P energy: -36.668 tors. eta vs tors. theta energy: -74.417 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 153 Temperature: 1.100000 Total energy: -882.739172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -882.739172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.939172 (E_RNA) where: Base-Base interactions energy: -492.790 where: short stacking energy: -218.699 Base-Backbone interact. energy: 1.400 local terms energy: -263.549691 where: bonds (distance) C4'-P energy: -58.907 bonds (distance) P-C4' energy: -48.710 flat angles C4'-P-C4' energy: -54.189 flat angles P-C4'-P energy: -45.659 tors. eta vs tors. theta energy: -56.085 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 153 Temperature: 1.150000 Total energy: -866.721632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.721632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.721632 (E_RNA) where: Base-Base interactions energy: -493.191 where: short stacking energy: -217.024 Base-Backbone interact. energy: -0.599 local terms energy: -246.932338 where: bonds (distance) C4'-P energy: -54.883 bonds (distance) P-C4' energy: -52.550 flat angles C4'-P-C4' energy: -49.417 flat angles P-C4'-P energy: -28.817 tors. eta vs tors. theta energy: -61.266 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 153 Temperature: 1.200000 Total energy: -832.994917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.994917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.394917 (E_RNA) where: Base-Base interactions energy: -461.910 where: short stacking energy: -201.407 Base-Backbone interact. energy: 0.742 local terms energy: -242.227083 where: bonds (distance) C4'-P energy: -55.590 bonds (distance) P-C4' energy: -52.640 flat angles C4'-P-C4' energy: -45.989 flat angles P-C4'-P energy: -40.667 tors. eta vs tors. theta energy: -47.341 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 153 Temperature: 1.250000 Total energy: -828.422695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -828.422695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.822695 (E_RNA) where: Base-Base interactions energy: -472.742 where: short stacking energy: -204.314 Base-Backbone interact. energy: -0.186 local terms energy: -225.895294 where: bonds (distance) C4'-P energy: -38.363 bonds (distance) P-C4' energy: -51.259 flat angles C4'-P-C4' energy: -51.041 flat angles P-C4'-P energy: -22.324 tors. eta vs tors. theta energy: -62.908 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 153 Temperature: 1.300000 Total energy: -739.668159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -739.668159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.868159 (E_RNA) where: Base-Base interactions energy: -402.571 where: short stacking energy: -166.436 Base-Backbone interact. energy: -1.916 local terms energy: -207.380409 where: bonds (distance) C4'-P energy: -43.146 bonds (distance) P-C4' energy: -46.506 flat angles C4'-P-C4' energy: -45.954 flat angles P-C4'-P energy: -25.127 tors. eta vs tors. theta energy: -46.647 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 153 Temperature: 1.350000 Total energy: -700.878372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.878372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.878372 (E_RNA) where: Base-Base interactions energy: -376.446 where: short stacking energy: -162.485 Base-Backbone interact. energy: -0.499 local terms energy: -197.933387 where: bonds (distance) C4'-P energy: -31.719 bonds (distance) P-C4' energy: -38.272 flat angles C4'-P-C4' energy: -46.347 flat angles P-C4'-P energy: -36.929 tors. eta vs tors. theta energy: -44.666 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 154 Temperature: 0.900000 Total energy: -1099.445521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1099.445521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -971.645521 (E_RNA) where: Base-Base interactions energy: -664.995 where: short stacking energy: -284.025 Base-Backbone interact. energy: 0.375 local terms energy: -307.025232 where: bonds (distance) C4'-P energy: -56.270 bonds (distance) P-C4' energy: -49.172 flat angles C4'-P-C4' energy: -67.199 flat angles P-C4'-P energy: -42.391 tors. eta vs tors. theta energy: -91.993 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 154 Temperature: 0.950000 Total energy: -1053.967726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.967726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -929.767726 (E_RNA) where: Base-Base interactions energy: -627.251 where: short stacking energy: -275.971 Base-Backbone interact. energy: 2.837 local terms energy: -305.353548 where: bonds (distance) C4'-P energy: -57.686 bonds (distance) P-C4' energy: -51.189 flat angles C4'-P-C4' energy: -67.532 flat angles P-C4'-P energy: -41.868 tors. eta vs tors. theta energy: -87.078 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 154 Temperature: 1.000000 Total energy: -1045.112374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.112374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.112374 (E_RNA) where: Base-Base interactions energy: -645.313 where: short stacking energy: -242.479 Base-Backbone interact. energy: -1.804 local terms energy: -271.994570 where: bonds (distance) C4'-P energy: -52.794 bonds (distance) P-C4' energy: -40.158 flat angles C4'-P-C4' energy: -63.831 flat angles P-C4'-P energy: -37.630 tors. eta vs tors. theta energy: -77.581 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 154 Temperature: 1.050000 Total energy: -957.401245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -957.401245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.601245 (E_RNA) where: Base-Base interactions energy: -550.580 where: short stacking energy: -241.994 Base-Backbone interact. energy: -0.698 local terms energy: -278.322730 where: bonds (distance) C4'-P energy: -50.904 bonds (distance) P-C4' energy: -54.017 flat angles C4'-P-C4' energy: -65.168 flat angles P-C4'-P energy: -41.423 tors. eta vs tors. theta energy: -66.811 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 154 Temperature: 1.100000 Total energy: -893.362779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.362779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.362779 (E_RNA) where: Base-Base interactions energy: -513.582 where: short stacking energy: -220.514 Base-Backbone interact. energy: -1.227 local terms energy: -252.553742 where: bonds (distance) C4'-P energy: -54.895 bonds (distance) P-C4' energy: -39.277 flat angles C4'-P-C4' energy: -57.546 flat angles P-C4'-P energy: -33.946 tors. eta vs tors. theta energy: -66.889 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 154 Temperature: 1.150000 Total energy: -850.936890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.936890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -726.736890 (E_RNA) where: Base-Base interactions energy: -460.178 where: short stacking energy: -203.119 Base-Backbone interact. energy: 0.341 local terms energy: -266.900256 where: bonds (distance) C4'-P energy: -49.977 bonds (distance) P-C4' energy: -55.765 flat angles C4'-P-C4' energy: -59.415 flat angles P-C4'-P energy: -45.119 tors. eta vs tors. theta energy: -56.624 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 154 Temperature: 1.200000 Total energy: -867.714059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -867.714059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.514059 (E_RNA) where: Base-Base interactions energy: -489.808 where: short stacking energy: -208.449 Base-Backbone interact. energy: -1.881 local terms energy: -251.824366 where: bonds (distance) C4'-P energy: -50.398 bonds (distance) P-C4' energy: -48.232 flat angles C4'-P-C4' energy: -52.900 flat angles P-C4'-P energy: -41.281 tors. eta vs tors. theta energy: -59.012 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 154 Temperature: 1.250000 Total energy: -812.911247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.911247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.111247 (E_RNA) where: Base-Base interactions energy: -438.881 where: short stacking energy: -177.952 Base-Backbone interact. energy: 0.523 local terms energy: -246.753213 where: bonds (distance) C4'-P energy: -58.337 bonds (distance) P-C4' energy: -48.751 flat angles C4'-P-C4' energy: -52.966 flat angles P-C4'-P energy: -28.320 tors. eta vs tors. theta energy: -58.379 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 154 Temperature: 1.300000 Total energy: -756.316201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.316201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.516201 (E_RNA) where: Base-Base interactions energy: -424.171 where: short stacking energy: -172.033 Base-Backbone interact. energy: -0.921 local terms energy: -203.424314 where: bonds (distance) C4'-P energy: -48.389 bonds (distance) P-C4' energy: -44.132 flat angles C4'-P-C4' energy: -44.389 flat angles P-C4'-P energy: -30.072 tors. eta vs tors. theta energy: -36.443 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 154 Temperature: 1.350000 Total energy: -681.494282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.494282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.694282 (E_RNA) where: Base-Base interactions energy: -386.851 where: short stacking energy: -161.017 Base-Backbone interact. energy: 0.949 local terms energy: -167.792009 where: bonds (distance) C4'-P energy: -33.477 bonds (distance) P-C4' energy: -33.929 flat angles C4'-P-C4' energy: -44.272 flat angles P-C4'-P energy: -25.377 tors. eta vs tors. theta energy: -30.737 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 155 Temperature: 0.900000 Total energy: -1095.360241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.360241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -967.560241 (E_RNA) where: Base-Base interactions energy: -649.361 where: short stacking energy: -274.811 Base-Backbone interact. energy: -0.906 local terms energy: -317.293566 where: bonds (distance) C4'-P energy: -63.618 bonds (distance) P-C4' energy: -62.246 flat angles C4'-P-C4' energy: -62.050 flat angles P-C4'-P energy: -47.348 tors. eta vs tors. theta energy: -82.032 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 155 Temperature: 0.950000 Total energy: -1064.467405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.467405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -934.867405 (E_RNA) where: Base-Base interactions energy: -644.604 where: short stacking energy: -258.234 Base-Backbone interact. energy: -1.983 local terms energy: -288.279999 where: bonds (distance) C4'-P energy: -56.249 bonds (distance) P-C4' energy: -57.244 flat angles C4'-P-C4' energy: -54.454 flat angles P-C4'-P energy: -45.213 tors. eta vs tors. theta energy: -75.121 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 155 Temperature: 1.000000 Total energy: -1031.924554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.924554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.924554 (E_RNA) where: Base-Base interactions energy: -603.906 where: short stacking energy: -277.849 Base-Backbone interact. energy: -0.824 local terms energy: -301.194047 where: bonds (distance) C4'-P energy: -59.194 bonds (distance) P-C4' energy: -56.951 flat angles C4'-P-C4' energy: -61.445 flat angles P-C4'-P energy: -45.903 tors. eta vs tors. theta energy: -77.701 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 155 Temperature: 1.050000 Total energy: -983.562428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -983.562428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -857.562428 (E_RNA) where: Base-Base interactions energy: -559.712 where: short stacking energy: -258.113 Base-Backbone interact. energy: -0.518 local terms energy: -297.332600 where: bonds (distance) C4'-P energy: -52.462 bonds (distance) P-C4' energy: -58.488 flat angles C4'-P-C4' energy: -62.017 flat angles P-C4'-P energy: -40.984 tors. eta vs tors. theta energy: -83.382 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 155 Temperature: 1.100000 Total energy: -892.934865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -892.934865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.734865 (E_RNA) where: Base-Base interactions energy: -498.858 where: short stacking energy: -231.580 Base-Backbone interact. energy: 3.302 local terms energy: -273.178402 where: bonds (distance) C4'-P energy: -57.324 bonds (distance) P-C4' energy: -59.441 flat angles C4'-P-C4' energy: -59.995 flat angles P-C4'-P energy: -37.314 tors. eta vs tors. theta energy: -59.105 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 155 Temperature: 1.150000 Total energy: -882.526874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -882.526874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.526874 (E_RNA) where: Base-Base interactions energy: -507.037 where: short stacking energy: -228.086 Base-Backbone interact. energy: -1.716 local terms energy: -247.774388 where: bonds (distance) C4'-P energy: -43.793 bonds (distance) P-C4' energy: -48.418 flat angles C4'-P-C4' energy: -49.287 flat angles P-C4'-P energy: -43.273 tors. eta vs tors. theta energy: -63.003 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 155 Temperature: 1.200000 Total energy: -815.850476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.850476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.050476 (E_RNA) where: Base-Base interactions energy: -448.344 where: short stacking energy: -196.655 Base-Backbone interact. energy: -0.414 local terms energy: -239.292999 where: bonds (distance) C4'-P energy: -44.292 bonds (distance) P-C4' energy: -54.944 flat angles C4'-P-C4' energy: -50.154 flat angles P-C4'-P energy: -34.593 tors. eta vs tors. theta energy: -55.309 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 155 Temperature: 1.250000 Total energy: -784.302714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.302714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.502714 (E_RNA) where: Base-Base interactions energy: -429.172 where: short stacking energy: -186.333 Base-Backbone interact. energy: 0.410 local terms energy: -227.740995 where: bonds (distance) C4'-P energy: -43.596 bonds (distance) P-C4' energy: -55.457 flat angles C4'-P-C4' energy: -45.731 flat angles P-C4'-P energy: -32.185 tors. eta vs tors. theta energy: -50.771 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 155 Temperature: 1.300000 Total energy: -729.484555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.484555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.684555 (E_RNA) where: Base-Base interactions energy: -389.243 where: short stacking energy: -147.751 Base-Backbone interact. energy: -0.993 local terms energy: -211.448366 where: bonds (distance) C4'-P energy: -38.030 bonds (distance) P-C4' energy: -56.394 flat angles C4'-P-C4' energy: -51.895 flat angles P-C4'-P energy: -36.224 tors. eta vs tors. theta energy: -28.906 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 155 Temperature: 1.350000 Total energy: -727.873289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.873289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.273289 (E_RNA) where: Base-Base interactions energy: -379.570 where: short stacking energy: -150.631 Base-Backbone interact. energy: -0.724 local terms energy: -226.979182 where: bonds (distance) C4'-P energy: -45.660 bonds (distance) P-C4' energy: -57.921 flat angles C4'-P-C4' energy: -49.342 flat angles P-C4'-P energy: -26.307 tors. eta vs tors. theta energy: -47.749 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 156 Temperature: 0.900000 Total energy: -1099.889395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1099.889395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.089395 (E_RNA) where: Base-Base interactions energy: -664.309 where: short stacking energy: -273.082 Base-Backbone interact. energy: -0.443 local terms energy: -307.337786 where: bonds (distance) C4'-P energy: -49.637 bonds (distance) P-C4' energy: -65.762 flat angles C4'-P-C4' energy: -57.497 flat angles P-C4'-P energy: -51.233 tors. eta vs tors. theta energy: -83.209 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 156 Temperature: 0.950000 Total energy: -1065.338659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1065.338659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -935.738659 (E_RNA) where: Base-Base interactions energy: -644.836 where: short stacking energy: -250.003 Base-Backbone interact. energy: -0.368 local terms energy: -290.534953 where: bonds (distance) C4'-P energy: -50.095 bonds (distance) P-C4' energy: -55.970 flat angles C4'-P-C4' energy: -59.271 flat angles P-C4'-P energy: -46.167 tors. eta vs tors. theta energy: -79.033 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 156 Temperature: 1.000000 Total energy: -966.156950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.156950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.556950 (E_RNA) where: Base-Base interactions energy: -559.872 where: short stacking energy: -248.786 Base-Backbone interact. energy: -0.054 local terms energy: -276.631102 where: bonds (distance) C4'-P energy: -65.281 bonds (distance) P-C4' energy: -49.000 flat angles C4'-P-C4' energy: -59.893 flat angles P-C4'-P energy: -36.720 tors. eta vs tors. theta energy: -65.737 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 156 Temperature: 1.050000 Total energy: -1004.569426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.569426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.969426 (E_RNA) where: Base-Base interactions energy: -580.247 where: short stacking energy: -269.702 Base-Backbone interact. energy: -1.591 local terms energy: -293.131694 where: bonds (distance) C4'-P energy: -49.166 bonds (distance) P-C4' energy: -57.670 flat angles C4'-P-C4' energy: -68.065 flat angles P-C4'-P energy: -39.692 tors. eta vs tors. theta energy: -78.539 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 156 Temperature: 1.100000 Total energy: -886.214688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -886.214688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.214688 (E_RNA) where: Base-Base interactions energy: -512.172 where: short stacking energy: -224.650 Base-Backbone interact. energy: -0.757 local terms energy: -247.286100 where: bonds (distance) C4'-P energy: -51.888 bonds (distance) P-C4' energy: -40.811 flat angles C4'-P-C4' energy: -60.056 flat angles P-C4'-P energy: -25.704 tors. eta vs tors. theta energy: -68.827 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 156 Temperature: 1.150000 Total energy: -910.262954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -910.262954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.662954 (E_RNA) where: Base-Base interactions energy: -528.609 where: short stacking energy: -226.364 Base-Backbone interact. energy: -0.733 local terms energy: -251.320930 where: bonds (distance) C4'-P energy: -54.535 bonds (distance) P-C4' energy: -48.318 flat angles C4'-P-C4' energy: -57.658 flat angles P-C4'-P energy: -28.589 tors. eta vs tors. theta energy: -62.220 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 156 Temperature: 1.200000 Total energy: -848.067716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.067716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.467716 (E_RNA) where: Base-Base interactions energy: -483.876 where: short stacking energy: -207.639 Base-Backbone interact. energy: 0.902 local terms energy: -235.493723 where: bonds (distance) C4'-P energy: -47.158 bonds (distance) P-C4' energy: -52.399 flat angles C4'-P-C4' energy: -51.361 flat angles P-C4'-P energy: -28.139 tors. eta vs tors. theta energy: -56.437 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 156 Temperature: 1.250000 Total energy: -781.685136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.685136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.685136 (E_RNA) where: Base-Base interactions energy: -421.963 where: short stacking energy: -169.814 Base-Backbone interact. energy: -0.879 local terms energy: -232.843732 where: bonds (distance) C4'-P energy: -40.960 bonds (distance) P-C4' energy: -47.401 flat angles C4'-P-C4' energy: -55.552 flat angles P-C4'-P energy: -38.638 tors. eta vs tors. theta energy: -50.292 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 156 Temperature: 1.300000 Total energy: -690.546570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.546570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.546570 (E_RNA) where: Base-Base interactions energy: -358.591 where: short stacking energy: -148.154 Base-Backbone interact. energy: -1.010 local terms energy: -204.945881 where: bonds (distance) C4'-P energy: -53.847 bonds (distance) P-C4' energy: -41.805 flat angles C4'-P-C4' energy: -48.765 flat angles P-C4'-P energy: -29.485 tors. eta vs tors. theta energy: -31.044 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 156 Temperature: 1.350000 Total energy: -776.457047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.457047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.657047 (E_RNA) where: Base-Base interactions energy: -439.661 where: short stacking energy: -196.646 Base-Backbone interact. energy: -0.085 local terms energy: -208.910733 where: bonds (distance) C4'-P energy: -45.419 bonds (distance) P-C4' energy: -39.663 flat angles C4'-P-C4' energy: -37.332 flat angles P-C4'-P energy: -33.550 tors. eta vs tors. theta energy: -52.947 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 157 Temperature: 0.900000 Total energy: -1099.207356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1099.207356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -969.607356 (E_RNA) where: Base-Base interactions energy: -662.138 where: short stacking energy: -278.702 Base-Backbone interact. energy: -1.389 local terms energy: -306.079651 where: bonds (distance) C4'-P energy: -58.312 bonds (distance) P-C4' energy: -46.308 flat angles C4'-P-C4' energy: -69.078 flat angles P-C4'-P energy: -47.552 tors. eta vs tors. theta energy: -84.829 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 157 Temperature: 0.950000 Total energy: -1055.826560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.826560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.026560 (E_RNA) where: Base-Base interactions energy: -640.934 where: short stacking energy: -228.830 Base-Backbone interact. energy: -1.604 local terms energy: -285.488654 where: bonds (distance) C4'-P energy: -54.374 bonds (distance) P-C4' energy: -59.865 flat angles C4'-P-C4' energy: -60.789 flat angles P-C4'-P energy: -38.552 tors. eta vs tors. theta energy: -71.909 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 157 Temperature: 1.000000 Total energy: -1002.096636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1002.096636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.096636 (E_RNA) where: Base-Base interactions energy: -583.447 where: short stacking energy: -264.509 Base-Backbone interact. energy: -1.929 local terms energy: -290.721480 where: bonds (distance) C4'-P energy: -59.847 bonds (distance) P-C4' energy: -52.392 flat angles C4'-P-C4' energy: -55.946 flat angles P-C4'-P energy: -43.830 tors. eta vs tors. theta energy: -78.706 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 157 Temperature: 1.050000 Total energy: -1006.397084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.397084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -878.597084 (E_RNA) where: Base-Base interactions energy: -606.186 where: short stacking energy: -260.643 Base-Backbone interact. energy: 1.484 local terms energy: -273.894545 where: bonds (distance) C4'-P energy: -50.576 bonds (distance) P-C4' energy: -57.022 flat angles C4'-P-C4' energy: -61.199 flat angles P-C4'-P energy: -28.988 tors. eta vs tors. theta energy: -76.110 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 157 Temperature: 1.100000 Total energy: -872.934582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.934582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.734582 (E_RNA) where: Base-Base interactions energy: -495.932 where: short stacking energy: -224.571 Base-Backbone interact. energy: 0.036 local terms energy: -252.838868 where: bonds (distance) C4'-P energy: -48.968 bonds (distance) P-C4' energy: -54.493 flat angles C4'-P-C4' energy: -55.437 flat angles P-C4'-P energy: -32.728 tors. eta vs tors. theta energy: -61.214 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 157 Temperature: 1.150000 Total energy: -872.424193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.424193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -742.824193 (E_RNA) where: Base-Base interactions energy: -485.802 where: short stacking energy: -214.227 Base-Backbone interact. energy: -0.739 local terms energy: -256.282791 where: bonds (distance) C4'-P energy: -50.276 bonds (distance) P-C4' energy: -47.478 flat angles C4'-P-C4' energy: -56.927 flat angles P-C4'-P energy: -34.528 tors. eta vs tors. theta energy: -67.075 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 157 Temperature: 1.200000 Total energy: -858.328491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.328491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.928491 (E_RNA) where: Base-Base interactions energy: -469.508 where: short stacking energy: -215.469 Base-Backbone interact. energy: -0.995 local terms energy: -265.425958 where: bonds (distance) C4'-P energy: -59.271 bonds (distance) P-C4' energy: -51.213 flat angles C4'-P-C4' energy: -56.435 flat angles P-C4'-P energy: -35.853 tors. eta vs tors. theta energy: -62.654 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 157 Temperature: 1.250000 Total energy: -768.218086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.218086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.418086 (E_RNA) where: Base-Base interactions energy: -417.299 where: short stacking energy: -171.844 Base-Backbone interact. energy: -0.847 local terms energy: -222.271379 where: bonds (distance) C4'-P energy: -38.732 bonds (distance) P-C4' energy: -57.151 flat angles C4'-P-C4' energy: -40.742 flat angles P-C4'-P energy: -36.012 tors. eta vs tors. theta energy: -49.635 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 157 Temperature: 1.300000 Total energy: -695.729396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.729396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.929396 (E_RNA) where: Base-Base interactions energy: -371.986 where: short stacking energy: -155.662 Base-Backbone interact. energy: -0.398 local terms energy: -195.544557 where: bonds (distance) C4'-P energy: -51.681 bonds (distance) P-C4' energy: -35.294 flat angles C4'-P-C4' energy: -47.747 flat angles P-C4'-P energy: -20.565 tors. eta vs tors. theta energy: -40.257 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 157 Temperature: 1.350000 Total energy: -736.148164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.148164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.748164 (E_RNA) where: Base-Base interactions energy: -413.350 where: short stacking energy: -176.544 Base-Backbone interact. energy: 1.042 local terms energy: -201.439859 where: bonds (distance) C4'-P energy: -39.960 bonds (distance) P-C4' energy: -49.747 flat angles C4'-P-C4' energy: -48.873 flat angles P-C4'-P energy: -24.191 tors. eta vs tors. theta energy: -38.668 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 158 Temperature: 0.900000 Total energy: -1090.557540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1090.557540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.757540 (E_RNA) where: Base-Base interactions energy: -655.514 where: short stacking energy: -269.863 Base-Backbone interact. energy: -1.303 local terms energy: -305.939734 where: bonds (distance) C4'-P energy: -59.755 bonds (distance) P-C4' energy: -58.352 flat angles C4'-P-C4' energy: -63.173 flat angles P-C4'-P energy: -42.334 tors. eta vs tors. theta energy: -82.326 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 158 Temperature: 0.950000 Total energy: -1077.816580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1077.816580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -950.016580 (E_RNA) where: Base-Base interactions energy: -677.171 where: short stacking energy: -258.102 Base-Backbone interact. energy: -1.317 local terms energy: -271.528616 where: bonds (distance) C4'-P energy: -45.131 bonds (distance) P-C4' energy: -51.892 flat angles C4'-P-C4' energy: -55.470 flat angles P-C4'-P energy: -41.403 tors. eta vs tors. theta energy: -77.631 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 158 Temperature: 1.000000 Total energy: -1009.075757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.075757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -883.075757 (E_RNA) where: Base-Base interactions energy: -596.537 where: short stacking energy: -258.831 Base-Backbone interact. energy: -0.285 local terms energy: -286.253550 where: bonds (distance) C4'-P energy: -46.073 bonds (distance) P-C4' energy: -63.247 flat angles C4'-P-C4' energy: -56.508 flat angles P-C4'-P energy: -45.054 tors. eta vs tors. theta energy: -75.372 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 158 Temperature: 1.050000 Total energy: -996.674158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.674158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -868.874158 (E_RNA) where: Base-Base interactions energy: -581.463 where: short stacking energy: -261.637 Base-Backbone interact. energy: 0.396 local terms energy: -287.806987 where: bonds (distance) C4'-P energy: -50.434 bonds (distance) P-C4' energy: -57.920 flat angles C4'-P-C4' energy: -58.427 flat angles P-C4'-P energy: -35.934 tors. eta vs tors. theta energy: -85.092 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 158 Temperature: 1.100000 Total energy: -888.002955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -888.002955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.202955 (E_RNA) where: Base-Base interactions energy: -497.357 where: short stacking energy: -219.201 Base-Backbone interact. energy: 1.123 local terms energy: -263.968529 where: bonds (distance) C4'-P energy: -50.855 bonds (distance) P-C4' energy: -45.449 flat angles C4'-P-C4' energy: -57.859 flat angles P-C4'-P energy: -38.267 tors. eta vs tors. theta energy: -71.539 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 158 Temperature: 1.150000 Total energy: -827.336376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.336376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.336376 (E_RNA) where: Base-Base interactions energy: -445.134 where: short stacking energy: -217.670 Base-Backbone interact. energy: -0.040 local terms energy: -256.163091 where: bonds (distance) C4'-P energy: -45.413 bonds (distance) P-C4' energy: -53.845 flat angles C4'-P-C4' energy: -57.655 flat angles P-C4'-P energy: -34.807 tors. eta vs tors. theta energy: -64.443 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 158 Temperature: 1.200000 Total energy: -826.911227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.911227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.111227 (E_RNA) where: Base-Base interactions energy: -474.874 where: short stacking energy: -206.129 Base-Backbone interact. energy: -0.073 local terms energy: -224.164323 where: bonds (distance) C4'-P energy: -43.233 bonds (distance) P-C4' energy: -44.672 flat angles C4'-P-C4' energy: -49.459 flat angles P-C4'-P energy: -25.881 tors. eta vs tors. theta energy: -60.918 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 158 Temperature: 1.250000 Total energy: -822.580953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.580953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.580953 (E_RNA) where: Base-Base interactions energy: -452.949 where: short stacking energy: -206.946 Base-Backbone interact. energy: 5.328 local terms energy: -248.960574 where: bonds (distance) C4'-P energy: -39.517 bonds (distance) P-C4' energy: -52.278 flat angles C4'-P-C4' energy: -63.488 flat angles P-C4'-P energy: -42.237 tors. eta vs tors. theta energy: -51.441 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 158 Temperature: 1.300000 Total energy: -756.918856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.918856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -627.318856 (E_RNA) where: Base-Base interactions energy: -426.015 where: short stacking energy: -182.242 Base-Backbone interact. energy: -1.089 local terms energy: -200.214931 where: bonds (distance) C4'-P energy: -45.428 bonds (distance) P-C4' energy: -35.691 flat angles C4'-P-C4' energy: -45.406 flat angles P-C4'-P energy: -33.866 tors. eta vs tors. theta energy: -39.824 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 158 Temperature: 1.350000 Total energy: -658.616093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.616093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.616093 (E_RNA) where: Base-Base interactions energy: -344.196 where: short stacking energy: -139.769 Base-Backbone interact. energy: 2.485 local terms energy: -199.905032 where: bonds (distance) C4'-P energy: -50.506 bonds (distance) P-C4' energy: -55.020 flat angles C4'-P-C4' energy: -47.193 flat angles P-C4'-P energy: -25.636 tors. eta vs tors. theta energy: -21.550 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 159 Temperature: 0.900000 Total energy: -1086.602161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.602161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.602161 (E_RNA) where: Base-Base interactions energy: -654.620 where: short stacking energy: -283.249 Base-Backbone interact. energy: 1.083 local terms energy: -307.064855 where: bonds (distance) C4'-P energy: -64.055 bonds (distance) P-C4' energy: -52.783 flat angles C4'-P-C4' energy: -59.974 flat angles P-C4'-P energy: -43.936 tors. eta vs tors. theta energy: -86.318 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 159 Temperature: 0.950000 Total energy: -1055.921840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.921840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.721840 (E_RNA) where: Base-Base interactions energy: -657.650 where: short stacking energy: -257.592 Base-Backbone interact. energy: -2.070 local terms energy: -272.001893 where: bonds (distance) C4'-P energy: -52.471 bonds (distance) P-C4' energy: -49.798 flat angles C4'-P-C4' energy: -56.363 flat angles P-C4'-P energy: -42.319 tors. eta vs tors. theta energy: -71.052 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 159 Temperature: 1.000000 Total energy: -1038.113343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.113343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.313343 (E_RNA) where: Base-Base interactions energy: -621.708 where: short stacking energy: -277.413 Base-Backbone interact. energy: 0.453 local terms energy: -289.058257 where: bonds (distance) C4'-P energy: -44.161 bonds (distance) P-C4' energy: -51.387 flat angles C4'-P-C4' energy: -64.219 flat angles P-C4'-P energy: -46.351 tors. eta vs tors. theta energy: -82.939 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 159 Temperature: 1.050000 Total energy: -972.074397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.074397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -844.274397 (E_RNA) where: Base-Base interactions energy: -565.534 where: short stacking energy: -260.229 Base-Backbone interact. energy: -0.960 local terms energy: -277.781228 where: bonds (distance) C4'-P energy: -51.175 bonds (distance) P-C4' energy: -42.863 flat angles C4'-P-C4' energy: -59.317 flat angles P-C4'-P energy: -39.304 tors. eta vs tors. theta energy: -85.123 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 159 Temperature: 1.100000 Total energy: -921.667026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.667026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.867026 (E_RNA) where: Base-Base interactions energy: -530.996 where: short stacking energy: -232.891 Base-Backbone interact. energy: -0.268 local terms energy: -262.603180 where: bonds (distance) C4'-P energy: -53.381 bonds (distance) P-C4' energy: -52.690 flat angles C4'-P-C4' energy: -47.773 flat angles P-C4'-P energy: -32.067 tors. eta vs tors. theta energy: -76.693 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 159 Temperature: 1.150000 Total energy: -835.405211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.405211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.605211 (E_RNA) where: Base-Base interactions energy: -468.737 where: short stacking energy: -198.368 Base-Backbone interact. energy: -1.220 local terms energy: -237.647471 where: bonds (distance) C4'-P energy: -39.258 bonds (distance) P-C4' energy: -47.272 flat angles C4'-P-C4' energy: -54.979 flat angles P-C4'-P energy: -39.539 tors. eta vs tors. theta energy: -56.600 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 159 Temperature: 1.200000 Total energy: -812.417566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.417566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.817566 (E_RNA) where: Base-Base interactions energy: -450.592 where: short stacking energy: -190.288 Base-Backbone interact. energy: 1.285 local terms energy: -233.510366 where: bonds (distance) C4'-P energy: -51.107 bonds (distance) P-C4' energy: -53.372 flat angles C4'-P-C4' energy: -59.545 flat angles P-C4'-P energy: -22.170 tors. eta vs tors. theta energy: -47.317 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 159 Temperature: 1.250000 Total energy: -793.298009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -793.298009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.298009 (E_RNA) where: Base-Base interactions energy: -457.746 where: short stacking energy: -198.955 Base-Backbone interact. energy: -0.778 local terms energy: -208.773534 where: bonds (distance) C4'-P energy: -37.535 bonds (distance) P-C4' energy: -48.244 flat angles C4'-P-C4' energy: -42.341 flat angles P-C4'-P energy: -35.697 tors. eta vs tors. theta energy: -44.956 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 159 Temperature: 1.300000 Total energy: -775.667327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.667327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.667327 (E_RNA) where: Base-Base interactions energy: -426.210 where: short stacking energy: -183.112 Base-Backbone interact. energy: 2.157 local terms energy: -225.614335 where: bonds (distance) C4'-P energy: -43.230 bonds (distance) P-C4' energy: -44.017 flat angles C4'-P-C4' energy: -52.074 flat angles P-C4'-P energy: -42.918 tors. eta vs tors. theta energy: -43.375 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 159 Temperature: 1.350000 Total energy: -707.420146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.420146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.820146 (E_RNA) where: Base-Base interactions energy: -383.109 where: short stacking energy: -162.941 Base-Backbone interact. energy: -1.908 local terms energy: -192.802690 where: bonds (distance) C4'-P energy: -54.686 bonds (distance) P-C4' energy: -41.274 flat angles C4'-P-C4' energy: -39.075 flat angles P-C4'-P energy: -26.469 tors. eta vs tors. theta energy: -31.299 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 160 Temperature: 0.900000 Total energy: -1096.671678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.671678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -970.671678 (E_RNA) where: Base-Base interactions energy: -668.410 where: short stacking energy: -289.311 Base-Backbone interact. energy: -0.805 local terms energy: -301.456511 where: bonds (distance) C4'-P energy: -56.864 bonds (distance) P-C4' energy: -56.964 flat angles C4'-P-C4' energy: -59.572 flat angles P-C4'-P energy: -44.055 tors. eta vs tors. theta energy: -84.001 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 160 Temperature: 0.950000 Total energy: -1076.979752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.979752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.179752 (E_RNA) where: Base-Base interactions energy: -657.868 where: short stacking energy: -248.038 Base-Backbone interact. energy: -2.029 local terms energy: -289.282822 where: bonds (distance) C4'-P energy: -50.417 bonds (distance) P-C4' energy: -57.240 flat angles C4'-P-C4' energy: -64.892 flat angles P-C4'-P energy: -42.753 tors. eta vs tors. theta energy: -73.981 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 160 Temperature: 1.000000 Total energy: -1026.179760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.179760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -898.379760 (E_RNA) where: Base-Base interactions energy: -594.089 where: short stacking energy: -268.494 Base-Backbone interact. energy: -0.221 local terms energy: -304.069759 where: bonds (distance) C4'-P energy: -57.998 bonds (distance) P-C4' energy: -52.012 flat angles C4'-P-C4' energy: -67.230 flat angles P-C4'-P energy: -45.568 tors. eta vs tors. theta energy: -81.262 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 160 Temperature: 1.050000 Total energy: -947.886799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -947.886799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -825.486799 (E_RNA) where: Base-Base interactions energy: -540.119 where: short stacking energy: -245.275 Base-Backbone interact. energy: -1.019 local terms energy: -284.348939 where: bonds (distance) C4'-P energy: -54.720 bonds (distance) P-C4' energy: -55.509 flat angles C4'-P-C4' energy: -56.432 flat angles P-C4'-P energy: -44.644 tors. eta vs tors. theta energy: -73.044 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 160 Temperature: 1.100000 Total energy: -911.644734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -911.644734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.844734 (E_RNA) where: Base-Base interactions energy: -504.630 where: short stacking energy: -232.116 Base-Backbone interact. energy: 0.607 local terms energy: -279.821638 where: bonds (distance) C4'-P energy: -56.238 bonds (distance) P-C4' energy: -55.048 flat angles C4'-P-C4' energy: -59.976 flat angles P-C4'-P energy: -40.192 tors. eta vs tors. theta energy: -68.367 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 160 Temperature: 1.150000 Total energy: -852.639036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -852.639036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.839036 (E_RNA) where: Base-Base interactions energy: -483.211 where: short stacking energy: -209.175 Base-Backbone interact. energy: -0.571 local terms energy: -241.057489 where: bonds (distance) C4'-P energy: -46.525 bonds (distance) P-C4' energy: -46.271 flat angles C4'-P-C4' energy: -52.231 flat angles P-C4'-P energy: -35.620 tors. eta vs tors. theta energy: -60.411 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 160 Temperature: 1.200000 Total energy: -826.498780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.498780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.498780 (E_RNA) where: Base-Base interactions energy: -478.431 where: short stacking energy: -215.068 Base-Backbone interact. energy: 0.819 local terms energy: -222.886655 where: bonds (distance) C4'-P energy: -28.820 bonds (distance) P-C4' energy: -53.610 flat angles C4'-P-C4' energy: -51.350 flat angles P-C4'-P energy: -29.015 tors. eta vs tors. theta energy: -60.091 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 160 Temperature: 1.250000 Total energy: -842.195489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -842.195489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.995489 (E_RNA) where: Base-Base interactions energy: -496.946 where: short stacking energy: -218.558 Base-Backbone interact. energy: -1.073 local terms energy: -219.977037 where: bonds (distance) C4'-P energy: -36.625 bonds (distance) P-C4' energy: -45.008 flat angles C4'-P-C4' energy: -49.821 flat angles P-C4'-P energy: -29.567 tors. eta vs tors. theta energy: -58.956 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 160 Temperature: 1.300000 Total energy: -749.556484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -749.556484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -625.356484 (E_RNA) where: Base-Base interactions energy: -396.829 where: short stacking energy: -173.318 Base-Backbone interact. energy: -1.794 local terms energy: -226.733311 where: bonds (distance) C4'-P energy: -49.788 bonds (distance) P-C4' energy: -48.677 flat angles C4'-P-C4' energy: -44.052 flat angles P-C4'-P energy: -36.210 tors. eta vs tors. theta energy: -48.007 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 160 Temperature: 1.350000 Total energy: -698.199544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.199544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.999544 (E_RNA) where: Base-Base interactions energy: -370.835 where: short stacking energy: -150.572 Base-Backbone interact. energy: -2.210 local terms energy: -200.954372 where: bonds (distance) C4'-P energy: -51.117 bonds (distance) P-C4' energy: -44.426 flat angles C4'-P-C4' energy: -45.022 flat angles P-C4'-P energy: -20.742 tors. eta vs tors. theta energy: -39.648 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 161 Temperature: 0.900000 Total energy: -1087.363930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.363930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -959.563930 (E_RNA) where: Base-Base interactions energy: -639.568 where: short stacking energy: -269.868 Base-Backbone interact. energy: -1.496 local terms energy: -318.500087 where: bonds (distance) C4'-P energy: -66.137 bonds (distance) P-C4' energy: -63.109 flat angles C4'-P-C4' energy: -63.415 flat angles P-C4'-P energy: -47.172 tors. eta vs tors. theta energy: -78.667 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 161 Temperature: 0.950000 Total energy: -1068.499039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.499039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -946.099039 (E_RNA) where: Base-Base interactions energy: -655.029 where: short stacking energy: -233.708 Base-Backbone interact. energy: 5.163 local terms energy: -296.234007 where: bonds (distance) C4'-P energy: -54.920 bonds (distance) P-C4' energy: -57.959 flat angles C4'-P-C4' energy: -67.165 flat angles P-C4'-P energy: -41.343 tors. eta vs tors. theta energy: -74.848 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 161 Temperature: 1.000000 Total energy: -1020.709758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.709758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -892.909758 (E_RNA) where: Base-Base interactions energy: -610.540 where: short stacking energy: -268.547 Base-Backbone interact. energy: -0.734 local terms energy: -281.636218 where: bonds (distance) C4'-P energy: -51.657 bonds (distance) P-C4' energy: -59.388 flat angles C4'-P-C4' energy: -56.867 flat angles P-C4'-P energy: -39.115 tors. eta vs tors. theta energy: -74.608 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 161 Temperature: 1.050000 Total energy: -944.472600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -944.472600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.872600 (E_RNA) where: Base-Base interactions energy: -553.222 where: short stacking energy: -252.617 Base-Backbone interact. energy: -0.634 local terms energy: -261.016791 where: bonds (distance) C4'-P energy: -51.812 bonds (distance) P-C4' energy: -36.744 flat angles C4'-P-C4' energy: -61.603 flat angles P-C4'-P energy: -38.719 tors. eta vs tors. theta energy: -72.139 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 161 Temperature: 1.100000 Total energy: -904.620061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.620061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.020061 (E_RNA) where: Base-Base interactions energy: -506.729 where: short stacking energy: -223.179 Base-Backbone interact. energy: -0.543 local terms energy: -267.747860 where: bonds (distance) C4'-P energy: -57.844 bonds (distance) P-C4' energy: -60.583 flat angles C4'-P-C4' energy: -51.367 flat angles P-C4'-P energy: -39.173 tors. eta vs tors. theta energy: -58.781 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 161 Temperature: 1.150000 Total energy: -855.306822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.306822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.506822 (E_RNA) where: Base-Base interactions energy: -468.622 where: short stacking energy: -199.478 Base-Backbone interact. energy: -1.292 local terms energy: -257.593064 where: bonds (distance) C4'-P energy: -51.569 bonds (distance) P-C4' energy: -49.670 flat angles C4'-P-C4' energy: -59.367 flat angles P-C4'-P energy: -35.390 tors. eta vs tors. theta energy: -61.597 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 161 Temperature: 1.200000 Total energy: -838.845527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.845527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.245527 (E_RNA) where: Base-Base interactions energy: -487.213 where: short stacking energy: -210.843 Base-Backbone interact. energy: 6.367 local terms energy: -228.399050 where: bonds (distance) C4'-P energy: -34.803 bonds (distance) P-C4' energy: -54.625 flat angles C4'-P-C4' energy: -48.299 flat angles P-C4'-P energy: -35.003 tors. eta vs tors. theta energy: -55.668 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 161 Temperature: 1.250000 Total energy: -828.471487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -828.471487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.871487 (E_RNA) where: Base-Base interactions energy: -478.440 where: short stacking energy: -212.221 Base-Backbone interact. energy: -2.016 local terms energy: -218.415663 where: bonds (distance) C4'-P energy: -33.259 bonds (distance) P-C4' energy: -51.809 flat angles C4'-P-C4' energy: -49.741 flat angles P-C4'-P energy: -22.757 tors. eta vs tors. theta energy: -60.851 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 161 Temperature: 1.300000 Total energy: -763.701162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.701162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.501162 (E_RNA) where: Base-Base interactions energy: -425.421 where: short stacking energy: -164.825 Base-Backbone interact. energy: -0.348 local terms energy: -213.732244 where: bonds (distance) C4'-P energy: -49.747 bonds (distance) P-C4' energy: -36.881 flat angles C4'-P-C4' energy: -50.932 flat angles P-C4'-P energy: -27.132 tors. eta vs tors. theta energy: -49.040 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 161 Temperature: 1.350000 Total energy: -686.144669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.144669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.144669 (E_RNA) where: Base-Base interactions energy: -368.630 where: short stacking energy: -145.198 Base-Backbone interact. energy: 0.004 local terms energy: -191.518763 where: bonds (distance) C4'-P energy: -47.209 bonds (distance) P-C4' energy: -46.711 flat angles C4'-P-C4' energy: -42.175 flat angles P-C4'-P energy: -28.720 tors. eta vs tors. theta energy: -26.703 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 162 Temperature: 0.900000 Total energy: -1089.523143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.523143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -959.923143 (E_RNA) where: Base-Base interactions energy: -656.733 where: short stacking energy: -254.845 Base-Backbone interact. energy: 1.064 local terms energy: -304.253807 where: bonds (distance) C4'-P energy: -59.609 bonds (distance) P-C4' energy: -58.084 flat angles C4'-P-C4' energy: -70.962 flat angles P-C4'-P energy: -39.822 tors. eta vs tors. theta energy: -75.776 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 162 Temperature: 0.950000 Total energy: -1070.186840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1070.186840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.586840 (E_RNA) where: Base-Base interactions energy: -646.332 where: short stacking energy: -251.843 Base-Backbone interact. energy: -0.241 local terms energy: -294.014473 where: bonds (distance) C4'-P energy: -59.075 bonds (distance) P-C4' energy: -57.705 flat angles C4'-P-C4' energy: -68.747 flat angles P-C4'-P energy: -37.376 tors. eta vs tors. theta energy: -71.112 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 162 Temperature: 1.000000 Total energy: -1043.545541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.545541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.945541 (E_RNA) where: Base-Base interactions energy: -614.249 where: short stacking energy: -261.884 Base-Backbone interact. energy: -0.373 local terms energy: -299.323216 where: bonds (distance) C4'-P energy: -59.830 bonds (distance) P-C4' energy: -52.140 flat angles C4'-P-C4' energy: -60.080 flat angles P-C4'-P energy: -47.627 tors. eta vs tors. theta energy: -79.646 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 162 Temperature: 1.050000 Total energy: -956.888301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -956.888301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.088301 (E_RNA) where: Base-Base interactions energy: -538.511 where: short stacking energy: -239.913 Base-Backbone interact. energy: -1.037 local terms energy: -289.540103 where: bonds (distance) C4'-P energy: -52.041 bonds (distance) P-C4' energy: -55.210 flat angles C4'-P-C4' energy: -60.894 flat angles P-C4'-P energy: -39.118 tors. eta vs tors. theta energy: -82.277 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 162 Temperature: 1.100000 Total energy: -878.087783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.087783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.487783 (E_RNA) where: Base-Base interactions energy: -500.551 where: short stacking energy: -222.150 Base-Backbone interact. energy: -2.048 local terms energy: -245.888081 where: bonds (distance) C4'-P energy: -48.264 bonds (distance) P-C4' energy: -44.680 flat angles C4'-P-C4' energy: -63.441 flat angles P-C4'-P energy: -28.517 tors. eta vs tors. theta energy: -60.986 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 162 Temperature: 1.150000 Total energy: -880.435770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.435770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.435770 (E_RNA) where: Base-Base interactions energy: -512.442 where: short stacking energy: -234.118 Base-Backbone interact. energy: -0.638 local terms energy: -241.356007 where: bonds (distance) C4'-P energy: -42.238 bonds (distance) P-C4' energy: -39.710 flat angles C4'-P-C4' energy: -48.924 flat angles P-C4'-P energy: -42.864 tors. eta vs tors. theta energy: -67.621 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 162 Temperature: 1.200000 Total energy: -833.747127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.747127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.947127 (E_RNA) where: Base-Base interactions energy: -474.626 where: short stacking energy: -202.312 Base-Backbone interact. energy: -0.910 local terms energy: -230.410852 where: bonds (distance) C4'-P energy: -49.575 bonds (distance) P-C4' energy: -49.739 flat angles C4'-P-C4' energy: -52.529 flat angles P-C4'-P energy: -24.920 tors. eta vs tors. theta energy: -53.648 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 162 Temperature: 1.250000 Total energy: -821.132600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -821.132600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.132600 (E_RNA) where: Base-Base interactions energy: -470.804 where: short stacking energy: -191.702 Base-Backbone interact. energy: 0.841 local terms energy: -225.169409 where: bonds (distance) C4'-P energy: -49.843 bonds (distance) P-C4' energy: -46.647 flat angles C4'-P-C4' energy: -48.522 flat angles P-C4'-P energy: -27.749 tors. eta vs tors. theta energy: -52.408 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 162 Temperature: 1.300000 Total energy: -730.186827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.186827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.786827 (E_RNA) where: Base-Base interactions energy: -397.554 where: short stacking energy: -172.795 Base-Backbone interact. energy: -1.410 local terms energy: -208.822797 where: bonds (distance) C4'-P energy: -44.983 bonds (distance) P-C4' energy: -44.129 flat angles C4'-P-C4' energy: -51.659 flat angles P-C4'-P energy: -31.126 tors. eta vs tors. theta energy: -36.925 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 162 Temperature: 1.350000 Total energy: -655.150221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.150221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.550221 (E_RNA) where: Base-Base interactions energy: -344.484 where: short stacking energy: -130.067 Base-Backbone interact. energy: 0.779 local terms energy: -181.844324 where: bonds (distance) C4'-P energy: -45.323 bonds (distance) P-C4' energy: -53.274 flat angles C4'-P-C4' energy: -40.099 flat angles P-C4'-P energy: -21.849 tors. eta vs tors. theta energy: -21.300 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 163 Temperature: 0.900000 Total energy: -1095.615922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.615922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.015922 (E_RNA) where: Base-Base interactions energy: -650.833 where: short stacking energy: -267.245 Base-Backbone interact. energy: 2.827 local terms energy: -318.009805 where: bonds (distance) C4'-P energy: -62.637 bonds (distance) P-C4' energy: -63.598 flat angles C4'-P-C4' energy: -64.260 flat angles P-C4'-P energy: -47.196 tors. eta vs tors. theta energy: -80.319 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 163 Temperature: 0.950000 Total energy: -1067.712416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.712416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -941.712416 (E_RNA) where: Base-Base interactions energy: -664.590 where: short stacking energy: -244.155 Base-Backbone interact. energy: -2.012 local terms energy: -275.110095 where: bonds (distance) C4'-P energy: -52.469 bonds (distance) P-C4' energy: -55.838 flat angles C4'-P-C4' energy: -62.361 flat angles P-C4'-P energy: -33.572 tors. eta vs tors. theta energy: -70.870 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 163 Temperature: 1.000000 Total energy: -1009.695970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.695970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -880.095970 (E_RNA) where: Base-Base interactions energy: -594.861 where: short stacking energy: -258.655 Base-Backbone interact. energy: -1.291 local terms energy: -283.943668 where: bonds (distance) C4'-P energy: -55.322 bonds (distance) P-C4' energy: -57.233 flat angles C4'-P-C4' energy: -47.847 flat angles P-C4'-P energy: -47.003 tors. eta vs tors. theta energy: -76.539 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 163 Temperature: 1.050000 Total energy: -962.200771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -962.200771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.400771 (E_RNA) where: Base-Base interactions energy: -564.231 where: short stacking energy: -245.986 Base-Backbone interact. energy: -0.464 local terms energy: -269.705213 where: bonds (distance) C4'-P energy: -49.979 bonds (distance) P-C4' energy: -45.158 flat angles C4'-P-C4' energy: -56.611 flat angles P-C4'-P energy: -36.481 tors. eta vs tors. theta energy: -81.475 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 163 Temperature: 1.100000 Total energy: -888.303506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -888.303506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.703506 (E_RNA) where: Base-Base interactions energy: -492.864 where: short stacking energy: -216.012 Base-Backbone interact. energy: 0.670 local terms energy: -266.509274 where: bonds (distance) C4'-P energy: -50.937 bonds (distance) P-C4' energy: -51.362 flat angles C4'-P-C4' energy: -59.785 flat angles P-C4'-P energy: -42.703 tors. eta vs tors. theta energy: -61.721 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 163 Temperature: 1.150000 Total energy: -882.034630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -882.034630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.234630 (E_RNA) where: Base-Base interactions energy: -497.484 where: short stacking energy: -220.513 Base-Backbone interact. energy: 0.000 local terms energy: -256.750838 where: bonds (distance) C4'-P energy: -43.266 bonds (distance) P-C4' energy: -47.101 flat angles C4'-P-C4' energy: -51.638 flat angles P-C4'-P energy: -44.406 tors. eta vs tors. theta energy: -70.341 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 163 Temperature: 1.200000 Total energy: -862.549697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.549697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.549697 (E_RNA) where: Base-Base interactions energy: -480.818 where: short stacking energy: -212.566 Base-Backbone interact. energy: -0.746 local terms energy: -254.985861 where: bonds (distance) C4'-P energy: -51.528 bonds (distance) P-C4' energy: -46.757 flat angles C4'-P-C4' energy: -54.101 flat angles P-C4'-P energy: -42.333 tors. eta vs tors. theta energy: -60.268 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 163 Temperature: 1.250000 Total energy: -809.506133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -809.506133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.506133 (E_RNA) where: Base-Base interactions energy: -465.021 where: short stacking energy: -202.366 Base-Backbone interact. energy: -0.363 local terms energy: -218.122307 where: bonds (distance) C4'-P energy: -46.919 bonds (distance) P-C4' energy: -36.064 flat angles C4'-P-C4' energy: -43.126 flat angles P-C4'-P energy: -33.065 tors. eta vs tors. theta energy: -58.948 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 163 Temperature: 1.300000 Total energy: -726.115695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.115695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.715695 (E_RNA) where: Base-Base interactions energy: -394.587 where: short stacking energy: -162.797 Base-Backbone interact. energy: 0.866 local terms energy: -209.994719 where: bonds (distance) C4'-P energy: -44.157 bonds (distance) P-C4' energy: -48.415 flat angles C4'-P-C4' energy: -46.465 flat angles P-C4'-P energy: -36.140 tors. eta vs tors. theta energy: -34.817 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 163 Temperature: 1.350000 Total energy: -697.619631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.619631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.019631 (E_RNA) where: Base-Base interactions energy: -350.302 where: short stacking energy: -146.241 Base-Backbone interact. energy: 1.355 local terms energy: -219.072731 where: bonds (distance) C4'-P energy: -43.025 bonds (distance) P-C4' energy: -63.508 flat angles C4'-P-C4' energy: -52.021 flat angles P-C4'-P energy: -26.202 tors. eta vs tors. theta energy: -34.317 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 164 Temperature: 0.900000 Total energy: -1077.966742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1077.966742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -948.366742 (E_RNA) where: Base-Base interactions energy: -636.947 where: short stacking energy: -273.914 Base-Backbone interact. energy: -1.677 local terms energy: -309.742199 where: bonds (distance) C4'-P energy: -48.502 bonds (distance) P-C4' energy: -66.058 flat angles C4'-P-C4' energy: -61.678 flat angles P-C4'-P energy: -49.123 tors. eta vs tors. theta energy: -84.381 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 164 Temperature: 0.950000 Total energy: -1055.600866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.600866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.800866 (E_RNA) where: Base-Base interactions energy: -640.346 where: short stacking energy: -260.171 Base-Backbone interact. energy: -1.527 local terms energy: -285.927757 where: bonds (distance) C4'-P energy: -48.520 bonds (distance) P-C4' energy: -52.244 flat angles C4'-P-C4' energy: -66.298 flat angles P-C4'-P energy: -38.472 tors. eta vs tors. theta energy: -80.394 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 164 Temperature: 1.000000 Total energy: -1001.351959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.351959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.751959 (E_RNA) where: Base-Base interactions energy: -586.468 where: short stacking energy: -254.113 Base-Backbone interact. energy: -0.688 local terms energy: -284.595481 where: bonds (distance) C4'-P energy: -50.393 bonds (distance) P-C4' energy: -56.270 flat angles C4'-P-C4' energy: -59.116 flat angles P-C4'-P energy: -43.121 tors. eta vs tors. theta energy: -75.694 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 164 Temperature: 1.050000 Total energy: -960.490538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.490538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.690538 (E_RNA) where: Base-Base interactions energy: -539.736 where: short stacking energy: -239.233 Base-Backbone interact. energy: -2.184 local terms energy: -290.770728 where: bonds (distance) C4'-P energy: -52.844 bonds (distance) P-C4' energy: -53.808 flat angles C4'-P-C4' energy: -64.406 flat angles P-C4'-P energy: -44.161 tors. eta vs tors. theta energy: -75.552 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 164 Temperature: 1.100000 Total energy: -897.462973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.462973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.462973 (E_RNA) where: Base-Base interactions energy: -513.482 where: short stacking energy: -227.116 Base-Backbone interact. energy: 0.034 local terms energy: -258.015097 where: bonds (distance) C4'-P energy: -48.918 bonds (distance) P-C4' energy: -43.636 flat angles C4'-P-C4' energy: -59.436 flat angles P-C4'-P energy: -41.305 tors. eta vs tors. theta energy: -64.720 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 164 Temperature: 1.150000 Total energy: -858.011329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.011329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.011329 (E_RNA) where: Base-Base interactions energy: -488.782 where: short stacking energy: -208.350 Base-Backbone interact. energy: 2.274 local terms energy: -245.502992 where: bonds (distance) C4'-P energy: -42.434 bonds (distance) P-C4' energy: -47.998 flat angles C4'-P-C4' energy: -52.956 flat angles P-C4'-P energy: -35.816 tors. eta vs tors. theta energy: -66.299 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 164 Temperature: 1.200000 Total energy: -856.073073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.073073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -726.473073 (E_RNA) where: Base-Base interactions energy: -472.626 where: short stacking energy: -205.465 Base-Backbone interact. energy: 0.167 local terms energy: -254.013713 where: bonds (distance) C4'-P energy: -41.954 bonds (distance) P-C4' energy: -46.938 flat angles C4'-P-C4' energy: -54.448 flat angles P-C4'-P energy: -44.018 tors. eta vs tors. theta energy: -66.656 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 164 Temperature: 1.250000 Total energy: -806.897763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.897763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.697763 (E_RNA) where: Base-Base interactions energy: -456.198 where: short stacking energy: -204.035 Base-Backbone interact. energy: -0.440 local terms energy: -226.059637 where: bonds (distance) C4'-P energy: -44.894 bonds (distance) P-C4' energy: -42.951 flat angles C4'-P-C4' energy: -44.102 flat angles P-C4'-P energy: -35.694 tors. eta vs tors. theta energy: -58.419 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 164 Temperature: 1.300000 Total energy: -753.049939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.049939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.849939 (E_RNA) where: Base-Base interactions energy: -400.231 where: short stacking energy: -171.180 Base-Backbone interact. energy: -1.029 local terms energy: -227.590523 where: bonds (distance) C4'-P energy: -57.677 bonds (distance) P-C4' energy: -36.038 flat angles C4'-P-C4' energy: -53.095 flat angles P-C4'-P energy: -31.788 tors. eta vs tors. theta energy: -48.993 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 164 Temperature: 1.350000 Total energy: -675.577372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.577372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.177372 (E_RNA) where: Base-Base interactions energy: -353.436 where: short stacking energy: -141.810 Base-Backbone interact. energy: -1.694 local terms energy: -198.046904 where: bonds (distance) C4'-P energy: -47.811 bonds (distance) P-C4' energy: -57.446 flat angles C4'-P-C4' energy: -45.703 flat angles P-C4'-P energy: -23.728 tors. eta vs tors. theta energy: -23.359 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 165 Temperature: 0.900000 Total energy: -1090.863338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1090.863338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.063338 (E_RNA) where: Base-Base interactions energy: -664.533 where: short stacking energy: -265.925 Base-Backbone interact. energy: -2.273 local terms energy: -296.256773 where: bonds (distance) C4'-P energy: -48.642 bonds (distance) P-C4' energy: -61.531 flat angles C4'-P-C4' energy: -60.137 flat angles P-C4'-P energy: -37.761 tors. eta vs tors. theta energy: -88.185 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 165 Temperature: 0.950000 Total energy: -1051.602845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.602845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -925.602845 (E_RNA) where: Base-Base interactions energy: -641.611 where: short stacking energy: -238.656 Base-Backbone interact. energy: -0.149 local terms energy: -283.842499 where: bonds (distance) C4'-P energy: -47.321 bonds (distance) P-C4' energy: -62.328 flat angles C4'-P-C4' energy: -52.267 flat angles P-C4'-P energy: -43.981 tors. eta vs tors. theta energy: -77.946 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 165 Temperature: 1.000000 Total energy: -1023.743888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.743888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -895.943888 (E_RNA) where: Base-Base interactions energy: -612.104 where: short stacking energy: -271.999 Base-Backbone interact. energy: -1.586 local terms energy: -282.253701 where: bonds (distance) C4'-P energy: -55.387 bonds (distance) P-C4' energy: -48.966 flat angles C4'-P-C4' energy: -61.687 flat angles P-C4'-P energy: -35.615 tors. eta vs tors. theta energy: -80.599 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 165 Temperature: 1.050000 Total energy: -969.203655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -969.203655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.403655 (E_RNA) where: Base-Base interactions energy: -580.134 where: short stacking energy: -242.183 Base-Backbone interact. energy: -1.694 local terms energy: -259.575658 where: bonds (distance) C4'-P energy: -44.985 bonds (distance) P-C4' energy: -49.557 flat angles C4'-P-C4' energy: -51.913 flat angles P-C4'-P energy: -42.793 tors. eta vs tors. theta energy: -70.328 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 165 Temperature: 1.100000 Total energy: -898.134376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.134376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.334376 (E_RNA) where: Base-Base interactions energy: -505.696 where: short stacking energy: -216.077 Base-Backbone interact. energy: -0.983 local terms energy: -263.655669 where: bonds (distance) C4'-P energy: -51.908 bonds (distance) P-C4' energy: -58.213 flat angles C4'-P-C4' energy: -54.165 flat angles P-C4'-P energy: -41.104 tors. eta vs tors. theta energy: -58.266 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 165 Temperature: 1.150000 Total energy: -870.818364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -870.818364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.018364 (E_RNA) where: Base-Base interactions energy: -482.535 where: short stacking energy: -219.753 Base-Backbone interact. energy: -0.174 local terms energy: -260.309385 where: bonds (distance) C4'-P energy: -50.653 bonds (distance) P-C4' energy: -51.001 flat angles C4'-P-C4' energy: -59.011 flat angles P-C4'-P energy: -32.258 tors. eta vs tors. theta energy: -67.386 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 165 Temperature: 1.200000 Total energy: -841.069594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.069594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.069594 (E_RNA) where: Base-Base interactions energy: -468.633 where: short stacking energy: -214.816 Base-Backbone interact. energy: -0.783 local terms energy: -245.653809 where: bonds (distance) C4'-P energy: -49.859 bonds (distance) P-C4' energy: -62.245 flat angles C4'-P-C4' energy: -48.322 flat angles P-C4'-P energy: -32.225 tors. eta vs tors. theta energy: -53.003 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 165 Temperature: 1.250000 Total energy: -816.050162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -816.050162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.050162 (E_RNA) where: Base-Base interactions energy: -465.913 where: short stacking energy: -204.020 Base-Backbone interact. energy: -0.169 local terms energy: -223.968040 where: bonds (distance) C4'-P energy: -42.932 bonds (distance) P-C4' energy: -47.805 flat angles C4'-P-C4' energy: -50.780 flat angles P-C4'-P energy: -20.735 tors. eta vs tors. theta energy: -61.716 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 165 Temperature: 1.300000 Total energy: -745.862473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.862473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.862473 (E_RNA) where: Base-Base interactions energy: -415.012 where: short stacking energy: -185.711 Base-Backbone interact. energy: 0.490 local terms energy: -205.341225 where: bonds (distance) C4'-P energy: -42.271 bonds (distance) P-C4' energy: -33.873 flat angles C4'-P-C4' energy: -44.183 flat angles P-C4'-P energy: -36.489 tors. eta vs tors. theta energy: -48.526 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 165 Temperature: 1.350000 Total energy: -664.572049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.572049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.772049 (E_RNA) where: Base-Base interactions energy: -338.959 where: short stacking energy: -139.108 Base-Backbone interact. energy: -0.771 local terms energy: -197.041985 where: bonds (distance) C4'-P energy: -46.285 bonds (distance) P-C4' energy: -46.662 flat angles C4'-P-C4' energy: -42.946 flat angles P-C4'-P energy: -33.226 tors. eta vs tors. theta energy: -27.923 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 166 Temperature: 0.900000 Total energy: -1109.663206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1109.663206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -981.863206 (E_RNA) where: Base-Base interactions energy: -661.179 where: short stacking energy: -274.989 Base-Backbone interact. energy: -0.661 local terms energy: -320.022832 where: bonds (distance) C4'-P energy: -51.252 bonds (distance) P-C4' energy: -63.464 flat angles C4'-P-C4' energy: -72.942 flat angles P-C4'-P energy: -50.999 tors. eta vs tors. theta energy: -81.366 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 166 Temperature: 0.950000 Total energy: -1073.937007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.937007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -944.337007 (E_RNA) where: Base-Base interactions energy: -653.542 where: short stacking energy: -258.307 Base-Backbone interact. energy: -0.796 local terms energy: -289.999877 where: bonds (distance) C4'-P energy: -52.060 bonds (distance) P-C4' energy: -50.563 flat angles C4'-P-C4' energy: -67.497 flat angles P-C4'-P energy: -38.662 tors. eta vs tors. theta energy: -81.219 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 166 Temperature: 1.000000 Total energy: -1045.177512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.177512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.177512 (E_RNA) where: Base-Base interactions energy: -625.021 where: short stacking energy: -263.699 Base-Backbone interact. energy: -2.411 local terms energy: -291.746078 where: bonds (distance) C4'-P energy: -58.809 bonds (distance) P-C4' energy: -57.999 flat angles C4'-P-C4' energy: -57.156 flat angles P-C4'-P energy: -37.235 tors. eta vs tors. theta energy: -80.547 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 166 Temperature: 1.050000 Total energy: -960.218405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.218405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -830.618405 (E_RNA) where: Base-Base interactions energy: -536.812 where: short stacking energy: -234.121 Base-Backbone interact. energy: -1.603 local terms energy: -292.203605 where: bonds (distance) C4'-P energy: -48.389 bonds (distance) P-C4' energy: -57.459 flat angles C4'-P-C4' energy: -65.319 flat angles P-C4'-P energy: -42.765 tors. eta vs tors. theta energy: -78.271 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 166 Temperature: 1.100000 Total energy: -894.018387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.018387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.218387 (E_RNA) where: Base-Base interactions energy: -491.632 where: short stacking energy: -223.138 Base-Backbone interact. energy: -0.215 local terms energy: -274.371669 where: bonds (distance) C4'-P energy: -50.210 bonds (distance) P-C4' energy: -55.241 flat angles C4'-P-C4' energy: -56.879 flat angles P-C4'-P energy: -37.394 tors. eta vs tors. theta energy: -74.647 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 166 Temperature: 1.150000 Total energy: -856.552099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.552099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.752099 (E_RNA) where: Base-Base interactions energy: -469.862 where: short stacking energy: -217.958 Base-Backbone interact. energy: -0.979 local terms energy: -257.911490 where: bonds (distance) C4'-P energy: -50.015 bonds (distance) P-C4' energy: -52.535 flat angles C4'-P-C4' energy: -57.752 flat angles P-C4'-P energy: -36.453 tors. eta vs tors. theta energy: -61.156 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 166 Temperature: 1.200000 Total energy: -835.365610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.365610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.765610 (E_RNA) where: Base-Base interactions energy: -467.554 where: short stacking energy: -192.275 Base-Backbone interact. energy: -0.472 local terms energy: -237.739777 where: bonds (distance) C4'-P energy: -42.989 bonds (distance) P-C4' energy: -57.082 flat angles C4'-P-C4' energy: -53.139 flat angles P-C4'-P energy: -26.889 tors. eta vs tors. theta energy: -57.642 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 166 Temperature: 1.250000 Total energy: -821.672084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -821.672084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.672084 (E_RNA) where: Base-Base interactions energy: -449.027 where: short stacking energy: -203.709 Base-Backbone interact. energy: -2.089 local terms energy: -244.555964 where: bonds (distance) C4'-P energy: -38.912 bonds (distance) P-C4' energy: -45.475 flat angles C4'-P-C4' energy: -55.321 flat angles P-C4'-P energy: -43.321 tors. eta vs tors. theta energy: -61.528 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 166 Temperature: 1.300000 Total energy: -727.673974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.673974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.673974 (E_RNA) where: Base-Base interactions energy: -390.475 where: short stacking energy: -164.115 Base-Backbone interact. energy: -0.806 local terms energy: -210.393247 where: bonds (distance) C4'-P energy: -30.762 bonds (distance) P-C4' energy: -45.931 flat angles C4'-P-C4' energy: -50.261 flat angles P-C4'-P energy: -35.150 tors. eta vs tors. theta energy: -48.290 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 166 Temperature: 1.350000 Total energy: -693.753629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.753629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.953629 (E_RNA) where: Base-Base interactions energy: -358.759 where: short stacking energy: -142.854 Base-Backbone interact. energy: -1.324 local terms energy: -205.870253 where: bonds (distance) C4'-P energy: -43.572 bonds (distance) P-C4' energy: -43.333 flat angles C4'-P-C4' energy: -39.464 flat angles P-C4'-P energy: -42.445 tors. eta vs tors. theta energy: -37.056 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 167 Temperature: 0.900000 Total energy: -1091.078524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.078524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.478524 (E_RNA) where: Base-Base interactions energy: -649.606 where: short stacking energy: -274.469 Base-Backbone interact. energy: 0.329 local terms energy: -312.201913 where: bonds (distance) C4'-P energy: -54.569 bonds (distance) P-C4' energy: -63.641 flat angles C4'-P-C4' energy: -62.163 flat angles P-C4'-P energy: -48.435 tors. eta vs tors. theta energy: -83.392 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 167 Temperature: 0.950000 Total energy: -1066.709103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1066.709103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.109103 (E_RNA) where: Base-Base interactions energy: -646.337 where: short stacking energy: -248.201 Base-Backbone interact. energy: -1.105 local terms energy: -289.667190 where: bonds (distance) C4'-P energy: -56.447 bonds (distance) P-C4' energy: -52.172 flat angles C4'-P-C4' energy: -63.893 flat angles P-C4'-P energy: -38.008 tors. eta vs tors. theta energy: -79.147 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 167 Temperature: 1.000000 Total energy: -1018.158672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1018.158672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -888.558672 (E_RNA) where: Base-Base interactions energy: -603.915 where: short stacking energy: -248.278 Base-Backbone interact. energy: -0.973 local terms energy: -283.670490 where: bonds (distance) C4'-P energy: -55.264 bonds (distance) P-C4' energy: -44.902 flat angles C4'-P-C4' energy: -65.346 flat angles P-C4'-P energy: -37.399 tors. eta vs tors. theta energy: -80.760 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 167 Temperature: 1.050000 Total energy: -966.088926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.088926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.488926 (E_RNA) where: Base-Base interactions energy: -554.640 where: short stacking energy: -243.195 Base-Backbone interact. energy: -0.647 local terms energy: -281.201647 where: bonds (distance) C4'-P energy: -53.868 bonds (distance) P-C4' energy: -58.748 flat angles C4'-P-C4' energy: -51.838 flat angles P-C4'-P energy: -36.437 tors. eta vs tors. theta energy: -80.311 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 167 Temperature: 1.100000 Total energy: -920.426862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.426862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -796.226862 (E_RNA) where: Base-Base interactions energy: -522.567 where: short stacking energy: -226.770 Base-Backbone interact. energy: 0.002 local terms energy: -273.661877 where: bonds (distance) C4'-P energy: -51.907 bonds (distance) P-C4' energy: -56.405 flat angles C4'-P-C4' energy: -55.320 flat angles P-C4'-P energy: -42.555 tors. eta vs tors. theta energy: -67.475 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 167 Temperature: 1.150000 Total energy: -869.584298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.584298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.184298 (E_RNA) where: Base-Base interactions energy: -498.240 where: short stacking energy: -229.667 Base-Backbone interact. energy: -0.664 local terms energy: -248.280909 where: bonds (distance) C4'-P energy: -49.331 bonds (distance) P-C4' energy: -48.742 flat angles C4'-P-C4' energy: -41.585 flat angles P-C4'-P energy: -37.812 tors. eta vs tors. theta energy: -70.810 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 167 Temperature: 1.200000 Total energy: -832.378114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.378114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.778114 (E_RNA) where: Base-Base interactions energy: -460.957 where: short stacking energy: -199.805 Base-Backbone interact. energy: -0.339 local terms energy: -241.482314 where: bonds (distance) C4'-P energy: -41.245 bonds (distance) P-C4' energy: -48.232 flat angles C4'-P-C4' energy: -56.577 flat angles P-C4'-P energy: -36.145 tors. eta vs tors. theta energy: -59.284 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 167 Temperature: 1.250000 Total energy: -809.569745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -809.569745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.769745 (E_RNA) where: Base-Base interactions energy: -442.828 where: short stacking energy: -180.325 Base-Backbone interact. energy: -0.781 local terms energy: -238.160616 where: bonds (distance) C4'-P energy: -49.709 bonds (distance) P-C4' energy: -51.836 flat angles C4'-P-C4' energy: -57.983 flat angles P-C4'-P energy: -25.428 tors. eta vs tors. theta energy: -53.205 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 167 Temperature: 1.300000 Total energy: -717.001613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.001613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.801613 (E_RNA) where: Base-Base interactions energy: -373.733 where: short stacking energy: -154.235 Base-Backbone interact. energy: -1.485 local terms energy: -217.584018 where: bonds (distance) C4'-P energy: -45.789 bonds (distance) P-C4' energy: -49.694 flat angles C4'-P-C4' energy: -53.254 flat angles P-C4'-P energy: -28.293 tors. eta vs tors. theta energy: -40.554 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 167 Temperature: 1.350000 Total energy: -708.047573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.047573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.047573 (E_RNA) where: Base-Base interactions energy: -377.702 where: short stacking energy: -157.426 Base-Backbone interact. energy: 0.825 local terms energy: -214.171051 where: bonds (distance) C4'-P energy: -36.396 bonds (distance) P-C4' energy: -54.718 flat angles C4'-P-C4' energy: -47.013 flat angles P-C4'-P energy: -36.728 tors. eta vs tors. theta energy: -39.316 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 168 Temperature: 0.900000 Total energy: -1105.167349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1105.167349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.567349 (E_RNA) where: Base-Base interactions energy: -664.539 where: short stacking energy: -273.304 Base-Backbone interact. energy: -0.494 local terms energy: -310.534525 where: bonds (distance) C4'-P energy: -53.388 bonds (distance) P-C4' energy: -58.066 flat angles C4'-P-C4' energy: -64.640 flat angles P-C4'-P energy: -45.133 tors. eta vs tors. theta energy: -89.307 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 168 Temperature: 0.950000 Total energy: -1058.674694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.674694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.874694 (E_RNA) where: Base-Base interactions energy: -649.905 where: short stacking energy: -248.915 Base-Backbone interact. energy: -3.329 local terms energy: -277.640771 where: bonds (distance) C4'-P energy: -52.995 bonds (distance) P-C4' energy: -46.042 flat angles C4'-P-C4' energy: -64.389 flat angles P-C4'-P energy: -39.971 tors. eta vs tors. theta energy: -74.244 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 168 Temperature: 1.000000 Total energy: -1002.138108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1002.138108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.538108 (E_RNA) where: Base-Base interactions energy: -601.177 where: short stacking energy: -257.869 Base-Backbone interact. energy: -0.479 local terms energy: -270.881956 where: bonds (distance) C4'-P energy: -49.819 bonds (distance) P-C4' energy: -44.791 flat angles C4'-P-C4' energy: -60.568 flat angles P-C4'-P energy: -37.416 tors. eta vs tors. theta energy: -78.288 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 168 Temperature: 1.050000 Total energy: -966.751826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.751826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.151826 (E_RNA) where: Base-Base interactions energy: -553.103 where: short stacking energy: -237.724 Base-Backbone interact. energy: -1.258 local terms energy: -282.790946 where: bonds (distance) C4'-P energy: -51.031 bonds (distance) P-C4' energy: -51.507 flat angles C4'-P-C4' energy: -61.523 flat angles P-C4'-P energy: -38.008 tors. eta vs tors. theta energy: -80.722 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 168 Temperature: 1.100000 Total energy: -894.496026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.496026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -764.896026 (E_RNA) where: Base-Base interactions energy: -479.999 where: short stacking energy: -222.557 Base-Backbone interact. energy: -0.376 local terms energy: -284.521498 where: bonds (distance) C4'-P energy: -56.800 bonds (distance) P-C4' energy: -52.719 flat angles C4'-P-C4' energy: -60.710 flat angles P-C4'-P energy: -42.741 tors. eta vs tors. theta energy: -71.550 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 168 Temperature: 1.150000 Total energy: -894.585152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.585152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -764.985152 (E_RNA) where: Base-Base interactions energy: -493.769 where: short stacking energy: -226.779 Base-Backbone interact. energy: -0.350 local terms energy: -270.866176 where: bonds (distance) C4'-P energy: -46.603 bonds (distance) P-C4' energy: -59.440 flat angles C4'-P-C4' energy: -52.704 flat angles P-C4'-P energy: -43.203 tors. eta vs tors. theta energy: -68.916 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 168 Temperature: 1.200000 Total energy: -803.053968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.053968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.453968 (E_RNA) where: Base-Base interactions energy: -445.278 where: short stacking energy: -196.896 Base-Backbone interact. energy: -1.441 local terms energy: -226.734605 where: bonds (distance) C4'-P energy: -46.503 bonds (distance) P-C4' energy: -43.248 flat angles C4'-P-C4' energy: -53.941 flat angles P-C4'-P energy: -36.189 tors. eta vs tors. theta energy: -46.854 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 168 Temperature: 1.250000 Total energy: -815.594635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.594635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.394635 (E_RNA) where: Base-Base interactions energy: -464.285 where: short stacking energy: -204.206 Base-Backbone interact. energy: -0.987 local terms energy: -226.122854 where: bonds (distance) C4'-P energy: -45.402 bonds (distance) P-C4' energy: -43.442 flat angles C4'-P-C4' energy: -50.433 flat angles P-C4'-P energy: -28.391 tors. eta vs tors. theta energy: -58.455 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 168 Temperature: 1.300000 Total energy: -723.672776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -723.672776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.872776 (E_RNA) where: Base-Base interactions energy: -405.574 where: short stacking energy: -151.651 Base-Backbone interact. energy: 3.664 local terms energy: -193.962860 where: bonds (distance) C4'-P energy: -46.591 bonds (distance) P-C4' energy: -51.720 flat angles C4'-P-C4' energy: -29.066 flat angles P-C4'-P energy: -31.968 tors. eta vs tors. theta energy: -34.618 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 168 Temperature: 1.350000 Total energy: -693.712398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.712398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.512398 (E_RNA) where: Base-Base interactions energy: -370.464 where: short stacking energy: -150.938 Base-Backbone interact. energy: 0.783 local terms energy: -208.830791 where: bonds (distance) C4'-P energy: -53.051 bonds (distance) P-C4' energy: -50.669 flat angles C4'-P-C4' energy: -47.864 flat angles P-C4'-P energy: -23.080 tors. eta vs tors. theta energy: -34.166 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 169 Temperature: 0.900000 Total energy: -1094.252859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1094.252859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.452859 (E_RNA) where: Base-Base interactions energy: -661.156 where: short stacking energy: -278.745 Base-Backbone interact. energy: -0.336 local terms energy: -304.960901 where: bonds (distance) C4'-P energy: -51.946 bonds (distance) P-C4' energy: -58.786 flat angles C4'-P-C4' energy: -62.346 flat angles P-C4'-P energy: -39.940 tors. eta vs tors. theta energy: -91.941 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 169 Temperature: 0.950000 Total energy: -1068.582287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.582287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.782287 (E_RNA) where: Base-Base interactions energy: -657.476 where: short stacking energy: -260.701 Base-Backbone interact. energy: -1.634 local terms energy: -281.672267 where: bonds (distance) C4'-P energy: -45.099 bonds (distance) P-C4' energy: -51.878 flat angles C4'-P-C4' energy: -66.129 flat angles P-C4'-P energy: -42.032 tors. eta vs tors. theta energy: -76.534 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 169 Temperature: 1.000000 Total energy: -1005.848665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.848665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.248665 (E_RNA) where: Base-Base interactions energy: -597.454 where: short stacking energy: -263.472 Base-Backbone interact. energy: -1.809 local terms energy: -276.986086 where: bonds (distance) C4'-P energy: -51.611 bonds (distance) P-C4' energy: -56.059 flat angles C4'-P-C4' energy: -62.682 flat angles P-C4'-P energy: -36.895 tors. eta vs tors. theta energy: -69.740 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 169 Temperature: 1.050000 Total energy: -970.067128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -970.067128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -840.467128 (E_RNA) where: Base-Base interactions energy: -559.669 where: short stacking energy: -260.261 Base-Backbone interact. energy: 0.443 local terms energy: -281.241111 where: bonds (distance) C4'-P energy: -49.442 bonds (distance) P-C4' energy: -57.022 flat angles C4'-P-C4' energy: -54.605 flat angles P-C4'-P energy: -36.368 tors. eta vs tors. theta energy: -83.805 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 169 Temperature: 1.100000 Total energy: -920.349520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.349520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.749520 (E_RNA) where: Base-Base interactions energy: -520.201 where: short stacking energy: -242.024 Base-Backbone interact. energy: -0.704 local terms energy: -269.844999 where: bonds (distance) C4'-P energy: -51.884 bonds (distance) P-C4' energy: -44.405 flat angles C4'-P-C4' energy: -63.766 flat angles P-C4'-P energy: -37.392 tors. eta vs tors. theta energy: -72.398 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 169 Temperature: 1.150000 Total energy: -874.281990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -874.281990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.081990 (E_RNA) where: Base-Base interactions energy: -491.434 where: short stacking energy: -246.208 Base-Backbone interact. energy: -0.471 local terms energy: -258.177659 where: bonds (distance) C4'-P energy: -44.551 bonds (distance) P-C4' energy: -56.325 flat angles C4'-P-C4' energy: -54.147 flat angles P-C4'-P energy: -36.141 tors. eta vs tors. theta energy: -67.013 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 169 Temperature: 1.200000 Total energy: -824.726372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.726372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.726372 (E_RNA) where: Base-Base interactions energy: -453.646 where: short stacking energy: -206.111 Base-Backbone interact. energy: -1.218 local terms energy: -243.863018 where: bonds (distance) C4'-P energy: -49.884 bonds (distance) P-C4' energy: -49.855 flat angles C4'-P-C4' energy: -54.067 flat angles P-C4'-P energy: -36.676 tors. eta vs tors. theta energy: -53.382 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 169 Temperature: 1.250000 Total energy: -814.519136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.519136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.919136 (E_RNA) where: Base-Base interactions energy: -462.313 where: short stacking energy: -216.599 Base-Backbone interact. energy: -0.892 local terms energy: -221.714708 where: bonds (distance) C4'-P energy: -44.950 bonds (distance) P-C4' energy: -31.968 flat angles C4'-P-C4' energy: -45.929 flat angles P-C4'-P energy: -39.106 tors. eta vs tors. theta energy: -59.762 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 169 Temperature: 1.300000 Total energy: -733.833900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -733.833900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.833900 (E_RNA) where: Base-Base interactions energy: -389.685 where: short stacking energy: -165.517 Base-Backbone interact. energy: -0.881 local terms energy: -217.268115 where: bonds (distance) C4'-P energy: -45.882 bonds (distance) P-C4' energy: -49.753 flat angles C4'-P-C4' energy: -51.970 flat angles P-C4'-P energy: -34.330 tors. eta vs tors. theta energy: -35.333 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 169 Temperature: 1.350000 Total energy: -696.176678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.176678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.376678 (E_RNA) where: Base-Base interactions energy: -372.037 where: short stacking energy: -170.523 Base-Backbone interact. energy: -1.119 local terms energy: -204.221495 where: bonds (distance) C4'-P energy: -30.819 bonds (distance) P-C4' energy: -56.276 flat angles C4'-P-C4' energy: -53.894 flat angles P-C4'-P energy: -26.694 tors. eta vs tors. theta energy: -36.538 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 170 Temperature: 0.900000 Total energy: -1096.208251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.208251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.608251 (E_RNA) where: Base-Base interactions energy: -669.132 where: short stacking energy: -287.873 Base-Backbone interact. energy: 0.006 local terms energy: -297.482399 where: bonds (distance) C4'-P energy: -54.402 bonds (distance) P-C4' energy: -49.286 flat angles C4'-P-C4' energy: -53.750 flat angles P-C4'-P energy: -48.530 tors. eta vs tors. theta energy: -91.514 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 170 Temperature: 0.950000 Total energy: -1067.624478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.624478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.824478 (E_RNA) where: Base-Base interactions energy: -648.972 where: short stacking energy: -266.952 Base-Backbone interact. energy: -1.875 local terms energy: -288.978319 where: bonds (distance) C4'-P energy: -54.867 bonds (distance) P-C4' energy: -48.649 flat angles C4'-P-C4' energy: -58.624 flat angles P-C4'-P energy: -44.432 tors. eta vs tors. theta energy: -82.406 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 170 Temperature: 1.000000 Total energy: -1004.248379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.248379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.448379 (E_RNA) where: Base-Base interactions energy: -590.676 where: short stacking energy: -238.204 Base-Backbone interact. energy: -0.562 local terms energy: -285.209955 where: bonds (distance) C4'-P energy: -55.571 bonds (distance) P-C4' energy: -55.570 flat angles C4'-P-C4' energy: -62.412 flat angles P-C4'-P energy: -42.602 tors. eta vs tors. theta energy: -69.054 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 170 Temperature: 1.050000 Total energy: -979.242049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -979.242049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.042049 (E_RNA) where: Base-Base interactions energy: -561.741 where: short stacking energy: -235.824 Base-Backbone interact. energy: -0.750 local terms energy: -292.550765 where: bonds (distance) C4'-P energy: -59.544 bonds (distance) P-C4' energy: -53.889 flat angles C4'-P-C4' energy: -55.629 flat angles P-C4'-P energy: -46.181 tors. eta vs tors. theta energy: -77.307 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 170 Temperature: 1.100000 Total energy: -936.850179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -936.850179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -810.850179 (E_RNA) where: Base-Base interactions energy: -535.223 where: short stacking energy: -233.428 Base-Backbone interact. energy: -0.246 local terms energy: -275.381798 where: bonds (distance) C4'-P energy: -50.142 bonds (distance) P-C4' energy: -58.601 flat angles C4'-P-C4' energy: -59.805 flat angles P-C4'-P energy: -46.579 tors. eta vs tors. theta energy: -60.255 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 170 Temperature: 1.150000 Total energy: -873.295831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -873.295831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.095831 (E_RNA) where: Base-Base interactions energy: -485.189 where: short stacking energy: -221.178 Base-Backbone interact. energy: -1.113 local terms energy: -262.794006 where: bonds (distance) C4'-P energy: -47.335 bonds (distance) P-C4' energy: -51.770 flat angles C4'-P-C4' energy: -54.752 flat angles P-C4'-P energy: -40.024 tors. eta vs tors. theta energy: -68.913 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 170 Temperature: 1.200000 Total energy: -841.077570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.077570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.077570 (E_RNA) where: Base-Base interactions energy: -473.166 where: short stacking energy: -202.946 Base-Backbone interact. energy: -1.146 local terms energy: -240.765883 where: bonds (distance) C4'-P energy: -47.084 bonds (distance) P-C4' energy: -56.787 flat angles C4'-P-C4' energy: -53.281 flat angles P-C4'-P energy: -29.464 tors. eta vs tors. theta energy: -54.149 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 170 Temperature: 1.250000 Total energy: -807.329959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -807.329959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.529959 (E_RNA) where: Base-Base interactions energy: -460.490 where: short stacking energy: -201.838 Base-Backbone interact. energy: 0.085 local terms energy: -219.124779 where: bonds (distance) C4'-P energy: -48.755 bonds (distance) P-C4' energy: -37.312 flat angles C4'-P-C4' energy: -47.414 flat angles P-C4'-P energy: -32.441 tors. eta vs tors. theta energy: -53.203 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 170 Temperature: 1.300000 Total energy: -728.467818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.467818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.667818 (E_RNA) where: Base-Base interactions energy: -403.059 where: short stacking energy: -160.130 Base-Backbone interact. energy: 1.667 local terms energy: -199.276122 where: bonds (distance) C4'-P energy: -35.117 bonds (distance) P-C4' energy: -45.724 flat angles C4'-P-C4' energy: -49.745 flat angles P-C4'-P energy: -34.288 tors. eta vs tors. theta energy: -34.403 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 170 Temperature: 1.350000 Total energy: -683.583021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.583021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.783021 (E_RNA) where: Base-Base interactions energy: -376.870 where: short stacking energy: -154.385 Base-Backbone interact. energy: 0.808 local terms energy: -188.721496 where: bonds (distance) C4'-P energy: -42.499 bonds (distance) P-C4' energy: -38.557 flat angles C4'-P-C4' energy: -47.988 flat angles P-C4'-P energy: -22.255 tors. eta vs tors. theta energy: -37.421 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 171 Temperature: 0.900000 Total energy: -1095.255597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.255597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -967.455597 (E_RNA) where: Base-Base interactions energy: -662.866 where: short stacking energy: -262.816 Base-Backbone interact. energy: 1.224 local terms energy: -305.813168 where: bonds (distance) C4'-P energy: -57.806 bonds (distance) P-C4' energy: -56.453 flat angles C4'-P-C4' energy: -63.813 flat angles P-C4'-P energy: -41.608 tors. eta vs tors. theta energy: -86.133 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 171 Temperature: 0.950000 Total energy: -1040.851785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.851785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.251785 (E_RNA) where: Base-Base interactions energy: -632.592 where: short stacking energy: -251.725 Base-Backbone interact. energy: -1.322 local terms energy: -277.337730 where: bonds (distance) C4'-P energy: -41.431 bonds (distance) P-C4' energy: -59.215 flat angles C4'-P-C4' energy: -54.832 flat angles P-C4'-P energy: -45.685 tors. eta vs tors. theta energy: -76.174 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 171 Temperature: 1.000000 Total energy: -1032.156509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1032.156509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -906.156509 (E_RNA) where: Base-Base interactions energy: -618.508 where: short stacking energy: -270.716 Base-Backbone interact. energy: -0.303 local terms energy: -287.345439 where: bonds (distance) C4'-P energy: -54.137 bonds (distance) P-C4' energy: -54.624 flat angles C4'-P-C4' energy: -65.682 flat angles P-C4'-P energy: -35.663 tors. eta vs tors. theta energy: -77.240 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 171 Temperature: 1.050000 Total energy: -959.595594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.595594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.795594 (E_RNA) where: Base-Base interactions energy: -550.119 where: short stacking energy: -248.808 Base-Backbone interact. energy: -0.709 local terms energy: -280.966951 where: bonds (distance) C4'-P energy: -52.513 bonds (distance) P-C4' energy: -58.101 flat angles C4'-P-C4' energy: -64.908 flat angles P-C4'-P energy: -34.970 tors. eta vs tors. theta energy: -70.475 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 171 Temperature: 1.100000 Total energy: -939.402060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -939.402060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -811.602060 (E_RNA) where: Base-Base interactions energy: -553.095 where: short stacking energy: -228.806 Base-Backbone interact. energy: 3.195 local terms energy: -261.701952 where: bonds (distance) C4'-P energy: -58.179 bonds (distance) P-C4' energy: -50.584 flat angles C4'-P-C4' energy: -56.215 flat angles P-C4'-P energy: -30.252 tors. eta vs tors. theta energy: -66.472 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 171 Temperature: 1.150000 Total energy: -907.265211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.265211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.465211 (E_RNA) where: Base-Base interactions energy: -506.218 where: short stacking energy: -218.790 Base-Backbone interact. energy: -0.544 local terms energy: -272.702540 where: bonds (distance) C4'-P energy: -51.896 bonds (distance) P-C4' energy: -55.199 flat angles C4'-P-C4' energy: -59.872 flat angles P-C4'-P energy: -38.787 tors. eta vs tors. theta energy: -66.948 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 171 Temperature: 1.200000 Total energy: -866.122515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.122515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.922515 (E_RNA) where: Base-Base interactions energy: -489.715 where: short stacking energy: -205.563 Base-Backbone interact. energy: 0.544 local terms energy: -252.751232 where: bonds (distance) C4'-P energy: -43.312 bonds (distance) P-C4' energy: -57.891 flat angles C4'-P-C4' energy: -52.701 flat angles P-C4'-P energy: -42.987 tors. eta vs tors. theta energy: -55.860 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 171 Temperature: 1.250000 Total energy: -813.988119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.988119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.388119 (E_RNA) where: Base-Base interactions energy: -471.676 where: short stacking energy: -203.572 Base-Backbone interact. energy: -1.299 local terms energy: -220.412616 where: bonds (distance) C4'-P energy: -58.193 bonds (distance) P-C4' energy: -48.306 flat angles C4'-P-C4' energy: -35.445 flat angles P-C4'-P energy: -24.209 tors. eta vs tors. theta energy: -54.260 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 171 Temperature: 1.300000 Total energy: -785.852155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.852155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.052155 (E_RNA) where: Base-Base interactions energy: -426.623 where: short stacking energy: -172.815 Base-Backbone interact. energy: -0.278 local terms energy: -231.151261 where: bonds (distance) C4'-P energy: -47.262 bonds (distance) P-C4' energy: -48.966 flat angles C4'-P-C4' energy: -52.512 flat angles P-C4'-P energy: -34.290 tors. eta vs tors. theta energy: -48.121 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 171 Temperature: 1.350000 Total energy: -645.117778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.117778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.917778 (E_RNA) where: Base-Base interactions energy: -320.298 where: short stacking energy: -117.954 Base-Backbone interact. energy: 0.104 local terms energy: -209.724713 where: bonds (distance) C4'-P energy: -55.734 bonds (distance) P-C4' energy: -51.635 flat angles C4'-P-C4' energy: -47.775 flat angles P-C4'-P energy: -35.374 tors. eta vs tors. theta energy: -19.207 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 172 Temperature: 0.900000 Total energy: -1060.906655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.906655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.306655 (E_RNA) where: Base-Base interactions energy: -635.174 where: short stacking energy: -262.023 Base-Backbone interact. energy: -0.564 local terms energy: -295.569605 where: bonds (distance) C4'-P energy: -51.363 bonds (distance) P-C4' energy: -55.801 flat angles C4'-P-C4' energy: -68.624 flat angles P-C4'-P energy: -44.000 tors. eta vs tors. theta energy: -75.782 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 172 Temperature: 0.950000 Total energy: -1071.600651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1071.600651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.600651 (E_RNA) where: Base-Base interactions energy: -645.931 where: short stacking energy: -286.896 Base-Backbone interact. energy: -0.883 local terms energy: -298.786895 where: bonds (distance) C4'-P energy: -45.216 bonds (distance) P-C4' energy: -50.896 flat angles C4'-P-C4' energy: -67.848 flat angles P-C4'-P energy: -47.545 tors. eta vs tors. theta energy: -87.282 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 172 Temperature: 1.000000 Total energy: -1043.111570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.111570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.511570 (E_RNA) where: Base-Base interactions energy: -640.043 where: short stacking energy: -287.886 Base-Backbone interact. energy: 0.760 local terms energy: -274.229109 where: bonds (distance) C4'-P energy: -49.895 bonds (distance) P-C4' energy: -43.656 flat angles C4'-P-C4' energy: -59.226 flat angles P-C4'-P energy: -43.511 tors. eta vs tors. theta energy: -77.942 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 172 Temperature: 1.050000 Total energy: -957.217919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -957.217919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.217919 (E_RNA) where: Base-Base interactions energy: -571.606 where: short stacking energy: -254.098 Base-Backbone interact. energy: 0.765 local terms energy: -260.376783 where: bonds (distance) C4'-P energy: -42.247 bonds (distance) P-C4' energy: -53.556 flat angles C4'-P-C4' energy: -49.364 flat angles P-C4'-P energy: -36.411 tors. eta vs tors. theta energy: -78.800 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 172 Temperature: 1.100000 Total energy: -894.191936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.191936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.391936 (E_RNA) where: Base-Base interactions energy: -495.139 where: short stacking energy: -235.874 Base-Backbone interact. energy: -1.870 local terms energy: -269.382981 where: bonds (distance) C4'-P energy: -50.793 bonds (distance) P-C4' energy: -60.033 flat angles C4'-P-C4' energy: -53.135 flat angles P-C4'-P energy: -38.600 tors. eta vs tors. theta energy: -66.823 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 172 Temperature: 1.150000 Total energy: -921.719353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.719353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.919353 (E_RNA) where: Base-Base interactions energy: -541.917 where: short stacking energy: -226.533 Base-Backbone interact. energy: 0.398 local terms energy: -252.399580 where: bonds (distance) C4'-P energy: -49.067 bonds (distance) P-C4' energy: -49.376 flat angles C4'-P-C4' energy: -53.870 flat angles P-C4'-P energy: -35.898 tors. eta vs tors. theta energy: -64.189 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 172 Temperature: 1.200000 Total energy: -845.098073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.098073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.898073 (E_RNA) where: Base-Base interactions energy: -475.022 where: short stacking energy: -193.658 Base-Backbone interact. energy: -0.546 local terms energy: -245.329480 where: bonds (distance) C4'-P energy: -54.084 bonds (distance) P-C4' energy: -42.967 flat angles C4'-P-C4' energy: -58.869 flat angles P-C4'-P energy: -26.151 tors. eta vs tors. theta energy: -63.258 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 172 Temperature: 1.250000 Total energy: -786.662386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.662386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.062386 (E_RNA) where: Base-Base interactions energy: -438.771 where: short stacking energy: -197.286 Base-Backbone interact. energy: -0.027 local terms energy: -218.263995 where: bonds (distance) C4'-P energy: -39.222 bonds (distance) P-C4' energy: -46.557 flat angles C4'-P-C4' energy: -45.384 flat angles P-C4'-P energy: -31.297 tors. eta vs tors. theta energy: -55.804 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 172 Temperature: 1.300000 Total energy: -768.681775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.681775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.481775 (E_RNA) where: Base-Base interactions energy: -432.930 where: short stacking energy: -182.797 Base-Backbone interact. energy: -0.212 local terms energy: -211.339527 where: bonds (distance) C4'-P energy: -46.314 bonds (distance) P-C4' energy: -32.897 flat angles C4'-P-C4' energy: -54.505 flat angles P-C4'-P energy: -34.161 tors. eta vs tors. theta energy: -43.462 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 172 Temperature: 1.350000 Total energy: -677.076321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.076321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.276321 (E_RNA) where: Base-Base interactions energy: -341.436 where: short stacking energy: -133.119 Base-Backbone interact. energy: -1.612 local terms energy: -206.228390 where: bonds (distance) C4'-P energy: -38.092 bonds (distance) P-C4' energy: -47.782 flat angles C4'-P-C4' energy: -49.804 flat angles P-C4'-P energy: -30.717 tors. eta vs tors. theta energy: -39.834 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 173 Temperature: 0.900000 Total energy: -1065.451364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1065.451364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.651364 (E_RNA) where: Base-Base interactions energy: -634.391 where: short stacking energy: -242.203 Base-Backbone interact. energy: -1.668 local terms energy: -301.591759 where: bonds (distance) C4'-P energy: -62.590 bonds (distance) P-C4' energy: -63.139 flat angles C4'-P-C4' energy: -55.466 flat angles P-C4'-P energy: -41.170 tors. eta vs tors. theta energy: -79.227 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 173 Temperature: 0.950000 Total energy: -1085.849025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.849025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.249025 (E_RNA) where: Base-Base interactions energy: -637.480 where: short stacking energy: -272.985 Base-Backbone interact. energy: -0.281 local terms energy: -318.488687 where: bonds (distance) C4'-P energy: -61.017 bonds (distance) P-C4' energy: -62.620 flat angles C4'-P-C4' energy: -66.150 flat angles P-C4'-P energy: -39.795 tors. eta vs tors. theta energy: -88.906 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 173 Temperature: 1.000000 Total energy: -1058.834790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.834790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.034790 (E_RNA) where: Base-Base interactions energy: -642.249 where: short stacking energy: -282.700 Base-Backbone interact. energy: -0.620 local terms energy: -288.166007 where: bonds (distance) C4'-P energy: -54.151 bonds (distance) P-C4' energy: -51.834 flat angles C4'-P-C4' energy: -58.462 flat angles P-C4'-P energy: -42.481 tors. eta vs tors. theta energy: -81.238 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 173 Temperature: 1.050000 Total energy: -965.983500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.983500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.383500 (E_RNA) where: Base-Base interactions energy: -564.210 where: short stacking energy: -241.693 Base-Backbone interact. energy: -0.440 local terms energy: -271.733200 where: bonds (distance) C4'-P energy: -44.467 bonds (distance) P-C4' energy: -57.008 flat angles C4'-P-C4' energy: -56.519 flat angles P-C4'-P energy: -43.285 tors. eta vs tors. theta energy: -70.454 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 173 Temperature: 1.100000 Total energy: -883.827687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -883.827687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.027687 (E_RNA) where: Base-Base interactions energy: -501.614 where: short stacking energy: -215.601 Base-Backbone interact. energy: -0.684 local terms energy: -253.729004 where: bonds (distance) C4'-P energy: -49.940 bonds (distance) P-C4' energy: -49.532 flat angles C4'-P-C4' energy: -57.013 flat angles P-C4'-P energy: -34.936 tors. eta vs tors. theta energy: -62.308 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 173 Temperature: 1.150000 Total energy: -906.806428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -906.806428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.206428 (E_RNA) where: Base-Base interactions energy: -539.396 where: short stacking energy: -241.621 Base-Backbone interact. energy: -2.374 local terms energy: -235.435818 where: bonds (distance) C4'-P energy: -50.615 bonds (distance) P-C4' energy: -50.369 flat angles C4'-P-C4' energy: -47.060 flat angles P-C4'-P energy: -19.406 tors. eta vs tors. theta energy: -67.988 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 173 Temperature: 1.200000 Total energy: -848.134163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.134163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.534163 (E_RNA) where: Base-Base interactions energy: -473.498 where: short stacking energy: -199.681 Base-Backbone interact. energy: -1.041 local terms energy: -243.995419 where: bonds (distance) C4'-P energy: -41.849 bonds (distance) P-C4' energy: -50.648 flat angles C4'-P-C4' energy: -61.381 flat angles P-C4'-P energy: -31.843 tors. eta vs tors. theta energy: -58.274 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 173 Temperature: 1.250000 Total energy: -775.048314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.048314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.848314 (E_RNA) where: Base-Base interactions energy: -452.827 where: short stacking energy: -193.310 Base-Backbone interact. energy: -2.317 local terms energy: -195.704497 where: bonds (distance) C4'-P energy: -37.416 bonds (distance) P-C4' energy: -36.969 flat angles C4'-P-C4' energy: -53.673 flat angles P-C4'-P energy: -22.325 tors. eta vs tors. theta energy: -45.322 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 173 Temperature: 1.300000 Total energy: -778.240034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.240034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.440034 (E_RNA) where: Base-Base interactions energy: -417.684 where: short stacking energy: -182.121 Base-Backbone interact. energy: -0.800 local terms energy: -231.955883 where: bonds (distance) C4'-P energy: -50.854 bonds (distance) P-C4' energy: -56.599 flat angles C4'-P-C4' energy: -46.199 flat angles P-C4'-P energy: -29.870 tors. eta vs tors. theta energy: -48.434 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 173 Temperature: 1.350000 Total energy: -673.988442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.988442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.188442 (E_RNA) where: Base-Base interactions energy: -365.242 where: short stacking energy: -161.459 Base-Backbone interact. energy: 0.646 local terms energy: -181.592216 where: bonds (distance) C4'-P energy: -38.910 bonds (distance) P-C4' energy: -44.669 flat angles C4'-P-C4' energy: -38.319 flat angles P-C4'-P energy: -26.354 tors. eta vs tors. theta energy: -33.340 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 174 Temperature: 0.900000 Total energy: -1075.370023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1075.370023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.770023 (E_RNA) where: Base-Base interactions energy: -653.457 where: short stacking energy: -261.382 Base-Backbone interact. energy: -0.360 local terms energy: -291.953329 where: bonds (distance) C4'-P energy: -55.352 bonds (distance) P-C4' energy: -58.453 flat angles C4'-P-C4' energy: -61.078 flat angles P-C4'-P energy: -35.075 tors. eta vs tors. theta energy: -81.995 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 174 Temperature: 0.950000 Total energy: -1060.239571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.239571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.639571 (E_RNA) where: Base-Base interactions energy: -638.113 where: short stacking energy: -243.160 Base-Backbone interact. energy: 1.433 local terms energy: -293.959115 where: bonds (distance) C4'-P energy: -51.361 bonds (distance) P-C4' energy: -58.660 flat angles C4'-P-C4' energy: -60.311 flat angles P-C4'-P energy: -44.952 tors. eta vs tors. theta energy: -78.676 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 174 Temperature: 1.000000 Total energy: -1021.197960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.197960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -893.397960 (E_RNA) where: Base-Base interactions energy: -611.661 where: short stacking energy: -257.627 Base-Backbone interact. energy: -1.872 local terms energy: -279.864512 where: bonds (distance) C4'-P energy: -39.394 bonds (distance) P-C4' energy: -57.723 flat angles C4'-P-C4' energy: -61.862 flat angles P-C4'-P energy: -43.278 tors. eta vs tors. theta energy: -77.608 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 174 Temperature: 1.050000 Total energy: -960.355276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.355276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.555276 (E_RNA) where: Base-Base interactions energy: -547.507 where: short stacking energy: -252.922 Base-Backbone interact. energy: -1.427 local terms energy: -283.620720 where: bonds (distance) C4'-P energy: -54.017 bonds (distance) P-C4' energy: -58.060 flat angles C4'-P-C4' energy: -53.753 flat angles P-C4'-P energy: -35.098 tors. eta vs tors. theta energy: -82.692 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 174 Temperature: 1.100000 Total energy: -885.753318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -885.753318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.553318 (E_RNA) where: Base-Base interactions energy: -500.233 where: short stacking energy: -232.057 Base-Backbone interact. energy: 0.543 local terms energy: -261.862906 where: bonds (distance) C4'-P energy: -39.850 bonds (distance) P-C4' energy: -47.731 flat angles C4'-P-C4' energy: -55.169 flat angles P-C4'-P energy: -46.990 tors. eta vs tors. theta energy: -72.123 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 174 Temperature: 1.150000 Total energy: -884.412584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.412584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.612584 (E_RNA) where: Base-Base interactions energy: -489.652 where: short stacking energy: -229.218 Base-Backbone interact. energy: -0.684 local terms energy: -266.276184 where: bonds (distance) C4'-P energy: -53.323 bonds (distance) P-C4' energy: -45.959 flat angles C4'-P-C4' energy: -55.298 flat angles P-C4'-P energy: -40.893 tors. eta vs tors. theta energy: -70.804 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 174 Temperature: 1.200000 Total energy: -856.360144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.360144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -726.760144 (E_RNA) where: Base-Base interactions energy: -472.320 where: short stacking energy: -207.650 Base-Backbone interact. energy: 0.888 local terms energy: -255.327971 where: bonds (distance) C4'-P energy: -45.618 bonds (distance) P-C4' energy: -48.498 flat angles C4'-P-C4' energy: -60.128 flat angles P-C4'-P energy: -35.287 tors. eta vs tors. theta energy: -65.797 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 174 Temperature: 1.250000 Total energy: -761.116429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.116429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.916429 (E_RNA) where: Base-Base interactions energy: -420.725 where: short stacking energy: -187.125 Base-Backbone interact. energy: 1.080 local terms energy: -217.271970 where: bonds (distance) C4'-P energy: -45.908 bonds (distance) P-C4' energy: -47.749 flat angles C4'-P-C4' energy: -55.932 flat angles P-C4'-P energy: -27.842 tors. eta vs tors. theta energy: -39.841 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 174 Temperature: 1.300000 Total energy: -766.264463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.264463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.064463 (E_RNA) where: Base-Base interactions energy: -423.730 where: short stacking energy: -181.333 Base-Backbone interact. energy: -0.706 local terms energy: -217.628124 where: bonds (distance) C4'-P energy: -54.554 bonds (distance) P-C4' energy: -38.025 flat angles C4'-P-C4' energy: -48.236 flat angles P-C4'-P energy: -33.708 tors. eta vs tors. theta energy: -43.104 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 174 Temperature: 1.350000 Total energy: -670.307087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -670.307087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.307087 (E_RNA) where: Base-Base interactions energy: -360.254 where: short stacking energy: -161.455 Base-Backbone interact. energy: -0.694 local terms energy: -183.358617 where: bonds (distance) C4'-P energy: -42.170 bonds (distance) P-C4' energy: -53.117 flat angles C4'-P-C4' energy: -34.158 flat angles P-C4'-P energy: -20.622 tors. eta vs tors. theta energy: -33.291 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 175 Temperature: 0.900000 Total energy: -1073.044480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.044480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -947.044480 (E_RNA) where: Base-Base interactions energy: -640.595 where: short stacking energy: -271.932 Base-Backbone interact. energy: -1.648 local terms energy: -304.801432 where: bonds (distance) C4'-P energy: -50.362 bonds (distance) P-C4' energy: -59.144 flat angles C4'-P-C4' energy: -62.157 flat angles P-C4'-P energy: -44.725 tors. eta vs tors. theta energy: -88.414 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 175 Temperature: 0.950000 Total energy: -1022.497429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1022.497429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -896.497429 (E_RNA) where: Base-Base interactions energy: -604.971 where: short stacking energy: -268.391 Base-Backbone interact. energy: -0.496 local terms energy: -291.029872 where: bonds (distance) C4'-P energy: -59.497 bonds (distance) P-C4' energy: -56.631 flat angles C4'-P-C4' energy: -53.336 flat angles P-C4'-P energy: -44.929 tors. eta vs tors. theta energy: -76.638 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 175 Temperature: 1.000000 Total energy: -1046.085043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1046.085043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -920.085043 (E_RNA) where: Base-Base interactions energy: -637.530 where: short stacking energy: -247.634 Base-Backbone interact. energy: -0.984 local terms energy: -281.571408 where: bonds (distance) C4'-P energy: -50.018 bonds (distance) P-C4' energy: -55.523 flat angles C4'-P-C4' energy: -57.374 flat angles P-C4'-P energy: -43.054 tors. eta vs tors. theta energy: -75.603 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 175 Temperature: 1.050000 Total energy: -984.009740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.009740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -861.609740 (E_RNA) where: Base-Base interactions energy: -584.487 where: short stacking energy: -267.423 Base-Backbone interact. energy: -0.107 local terms energy: -277.016511 where: bonds (distance) C4'-P energy: -45.490 bonds (distance) P-C4' energy: -38.512 flat angles C4'-P-C4' energy: -65.669 flat angles P-C4'-P energy: -41.619 tors. eta vs tors. theta energy: -85.727 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 175 Temperature: 1.100000 Total energy: -888.335351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -888.335351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.735351 (E_RNA) where: Base-Base interactions energy: -491.063 where: short stacking energy: -215.938 Base-Backbone interact. energy: 6.001 local terms energy: -273.673939 where: bonds (distance) C4'-P energy: -49.425 bonds (distance) P-C4' energy: -61.980 flat angles C4'-P-C4' energy: -58.184 flat angles P-C4'-P energy: -36.384 tors. eta vs tors. theta energy: -67.700 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 175 Temperature: 1.150000 Total energy: -885.450821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -885.450821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.850821 (E_RNA) where: Base-Base interactions energy: -492.214 where: short stacking energy: -226.797 Base-Backbone interact. energy: -0.789 local terms energy: -262.847185 where: bonds (distance) C4'-P energy: -47.830 bonds (distance) P-C4' energy: -49.409 flat angles C4'-P-C4' energy: -61.249 flat angles P-C4'-P energy: -30.896 tors. eta vs tors. theta energy: -73.463 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 175 Temperature: 1.200000 Total energy: -860.197469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.197469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.197469 (E_RNA) where: Base-Base interactions energy: -469.322 where: short stacking energy: -224.203 Base-Backbone interact. energy: -0.679 local terms energy: -264.197336 where: bonds (distance) C4'-P energy: -48.813 bonds (distance) P-C4' energy: -54.080 flat angles C4'-P-C4' energy: -53.088 flat angles P-C4'-P energy: -36.601 tors. eta vs tors. theta energy: -71.615 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 175 Temperature: 1.250000 Total energy: -814.958891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.958891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.958891 (E_RNA) where: Base-Base interactions energy: -456.317 where: short stacking energy: -188.456 Base-Backbone interact. energy: -1.182 local terms energy: -231.459463 where: bonds (distance) C4'-P energy: -51.507 bonds (distance) P-C4' energy: -46.248 flat angles C4'-P-C4' energy: -48.461 flat angles P-C4'-P energy: -35.403 tors. eta vs tors. theta energy: -49.840 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 175 Temperature: 1.300000 Total energy: -763.369576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.369576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.769576 (E_RNA) where: Base-Base interactions energy: -410.155 where: short stacking energy: -174.698 Base-Backbone interact. energy: -0.211 local terms energy: -223.403527 where: bonds (distance) C4'-P energy: -41.467 bonds (distance) P-C4' energy: -46.811 flat angles C4'-P-C4' energy: -55.245 flat angles P-C4'-P energy: -28.068 tors. eta vs tors. theta energy: -51.813 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 175 Temperature: 1.350000 Total energy: -684.279027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.279027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.679027 (E_RNA) where: Base-Base interactions energy: -359.575 where: short stacking energy: -139.660 Base-Backbone interact. energy: -0.734 local terms energy: -194.370451 where: bonds (distance) C4'-P energy: -39.561 bonds (distance) P-C4' energy: -45.657 flat angles C4'-P-C4' energy: -51.983 flat angles P-C4'-P energy: -28.964 tors. eta vs tors. theta energy: -28.204 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 176 Temperature: 0.900000 Total energy: -1092.064263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1092.064263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.464263 (E_RNA) where: Base-Base interactions energy: -661.809 where: short stacking energy: -263.058 Base-Backbone interact. energy: 1.859 local terms energy: -302.513861 where: bonds (distance) C4'-P energy: -53.802 bonds (distance) P-C4' energy: -53.391 flat angles C4'-P-C4' energy: -63.995 flat angles P-C4'-P energy: -45.837 tors. eta vs tors. theta energy: -85.489 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 176 Temperature: 0.950000 Total energy: -1037.321763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.321763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -909.521763 (E_RNA) where: Base-Base interactions energy: -633.546 where: short stacking energy: -276.553 Base-Backbone interact. energy: -0.685 local terms energy: -275.290804 where: bonds (distance) C4'-P energy: -49.627 bonds (distance) P-C4' energy: -48.206 flat angles C4'-P-C4' energy: -57.150 flat angles P-C4'-P energy: -44.070 tors. eta vs tors. theta energy: -76.237 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 176 Temperature: 1.000000 Total energy: -1040.944245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.944245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.344245 (E_RNA) where: Base-Base interactions energy: -617.918 where: short stacking energy: -233.147 Base-Backbone interact. energy: -0.702 local terms energy: -292.724085 where: bonds (distance) C4'-P energy: -48.698 bonds (distance) P-C4' energy: -61.672 flat angles C4'-P-C4' energy: -60.225 flat angles P-C4'-P energy: -46.161 tors. eta vs tors. theta energy: -75.969 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 176 Temperature: 1.050000 Total energy: -959.813121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.813121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.013121 (E_RNA) where: Base-Base interactions energy: -557.220 where: short stacking energy: -240.265 Base-Backbone interact. energy: 0.006 local terms energy: -274.798453 where: bonds (distance) C4'-P energy: -54.756 bonds (distance) P-C4' energy: -47.102 flat angles C4'-P-C4' energy: -59.893 flat angles P-C4'-P energy: -37.587 tors. eta vs tors. theta energy: -75.461 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 176 Temperature: 1.100000 Total energy: -899.476951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -899.476951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.276951 (E_RNA) where: Base-Base interactions energy: -516.066 where: short stacking energy: -244.882 Base-Backbone interact. energy: 1.695 local terms energy: -260.905243 where: bonds (distance) C4'-P energy: -48.431 bonds (distance) P-C4' energy: -53.903 flat angles C4'-P-C4' energy: -50.122 flat angles P-C4'-P energy: -32.393 tors. eta vs tors. theta energy: -76.056 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 176 Temperature: 1.150000 Total energy: -858.805682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.805682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.805682 (E_RNA) where: Base-Base interactions energy: -471.665 where: short stacking energy: -206.588 Base-Backbone interact. energy: -0.353 local terms energy: -260.787415 where: bonds (distance) C4'-P energy: -50.308 bonds (distance) P-C4' energy: -50.159 flat angles C4'-P-C4' energy: -53.003 flat angles P-C4'-P energy: -40.128 tors. eta vs tors. theta energy: -67.189 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 176 Temperature: 1.200000 Total energy: -862.318928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.318928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.518928 (E_RNA) where: Base-Base interactions energy: -483.785 where: short stacking energy: -202.684 Base-Backbone interact. energy: -0.796 local terms energy: -249.937684 where: bonds (distance) C4'-P energy: -51.476 bonds (distance) P-C4' energy: -54.983 flat angles C4'-P-C4' energy: -48.447 flat angles P-C4'-P energy: -36.690 tors. eta vs tors. theta energy: -58.342 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 176 Temperature: 1.250000 Total energy: -814.708805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.708805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.708805 (E_RNA) where: Base-Base interactions energy: -439.795 where: short stacking energy: -190.893 Base-Backbone interact. energy: -0.631 local terms energy: -248.283360 where: bonds (distance) C4'-P energy: -41.864 bonds (distance) P-C4' energy: -58.180 flat angles C4'-P-C4' energy: -53.799 flat angles P-C4'-P energy: -32.750 tors. eta vs tors. theta energy: -61.690 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 176 Temperature: 1.300000 Total energy: -757.784529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -757.784529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.584529 (E_RNA) where: Base-Base interactions energy: -423.875 where: short stacking energy: -170.953 Base-Backbone interact. energy: 0.665 local terms energy: -210.373628 where: bonds (distance) C4'-P energy: -42.327 bonds (distance) P-C4' energy: -38.153 flat angles C4'-P-C4' energy: -56.489 flat angles P-C4'-P energy: -31.305 tors. eta vs tors. theta energy: -42.099 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 176 Temperature: 1.350000 Total energy: -699.876117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.876117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.276117 (E_RNA) where: Base-Base interactions energy: -378.164 where: short stacking energy: -163.801 Base-Backbone interact. energy: -1.922 local terms energy: -190.190570 where: bonds (distance) C4'-P energy: -45.339 bonds (distance) P-C4' energy: -35.716 flat angles C4'-P-C4' energy: -50.729 flat angles P-C4'-P energy: -25.331 tors. eta vs tors. theta energy: -33.075 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 177 Temperature: 0.900000 Total energy: -1091.340366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.340366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.740366 (E_RNA) where: Base-Base interactions energy: -665.326 where: short stacking energy: -281.549 Base-Backbone interact. energy: -0.231 local terms energy: -296.182533 where: bonds (distance) C4'-P energy: -50.180 bonds (distance) P-C4' energy: -54.911 flat angles C4'-P-C4' energy: -67.605 flat angles P-C4'-P energy: -38.880 tors. eta vs tors. theta energy: -84.607 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 177 Temperature: 0.950000 Total energy: -1070.305758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1070.305758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.705758 (E_RNA) where: Base-Base interactions energy: -658.283 where: short stacking energy: -254.817 Base-Backbone interact. energy: -3.337 local terms energy: -279.085546 where: bonds (distance) C4'-P energy: -57.963 bonds (distance) P-C4' energy: -49.977 flat angles C4'-P-C4' energy: -58.533 flat angles P-C4'-P energy: -37.878 tors. eta vs tors. theta energy: -74.736 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 177 Temperature: 1.000000 Total energy: -1010.279727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.279727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.479727 (E_RNA) where: Base-Base interactions energy: -581.377 where: short stacking energy: -250.209 Base-Backbone interact. energy: -0.286 local terms energy: -300.817190 where: bonds (distance) C4'-P energy: -60.141 bonds (distance) P-C4' energy: -65.026 flat angles C4'-P-C4' energy: -61.745 flat angles P-C4'-P energy: -40.192 tors. eta vs tors. theta energy: -73.713 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 177 Temperature: 1.050000 Total energy: -966.715328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.715328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.915328 (E_RNA) where: Base-Base interactions energy: -562.550 where: short stacking energy: -248.500 Base-Backbone interact. energy: -0.857 local terms energy: -275.507983 where: bonds (distance) C4'-P energy: -54.054 bonds (distance) P-C4' energy: -46.623 flat angles C4'-P-C4' energy: -59.837 flat angles P-C4'-P energy: -36.838 tors. eta vs tors. theta energy: -78.156 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 177 Temperature: 1.100000 Total energy: -896.255880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.255880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.455880 (E_RNA) where: Base-Base interactions energy: -522.520 where: short stacking energy: -245.689 Base-Backbone interact. energy: 0.681 local terms energy: -246.617254 where: bonds (distance) C4'-P energy: -40.580 bonds (distance) P-C4' energy: -45.722 flat angles C4'-P-C4' energy: -55.986 flat angles P-C4'-P energy: -33.919 tors. eta vs tors. theta energy: -70.412 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 177 Temperature: 1.150000 Total energy: -860.028517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.028517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.428517 (E_RNA) where: Base-Base interactions energy: -475.114 where: short stacking energy: -217.933 Base-Backbone interact. energy: 0.674 local terms energy: -255.988637 where: bonds (distance) C4'-P energy: -52.509 bonds (distance) P-C4' energy: -46.598 flat angles C4'-P-C4' energy: -56.022 flat angles P-C4'-P energy: -40.991 tors. eta vs tors. theta energy: -59.869 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 177 Temperature: 1.200000 Total energy: -826.432636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.432636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.432636 (E_RNA) where: Base-Base interactions energy: -448.552 where: short stacking energy: -199.021 Base-Backbone interact. energy: -0.786 local terms energy: -251.093899 where: bonds (distance) C4'-P energy: -57.673 bonds (distance) P-C4' energy: -51.262 flat angles C4'-P-C4' energy: -50.083 flat angles P-C4'-P energy: -41.704 tors. eta vs tors. theta energy: -50.373 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 177 Temperature: 1.250000 Total energy: -830.722920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -830.722920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.922920 (E_RNA) where: Base-Base interactions energy: -447.320 where: short stacking energy: -205.605 Base-Backbone interact. energy: -0.525 local terms energy: -255.077371 where: bonds (distance) C4'-P energy: -44.466 bonds (distance) P-C4' energy: -56.536 flat angles C4'-P-C4' energy: -47.407 flat angles P-C4'-P energy: -39.614 tors. eta vs tors. theta energy: -67.054 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 177 Temperature: 1.300000 Total energy: -736.485886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.485886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.485886 (E_RNA) where: Base-Base interactions energy: -406.560 where: short stacking energy: -166.248 Base-Backbone interact. energy: -0.549 local terms energy: -203.376621 where: bonds (distance) C4'-P energy: -48.494 bonds (distance) P-C4' energy: -42.842 flat angles C4'-P-C4' energy: -37.542 flat angles P-C4'-P energy: -31.300 tors. eta vs tors. theta energy: -43.198 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 177 Temperature: 1.350000 Total energy: -663.699022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.699022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.299022 (E_RNA) where: Base-Base interactions energy: -345.839 where: short stacking energy: -146.374 Base-Backbone interact. energy: 1.141 local terms energy: -196.601648 where: bonds (distance) C4'-P energy: -42.683 bonds (distance) P-C4' energy: -32.864 flat angles C4'-P-C4' energy: -52.790 flat angles P-C4'-P energy: -37.926 tors. eta vs tors. theta energy: -30.339 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 178 Temperature: 0.900000 Total energy: -1090.636206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1090.636206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.636206 (E_RNA) where: Base-Base interactions energy: -663.214 where: short stacking energy: -279.296 Base-Backbone interact. energy: -1.544 local terms energy: -299.878082 where: bonds (distance) C4'-P energy: -61.509 bonds (distance) P-C4' energy: -54.309 flat angles C4'-P-C4' energy: -58.570 flat angles P-C4'-P energy: -37.962 tors. eta vs tors. theta energy: -87.527 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 178 Temperature: 0.950000 Total energy: -1049.359658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1049.359658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.359658 (E_RNA) where: Base-Base interactions energy: -627.242 where: short stacking energy: -234.529 Base-Backbone interact. energy: -1.828 local terms energy: -294.289027 where: bonds (distance) C4'-P energy: -63.492 bonds (distance) P-C4' energy: -50.749 flat angles C4'-P-C4' energy: -69.764 flat angles P-C4'-P energy: -42.891 tors. eta vs tors. theta energy: -67.394 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 178 Temperature: 1.000000 Total energy: -1026.351149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.351149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -898.551149 (E_RNA) where: Base-Base interactions energy: -609.584 where: short stacking energy: -274.820 Base-Backbone interact. energy: -0.219 local terms energy: -288.747948 where: bonds (distance) C4'-P energy: -46.008 bonds (distance) P-C4' energy: -47.115 flat angles C4'-P-C4' energy: -66.794 flat angles P-C4'-P energy: -45.167 tors. eta vs tors. theta energy: -83.664 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 178 Temperature: 1.050000 Total energy: -953.606433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -953.606433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.006433 (E_RNA) where: Base-Base interactions energy: -533.585 where: short stacking energy: -226.524 Base-Backbone interact. energy: -3.079 local terms energy: -287.342350 where: bonds (distance) C4'-P energy: -53.145 bonds (distance) P-C4' energy: -58.871 flat angles C4'-P-C4' energy: -59.156 flat angles P-C4'-P energy: -43.234 tors. eta vs tors. theta energy: -72.937 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 178 Temperature: 1.100000 Total energy: -895.452461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -895.452461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.852461 (E_RNA) where: Base-Base interactions energy: -509.137 where: short stacking energy: -234.575 Base-Backbone interact. energy: 4.000 local terms energy: -260.715211 where: bonds (distance) C4'-P energy: -39.762 bonds (distance) P-C4' energy: -55.956 flat angles C4'-P-C4' energy: -52.587 flat angles P-C4'-P energy: -38.392 tors. eta vs tors. theta energy: -74.018 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 178 Temperature: 1.150000 Total energy: -895.177666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -895.177666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.377666 (E_RNA) where: Base-Base interactions energy: -497.439 where: short stacking energy: -232.705 Base-Backbone interact. energy: -0.094 local terms energy: -269.844404 where: bonds (distance) C4'-P energy: -52.572 bonds (distance) P-C4' energy: -50.908 flat angles C4'-P-C4' energy: -57.458 flat angles P-C4'-P energy: -42.134 tors. eta vs tors. theta energy: -66.773 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 178 Temperature: 1.200000 Total energy: -862.061333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.061333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.661333 (E_RNA) where: Base-Base interactions energy: -476.082 where: short stacking energy: -210.606 Base-Backbone interact. energy: -2.110 local terms energy: -261.469217 where: bonds (distance) C4'-P energy: -52.189 bonds (distance) P-C4' energy: -55.411 flat angles C4'-P-C4' energy: -55.064 flat angles P-C4'-P energy: -36.392 tors. eta vs tors. theta energy: -62.412 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 178 Temperature: 1.250000 Total energy: -805.033524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -805.033524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.233524 (E_RNA) where: Base-Base interactions energy: -444.455 where: short stacking energy: -203.329 Base-Backbone interact. energy: -0.023 local terms energy: -232.755375 where: bonds (distance) C4'-P energy: -37.555 bonds (distance) P-C4' energy: -47.466 flat angles C4'-P-C4' energy: -59.729 flat angles P-C4'-P energy: -28.583 tors. eta vs tors. theta energy: -59.422 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 178 Temperature: 1.300000 Total energy: -773.479846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -773.479846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.479846 (E_RNA) where: Base-Base interactions energy: -409.938 where: short stacking energy: -173.911 Base-Backbone interact. energy: -0.412 local terms energy: -246.130373 where: bonds (distance) C4'-P energy: -48.449 bonds (distance) P-C4' energy: -59.043 flat angles C4'-P-C4' energy: -50.691 flat angles P-C4'-P energy: -36.102 tors. eta vs tors. theta energy: -51.845 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 178 Temperature: 1.350000 Total energy: -656.260952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.260952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.260952 (E_RNA) where: Base-Base interactions energy: -357.891 where: short stacking energy: -148.272 Base-Backbone interact. energy: -1.146 local terms energy: -180.224670 where: bonds (distance) C4'-P energy: -37.341 bonds (distance) P-C4' energy: -38.360 flat angles C4'-P-C4' energy: -44.580 flat angles P-C4'-P energy: -32.527 tors. eta vs tors. theta energy: -27.417 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 179 Temperature: 0.900000 Total energy: -1073.888748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.888748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -944.288748 (E_RNA) where: Base-Base interactions energy: -634.819 where: short stacking energy: -275.566 Base-Backbone interact. energy: 1.362 local terms energy: -310.831026 where: bonds (distance) C4'-P energy: -59.514 bonds (distance) P-C4' energy: -57.946 flat angles C4'-P-C4' energy: -61.016 flat angles P-C4'-P energy: -45.446 tors. eta vs tors. theta energy: -86.909 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 179 Temperature: 0.950000 Total energy: -1051.015399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.015399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.215399 (E_RNA) where: Base-Base interactions energy: -629.139 where: short stacking energy: -273.137 Base-Backbone interact. energy: -0.900 local terms energy: -293.176102 where: bonds (distance) C4'-P energy: -55.403 bonds (distance) P-C4' energy: -55.584 flat angles C4'-P-C4' energy: -64.261 flat angles P-C4'-P energy: -38.038 tors. eta vs tors. theta energy: -79.891 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 179 Temperature: 1.000000 Total energy: -1025.601202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.601202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -896.001202 (E_RNA) where: Base-Base interactions energy: -608.196 where: short stacking energy: -229.905 Base-Backbone interact. energy: -0.591 local terms energy: -287.214328 where: bonds (distance) C4'-P energy: -49.163 bonds (distance) P-C4' energy: -60.643 flat angles C4'-P-C4' energy: -61.937 flat angles P-C4'-P energy: -42.581 tors. eta vs tors. theta energy: -72.891 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 179 Temperature: 1.050000 Total energy: -964.852337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.852337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.852337 (E_RNA) where: Base-Base interactions energy: -563.310 where: short stacking energy: -231.348 Base-Backbone interact. energy: -0.567 local terms energy: -274.975286 where: bonds (distance) C4'-P energy: -46.382 bonds (distance) P-C4' energy: -61.861 flat angles C4'-P-C4' energy: -59.104 flat angles P-C4'-P energy: -39.748 tors. eta vs tors. theta energy: -67.880 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 179 Temperature: 1.100000 Total energy: -894.253003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.253003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.053003 (E_RNA) where: Base-Base interactions energy: -497.931 where: short stacking energy: -230.122 Base-Backbone interact. energy: -1.091 local terms energy: -271.030607 where: bonds (distance) C4'-P energy: -53.127 bonds (distance) P-C4' energy: -56.691 flat angles C4'-P-C4' energy: -53.909 flat angles P-C4'-P energy: -43.245 tors. eta vs tors. theta energy: -64.059 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 179 Temperature: 1.150000 Total energy: -872.850487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.850487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.250487 (E_RNA) where: Base-Base interactions energy: -491.428 where: short stacking energy: -215.402 Base-Backbone interact. energy: -1.265 local terms energy: -250.558199 where: bonds (distance) C4'-P energy: -49.522 bonds (distance) P-C4' energy: -53.237 flat angles C4'-P-C4' energy: -51.266 flat angles P-C4'-P energy: -37.445 tors. eta vs tors. theta energy: -59.088 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 179 Temperature: 1.200000 Total energy: -849.741299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.741299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.941299 (E_RNA) where: Base-Base interactions energy: -466.192 where: short stacking energy: -206.471 Base-Backbone interact. energy: 1.350 local terms energy: -257.100062 where: bonds (distance) C4'-P energy: -57.871 bonds (distance) P-C4' energy: -47.400 flat angles C4'-P-C4' energy: -53.880 flat angles P-C4'-P energy: -36.234 tors. eta vs tors. theta energy: -61.715 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 179 Temperature: 1.250000 Total energy: -801.349230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -801.349230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.349230 (E_RNA) where: Base-Base interactions energy: -422.687 where: short stacking energy: -208.114 Base-Backbone interact. energy: -1.647 local terms energy: -251.014766 where: bonds (distance) C4'-P energy: -54.577 bonds (distance) P-C4' energy: -46.717 flat angles C4'-P-C4' energy: -51.757 flat angles P-C4'-P energy: -40.666 tors. eta vs tors. theta energy: -57.298 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 179 Temperature: 1.300000 Total energy: -755.029843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.029843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -627.229843 (E_RNA) where: Base-Base interactions energy: -418.873 where: short stacking energy: -164.318 Base-Backbone interact. energy: -0.149 local terms energy: -208.207983 where: bonds (distance) C4'-P energy: -37.731 bonds (distance) P-C4' energy: -46.326 flat angles C4'-P-C4' energy: -52.491 flat angles P-C4'-P energy: -35.710 tors. eta vs tors. theta energy: -35.950 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 179 Temperature: 1.350000 Total energy: -682.211917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.211917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.211917 (E_RNA) where: Base-Base interactions energy: -347.151 where: short stacking energy: -129.604 Base-Backbone interact. energy: 1.663 local terms energy: -210.724393 where: bonds (distance) C4'-P energy: -39.693 bonds (distance) P-C4' energy: -57.188 flat angles C4'-P-C4' energy: -58.588 flat angles P-C4'-P energy: -23.868 tors. eta vs tors. theta energy: -31.387 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 180 Temperature: 0.900000 Total energy: -1074.509004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1074.509004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -944.909004 (E_RNA) where: Base-Base interactions energy: -636.532 where: short stacking energy: -282.283 Base-Backbone interact. energy: -0.449 local terms energy: -307.928194 where: bonds (distance) C4'-P energy: -53.685 bonds (distance) P-C4' energy: -57.149 flat angles C4'-P-C4' energy: -62.333 flat angles P-C4'-P energy: -45.377 tors. eta vs tors. theta energy: -89.384 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 180 Temperature: 0.950000 Total energy: -1069.782692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.782692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.182692 (E_RNA) where: Base-Base interactions energy: -645.117 where: short stacking energy: -264.814 Base-Backbone interact. energy: -1.264 local terms energy: -293.801659 where: bonds (distance) C4'-P energy: -53.550 bonds (distance) P-C4' energy: -58.891 flat angles C4'-P-C4' energy: -62.959 flat angles P-C4'-P energy: -40.257 tors. eta vs tors. theta energy: -78.145 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 180 Temperature: 1.000000 Total energy: -1044.390120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1044.390120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -914.790120 (E_RNA) where: Base-Base interactions energy: -631.730 where: short stacking energy: -238.320 Base-Backbone interact. energy: -0.665 local terms energy: -282.395806 where: bonds (distance) C4'-P energy: -46.033 bonds (distance) P-C4' energy: -55.445 flat angles C4'-P-C4' energy: -68.383 flat angles P-C4'-P energy: -43.275 tors. eta vs tors. theta energy: -69.260 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 180 Temperature: 1.050000 Total energy: -984.724640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.724640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.524640 (E_RNA) where: Base-Base interactions energy: -579.686 where: short stacking energy: -268.067 Base-Backbone interact. energy: -0.450 local terms energy: -280.388507 where: bonds (distance) C4'-P energy: -50.718 bonds (distance) P-C4' energy: -47.362 flat angles C4'-P-C4' energy: -59.004 flat angles P-C4'-P energy: -41.287 tors. eta vs tors. theta energy: -82.017 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 180 Temperature: 1.100000 Total energy: -941.441693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -941.441693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.641693 (E_RNA) where: Base-Base interactions energy: -538.154 where: short stacking energy: -238.599 Base-Backbone interact. energy: -0.501 local terms energy: -274.986911 where: bonds (distance) C4'-P energy: -42.209 bonds (distance) P-C4' energy: -55.989 flat angles C4'-P-C4' energy: -60.300 flat angles P-C4'-P energy: -42.973 tors. eta vs tors. theta energy: -73.516 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 180 Temperature: 1.150000 Total energy: -889.269397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.269397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.469397 (E_RNA) where: Base-Base interactions energy: -508.709 where: short stacking energy: -221.868 Base-Backbone interact. energy: -1.375 local terms energy: -251.385370 where: bonds (distance) C4'-P energy: -45.217 bonds (distance) P-C4' energy: -52.548 flat angles C4'-P-C4' energy: -58.810 flat angles P-C4'-P energy: -28.930 tors. eta vs tors. theta energy: -65.881 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 180 Temperature: 1.200000 Total energy: -823.754298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -823.754298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.754298 (E_RNA) where: Base-Base interactions energy: -471.446 where: short stacking energy: -223.724 Base-Backbone interact. energy: 2.072 local terms energy: -228.380600 where: bonds (distance) C4'-P energy: -32.951 bonds (distance) P-C4' energy: -51.097 flat angles C4'-P-C4' energy: -51.712 flat angles P-C4'-P energy: -32.618 tors. eta vs tors. theta energy: -60.002 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 180 Temperature: 1.250000 Total energy: -798.644597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.644597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.844597 (E_RNA) where: Base-Base interactions energy: -429.241 where: short stacking energy: -191.930 Base-Backbone interact. energy: -0.414 local terms energy: -241.190009 where: bonds (distance) C4'-P energy: -45.175 bonds (distance) P-C4' energy: -45.377 flat angles C4'-P-C4' energy: -56.073 flat angles P-C4'-P energy: -39.943 tors. eta vs tors. theta energy: -54.623 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 180 Temperature: 1.300000 Total energy: -827.605906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.605906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.405906 (E_RNA) where: Base-Base interactions energy: -455.598 where: short stacking energy: -200.423 Base-Backbone interact. energy: -0.154 local terms energy: -247.653606 where: bonds (distance) C4'-P energy: -43.257 bonds (distance) P-C4' energy: -55.574 flat angles C4'-P-C4' energy: -53.256 flat angles P-C4'-P energy: -37.748 tors. eta vs tors. theta energy: -57.819 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 180 Temperature: 1.350000 Total energy: -638.153407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.153407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.353407 (E_RNA) where: Base-Base interactions energy: -327.821 where: short stacking energy: -136.180 Base-Backbone interact. energy: 0.737 local terms energy: -192.269763 where: bonds (distance) C4'-P energy: -48.908 bonds (distance) P-C4' energy: -41.436 flat angles C4'-P-C4' energy: -45.019 flat angles P-C4'-P energy: -21.173 tors. eta vs tors. theta energy: -35.733 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 181 Temperature: 0.900000 Total energy: -1096.474626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.474626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.874626 (E_RNA) where: Base-Base interactions energy: -654.827 where: short stacking energy: -286.413 Base-Backbone interact. energy: -0.618 local terms energy: -311.430240 where: bonds (distance) C4'-P energy: -59.176 bonds (distance) P-C4' energy: -55.138 flat angles C4'-P-C4' energy: -62.668 flat angles P-C4'-P energy: -47.019 tors. eta vs tors. theta energy: -87.429 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 181 Temperature: 0.950000 Total energy: -1063.065884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.065884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.065884 (E_RNA) where: Base-Base interactions energy: -646.839 where: short stacking energy: -248.921 Base-Backbone interact. energy: -0.837 local terms energy: -289.389950 where: bonds (distance) C4'-P energy: -57.337 bonds (distance) P-C4' energy: -53.499 flat angles C4'-P-C4' energy: -54.978 flat angles P-C4'-P energy: -46.260 tors. eta vs tors. theta energy: -77.316 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 181 Temperature: 1.000000 Total energy: -1076.470143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.470143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -946.870143 (E_RNA) where: Base-Base interactions energy: -640.720 where: short stacking energy: -276.959 Base-Backbone interact. energy: 0.550 local terms energy: -306.700329 where: bonds (distance) C4'-P energy: -55.990 bonds (distance) P-C4' energy: -53.885 flat angles C4'-P-C4' energy: -63.517 flat angles P-C4'-P energy: -49.953 tors. eta vs tors. theta energy: -83.355 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 181 Temperature: 1.050000 Total energy: -971.516069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -971.516069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.716069 (E_RNA) where: Base-Base interactions energy: -569.028 where: short stacking energy: -243.104 Base-Backbone interact. energy: -1.153 local terms energy: -273.535100 where: bonds (distance) C4'-P energy: -49.714 bonds (distance) P-C4' energy: -51.668 flat angles C4'-P-C4' energy: -63.030 flat angles P-C4'-P energy: -35.135 tors. eta vs tors. theta energy: -73.988 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 181 Temperature: 1.100000 Total energy: -913.944366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -913.944366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.944366 (E_RNA) where: Base-Base interactions energy: -522.257 where: short stacking energy: -242.320 Base-Backbone interact. energy: 0.043 local terms energy: -265.730043 where: bonds (distance) C4'-P energy: -44.294 bonds (distance) P-C4' energy: -53.880 flat angles C4'-P-C4' energy: -57.938 flat angles P-C4'-P energy: -35.064 tors. eta vs tors. theta energy: -74.553 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 181 Temperature: 1.150000 Total energy: -891.389584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -891.389584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.789584 (E_RNA) where: Base-Base interactions energy: -483.309 where: short stacking energy: -218.665 Base-Backbone interact. energy: -0.676 local terms energy: -277.804702 where: bonds (distance) C4'-P energy: -56.932 bonds (distance) P-C4' energy: -62.418 flat angles C4'-P-C4' energy: -60.178 flat angles P-C4'-P energy: -39.016 tors. eta vs tors. theta energy: -59.262 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 181 Temperature: 1.200000 Total energy: -871.776612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.776612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.976612 (E_RNA) where: Base-Base interactions energy: -502.658 where: short stacking energy: -235.309 Base-Backbone interact. energy: -1.911 local terms energy: -239.407001 where: bonds (distance) C4'-P energy: -39.016 bonds (distance) P-C4' energy: -41.396 flat angles C4'-P-C4' energy: -55.812 flat angles P-C4'-P energy: -37.292 tors. eta vs tors. theta energy: -65.891 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 181 Temperature: 1.250000 Total energy: -853.633013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.633013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.433013 (E_RNA) where: Base-Base interactions energy: -470.020 where: short stacking energy: -195.976 Base-Backbone interact. energy: 2.842 local terms energy: -262.255007 where: bonds (distance) C4'-P energy: -48.487 bonds (distance) P-C4' energy: -59.216 flat angles C4'-P-C4' energy: -50.851 flat angles P-C4'-P energy: -46.092 tors. eta vs tors. theta energy: -57.610 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 181 Temperature: 1.300000 Total energy: -758.724887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.724887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.124887 (E_RNA) where: Base-Base interactions energy: -403.223 where: short stacking energy: -158.004 Base-Backbone interact. energy: 0.068 local terms energy: -225.969546 where: bonds (distance) C4'-P energy: -46.906 bonds (distance) P-C4' energy: -53.252 flat angles C4'-P-C4' energy: -48.982 flat angles P-C4'-P energy: -30.261 tors. eta vs tors. theta energy: -46.569 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 181 Temperature: 1.350000 Total energy: -647.741811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.741811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.741811 (E_RNA) where: Base-Base interactions energy: -339.117 where: short stacking energy: -130.040 Base-Backbone interact. energy: 0.710 local terms energy: -183.334114 where: bonds (distance) C4'-P energy: -44.596 bonds (distance) P-C4' energy: -46.579 flat angles C4'-P-C4' energy: -44.668 flat angles P-C4'-P energy: -31.151 tors. eta vs tors. theta energy: -16.339 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 182 Temperature: 0.900000 Total energy: -1088.085856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1088.085856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.885856 (E_RNA) where: Base-Base interactions energy: -653.366 where: short stacking energy: -269.905 Base-Backbone interact. energy: -0.453 local terms energy: -310.067417 where: bonds (distance) C4'-P energy: -58.209 bonds (distance) P-C4' energy: -57.007 flat angles C4'-P-C4' energy: -65.841 flat angles P-C4'-P energy: -47.691 tors. eta vs tors. theta energy: -81.319 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 182 Temperature: 0.950000 Total energy: -1045.265448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.265448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -917.465448 (E_RNA) where: Base-Base interactions energy: -635.474 where: short stacking energy: -248.597 Base-Backbone interact. energy: -2.231 local terms energy: -279.760740 where: bonds (distance) C4'-P energy: -51.906 bonds (distance) P-C4' energy: -53.586 flat angles C4'-P-C4' energy: -58.917 flat angles P-C4'-P energy: -37.305 tors. eta vs tors. theta energy: -78.047 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 182 Temperature: 1.000000 Total energy: -1038.264163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.264163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.464163 (E_RNA) where: Base-Base interactions energy: -639.842 where: short stacking energy: -282.926 Base-Backbone interact. energy: 0.418 local terms energy: -271.040419 where: bonds (distance) C4'-P energy: -52.235 bonds (distance) P-C4' energy: -43.625 flat angles C4'-P-C4' energy: -52.881 flat angles P-C4'-P energy: -35.566 tors. eta vs tors. theta energy: -86.733 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 182 Temperature: 1.050000 Total energy: -1002.467720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1002.467720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.467720 (E_RNA) where: Base-Base interactions energy: -585.761 where: short stacking energy: -256.081 Base-Backbone interact. energy: 1.382 local terms energy: -292.088297 where: bonds (distance) C4'-P energy: -62.161 bonds (distance) P-C4' energy: -48.382 flat angles C4'-P-C4' energy: -55.259 flat angles P-C4'-P energy: -45.255 tors. eta vs tors. theta energy: -81.033 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 182 Temperature: 1.100000 Total energy: -930.018329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -930.018329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.418329 (E_RNA) where: Base-Base interactions energy: -517.039 where: short stacking energy: -248.908 Base-Backbone interact. energy: -0.206 local terms energy: -283.173568 where: bonds (distance) C4'-P energy: -51.842 bonds (distance) P-C4' energy: -62.756 flat angles C4'-P-C4' energy: -60.784 flat angles P-C4'-P energy: -42.152 tors. eta vs tors. theta energy: -65.639 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 182 Temperature: 1.150000 Total energy: -889.150845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.150845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.550845 (E_RNA) where: Base-Base interactions energy: -492.864 where: short stacking energy: -224.283 Base-Backbone interact. energy: 0.787 local terms energy: -267.474320 where: bonds (distance) C4'-P energy: -54.441 bonds (distance) P-C4' energy: -52.413 flat angles C4'-P-C4' energy: -57.206 flat angles P-C4'-P energy: -40.058 tors. eta vs tors. theta energy: -63.357 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 182 Temperature: 1.200000 Total energy: -856.584248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.584248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.784248 (E_RNA) where: Base-Base interactions energy: -485.627 where: short stacking energy: -219.796 Base-Backbone interact. energy: -1.175 local terms energy: -241.982487 where: bonds (distance) C4'-P energy: -56.116 bonds (distance) P-C4' energy: -45.196 flat angles C4'-P-C4' energy: -53.469 flat angles P-C4'-P energy: -25.633 tors. eta vs tors. theta energy: -61.569 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 182 Temperature: 1.250000 Total energy: -850.880612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.880612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.280612 (E_RNA) where: Base-Base interactions energy: -484.851 where: short stacking energy: -209.237 Base-Backbone interact. energy: -1.040 local terms energy: -235.390153 where: bonds (distance) C4'-P energy: -43.163 bonds (distance) P-C4' energy: -51.658 flat angles C4'-P-C4' energy: -50.129 flat angles P-C4'-P energy: -35.149 tors. eta vs tors. theta energy: -55.291 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 182 Temperature: 1.300000 Total energy: -789.557218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.557218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.957218 (E_RNA) where: Base-Base interactions energy: -434.443 where: short stacking energy: -192.676 Base-Backbone interact. energy: 1.715 local terms energy: -227.229349 where: bonds (distance) C4'-P energy: -48.706 bonds (distance) P-C4' energy: -45.936 flat angles C4'-P-C4' energy: -48.524 flat angles P-C4'-P energy: -36.225 tors. eta vs tors. theta energy: -47.838 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 182 Temperature: 1.350000 Total energy: -673.928936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.928936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.728936 (E_RNA) where: Base-Base interactions energy: -345.751 where: short stacking energy: -131.250 Base-Backbone interact. energy: -0.418 local terms energy: -203.559174 where: bonds (distance) C4'-P energy: -44.078 bonds (distance) P-C4' energy: -48.475 flat angles C4'-P-C4' energy: -50.979 flat angles P-C4'-P energy: -32.618 tors. eta vs tors. theta energy: -27.409 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 183 Temperature: 0.900000 Total energy: -1077.533753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1077.533753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -947.933753 (E_RNA) where: Base-Base interactions energy: -647.220 where: short stacking energy: -273.462 Base-Backbone interact. energy: -0.761 local terms energy: -299.951981 where: bonds (distance) C4'-P energy: -55.199 bonds (distance) P-C4' energy: -63.303 flat angles C4'-P-C4' energy: -60.606 flat angles P-C4'-P energy: -41.711 tors. eta vs tors. theta energy: -79.133 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 183 Temperature: 0.950000 Total energy: -1060.898594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.898594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -933.098594 (E_RNA) where: Base-Base interactions energy: -644.879 where: short stacking energy: -252.372 Base-Backbone interact. energy: -1.906 local terms energy: -286.313095 where: bonds (distance) C4'-P energy: -49.562 bonds (distance) P-C4' energy: -55.474 flat angles C4'-P-C4' energy: -59.839 flat angles P-C4'-P energy: -46.945 tors. eta vs tors. theta energy: -74.493 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 183 Temperature: 1.000000 Total energy: -1041.257059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.257059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.657059 (E_RNA) where: Base-Base interactions energy: -615.979 where: short stacking energy: -260.427 Base-Backbone interact. energy: -0.162 local terms energy: -295.515167 where: bonds (distance) C4'-P energy: -57.021 bonds (distance) P-C4' energy: -56.939 flat angles C4'-P-C4' energy: -61.376 flat angles P-C4'-P energy: -43.368 tors. eta vs tors. theta energy: -76.812 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 183 Temperature: 1.050000 Total energy: -1020.484322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.484322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -894.484322 (E_RNA) where: Base-Base interactions energy: -594.649 where: short stacking energy: -272.463 Base-Backbone interact. energy: -1.082 local terms energy: -298.753896 where: bonds (distance) C4'-P energy: -51.050 bonds (distance) P-C4' energy: -55.261 flat angles C4'-P-C4' energy: -61.317 flat angles P-C4'-P energy: -45.371 tors. eta vs tors. theta energy: -85.755 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 183 Temperature: 1.100000 Total energy: -897.398055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.398055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.598055 (E_RNA) where: Base-Base interactions energy: -495.625 where: short stacking energy: -233.346 Base-Backbone interact. energy: 0.035 local terms energy: -274.007256 where: bonds (distance) C4'-P energy: -56.066 bonds (distance) P-C4' energy: -54.763 flat angles C4'-P-C4' energy: -61.262 flat angles P-C4'-P energy: -36.837 tors. eta vs tors. theta energy: -65.079 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 183 Temperature: 1.150000 Total energy: -881.098724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -881.098724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.498724 (E_RNA) where: Base-Base interactions energy: -487.310 where: short stacking energy: -227.804 Base-Backbone interact. energy: -0.149 local terms energy: -264.039901 where: bonds (distance) C4'-P energy: -53.799 bonds (distance) P-C4' energy: -53.454 flat angles C4'-P-C4' energy: -49.689 flat angles P-C4'-P energy: -35.711 tors. eta vs tors. theta energy: -71.387 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 183 Temperature: 1.200000 Total energy: -887.204833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.204833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.404833 (E_RNA) where: Base-Base interactions energy: -515.507 where: short stacking energy: -212.609 Base-Backbone interact. energy: -0.179 local terms energy: -243.718900 where: bonds (distance) C4'-P energy: -33.737 bonds (distance) P-C4' energy: -51.791 flat angles C4'-P-C4' energy: -56.190 flat angles P-C4'-P energy: -37.664 tors. eta vs tors. theta energy: -64.338 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 183 Temperature: 1.250000 Total energy: -818.034991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.034991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.034991 (E_RNA) where: Base-Base interactions energy: -442.760 where: short stacking energy: -192.472 Base-Backbone interact. energy: -0.589 local terms energy: -248.686537 where: bonds (distance) C4'-P energy: -54.714 bonds (distance) P-C4' energy: -45.199 flat angles C4'-P-C4' energy: -49.877 flat angles P-C4'-P energy: -43.877 tors. eta vs tors. theta energy: -55.019 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 183 Temperature: 1.300000 Total energy: -727.124621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.124621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.324621 (E_RNA) where: Base-Base interactions energy: -396.680 where: short stacking energy: -164.001 Base-Backbone interact. energy: 0.312 local terms energy: -202.957259 where: bonds (distance) C4'-P energy: -46.954 bonds (distance) P-C4' energy: -45.896 flat angles C4'-P-C4' energy: -44.786 flat angles P-C4'-P energy: -23.052 tors. eta vs tors. theta energy: -42.269 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 183 Temperature: 1.350000 Total energy: -647.409295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.409295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.009295 (E_RNA) where: Base-Base interactions energy: -352.675 where: short stacking energy: -146.627 Base-Backbone interact. energy: 0.835 local terms energy: -173.169565 where: bonds (distance) C4'-P energy: -35.090 bonds (distance) P-C4' energy: -40.159 flat angles C4'-P-C4' energy: -44.837 flat angles P-C4'-P energy: -22.776 tors. eta vs tors. theta energy: -30.308 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 184 Temperature: 0.900000 Total energy: -1095.189150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.189150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -965.589150 (E_RNA) where: Base-Base interactions energy: -661.708 where: short stacking energy: -288.395 Base-Backbone interact. energy: 1.407 local terms energy: -305.287681 where: bonds (distance) C4'-P energy: -57.706 bonds (distance) P-C4' energy: -59.954 flat angles C4'-P-C4' energy: -59.868 flat angles P-C4'-P energy: -42.128 tors. eta vs tors. theta energy: -85.631 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 184 Temperature: 0.950000 Total energy: -1060.571563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.571563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -934.571563 (E_RNA) where: Base-Base interactions energy: -632.194 where: short stacking energy: -242.813 Base-Backbone interact. energy: -2.146 local terms energy: -300.230865 where: bonds (distance) C4'-P energy: -66.383 bonds (distance) P-C4' energy: -49.507 flat angles C4'-P-C4' energy: -65.299 flat angles P-C4'-P energy: -43.922 tors. eta vs tors. theta energy: -75.119 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 184 Temperature: 1.000000 Total energy: -1031.180504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.180504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -903.380504 (E_RNA) where: Base-Base interactions energy: -608.701 where: short stacking energy: -259.601 Base-Backbone interact. energy: -1.122 local terms energy: -293.557576 where: bonds (distance) C4'-P energy: -56.790 bonds (distance) P-C4' energy: -62.204 flat angles C4'-P-C4' energy: -51.975 flat angles P-C4'-P energy: -42.388 tors. eta vs tors. theta energy: -80.199 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 184 Temperature: 1.050000 Total energy: -1009.292546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.292546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.492546 (E_RNA) where: Base-Base interactions energy: -598.266 where: short stacking energy: -249.308 Base-Backbone interact. energy: 1.685 local terms energy: -284.911608 where: bonds (distance) C4'-P energy: -51.771 bonds (distance) P-C4' energy: -47.632 flat angles C4'-P-C4' energy: -60.996 flat angles P-C4'-P energy: -39.356 tors. eta vs tors. theta energy: -85.157 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 184 Temperature: 1.100000 Total energy: -912.327996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -912.327996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.727996 (E_RNA) where: Base-Base interactions energy: -526.213 where: short stacking energy: -238.328 Base-Backbone interact. energy: 0.546 local terms energy: -257.061591 where: bonds (distance) C4'-P energy: -48.095 bonds (distance) P-C4' energy: -48.024 flat angles C4'-P-C4' energy: -62.045 flat angles P-C4'-P energy: -23.357 tors. eta vs tors. theta energy: -75.541 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 184 Temperature: 1.150000 Total energy: -886.417023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -886.417023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.617023 (E_RNA) where: Base-Base interactions energy: -498.021 where: short stacking energy: -223.539 Base-Backbone interact. energy: -1.137 local terms energy: -259.459310 where: bonds (distance) C4'-P energy: -53.577 bonds (distance) P-C4' energy: -47.936 flat angles C4'-P-C4' energy: -59.312 flat angles P-C4'-P energy: -34.230 tors. eta vs tors. theta energy: -64.404 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 184 Temperature: 1.200000 Total energy: -867.403761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -867.403761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.403761 (E_RNA) where: Base-Base interactions energy: -505.271 where: short stacking energy: -221.273 Base-Backbone interact. energy: -0.341 local terms energy: -235.791723 where: bonds (distance) C4'-P energy: -40.484 bonds (distance) P-C4' energy: -54.321 flat angles C4'-P-C4' energy: -41.461 flat angles P-C4'-P energy: -35.139 tors. eta vs tors. theta energy: -64.387 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 184 Temperature: 1.250000 Total energy: -785.884286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.884286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.884286 (E_RNA) where: Base-Base interactions energy: -439.581 where: short stacking energy: -193.999 Base-Backbone interact. energy: 4.173 local terms energy: -224.476746 where: bonds (distance) C4'-P energy: -48.904 bonds (distance) P-C4' energy: -53.332 flat angles C4'-P-C4' energy: -51.256 flat angles P-C4'-P energy: -22.252 tors. eta vs tors. theta energy: -48.733 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 184 Temperature: 1.300000 Total energy: -703.356532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.356532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.356532 (E_RNA) where: Base-Base interactions energy: -368.152 where: short stacking energy: -153.287 Base-Backbone interact. energy: -0.132 local terms energy: -209.072732 where: bonds (distance) C4'-P energy: -38.926 bonds (distance) P-C4' energy: -52.965 flat angles C4'-P-C4' energy: -45.351 flat angles P-C4'-P energy: -28.158 tors. eta vs tors. theta energy: -43.673 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 184 Temperature: 1.350000 Total energy: -668.807757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.807757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.207757 (E_RNA) where: Base-Base interactions energy: -346.609 where: short stacking energy: -150.391 Base-Backbone interact. energy: 1.158 local terms energy: -193.757014 where: bonds (distance) C4'-P energy: -42.877 bonds (distance) P-C4' energy: -51.664 flat angles C4'-P-C4' energy: -48.442 flat angles P-C4'-P energy: -26.030 tors. eta vs tors. theta energy: -24.745 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 185 Temperature: 0.900000 Total energy: -1099.719878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1099.719878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -971.919878 (E_RNA) where: Base-Base interactions energy: -659.770 where: short stacking energy: -297.262 Base-Backbone interact. energy: -0.234 local terms energy: -311.916070 where: bonds (distance) C4'-P energy: -53.905 bonds (distance) P-C4' energy: -63.073 flat angles C4'-P-C4' energy: -60.365 flat angles P-C4'-P energy: -43.766 tors. eta vs tors. theta energy: -90.808 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 185 Temperature: 0.950000 Total energy: -1061.212287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.212287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -933.412287 (E_RNA) where: Base-Base interactions energy: -638.877 where: short stacking energy: -271.405 Base-Backbone interact. energy: -1.236 local terms energy: -293.299985 where: bonds (distance) C4'-P energy: -55.220 bonds (distance) P-C4' energy: -61.324 flat angles C4'-P-C4' energy: -57.579 flat angles P-C4'-P energy: -39.426 tors. eta vs tors. theta energy: -79.751 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 185 Temperature: 1.000000 Total energy: -1054.041482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1054.041482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.241482 (E_RNA) where: Base-Base interactions energy: -640.261 where: short stacking energy: -251.652 Base-Backbone interact. energy: -0.128 local terms energy: -285.851555 where: bonds (distance) C4'-P energy: -55.699 bonds (distance) P-C4' energy: -53.311 flat angles C4'-P-C4' energy: -61.244 flat angles P-C4'-P energy: -40.424 tors. eta vs tors. theta energy: -75.173 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 185 Temperature: 1.050000 Total energy: -1026.172562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.172562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -896.572562 (E_RNA) where: Base-Base interactions energy: -608.598 where: short stacking energy: -274.677 Base-Backbone interact. energy: -1.164 local terms energy: -286.811338 where: bonds (distance) C4'-P energy: -55.190 bonds (distance) P-C4' energy: -49.757 flat angles C4'-P-C4' energy: -53.492 flat angles P-C4'-P energy: -39.818 tors. eta vs tors. theta energy: -88.554 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 185 Temperature: 1.100000 Total energy: -913.754679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -913.754679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.554679 (E_RNA) where: Base-Base interactions energy: -516.544 where: short stacking energy: -234.564 Base-Backbone interact. energy: -1.067 local terms energy: -271.944085 where: bonds (distance) C4'-P energy: -52.214 bonds (distance) P-C4' energy: -51.670 flat angles C4'-P-C4' energy: -57.980 flat angles P-C4'-P energy: -41.729 tors. eta vs tors. theta energy: -68.351 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 185 Temperature: 1.150000 Total energy: -878.991452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.991452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.391452 (E_RNA) where: Base-Base interactions energy: -489.555 where: short stacking energy: -210.249 Base-Backbone interact. energy: -0.889 local terms energy: -258.947936 where: bonds (distance) C4'-P energy: -42.833 bonds (distance) P-C4' energy: -45.105 flat angles C4'-P-C4' energy: -64.200 flat angles P-C4'-P energy: -40.039 tors. eta vs tors. theta energy: -66.771 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 185 Temperature: 1.200000 Total energy: -862.883396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.883396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.083396 (E_RNA) where: Base-Base interactions energy: -486.478 where: short stacking energy: -210.619 Base-Backbone interact. energy: -0.361 local terms energy: -248.244574 where: bonds (distance) C4'-P energy: -53.847 bonds (distance) P-C4' energy: -44.224 flat angles C4'-P-C4' energy: -50.369 flat angles P-C4'-P energy: -37.097 tors. eta vs tors. theta energy: -62.707 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 185 Temperature: 1.250000 Total energy: -797.158597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.158597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.358597 (E_RNA) where: Base-Base interactions energy: -445.665 where: short stacking energy: -197.027 Base-Backbone interact. energy: 3.438 local terms energy: -227.131348 where: bonds (distance) C4'-P energy: -52.425 bonds (distance) P-C4' energy: -40.363 flat angles C4'-P-C4' energy: -52.887 flat angles P-C4'-P energy: -24.614 tors. eta vs tors. theta energy: -56.842 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 185 Temperature: 1.300000 Total energy: -658.975579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.975579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.575579 (E_RNA) where: Base-Base interactions energy: -348.000 where: short stacking energy: -131.770 Base-Backbone interact. energy: -1.854 local terms energy: -186.721243 where: bonds (distance) C4'-P energy: -55.565 bonds (distance) P-C4' energy: -38.452 flat angles C4'-P-C4' energy: -48.864 flat angles P-C4'-P energy: -26.979 tors. eta vs tors. theta energy: -16.862 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 185 Temperature: 1.350000 Total energy: -671.715967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.715967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.515967 (E_RNA) where: Base-Base interactions energy: -370.835 where: short stacking energy: -156.732 Base-Backbone interact. energy: 2.152 local terms energy: -178.832999 where: bonds (distance) C4'-P energy: -47.849 bonds (distance) P-C4' energy: -48.587 flat angles C4'-P-C4' energy: -35.087 flat angles P-C4'-P energy: -24.077 tors. eta vs tors. theta energy: -23.232 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 186 Temperature: 0.900000 Total energy: -1098.615604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1098.615604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -969.015604 (E_RNA) where: Base-Base interactions energy: -660.726 where: short stacking energy: -281.593 Base-Backbone interact. energy: 0.605 local terms energy: -308.894232 where: bonds (distance) C4'-P energy: -56.377 bonds (distance) P-C4' energy: -58.662 flat angles C4'-P-C4' energy: -67.264 flat angles P-C4'-P energy: -49.350 tors. eta vs tors. theta energy: -77.240 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 186 Temperature: 0.950000 Total energy: -1075.289665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1075.289665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.689665 (E_RNA) where: Base-Base interactions energy: -647.055 where: short stacking energy: -278.617 Base-Backbone interact. energy: -0.299 local terms energy: -298.335316 where: bonds (distance) C4'-P energy: -61.777 bonds (distance) P-C4' energy: -48.419 flat angles C4'-P-C4' energy: -59.967 flat angles P-C4'-P energy: -46.138 tors. eta vs tors. theta energy: -82.034 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 186 Temperature: 1.000000 Total energy: -1046.953703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1046.953703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.153703 (E_RNA) where: Base-Base interactions energy: -631.416 where: short stacking energy: -233.733 Base-Backbone interact. energy: -0.371 local terms energy: -287.366831 where: bonds (distance) C4'-P energy: -55.619 bonds (distance) P-C4' energy: -54.039 flat angles C4'-P-C4' energy: -57.964 flat angles P-C4'-P energy: -42.378 tors. eta vs tors. theta energy: -77.366 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 186 Temperature: 1.050000 Total energy: -1013.958189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1013.958189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.958189 (E_RNA) where: Base-Base interactions energy: -584.762 where: short stacking energy: -247.652 Base-Backbone interact. energy: -1.373 local terms energy: -301.823350 where: bonds (distance) C4'-P energy: -59.978 bonds (distance) P-C4' energy: -59.292 flat angles C4'-P-C4' energy: -63.476 flat angles P-C4'-P energy: -38.363 tors. eta vs tors. theta energy: -80.715 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 186 Temperature: 1.100000 Total energy: -880.711682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.711682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.911682 (E_RNA) where: Base-Base interactions energy: -493.152 where: short stacking energy: -202.050 Base-Backbone interact. energy: -1.014 local terms energy: -258.745750 where: bonds (distance) C4'-P energy: -49.214 bonds (distance) P-C4' energy: -56.530 flat angles C4'-P-C4' energy: -54.500 flat angles P-C4'-P energy: -36.011 tors. eta vs tors. theta energy: -62.490 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 186 Temperature: 1.150000 Total energy: -874.919979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -874.919979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.919979 (E_RNA) where: Base-Base interactions energy: -499.663 where: short stacking energy: -216.349 Base-Backbone interact. energy: -0.809 local terms energy: -248.447699 where: bonds (distance) C4'-P energy: -45.543 bonds (distance) P-C4' energy: -44.129 flat angles C4'-P-C4' energy: -58.270 flat angles P-C4'-P energy: -33.503 tors. eta vs tors. theta energy: -67.002 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 186 Temperature: 1.200000 Total energy: -824.583094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.583094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.583094 (E_RNA) where: Base-Base interactions energy: -452.632 where: short stacking energy: -186.085 Base-Backbone interact. energy: -0.482 local terms energy: -245.468613 where: bonds (distance) C4'-P energy: -47.168 bonds (distance) P-C4' energy: -58.437 flat angles C4'-P-C4' energy: -54.851 flat angles P-C4'-P energy: -28.755 tors. eta vs tors. theta energy: -56.257 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 186 Temperature: 1.250000 Total energy: -775.888961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.888961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.888961 (E_RNA) where: Base-Base interactions energy: -428.433 where: short stacking energy: -190.753 Base-Backbone interact. energy: -0.412 local terms energy: -230.044374 where: bonds (distance) C4'-P energy: -40.069 bonds (distance) P-C4' energy: -55.686 flat angles C4'-P-C4' energy: -56.352 flat angles P-C4'-P energy: -30.213 tors. eta vs tors. theta energy: -47.724 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 186 Temperature: 1.300000 Total energy: -683.812768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.812768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.012768 (E_RNA) where: Base-Base interactions energy: -365.890 where: short stacking energy: -141.512 Base-Backbone interact. energy: 0.199 local terms energy: -190.321695 where: bonds (distance) C4'-P energy: -47.100 bonds (distance) P-C4' energy: -47.916 flat angles C4'-P-C4' energy: -36.430 flat angles P-C4'-P energy: -27.583 tors. eta vs tors. theta energy: -31.292 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 186 Temperature: 1.350000 Total energy: -666.157157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.157157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.557157 (E_RNA) where: Base-Base interactions energy: -332.970 where: short stacking energy: -134.443 Base-Backbone interact. energy: -0.478 local terms energy: -212.109127 where: bonds (distance) C4'-P energy: -35.111 bonds (distance) P-C4' energy: -48.167 flat angles C4'-P-C4' energy: -53.954 flat angles P-C4'-P energy: -37.832 tors. eta vs tors. theta energy: -37.045 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 187 Temperature: 0.900000 Total energy: -1090.235627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1090.235627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.435627 (E_RNA) where: Base-Base interactions energy: -664.273 where: short stacking energy: -284.116 Base-Backbone interact. energy: -0.385 local terms energy: -297.777099 where: bonds (distance) C4'-P energy: -50.951 bonds (distance) P-C4' energy: -55.443 flat angles C4'-P-C4' energy: -65.910 flat angles P-C4'-P energy: -39.017 tors. eta vs tors. theta energy: -86.456 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 187 Temperature: 0.950000 Total energy: -1075.825252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1075.825252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -946.225252 (E_RNA) where: Base-Base interactions energy: -664.131 where: short stacking energy: -284.982 Base-Backbone interact. energy: -1.092 local terms energy: -281.001817 where: bonds (distance) C4'-P energy: -43.259 bonds (distance) P-C4' energy: -50.450 flat angles C4'-P-C4' energy: -63.503 flat angles P-C4'-P energy: -41.426 tors. eta vs tors. theta energy: -82.365 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 187 Temperature: 1.000000 Total energy: -1054.511947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1054.511947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.711947 (E_RNA) where: Base-Base interactions energy: -631.093 where: short stacking energy: -243.665 Base-Backbone interact. energy: -1.684 local terms energy: -293.934701 where: bonds (distance) C4'-P energy: -52.611 bonds (distance) P-C4' energy: -53.791 flat angles C4'-P-C4' energy: -62.735 flat angles P-C4'-P energy: -50.483 tors. eta vs tors. theta energy: -74.314 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 187 Temperature: 1.050000 Total energy: -1000.543455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1000.543455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.743455 (E_RNA) where: Base-Base interactions energy: -592.448 where: short stacking energy: -255.611 Base-Backbone interact. energy: -1.276 local terms energy: -279.018884 where: bonds (distance) C4'-P energy: -52.208 bonds (distance) P-C4' energy: -54.912 flat angles C4'-P-C4' energy: -53.649 flat angles P-C4'-P energy: -36.244 tors. eta vs tors. theta energy: -82.006 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 187 Temperature: 1.100000 Total energy: -894.003743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.003743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.203743 (E_RNA) where: Base-Base interactions energy: -513.998 where: short stacking energy: -237.010 Base-Backbone interact. energy: -0.441 local terms energy: -251.764625 where: bonds (distance) C4'-P energy: -53.791 bonds (distance) P-C4' energy: -49.607 flat angles C4'-P-C4' energy: -48.616 flat angles P-C4'-P energy: -33.014 tors. eta vs tors. theta energy: -66.737 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 187 Temperature: 1.150000 Total energy: -857.627225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -857.627225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.827225 (E_RNA) where: Base-Base interactions energy: -461.309 where: short stacking energy: -208.982 Base-Backbone interact. energy: 0.522 local terms energy: -269.039712 where: bonds (distance) C4'-P energy: -58.935 bonds (distance) P-C4' energy: -49.230 flat angles C4'-P-C4' energy: -49.730 flat angles P-C4'-P energy: -44.125 tors. eta vs tors. theta energy: -67.020 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 187 Temperature: 1.200000 Total energy: -881.127951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -881.127951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.327951 (E_RNA) where: Base-Base interactions energy: -500.474 where: short stacking energy: -236.024 Base-Backbone interact. energy: -0.336 local terms energy: -252.518551 where: bonds (distance) C4'-P energy: -50.257 bonds (distance) P-C4' energy: -49.521 flat angles C4'-P-C4' energy: -52.208 flat angles P-C4'-P energy: -29.967 tors. eta vs tors. theta energy: -70.566 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 187 Temperature: 1.250000 Total energy: -787.591041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -787.591041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.591041 (E_RNA) where: Base-Base interactions energy: -422.475 where: short stacking energy: -190.255 Base-Backbone interact. energy: -1.122 local terms energy: -237.994755 where: bonds (distance) C4'-P energy: -47.787 bonds (distance) P-C4' energy: -64.737 flat angles C4'-P-C4' energy: -47.366 flat angles P-C4'-P energy: -31.840 tors. eta vs tors. theta energy: -46.265 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 187 Temperature: 1.300000 Total energy: -704.461708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.461708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.861708 (E_RNA) where: Base-Base interactions energy: -371.646 where: short stacking energy: -144.987 Base-Backbone interact. energy: -1.387 local terms energy: -210.829376 where: bonds (distance) C4'-P energy: -51.066 bonds (distance) P-C4' energy: -49.334 flat angles C4'-P-C4' energy: -47.533 flat angles P-C4'-P energy: -29.602 tors. eta vs tors. theta energy: -33.294 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 187 Temperature: 1.350000 Total energy: -659.573818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.573818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.573818 (E_RNA) where: Base-Base interactions energy: -366.582 where: short stacking energy: -154.474 Base-Backbone interact. energy: -0.470 local terms energy: -166.521477 where: bonds (distance) C4'-P energy: -35.538 bonds (distance) P-C4' energy: -43.390 flat angles C4'-P-C4' energy: -36.820 flat angles P-C4'-P energy: -19.225 tors. eta vs tors. theta energy: -31.548 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 188 Temperature: 0.900000 Total energy: -1090.885983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1090.885983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.085983 (E_RNA) where: Base-Base interactions energy: -654.976 where: short stacking energy: -276.679 Base-Backbone interact. energy: 0.699 local terms energy: -308.809581 where: bonds (distance) C4'-P energy: -52.578 bonds (distance) P-C4' energy: -60.441 flat angles C4'-P-C4' energy: -65.163 flat angles P-C4'-P energy: -47.141 tors. eta vs tors. theta energy: -83.486 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 188 Temperature: 0.950000 Total energy: -1074.251731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1074.251731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -944.651731 (E_RNA) where: Base-Base interactions energy: -657.121 where: short stacking energy: -283.497 Base-Backbone interact. energy: -0.577 local terms energy: -286.953551 where: bonds (distance) C4'-P energy: -50.244 bonds (distance) P-C4' energy: -52.488 flat angles C4'-P-C4' energy: -57.345 flat angles P-C4'-P energy: -42.995 tors. eta vs tors. theta energy: -83.883 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 188 Temperature: 1.000000 Total energy: -1028.488350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1028.488350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -898.888350 (E_RNA) where: Base-Base interactions energy: -615.339 where: short stacking energy: -265.311 Base-Backbone interact. energy: -1.966 local terms energy: -281.583397 where: bonds (distance) C4'-P energy: -46.116 bonds (distance) P-C4' energy: -54.284 flat angles C4'-P-C4' energy: -63.935 flat angles P-C4'-P energy: -28.235 tors. eta vs tors. theta energy: -89.014 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 188 Temperature: 1.050000 Total energy: -1008.713303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.713303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.113303 (E_RNA) where: Base-Base interactions energy: -608.342 where: short stacking energy: -227.246 Base-Backbone interact. energy: -1.279 local terms energy: -269.492324 where: bonds (distance) C4'-P energy: -58.324 bonds (distance) P-C4' energy: -45.892 flat angles C4'-P-C4' energy: -55.299 flat angles P-C4'-P energy: -39.581 tors. eta vs tors. theta energy: -70.396 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 188 Temperature: 1.100000 Total energy: -927.206194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.206194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.406194 (E_RNA) where: Base-Base interactions energy: -524.169 where: short stacking energy: -236.555 Base-Backbone interact. energy: -0.520 local terms energy: -274.717027 where: bonds (distance) C4'-P energy: -47.752 bonds (distance) P-C4' energy: -54.689 flat angles C4'-P-C4' energy: -63.744 flat angles P-C4'-P energy: -32.507 tors. eta vs tors. theta energy: -76.025 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 188 Temperature: 1.150000 Total energy: -862.038804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.038804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.438804 (E_RNA) where: Base-Base interactions energy: -480.557 where: short stacking energy: -222.317 Base-Backbone interact. energy: 0.255 local terms energy: -252.136746 where: bonds (distance) C4'-P energy: -53.026 bonds (distance) P-C4' energy: -50.477 flat angles C4'-P-C4' energy: -45.629 flat angles P-C4'-P energy: -41.400 tors. eta vs tors. theta energy: -61.604 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 188 Temperature: 1.200000 Total energy: -836.824653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.824653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.824653 (E_RNA) where: Base-Base interactions energy: -478.737 where: short stacking energy: -196.840 Base-Backbone interact. energy: -0.187 local terms energy: -231.900754 where: bonds (distance) C4'-P energy: -42.037 bonds (distance) P-C4' energy: -56.336 flat angles C4'-P-C4' energy: -49.016 flat angles P-C4'-P energy: -30.418 tors. eta vs tors. theta energy: -54.093 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 188 Temperature: 1.250000 Total energy: -800.577364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.577364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.777364 (E_RNA) where: Base-Base interactions energy: -432.021 where: short stacking energy: -184.204 Base-Backbone interact. energy: -2.004 local terms energy: -238.752079 where: bonds (distance) C4'-P energy: -50.514 bonds (distance) P-C4' energy: -45.718 flat angles C4'-P-C4' energy: -57.159 flat angles P-C4'-P energy: -33.730 tors. eta vs tors. theta energy: -51.631 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 188 Temperature: 1.300000 Total energy: -703.124098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.124098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.124098 (E_RNA) where: Base-Base interactions energy: -375.380 where: short stacking energy: -154.845 Base-Backbone interact. energy: -0.544 local terms energy: -201.199961 where: bonds (distance) C4'-P energy: -40.025 bonds (distance) P-C4' energy: -49.284 flat angles C4'-P-C4' energy: -56.394 flat angles P-C4'-P energy: -21.900 tors. eta vs tors. theta energy: -33.597 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 188 Temperature: 1.350000 Total energy: -744.070666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.070666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.870666 (E_RNA) where: Base-Base interactions energy: -399.473 where: short stacking energy: -160.222 Base-Backbone interact. energy: -0.160 local terms energy: -220.237207 where: bonds (distance) C4'-P energy: -36.612 bonds (distance) P-C4' energy: -57.573 flat angles C4'-P-C4' energy: -50.065 flat angles P-C4'-P energy: -36.999 tors. eta vs tors. theta energy: -38.988 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 189 Temperature: 0.900000 Total energy: -1092.023581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1092.023581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.023581 (E_RNA) where: Base-Base interactions energy: -663.292 where: short stacking energy: -272.572 Base-Backbone interact. energy: -1.489 local terms energy: -301.243005 where: bonds (distance) C4'-P energy: -51.861 bonds (distance) P-C4' energy: -53.757 flat angles C4'-P-C4' energy: -69.294 flat angles P-C4'-P energy: -49.632 tors. eta vs tors. theta energy: -76.699 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 189 Temperature: 0.950000 Total energy: -1050.984575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1050.984575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.984575 (E_RNA) where: Base-Base interactions energy: -632.085 where: short stacking energy: -279.966 Base-Backbone interact. energy: 3.158 local terms energy: -296.057424 where: bonds (distance) C4'-P energy: -59.487 bonds (distance) P-C4' energy: -41.830 flat angles C4'-P-C4' energy: -66.630 flat angles P-C4'-P energy: -43.779 tors. eta vs tors. theta energy: -84.332 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 189 Temperature: 1.000000 Total energy: -1059.828407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.828407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -932.028407 (E_RNA) where: Base-Base interactions energy: -638.667 where: short stacking energy: -276.069 Base-Backbone interact. energy: -0.247 local terms energy: -293.114612 where: bonds (distance) C4'-P energy: -53.042 bonds (distance) P-C4' energy: -60.190 flat angles C4'-P-C4' energy: -58.124 flat angles P-C4'-P energy: -40.871 tors. eta vs tors. theta energy: -80.888 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 189 Temperature: 1.050000 Total energy: -931.035024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -931.035024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -801.435024 (E_RNA) where: Base-Base interactions energy: -539.954 where: short stacking energy: -238.883 Base-Backbone interact. energy: -1.322 local terms energy: -260.158550 where: bonds (distance) C4'-P energy: -46.527 bonds (distance) P-C4' energy: -53.852 flat angles C4'-P-C4' energy: -61.755 flat angles P-C4'-P energy: -32.009 tors. eta vs tors. theta energy: -66.017 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 189 Temperature: 1.100000 Total energy: -965.113375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.113375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.313375 (E_RNA) where: Base-Base interactions energy: -569.528 where: short stacking energy: -216.342 Base-Backbone interact. energy: -1.096 local terms energy: -266.689649 where: bonds (distance) C4'-P energy: -45.330 bonds (distance) P-C4' energy: -57.188 flat angles C4'-P-C4' energy: -56.638 flat angles P-C4'-P energy: -44.255 tors. eta vs tors. theta energy: -63.279 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 189 Temperature: 1.150000 Total energy: -834.455197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.455197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.855197 (E_RNA) where: Base-Base interactions energy: -467.693 where: short stacking energy: -213.914 Base-Backbone interact. energy: -0.742 local terms energy: -236.420007 where: bonds (distance) C4'-P energy: -33.199 bonds (distance) P-C4' energy: -48.083 flat angles C4'-P-C4' energy: -56.169 flat angles P-C4'-P energy: -38.344 tors. eta vs tors. theta energy: -60.625 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 189 Temperature: 1.200000 Total energy: -835.500847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.500847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.900847 (E_RNA) where: Base-Base interactions energy: -462.461 where: short stacking energy: -204.655 Base-Backbone interact. energy: -0.937 local terms energy: -242.502396 where: bonds (distance) C4'-P energy: -59.761 bonds (distance) P-C4' energy: -39.044 flat angles C4'-P-C4' energy: -45.774 flat angles P-C4'-P energy: -43.477 tors. eta vs tors. theta energy: -54.447 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 189 Temperature: 1.250000 Total energy: -785.678914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.678914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.878914 (E_RNA) where: Base-Base interactions energy: -425.883 where: short stacking energy: -190.968 Base-Backbone interact. energy: -0.188 local terms energy: -231.808067 where: bonds (distance) C4'-P energy: -47.562 bonds (distance) P-C4' energy: -54.893 flat angles C4'-P-C4' energy: -40.946 flat angles P-C4'-P energy: -31.357 tors. eta vs tors. theta energy: -57.050 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 189 Temperature: 1.300000 Total energy: -733.068582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -733.068582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.268582 (E_RNA) where: Base-Base interactions energy: -405.277 where: short stacking energy: -174.600 Base-Backbone interact. energy: 0.576 local terms energy: -200.567709 where: bonds (distance) C4'-P energy: -48.862 bonds (distance) P-C4' energy: -39.245 flat angles C4'-P-C4' energy: -48.639 flat angles P-C4'-P energy: -27.851 tors. eta vs tors. theta energy: -35.971 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 189 Temperature: 1.350000 Total energy: -756.669447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.669447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.469448 (E_RNA) where: Base-Base interactions energy: -408.443 where: short stacking energy: -174.275 Base-Backbone interact. energy: 0.585 local terms energy: -224.611100 where: bonds (distance) C4'-P energy: -39.812 bonds (distance) P-C4' energy: -50.583 flat angles C4'-P-C4' energy: -43.028 flat angles P-C4'-P energy: -39.911 tors. eta vs tors. theta energy: -51.277 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 190 Temperature: 0.900000 Total energy: -1087.875079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.875079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.275079 (E_RNA) where: Base-Base interactions energy: -658.637 where: short stacking energy: -287.929 Base-Backbone interact. energy: -0.495 local terms energy: -299.142716 where: bonds (distance) C4'-P energy: -54.044 bonds (distance) P-C4' energy: -60.960 flat angles C4'-P-C4' energy: -61.353 flat angles P-C4'-P energy: -32.627 tors. eta vs tors. theta energy: -90.159 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 190 Temperature: 0.950000 Total energy: -1071.690274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1071.690274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -943.890274 (E_RNA) where: Base-Base interactions energy: -636.814 where: short stacking energy: -277.797 Base-Backbone interact. energy: -1.462 local terms energy: -305.614886 where: bonds (distance) C4'-P energy: -52.368 bonds (distance) P-C4' energy: -54.700 flat angles C4'-P-C4' energy: -68.122 flat angles P-C4'-P energy: -42.826 tors. eta vs tors. theta energy: -87.599 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 190 Temperature: 1.000000 Total energy: -1057.387593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.387593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.387593 (E_RNA) where: Base-Base interactions energy: -639.996 where: short stacking energy: -283.375 Base-Backbone interact. energy: -0.440 local terms energy: -290.952245 where: bonds (distance) C4'-P energy: -47.696 bonds (distance) P-C4' energy: -53.172 flat angles C4'-P-C4' energy: -67.101 flat angles P-C4'-P energy: -37.193 tors. eta vs tors. theta energy: -85.790 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 190 Temperature: 1.050000 Total energy: -918.522592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -918.522592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.722592 (E_RNA) where: Base-Base interactions energy: -532.292 where: short stacking energy: -238.436 Base-Backbone interact. energy: -0.297 local terms energy: -258.134269 where: bonds (distance) C4'-P energy: -46.453 bonds (distance) P-C4' energy: -50.878 flat angles C4'-P-C4' energy: -55.509 flat angles P-C4'-P energy: -37.537 tors. eta vs tors. theta energy: -67.757 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 190 Temperature: 1.100000 Total energy: -995.914699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -995.914699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.314699 (E_RNA) where: Base-Base interactions energy: -599.199 where: short stacking energy: -218.589 Base-Backbone interact. energy: -1.086 local terms energy: -266.030022 where: bonds (distance) C4'-P energy: -46.215 bonds (distance) P-C4' energy: -62.985 flat angles C4'-P-C4' energy: -56.067 flat angles P-C4'-P energy: -36.037 tors. eta vs tors. theta energy: -64.727 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 190 Temperature: 1.150000 Total energy: -860.230872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.230872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.430872 (E_RNA) where: Base-Base interactions energy: -489.003 where: short stacking energy: -218.171 Base-Backbone interact. energy: -1.551 local terms energy: -241.876054 where: bonds (distance) C4'-P energy: -45.019 bonds (distance) P-C4' energy: -44.578 flat angles C4'-P-C4' energy: -57.416 flat angles P-C4'-P energy: -42.820 tors. eta vs tors. theta energy: -52.042 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 190 Temperature: 1.200000 Total energy: -822.370993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.370993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.570993 (E_RNA) where: Base-Base interactions energy: -442.943 where: short stacking energy: -184.247 Base-Backbone interact. energy: -0.855 local terms energy: -250.772974 where: bonds (distance) C4'-P energy: -47.216 bonds (distance) P-C4' energy: -52.153 flat angles C4'-P-C4' energy: -57.515 flat angles P-C4'-P energy: -43.222 tors. eta vs tors. theta energy: -50.667 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 190 Temperature: 1.250000 Total energy: -816.700267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -816.700267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.500267 (E_RNA) where: Base-Base interactions energy: -480.624 where: short stacking energy: -225.083 Base-Backbone interact. energy: 1.396 local terms energy: -213.271871 where: bonds (distance) C4'-P energy: -43.696 bonds (distance) P-C4' energy: -40.701 flat angles C4'-P-C4' energy: -42.204 flat angles P-C4'-P energy: -31.773 tors. eta vs tors. theta energy: -54.899 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 190 Temperature: 1.300000 Total energy: -711.329139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.329139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.129139 (E_RNA) where: Base-Base interactions energy: -390.952 where: short stacking energy: -151.634 Base-Backbone interact. energy: 1.809 local terms energy: -197.986048 where: bonds (distance) C4'-P energy: -47.423 bonds (distance) P-C4' energy: -48.353 flat angles C4'-P-C4' energy: -39.022 flat angles P-C4'-P energy: -27.122 tors. eta vs tors. theta energy: -36.066 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 190 Temperature: 1.350000 Total energy: -737.086625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.086625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.286625 (E_RNA) where: Base-Base interactions energy: -415.544 where: short stacking energy: -182.036 Base-Backbone interact. energy: 1.495 local terms energy: -195.237312 where: bonds (distance) C4'-P energy: -50.292 bonds (distance) P-C4' energy: -29.294 flat angles C4'-P-C4' energy: -29.722 flat angles P-C4'-P energy: -30.379 tors. eta vs tors. theta energy: -55.550 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 191 Temperature: 0.900000 Total energy: -1092.295838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1092.295838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.495838 (E_RNA) where: Base-Base interactions energy: -664.223 where: short stacking energy: -281.454 Base-Backbone interact. energy: -1.027 local terms energy: -299.246022 where: bonds (distance) C4'-P energy: -46.999 bonds (distance) P-C4' energy: -59.670 flat angles C4'-P-C4' energy: -59.917 flat angles P-C4'-P energy: -48.227 tors. eta vs tors. theta energy: -84.433 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 191 Temperature: 0.950000 Total energy: -1062.835660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1062.835660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -936.835660 (E_RNA) where: Base-Base interactions energy: -637.191 where: short stacking energy: -273.706 Base-Backbone interact. energy: 0.387 local terms energy: -300.032240 where: bonds (distance) C4'-P energy: -57.106 bonds (distance) P-C4' energy: -58.121 flat angles C4'-P-C4' energy: -59.986 flat angles P-C4'-P energy: -44.900 tors. eta vs tors. theta energy: -79.920 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 191 Temperature: 1.000000 Total energy: -1061.123141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.123141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.523141 (E_RNA) where: Base-Base interactions energy: -641.509 where: short stacking energy: -284.599 Base-Backbone interact. energy: -0.489 local terms energy: -289.525075 where: bonds (distance) C4'-P energy: -52.191 bonds (distance) P-C4' energy: -47.175 flat angles C4'-P-C4' energy: -60.146 flat angles P-C4'-P energy: -39.036 tors. eta vs tors. theta energy: -90.977 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 191 Temperature: 1.050000 Total energy: -1023.600813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.600813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.600813 (E_RNA) where: Base-Base interactions energy: -612.781 where: short stacking energy: -234.368 Base-Backbone interact. energy: 1.700 local terms energy: -286.519529 where: bonds (distance) C4'-P energy: -49.290 bonds (distance) P-C4' energy: -52.885 flat angles C4'-P-C4' energy: -63.108 flat angles P-C4'-P energy: -46.819 tors. eta vs tors. theta energy: -74.418 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 191 Temperature: 1.100000 Total energy: -910.618582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -910.618582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -781.018582 (E_RNA) where: Base-Base interactions energy: -534.631 where: short stacking energy: -229.924 Base-Backbone interact. energy: -1.532 local terms energy: -244.855505 where: bonds (distance) C4'-P energy: -47.307 bonds (distance) P-C4' energy: -40.224 flat angles C4'-P-C4' energy: -49.395 flat angles P-C4'-P energy: -33.835 tors. eta vs tors. theta energy: -74.094 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 191 Temperature: 1.150000 Total energy: -850.786892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.786892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.186892 (E_RNA) where: Base-Base interactions energy: -463.201 where: short stacking energy: -198.031 Base-Backbone interact. energy: -0.808 local terms energy: -257.177494 where: bonds (distance) C4'-P energy: -44.582 bonds (distance) P-C4' energy: -58.150 flat angles C4'-P-C4' energy: -53.003 flat angles P-C4'-P energy: -37.983 tors. eta vs tors. theta energy: -63.460 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 191 Temperature: 1.200000 Total energy: -858.470620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.470620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.670620 (E_RNA) where: Base-Base interactions energy: -490.627 where: short stacking energy: -211.379 Base-Backbone interact. energy: 3.511 local terms energy: -243.553842 where: bonds (distance) C4'-P energy: -52.882 bonds (distance) P-C4' energy: -40.623 flat angles C4'-P-C4' energy: -56.542 flat angles P-C4'-P energy: -43.358 tors. eta vs tors. theta energy: -50.149 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 191 Temperature: 1.250000 Total energy: -832.461335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.461335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.461335 (E_RNA) where: Base-Base interactions energy: -454.466 where: short stacking energy: -209.790 Base-Backbone interact. energy: -0.349 local terms energy: -251.646886 where: bonds (distance) C4'-P energy: -51.181 bonds (distance) P-C4' energy: -41.088 flat angles C4'-P-C4' energy: -56.649 flat angles P-C4'-P energy: -46.743 tors. eta vs tors. theta energy: -55.986 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 191 Temperature: 1.300000 Total energy: -718.137214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.137214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.737214 (E_RNA) where: Base-Base interactions energy: -380.030 where: short stacking energy: -167.133 Base-Backbone interact. energy: 0.212 local terms energy: -215.918686 where: bonds (distance) C4'-P energy: -41.806 bonds (distance) P-C4' energy: -48.570 flat angles C4'-P-C4' energy: -54.467 flat angles P-C4'-P energy: -30.723 tors. eta vs tors. theta energy: -40.352 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 191 Temperature: 1.350000 Total energy: -769.893965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.893965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.893965 (E_RNA) where: Base-Base interactions energy: -418.623 where: short stacking energy: -167.750 Base-Backbone interact. energy: -1.024 local terms energy: -224.246443 where: bonds (distance) C4'-P energy: -43.925 bonds (distance) P-C4' energy: -42.181 flat angles C4'-P-C4' energy: -60.853 flat angles P-C4'-P energy: -37.070 tors. eta vs tors. theta energy: -40.218 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 192 Temperature: 0.900000 Total energy: -1102.898997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.898997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.098997 (E_RNA) where: Base-Base interactions energy: -667.289 where: short stacking energy: -278.517 Base-Backbone interact. energy: -1.521 local terms energy: -306.289185 where: bonds (distance) C4'-P energy: -53.026 bonds (distance) P-C4' energy: -52.384 flat angles C4'-P-C4' energy: -68.367 flat angles P-C4'-P energy: -44.295 tors. eta vs tors. theta energy: -88.217 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 192 Temperature: 0.950000 Total energy: -1062.284544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1062.284544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -934.484544 (E_RNA) where: Base-Base interactions energy: -630.136 where: short stacking energy: -285.274 Base-Backbone interact. energy: -0.828 local terms energy: -303.519941 where: bonds (distance) C4'-P energy: -48.197 bonds (distance) P-C4' energy: -52.688 flat angles C4'-P-C4' energy: -63.537 flat angles P-C4'-P energy: -43.571 tors. eta vs tors. theta energy: -95.526 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 192 Temperature: 1.000000 Total energy: -1053.593912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.593912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.993912 (E_RNA) where: Base-Base interactions energy: -618.663 where: short stacking energy: -277.780 Base-Backbone interact. energy: -1.098 local terms energy: -304.232769 where: bonds (distance) C4'-P energy: -56.094 bonds (distance) P-C4' energy: -58.605 flat angles C4'-P-C4' energy: -64.150 flat angles P-C4'-P energy: -40.954 tors. eta vs tors. theta energy: -84.429 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 192 Temperature: 1.050000 Total energy: -1026.183672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.183672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -896.583672 (E_RNA) where: Base-Base interactions energy: -626.874 where: short stacking energy: -241.974 Base-Backbone interact. energy: 1.046 local terms energy: -270.755671 where: bonds (distance) C4'-P energy: -45.069 bonds (distance) P-C4' energy: -62.080 flat angles C4'-P-C4' energy: -54.249 flat angles P-C4'-P energy: -39.331 tors. eta vs tors. theta energy: -70.027 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 192 Temperature: 1.100000 Total energy: -901.050514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -901.050514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.050514 (E_RNA) where: Base-Base interactions energy: -516.582 where: short stacking energy: -214.003 Base-Backbone interact. energy: -0.080 local terms energy: -258.388906 where: bonds (distance) C4'-P energy: -55.145 bonds (distance) P-C4' energy: -52.135 flat angles C4'-P-C4' energy: -49.893 flat angles P-C4'-P energy: -38.626 tors. eta vs tors. theta energy: -62.590 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 192 Temperature: 1.150000 Total energy: -865.622506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -865.622506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.422506 (E_RNA) where: Base-Base interactions energy: -492.875 where: short stacking energy: -223.640 Base-Backbone interact. energy: -0.663 local terms energy: -247.884049 where: bonds (distance) C4'-P energy: -44.254 bonds (distance) P-C4' energy: -52.227 flat angles C4'-P-C4' energy: -56.448 flat angles P-C4'-P energy: -35.554 tors. eta vs tors. theta energy: -59.400 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 192 Temperature: 1.200000 Total energy: -821.134585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -821.134585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.134585 (E_RNA) where: Base-Base interactions energy: -445.522 where: short stacking energy: -201.653 Base-Backbone interact. energy: -1.668 local terms energy: -247.944657 where: bonds (distance) C4'-P energy: -51.936 bonds (distance) P-C4' energy: -51.036 flat angles C4'-P-C4' energy: -58.182 flat angles P-C4'-P energy: -34.225 tors. eta vs tors. theta energy: -52.565 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 192 Temperature: 1.250000 Total energy: -784.425920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.425920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.625920 (E_RNA) where: Base-Base interactions energy: -438.855 where: short stacking energy: -202.159 Base-Backbone interact. energy: 0.235 local terms energy: -218.006055 where: bonds (distance) C4'-P energy: -47.221 bonds (distance) P-C4' energy: -36.812 flat angles C4'-P-C4' energy: -49.564 flat angles P-C4'-P energy: -23.314 tors. eta vs tors. theta energy: -61.094 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 192 Temperature: 1.300000 Total energy: -786.276996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.276996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.676996 (E_RNA) where: Base-Base interactions energy: -432.048 where: short stacking energy: -188.683 Base-Backbone interact. energy: 0.287 local terms energy: -224.916270 where: bonds (distance) C4'-P energy: -44.809 bonds (distance) P-C4' energy: -47.727 flat angles C4'-P-C4' energy: -47.955 flat angles P-C4'-P energy: -25.547 tors. eta vs tors. theta energy: -58.879 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 192 Temperature: 1.350000 Total energy: -688.294898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.294898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.094898 (E_RNA) where: Base-Base interactions energy: -354.776 where: short stacking energy: -143.962 Base-Backbone interact. energy: -0.819 local terms energy: -208.499504 where: bonds (distance) C4'-P energy: -46.754 bonds (distance) P-C4' energy: -36.223 flat angles C4'-P-C4' energy: -54.741 flat angles P-C4'-P energy: -28.535 tors. eta vs tors. theta energy: -42.247 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 193 Temperature: 0.900000 Total energy: -1098.325755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1098.325755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -968.725755 (E_RNA) where: Base-Base interactions energy: -667.579 where: short stacking energy: -283.175 Base-Backbone interact. energy: -0.955 local terms energy: -300.192605 where: bonds (distance) C4'-P energy: -56.041 bonds (distance) P-C4' energy: -57.265 flat angles C4'-P-C4' energy: -54.904 flat angles P-C4'-P energy: -50.118 tors. eta vs tors. theta energy: -81.864 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 193 Temperature: 0.950000 Total energy: -1062.396212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1062.396212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -934.596212 (E_RNA) where: Base-Base interactions energy: -629.000 where: short stacking energy: -281.992 Base-Backbone interact. energy: -0.414 local terms energy: -305.182096 where: bonds (distance) C4'-P energy: -44.284 bonds (distance) P-C4' energy: -59.956 flat angles C4'-P-C4' energy: -61.992 flat angles P-C4'-P energy: -44.901 tors. eta vs tors. theta energy: -94.050 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 193 Temperature: 1.000000 Total energy: -1035.216036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.216036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.616036 (E_RNA) where: Base-Base interactions energy: -621.983 where: short stacking energy: -261.020 Base-Backbone interact. energy: -0.697 local terms energy: -282.935877 where: bonds (distance) C4'-P energy: -52.377 bonds (distance) P-C4' energy: -48.202 flat angles C4'-P-C4' energy: -68.000 flat angles P-C4'-P energy: -35.050 tors. eta vs tors. theta energy: -79.308 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 193 Temperature: 1.050000 Total energy: -1031.318833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.318833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -903.518833 (E_RNA) where: Base-Base interactions energy: -624.806 where: short stacking energy: -254.026 Base-Backbone interact. energy: -1.713 local terms energy: -277.000146 where: bonds (distance) C4'-P energy: -47.979 bonds (distance) P-C4' energy: -47.122 flat angles C4'-P-C4' energy: -60.569 flat angles P-C4'-P energy: -46.466 tors. eta vs tors. theta energy: -74.864 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 193 Temperature: 1.100000 Total energy: -925.958577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -925.958577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -798.158577 (E_RNA) where: Base-Base interactions energy: -554.341 where: short stacking energy: -246.748 Base-Backbone interact. energy: -0.981 local terms energy: -242.836847 where: bonds (distance) C4'-P energy: -36.921 bonds (distance) P-C4' energy: -44.785 flat angles C4'-P-C4' energy: -54.712 flat angles P-C4'-P energy: -34.879 tors. eta vs tors. theta energy: -71.540 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 193 Temperature: 1.150000 Total energy: -850.695861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.695861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.895861 (E_RNA) where: Base-Base interactions energy: -478.315 where: short stacking energy: -205.568 Base-Backbone interact. energy: -0.548 local terms energy: -244.032336 where: bonds (distance) C4'-P energy: -51.899 bonds (distance) P-C4' energy: -48.194 flat angles C4'-P-C4' energy: -55.262 flat angles P-C4'-P energy: -30.748 tors. eta vs tors. theta energy: -57.928 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 193 Temperature: 1.200000 Total energy: -841.177954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.177954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.777954 (E_RNA) where: Base-Base interactions energy: -478.753 where: short stacking energy: -195.228 Base-Backbone interact. energy: -0.022 local terms energy: -240.002857 where: bonds (distance) C4'-P energy: -49.019 bonds (distance) P-C4' energy: -46.413 flat angles C4'-P-C4' energy: -55.592 flat angles P-C4'-P energy: -33.477 tors. eta vs tors. theta energy: -55.501 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 193 Temperature: 1.250000 Total energy: -800.385476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.385476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.185476 (E_RNA) where: Base-Base interactions energy: -441.244 where: short stacking energy: -187.202 Base-Backbone interact. energy: 0.222 local terms energy: -235.163698 where: bonds (distance) C4'-P energy: -54.037 bonds (distance) P-C4' energy: -41.293 flat angles C4'-P-C4' energy: -54.121 flat angles P-C4'-P energy: -37.196 tors. eta vs tors. theta energy: -48.516 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 193 Temperature: 1.300000 Total energy: -806.890549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.890549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.690549 (E_RNA) where: Base-Base interactions energy: -437.378 where: short stacking energy: -200.310 Base-Backbone interact. energy: -0.421 local terms energy: -244.891952 where: bonds (distance) C4'-P energy: -54.037 bonds (distance) P-C4' energy: -51.620 flat angles C4'-P-C4' energy: -54.904 flat angles P-C4'-P energy: -23.947 tors. eta vs tors. theta energy: -60.383 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 193 Temperature: 1.350000 Total energy: -674.356507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.356507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.156507 (E_RNA) where: Base-Base interactions energy: -359.827 where: short stacking energy: -141.923 Base-Backbone interact. energy: -0.506 local terms energy: -189.823327 where: bonds (distance) C4'-P energy: -40.297 bonds (distance) P-C4' energy: -46.866 flat angles C4'-P-C4' energy: -44.148 flat angles P-C4'-P energy: -30.824 tors. eta vs tors. theta energy: -27.690 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 194 Temperature: 0.900000 Total energy: -1099.339305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1099.339305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -969.739305 (E_RNA) where: Base-Base interactions energy: -662.307 where: short stacking energy: -285.348 Base-Backbone interact. energy: -1.915 local terms energy: -305.517123 where: bonds (distance) C4'-P energy: -57.109 bonds (distance) P-C4' energy: -58.810 flat angles C4'-P-C4' energy: -57.611 flat angles P-C4'-P energy: -47.634 tors. eta vs tors. theta energy: -84.352 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 194 Temperature: 0.950000 Total energy: -1062.983496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1062.983496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -933.383496 (E_RNA) where: Base-Base interactions energy: -642.641 where: short stacking energy: -283.486 Base-Backbone interact. energy: 0.367 local terms energy: -291.109310 where: bonds (distance) C4'-P energy: -46.803 bonds (distance) P-C4' energy: -48.811 flat angles C4'-P-C4' energy: -67.373 flat angles P-C4'-P energy: -40.165 tors. eta vs tors. theta energy: -87.957 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 194 Temperature: 1.000000 Total energy: -1027.685667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1027.685667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -898.085667 (E_RNA) where: Base-Base interactions energy: -612.465 where: short stacking energy: -243.518 Base-Backbone interact. energy: 0.688 local terms energy: -286.308163 where: bonds (distance) C4'-P energy: -56.563 bonds (distance) P-C4' energy: -53.342 flat angles C4'-P-C4' energy: -52.370 flat angles P-C4'-P energy: -51.480 tors. eta vs tors. theta energy: -72.553 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 194 Temperature: 1.050000 Total energy: -1017.935523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1017.935523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -893.735523 (E_RNA) where: Base-Base interactions energy: -584.491 where: short stacking energy: -264.247 Base-Backbone interact. energy: 2.023 local terms energy: -311.268005 where: bonds (distance) C4'-P energy: -62.458 bonds (distance) P-C4' energy: -55.530 flat angles C4'-P-C4' energy: -58.810 flat angles P-C4'-P energy: -43.274 tors. eta vs tors. theta energy: -91.195 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 194 Temperature: 1.100000 Total energy: -910.409098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -910.409098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.409098 (E_RNA) where: Base-Base interactions energy: -506.996 where: short stacking energy: -229.427 Base-Backbone interact. energy: 0.904 local terms energy: -278.317788 where: bonds (distance) C4'-P energy: -51.883 bonds (distance) P-C4' energy: -55.247 flat angles C4'-P-C4' energy: -59.602 flat angles P-C4'-P energy: -41.638 tors. eta vs tors. theta energy: -69.949 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 194 Temperature: 1.150000 Total energy: -876.502576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -876.502576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.902576 (E_RNA) where: Base-Base interactions energy: -490.722 where: short stacking energy: -237.930 Base-Backbone interact. energy: -0.899 local terms energy: -264.281214 where: bonds (distance) C4'-P energy: -43.732 bonds (distance) P-C4' energy: -59.763 flat angles C4'-P-C4' energy: -55.165 flat angles P-C4'-P energy: -39.097 tors. eta vs tors. theta energy: -66.524 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 194 Temperature: 1.200000 Total energy: -857.691641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -857.691641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.691641 (E_RNA) where: Base-Base interactions energy: -482.387 where: short stacking energy: -217.361 Base-Backbone interact. energy: -1.374 local terms energy: -247.931338 where: bonds (distance) C4'-P energy: -46.878 bonds (distance) P-C4' energy: -49.729 flat angles C4'-P-C4' energy: -48.876 flat angles P-C4'-P energy: -39.914 tors. eta vs tors. theta energy: -62.534 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 194 Temperature: 1.250000 Total energy: -822.765652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.765652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.765652 (E_RNA) where: Base-Base interactions energy: -465.568 where: short stacking energy: -190.173 Base-Backbone interact. energy: -1.332 local terms energy: -229.865532 where: bonds (distance) C4'-P energy: -44.129 bonds (distance) P-C4' energy: -47.310 flat angles C4'-P-C4' energy: -56.544 flat angles P-C4'-P energy: -32.849 tors. eta vs tors. theta energy: -49.033 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 194 Temperature: 1.300000 Total energy: -765.297843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.297843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.497843 (E_RNA) where: Base-Base interactions energy: -413.854 where: short stacking energy: -167.075 Base-Backbone interact. energy: -0.633 local terms energy: -223.011283 where: bonds (distance) C4'-P energy: -50.231 bonds (distance) P-C4' energy: -47.673 flat angles C4'-P-C4' energy: -52.230 flat angles P-C4'-P energy: -30.008 tors. eta vs tors. theta energy: -42.870 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 194 Temperature: 1.350000 Total energy: -739.601331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -739.601331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.001331 (E_RNA) where: Base-Base interactions energy: -383.484 where: short stacking energy: -159.620 Base-Backbone interact. energy: 1.507 local terms energy: -228.023863 where: bonds (distance) C4'-P energy: -45.181 bonds (distance) P-C4' energy: -46.053 flat angles C4'-P-C4' energy: -49.042 flat angles P-C4'-P energy: -35.974 tors. eta vs tors. theta energy: -51.773 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 195 Temperature: 0.900000 Total energy: -1072.186922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1072.186922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -942.586922 (E_RNA) where: Base-Base interactions energy: -647.018 where: short stacking energy: -268.768 Base-Backbone interact. energy: 1.139 local terms energy: -296.707931 where: bonds (distance) C4'-P energy: -49.678 bonds (distance) P-C4' energy: -54.763 flat angles C4'-P-C4' energy: -60.959 flat angles P-C4'-P energy: -50.082 tors. eta vs tors. theta energy: -81.226 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 195 Temperature: 0.950000 Total energy: -1030.960654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1030.960654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -904.960654 (E_RNA) where: Base-Base interactions energy: -615.808 where: short stacking energy: -274.375 Base-Backbone interact. energy: -1.266 local terms energy: -287.887104 where: bonds (distance) C4'-P energy: -55.053 bonds (distance) P-C4' energy: -59.456 flat angles C4'-P-C4' energy: -54.932 flat angles P-C4'-P energy: -31.941 tors. eta vs tors. theta energy: -86.505 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 195 Temperature: 1.000000 Total energy: -1024.231750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1024.231750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -894.631750 (E_RNA) where: Base-Base interactions energy: -632.179 where: short stacking energy: -236.355 Base-Backbone interact. energy: -1.760 local terms energy: -260.692525 where: bonds (distance) C4'-P energy: -51.767 bonds (distance) P-C4' energy: -38.136 flat angles C4'-P-C4' energy: -60.433 flat angles P-C4'-P energy: -38.027 tors. eta vs tors. theta energy: -72.330 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 195 Temperature: 1.050000 Total energy: -927.346308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.346308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.746308 (E_RNA) where: Base-Base interactions energy: -543.344 where: short stacking energy: -242.991 Base-Backbone interact. energy: 0.062 local terms energy: -254.463580 where: bonds (distance) C4'-P energy: -42.576 bonds (distance) P-C4' energy: -45.072 flat angles C4'-P-C4' energy: -60.653 flat angles P-C4'-P energy: -34.360 tors. eta vs tors. theta energy: -71.802 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 195 Temperature: 1.100000 Total energy: -1009.271859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.271859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.671859 (E_RNA) where: Base-Base interactions energy: -604.447 where: short stacking energy: -256.231 Base-Backbone interact. energy: -0.340 local terms energy: -274.884524 where: bonds (distance) C4'-P energy: -44.438 bonds (distance) P-C4' energy: -51.235 flat angles C4'-P-C4' energy: -55.641 flat angles P-C4'-P energy: -38.917 tors. eta vs tors. theta energy: -84.654 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 195 Temperature: 1.150000 Total energy: -861.947231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -861.947231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.147231 (E_RNA) where: Base-Base interactions energy: -485.505 where: short stacking energy: -216.354 Base-Backbone interact. energy: -0.625 local terms energy: -248.017223 where: bonds (distance) C4'-P energy: -51.701 bonds (distance) P-C4' energy: -46.932 flat angles C4'-P-C4' energy: -51.516 flat angles P-C4'-P energy: -41.016 tors. eta vs tors. theta energy: -56.852 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 195 Temperature: 1.200000 Total energy: -858.500293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.500293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.700293 (E_RNA) where: Base-Base interactions energy: -474.955 where: short stacking energy: -217.307 Base-Backbone interact. energy: -0.776 local terms energy: -254.970142 where: bonds (distance) C4'-P energy: -54.095 bonds (distance) P-C4' energy: -60.189 flat angles C4'-P-C4' energy: -54.781 flat angles P-C4'-P energy: -26.452 tors. eta vs tors. theta energy: -59.453 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 195 Temperature: 1.250000 Total energy: -820.879516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.879516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.079516 (E_RNA) where: Base-Base interactions energy: -460.245 where: short stacking energy: -181.745 Base-Backbone interact. energy: -0.817 local terms energy: -232.018298 where: bonds (distance) C4'-P energy: -41.690 bonds (distance) P-C4' energy: -62.232 flat angles C4'-P-C4' energy: -46.302 flat angles P-C4'-P energy: -36.019 tors. eta vs tors. theta energy: -45.774 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 195 Temperature: 1.300000 Total energy: -737.781100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.781100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.181100 (E_RNA) where: Base-Base interactions energy: -390.551 where: short stacking energy: -156.841 Base-Backbone interact. energy: -1.510 local terms energy: -216.120272 where: bonds (distance) C4'-P energy: -42.064 bonds (distance) P-C4' energy: -46.276 flat angles C4'-P-C4' energy: -45.222 flat angles P-C4'-P energy: -36.926 tors. eta vs tors. theta energy: -45.633 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 195 Temperature: 1.350000 Total energy: -689.031555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.031555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.231555 (E_RNA) where: Base-Base interactions energy: -372.538 where: short stacking energy: -147.890 Base-Backbone interact. energy: 0.982 local terms energy: -198.675913 where: bonds (distance) C4'-P energy: -39.280 bonds (distance) P-C4' energy: -37.473 flat angles C4'-P-C4' energy: -39.170 flat angles P-C4'-P energy: -41.450 tors. eta vs tors. theta energy: -41.303 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 196 Temperature: 0.900000 Total energy: -1063.818580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.818580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.618580 (E_RNA) where: Base-Base interactions energy: -620.678 where: short stacking energy: -268.152 Base-Backbone interact. energy: -0.595 local terms energy: -318.345895 where: bonds (distance) C4'-P energy: -54.793 bonds (distance) P-C4' energy: -58.503 flat angles C4'-P-C4' energy: -65.867 flat angles P-C4'-P energy: -48.635 tors. eta vs tors. theta energy: -90.548 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 196 Temperature: 0.950000 Total energy: -1068.147535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.147535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.347535 (E_RNA) where: Base-Base interactions energy: -635.581 where: short stacking energy: -288.019 Base-Backbone interact. energy: -1.919 local terms energy: -302.847994 where: bonds (distance) C4'-P energy: -59.117 bonds (distance) P-C4' energy: -46.018 flat angles C4'-P-C4' energy: -61.439 flat angles P-C4'-P energy: -46.484 tors. eta vs tors. theta energy: -89.791 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 196 Temperature: 1.000000 Total energy: -1010.240192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.240192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.440192 (E_RNA) where: Base-Base interactions energy: -589.003 where: short stacking energy: -235.762 Base-Backbone interact. energy: -0.583 local terms energy: -292.854185 where: bonds (distance) C4'-P energy: -55.318 bonds (distance) P-C4' energy: -60.772 flat angles C4'-P-C4' energy: -60.261 flat angles P-C4'-P energy: -42.862 tors. eta vs tors. theta energy: -73.641 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 196 Temperature: 1.050000 Total energy: -910.874000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -910.874000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -781.274000 (E_RNA) where: Base-Base interactions energy: -503.983 where: short stacking energy: -228.247 Base-Backbone interact. energy: -1.124 local terms energy: -276.166852 where: bonds (distance) C4'-P energy: -50.577 bonds (distance) P-C4' energy: -61.121 flat angles C4'-P-C4' energy: -59.083 flat angles P-C4'-P energy: -39.908 tors. eta vs tors. theta energy: -65.479 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 196 Temperature: 1.100000 Total energy: -989.307325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.307325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.707325 (E_RNA) where: Base-Base interactions energy: -582.036 where: short stacking energy: -251.224 Base-Backbone interact. energy: -0.676 local terms energy: -276.994614 where: bonds (distance) C4'-P energy: -47.660 bonds (distance) P-C4' energy: -54.779 flat angles C4'-P-C4' energy: -60.022 flat angles P-C4'-P energy: -36.826 tors. eta vs tors. theta energy: -77.707 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 196 Temperature: 1.150000 Total energy: -858.038185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.038185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.038185 (E_RNA) where: Base-Base interactions energy: -475.357 where: short stacking energy: -215.885 Base-Backbone interact. energy: -1.199 local terms energy: -264.482506 where: bonds (distance) C4'-P energy: -44.941 bonds (distance) P-C4' energy: -61.631 flat angles C4'-P-C4' energy: -50.791 flat angles P-C4'-P energy: -41.928 tors. eta vs tors. theta energy: -65.191 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 196 Temperature: 1.200000 Total energy: -850.443338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.443338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.443338 (E_RNA) where: Base-Base interactions energy: -480.986 where: short stacking energy: -217.996 Base-Backbone interact. energy: 0.510 local terms energy: -243.967726 where: bonds (distance) C4'-P energy: -35.175 bonds (distance) P-C4' energy: -54.376 flat angles C4'-P-C4' energy: -55.770 flat angles P-C4'-P energy: -45.392 tors. eta vs tors. theta energy: -53.255 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 196 Temperature: 1.250000 Total energy: -830.536785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -830.536785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.736785 (E_RNA) where: Base-Base interactions energy: -462.898 where: short stacking energy: -189.168 Base-Backbone interact. energy: 0.448 local terms energy: -240.286705 where: bonds (distance) C4'-P energy: -44.814 bonds (distance) P-C4' energy: -53.883 flat angles C4'-P-C4' energy: -58.755 flat angles P-C4'-P energy: -33.542 tors. eta vs tors. theta energy: -49.292 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 196 Temperature: 1.300000 Total energy: -771.228262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.228262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.828262 (E_RNA) where: Base-Base interactions energy: -424.479 where: short stacking energy: -188.111 Base-Backbone interact. energy: -1.308 local terms energy: -223.041584 where: bonds (distance) C4'-P energy: -46.773 bonds (distance) P-C4' energy: -49.117 flat angles C4'-P-C4' energy: -49.994 flat angles P-C4'-P energy: -28.324 tors. eta vs tors. theta energy: -48.834 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 196 Temperature: 1.350000 Total energy: -686.852873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.852873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.852873 (E_RNA) where: Base-Base interactions energy: -354.789 where: short stacking energy: -158.247 Base-Backbone interact. energy: -0.868 local terms energy: -205.196008 where: bonds (distance) C4'-P energy: -46.273 bonds (distance) P-C4' energy: -48.687 flat angles C4'-P-C4' energy: -45.305 flat angles P-C4'-P energy: -33.971 tors. eta vs tors. theta energy: -30.960 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 197 Temperature: 0.900000 Total energy: -1090.927297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1090.927297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.327297 (E_RNA) where: Base-Base interactions energy: -644.178 where: short stacking energy: -274.748 Base-Backbone interact. energy: -1.840 local terms energy: -315.308760 where: bonds (distance) C4'-P energy: -61.663 bonds (distance) P-C4' energy: -58.207 flat angles C4'-P-C4' energy: -64.135 flat angles P-C4'-P energy: -41.908 tors. eta vs tors. theta energy: -89.395 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 197 Temperature: 0.950000 Total energy: -1069.154581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.154581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.554581 (E_RNA) where: Base-Base interactions energy: -640.850 where: short stacking energy: -285.017 Base-Backbone interact. energy: -0.012 local terms energy: -298.691670 where: bonds (distance) C4'-P energy: -51.907 bonds (distance) P-C4' energy: -54.724 flat angles C4'-P-C4' energy: -59.053 flat angles P-C4'-P energy: -43.186 tors. eta vs tors. theta energy: -89.822 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 197 Temperature: 1.000000 Total energy: -1008.952300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.952300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.352300 (E_RNA) where: Base-Base interactions energy: -601.784 where: short stacking energy: -241.630 Base-Backbone interact. energy: -0.673 local terms energy: -276.895615 where: bonds (distance) C4'-P energy: -58.945 bonds (distance) P-C4' energy: -57.635 flat angles C4'-P-C4' energy: -55.432 flat angles P-C4'-P energy: -42.152 tors. eta vs tors. theta energy: -62.731 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 197 Temperature: 1.050000 Total energy: -993.888702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -993.888702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -869.688702 (E_RNA) where: Base-Base interactions energy: -595.343 where: short stacking energy: -251.265 Base-Backbone interact. energy: -0.420 local terms energy: -273.926623 where: bonds (distance) C4'-P energy: -49.110 bonds (distance) P-C4' energy: -57.726 flat angles C4'-P-C4' energy: -60.223 flat angles P-C4'-P energy: -34.695 tors. eta vs tors. theta energy: -72.172 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 197 Temperature: 1.100000 Total energy: -898.074581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.074581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.474581 (E_RNA) where: Base-Base interactions energy: -495.427 where: short stacking energy: -231.673 Base-Backbone interact. energy: -1.321 local terms energy: -271.726990 where: bonds (distance) C4'-P energy: -60.773 bonds (distance) P-C4' energy: -45.947 flat angles C4'-P-C4' energy: -59.013 flat angles P-C4'-P energy: -42.074 tors. eta vs tors. theta energy: -63.919 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 197 Temperature: 1.150000 Total energy: -878.269928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.269928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.669928 (E_RNA) where: Base-Base interactions energy: -486.198 where: short stacking energy: -224.257 Base-Backbone interact. energy: -1.476 local terms energy: -260.995570 where: bonds (distance) C4'-P energy: -58.545 bonds (distance) P-C4' energy: -50.264 flat angles C4'-P-C4' energy: -54.304 flat angles P-C4'-P energy: -29.395 tors. eta vs tors. theta energy: -68.488 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 197 Temperature: 1.200000 Total energy: -849.617677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.617677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.417677 (E_RNA) where: Base-Base interactions energy: -456.272 where: short stacking energy: -206.171 Base-Backbone interact. energy: -2.016 local terms energy: -267.129611 where: bonds (distance) C4'-P energy: -55.871 bonds (distance) P-C4' energy: -51.432 flat angles C4'-P-C4' energy: -58.156 flat angles P-C4'-P energy: -37.582 tors. eta vs tors. theta energy: -64.089 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 197 Temperature: 1.250000 Total energy: -810.245170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.245170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.045170 (E_RNA) where: Base-Base interactions energy: -450.950 where: short stacking energy: -206.057 Base-Backbone interact. energy: -0.608 local terms energy: -234.487057 where: bonds (distance) C4'-P energy: -44.462 bonds (distance) P-C4' energy: -51.529 flat angles C4'-P-C4' energy: -58.074 flat angles P-C4'-P energy: -30.798 tors. eta vs tors. theta energy: -49.624 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 197 Temperature: 1.300000 Total energy: -760.373016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -760.373016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.173016 (E_RNA) where: Base-Base interactions energy: -424.261 where: short stacking energy: -186.457 Base-Backbone interact. energy: 1.676 local terms energy: -213.587637 where: bonds (distance) C4'-P energy: -40.009 bonds (distance) P-C4' energy: -51.959 flat angles C4'-P-C4' energy: -38.840 flat angles P-C4'-P energy: -31.302 tors. eta vs tors. theta energy: -51.477 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 197 Temperature: 1.350000 Total energy: -701.639555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.639555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.839555 (E_RNA) where: Base-Base interactions energy: -347.639 where: short stacking energy: -140.288 Base-Backbone interact. energy: -0.967 local terms energy: -225.233888 where: bonds (distance) C4'-P energy: -50.533 bonds (distance) P-C4' energy: -50.875 flat angles C4'-P-C4' energy: -59.386 flat angles P-C4'-P energy: -26.440 tors. eta vs tors. theta energy: -38.000 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 198 Temperature: 0.900000 Total energy: -1082.907924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1082.907924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.107924 (E_RNA) where: Base-Base interactions energy: -665.516 where: short stacking energy: -286.339 Base-Backbone interact. energy: 1.200 local terms energy: -290.791991 where: bonds (distance) C4'-P energy: -46.897 bonds (distance) P-C4' energy: -55.453 flat angles C4'-P-C4' energy: -60.203 flat angles P-C4'-P energy: -38.862 tors. eta vs tors. theta energy: -89.378 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 198 Temperature: 0.950000 Total energy: -1074.696502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1074.696502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.096502 (E_RNA) where: Base-Base interactions energy: -643.530 where: short stacking energy: -280.652 Base-Backbone interact. energy: -1.045 local terms energy: -300.521888 where: bonds (distance) C4'-P energy: -53.193 bonds (distance) P-C4' energy: -54.826 flat angles C4'-P-C4' energy: -61.794 flat angles P-C4'-P energy: -44.494 tors. eta vs tors. theta energy: -86.214 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 198 Temperature: 1.000000 Total energy: -1029.855900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1029.855900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -903.855900 (E_RNA) where: Base-Base interactions energy: -611.504 where: short stacking energy: -273.634 Base-Backbone interact. energy: -0.794 local terms energy: -291.557540 where: bonds (distance) C4'-P energy: -49.165 bonds (distance) P-C4' energy: -56.635 flat angles C4'-P-C4' energy: -57.503 flat angles P-C4'-P energy: -43.812 tors. eta vs tors. theta energy: -84.442 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 198 Temperature: 1.050000 Total energy: -1009.600115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.600115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.800115 (E_RNA) where: Base-Base interactions energy: -599.132 where: short stacking energy: -232.224 Base-Backbone interact. energy: 0.913 local terms energy: -283.580583 where: bonds (distance) C4'-P energy: -57.075 bonds (distance) P-C4' energy: -53.891 flat angles C4'-P-C4' energy: -56.222 flat angles P-C4'-P energy: -44.595 tors. eta vs tors. theta energy: -71.798 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 198 Temperature: 1.100000 Total energy: -896.963451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.963451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.363451 (E_RNA) where: Base-Base interactions energy: -510.841 where: short stacking energy: -214.734 Base-Backbone interact. energy: -1.662 local terms energy: -254.860743 where: bonds (distance) C4'-P energy: -38.861 bonds (distance) P-C4' energy: -50.178 flat angles C4'-P-C4' energy: -61.847 flat angles P-C4'-P energy: -35.233 tors. eta vs tors. theta energy: -68.742 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 198 Temperature: 1.150000 Total energy: -849.773855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.773855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.773856 (E_RNA) where: Base-Base interactions energy: -470.130 where: short stacking energy: -203.544 Base-Backbone interact. energy: 0.678 local terms energy: -254.321734 where: bonds (distance) C4'-P energy: -41.221 bonds (distance) P-C4' energy: -54.553 flat angles C4'-P-C4' energy: -62.936 flat angles P-C4'-P energy: -35.957 tors. eta vs tors. theta energy: -59.656 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 198 Temperature: 1.200000 Total energy: -836.531086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.531086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.731086 (E_RNA) where: Base-Base interactions energy: -460.737 where: short stacking energy: -199.827 Base-Backbone interact. energy: -0.726 local terms energy: -247.267965 where: bonds (distance) C4'-P energy: -51.879 bonds (distance) P-C4' energy: -45.641 flat angles C4'-P-C4' energy: -56.079 flat angles P-C4'-P energy: -29.630 tors. eta vs tors. theta energy: -64.038 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 198 Temperature: 1.250000 Total energy: -814.088132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.088132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.288132 (E_RNA) where: Base-Base interactions energy: -446.694 where: short stacking energy: -196.065 Base-Backbone interact. energy: -0.461 local terms energy: -239.132830 where: bonds (distance) C4'-P energy: -35.371 bonds (distance) P-C4' energy: -61.958 flat angles C4'-P-C4' energy: -45.861 flat angles P-C4'-P energy: -34.779 tors. eta vs tors. theta energy: -61.164 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 198 Temperature: 1.300000 Total energy: -725.826166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.826166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.626166 (E_RNA) where: Base-Base interactions energy: -386.353 where: short stacking energy: -186.907 Base-Backbone interact. energy: -1.540 local terms energy: -222.733373 where: bonds (distance) C4'-P energy: -43.500 bonds (distance) P-C4' energy: -55.954 flat angles C4'-P-C4' energy: -48.713 flat angles P-C4'-P energy: -33.856 tors. eta vs tors. theta energy: -40.711 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 198 Temperature: 1.350000 Total energy: -674.646597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.646597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.046597 (E_RNA) where: Base-Base interactions energy: -355.748 where: short stacking energy: -144.690 Base-Backbone interact. energy: -1.225 local terms energy: -197.073688 where: bonds (distance) C4'-P energy: -41.219 bonds (distance) P-C4' energy: -53.226 flat angles C4'-P-C4' energy: -37.601 flat angles P-C4'-P energy: -30.686 tors. eta vs tors. theta energy: -34.341 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 199 Temperature: 0.900000 Total energy: -1074.667270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1074.667270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.067270 (E_RNA) where: Base-Base interactions energy: -645.257 where: short stacking energy: -284.472 Base-Backbone interact. energy: -1.121 local terms energy: -298.689377 where: bonds (distance) C4'-P energy: -54.542 bonds (distance) P-C4' energy: -56.041 flat angles C4'-P-C4' energy: -66.623 flat angles P-C4'-P energy: -35.687 tors. eta vs tors. theta energy: -85.796 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 199 Temperature: 0.950000 Total energy: -1080.524495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1080.524495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -954.524495 (E_RNA) where: Base-Base interactions energy: -641.227 where: short stacking energy: -274.926 Base-Backbone interact. energy: -0.455 local terms energy: -312.841987 where: bonds (distance) C4'-P energy: -49.551 bonds (distance) P-C4' energy: -63.497 flat angles C4'-P-C4' energy: -65.111 flat angles P-C4'-P energy: -46.976 tors. eta vs tors. theta energy: -87.707 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 199 Temperature: 1.000000 Total energy: -1055.707209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.707209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.907209 (E_RNA) where: Base-Base interactions energy: -626.626 where: short stacking energy: -261.020 Base-Backbone interact. energy: -0.538 local terms energy: -300.743545 where: bonds (distance) C4'-P energy: -56.068 bonds (distance) P-C4' energy: -60.672 flat angles C4'-P-C4' energy: -65.120 flat angles P-C4'-P energy: -38.803 tors. eta vs tors. theta energy: -80.079 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 199 Temperature: 1.050000 Total energy: -1005.219763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.219763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -875.619763 (E_RNA) where: Base-Base interactions energy: -597.994 where: short stacking energy: -229.583 Base-Backbone interact. energy: -0.781 local terms energy: -276.844419 where: bonds (distance) C4'-P energy: -46.477 bonds (distance) P-C4' energy: -51.391 flat angles C4'-P-C4' energy: -58.889 flat angles P-C4'-P energy: -38.852 tors. eta vs tors. theta energy: -81.235 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 199 Temperature: 1.100000 Total energy: -861.704712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -861.704712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.704712 (E_RNA) where: Base-Base interactions energy: -480.367 where: short stacking energy: -225.221 Base-Backbone interact. energy: 1.432 local terms energy: -256.769004 where: bonds (distance) C4'-P energy: -51.150 bonds (distance) P-C4' energy: -49.365 flat angles C4'-P-C4' energy: -58.885 flat angles P-C4'-P energy: -44.458 tors. eta vs tors. theta energy: -52.912 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 199 Temperature: 1.150000 Total energy: -886.375793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -886.375793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.775793 (E_RNA) where: Base-Base interactions energy: -498.309 where: short stacking energy: -213.655 Base-Backbone interact. energy: -0.823 local terms energy: -257.644529 where: bonds (distance) C4'-P energy: -48.967 bonds (distance) P-C4' energy: -53.961 flat angles C4'-P-C4' energy: -54.963 flat angles P-C4'-P energy: -35.633 tors. eta vs tors. theta energy: -64.120 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 199 Temperature: 1.200000 Total energy: -845.242340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.242340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.642340 (E_RNA) where: Base-Base interactions energy: -472.692 where: short stacking energy: -208.605 Base-Backbone interact. energy: -0.711 local terms energy: -242.238638 where: bonds (distance) C4'-P energy: -56.818 bonds (distance) P-C4' energy: -49.864 flat angles C4'-P-C4' energy: -49.680 flat angles P-C4'-P energy: -29.602 tors. eta vs tors. theta energy: -56.275 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 199 Temperature: 1.250000 Total energy: -806.775790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.775790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.975790 (E_RNA) where: Base-Base interactions energy: -453.843 where: short stacking energy: -172.537 Base-Backbone interact. energy: -1.927 local terms energy: -223.205276 where: bonds (distance) C4'-P energy: -39.752 bonds (distance) P-C4' energy: -46.844 flat angles C4'-P-C4' energy: -46.562 flat angles P-C4'-P energy: -40.043 tors. eta vs tors. theta energy: -50.004 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 199 Temperature: 1.300000 Total energy: -704.713423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.713423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.713423 (E_RNA) where: Base-Base interactions energy: -382.299 where: short stacking energy: -143.949 Base-Backbone interact. energy: -0.407 local terms energy: -196.007405 where: bonds (distance) C4'-P energy: -41.436 bonds (distance) P-C4' energy: -52.896 flat angles C4'-P-C4' energy: -41.346 flat angles P-C4'-P energy: -24.834 tors. eta vs tors. theta energy: -35.496 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 199 Temperature: 1.350000 Total energy: -672.722776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.722776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.122776 (E_RNA) where: Base-Base interactions energy: -356.152 where: short stacking energy: -144.824 Base-Backbone interact. energy: 1.418 local terms energy: -188.388423 where: bonds (distance) C4'-P energy: -46.395 bonds (distance) P-C4' energy: -56.031 flat angles C4'-P-C4' energy: -37.448 flat angles P-C4'-P energy: -23.261 tors. eta vs tors. theta energy: -25.253 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 200 Temperature: 0.900000 Total energy: -1097.501508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1097.501508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -969.701508 (E_RNA) where: Base-Base interactions energy: -662.638 where: short stacking energy: -278.623 Base-Backbone interact. energy: -1.245 local terms energy: -305.818253 where: bonds (distance) C4'-P energy: -52.308 bonds (distance) P-C4' energy: -58.540 flat angles C4'-P-C4' energy: -66.338 flat angles P-C4'-P energy: -47.661 tors. eta vs tors. theta energy: -80.972 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 200 Temperature: 0.950000 Total energy: -1046.001255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1046.001255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -916.401255 (E_RNA) where: Base-Base interactions energy: -619.771 where: short stacking energy: -267.131 Base-Backbone interact. energy: -0.273 local terms energy: -296.357585 where: bonds (distance) C4'-P energy: -51.022 bonds (distance) P-C4' energy: -57.740 flat angles C4'-P-C4' energy: -66.341 flat angles P-C4'-P energy: -45.754 tors. eta vs tors. theta energy: -75.500 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 200 Temperature: 1.000000 Total energy: -1058.150869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.150869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.350869 (E_RNA) where: Base-Base interactions energy: -629.857 where: short stacking energy: -270.658 Base-Backbone interact. energy: -1.751 local terms energy: -298.743209 where: bonds (distance) C4'-P energy: -58.439 bonds (distance) P-C4' energy: -54.653 flat angles C4'-P-C4' energy: -59.778 flat angles P-C4'-P energy: -38.500 tors. eta vs tors. theta energy: -87.373 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 200 Temperature: 1.050000 Total energy: -994.311911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.311911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -868.311911 (E_RNA) where: Base-Base interactions energy: -596.842 where: short stacking energy: -227.544 Base-Backbone interact. energy: -1.217 local terms energy: -270.252806 where: bonds (distance) C4'-P energy: -45.873 bonds (distance) P-C4' energy: -50.956 flat angles C4'-P-C4' energy: -59.344 flat angles P-C4'-P energy: -40.589 tors. eta vs tors. theta energy: -73.490 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 200 Temperature: 1.100000 Total energy: -922.018233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.018233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -792.418233 (E_RNA) where: Base-Base interactions energy: -523.047 where: short stacking energy: -231.906 Base-Backbone interact. energy: 2.585 local terms energy: -271.956063 where: bonds (distance) C4'-P energy: -53.224 bonds (distance) P-C4' energy: -51.770 flat angles C4'-P-C4' energy: -58.577 flat angles P-C4'-P energy: -42.170 tors. eta vs tors. theta energy: -66.215 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 200 Temperature: 1.150000 Total energy: -860.182509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.182509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.382509 (E_RNA) where: Base-Base interactions energy: -484.009 where: short stacking energy: -198.720 Base-Backbone interact. energy: -1.188 local terms energy: -247.185612 where: bonds (distance) C4'-P energy: -54.885 bonds (distance) P-C4' energy: -55.953 flat angles C4'-P-C4' energy: -51.295 flat angles P-C4'-P energy: -30.844 tors. eta vs tors. theta energy: -54.208 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 200 Temperature: 1.200000 Total energy: -815.373883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.373883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.773883 (E_RNA) where: Base-Base interactions energy: -448.771 where: short stacking energy: -201.917 Base-Backbone interact. energy: 0.820 local terms energy: -237.823177 where: bonds (distance) C4'-P energy: -51.920 bonds (distance) P-C4' energy: -47.353 flat angles C4'-P-C4' energy: -50.358 flat angles P-C4'-P energy: -29.320 tors. eta vs tors. theta energy: -58.872 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 200 Temperature: 1.250000 Total energy: -819.044077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.044077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.444077 (E_RNA) where: Base-Base interactions energy: -464.644 where: short stacking energy: -204.590 Base-Backbone interact. energy: 3.652 local terms energy: -228.452066 where: bonds (distance) C4'-P energy: -45.173 bonds (distance) P-C4' energy: -51.489 flat angles C4'-P-C4' energy: -48.747 flat angles P-C4'-P energy: -35.012 tors. eta vs tors. theta energy: -48.031 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 200 Temperature: 1.300000 Total energy: -685.180904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.180904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.980904 (E_RNA) where: Base-Base interactions energy: -369.177 where: short stacking energy: -150.285 Base-Backbone interact. energy: -1.183 local terms energy: -190.620381 where: bonds (distance) C4'-P energy: -38.123 bonds (distance) P-C4' energy: -55.905 flat angles C4'-P-C4' energy: -43.355 flat angles P-C4'-P energy: -23.028 tors. eta vs tors. theta energy: -30.209 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 200 Temperature: 1.350000 Total energy: -694.823342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.823342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.023342 (E_RNA) where: Base-Base interactions energy: -373.302 where: short stacking energy: -150.396 Base-Backbone interact. energy: 0.483 local terms energy: -194.203451 where: bonds (distance) C4'-P energy: -49.409 bonds (distance) P-C4' energy: -41.034 flat angles C4'-P-C4' energy: -57.255 flat angles P-C4'-P energy: -18.433 tors. eta vs tors. theta energy: -28.073 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 201 Temperature: 0.900000 Total energy: -1088.673523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1088.673523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.873523 (E_RNA) where: Base-Base interactions energy: -665.426 where: short stacking energy: -270.844 Base-Backbone interact. energy: -1.128 local terms energy: -294.319261 where: bonds (distance) C4'-P energy: -49.818 bonds (distance) P-C4' energy: -56.798 flat angles C4'-P-C4' energy: -66.208 flat angles P-C4'-P energy: -44.058 tors. eta vs tors. theta energy: -77.437 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 201 Temperature: 0.950000 Total energy: -1070.964729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1070.964729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -948.564729 (E_RNA) where: Base-Base interactions energy: -644.731 where: short stacking energy: -274.448 Base-Backbone interact. energy: 1.736 local terms energy: -305.570289 where: bonds (distance) C4'-P energy: -57.425 bonds (distance) P-C4' energy: -52.578 flat angles C4'-P-C4' energy: -63.383 flat angles P-C4'-P energy: -40.966 tors. eta vs tors. theta energy: -91.219 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 201 Temperature: 1.000000 Total energy: -1026.009546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.009546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -898.209546 (E_RNA) where: Base-Base interactions energy: -614.275 where: short stacking energy: -261.676 Base-Backbone interact. energy: -1.630 local terms energy: -282.304801 where: bonds (distance) C4'-P energy: -56.773 bonds (distance) P-C4' energy: -45.431 flat angles C4'-P-C4' energy: -47.374 flat angles P-C4'-P energy: -48.493 tors. eta vs tors. theta energy: -84.233 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 201 Temperature: 1.050000 Total energy: -1001.265648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.265648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -875.265648 (E_RNA) where: Base-Base interactions energy: -592.896 where: short stacking energy: -228.090 Base-Backbone interact. energy: -0.795 local terms energy: -281.574105 where: bonds (distance) C4'-P energy: -47.674 bonds (distance) P-C4' energy: -56.217 flat angles C4'-P-C4' energy: -62.230 flat angles P-C4'-P energy: -46.325 tors. eta vs tors. theta energy: -69.129 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 201 Temperature: 1.100000 Total energy: -907.385026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.385026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.585026 (E_RNA) where: Base-Base interactions energy: -532.280 where: short stacking energy: -235.942 Base-Backbone interact. energy: -1.058 local terms energy: -246.246756 where: bonds (distance) C4'-P energy: -40.078 bonds (distance) P-C4' energy: -47.791 flat angles C4'-P-C4' energy: -54.909 flat angles P-C4'-P energy: -41.019 tors. eta vs tors. theta energy: -62.450 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 201 Temperature: 1.150000 Total energy: -860.528418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.528418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.528418 (E_RNA) where: Base-Base interactions energy: -485.331 where: short stacking energy: -213.368 Base-Backbone interact. energy: -0.813 local terms energy: -248.384065 where: bonds (distance) C4'-P energy: -45.891 bonds (distance) P-C4' energy: -47.349 flat angles C4'-P-C4' energy: -52.391 flat angles P-C4'-P energy: -33.236 tors. eta vs tors. theta energy: -69.518 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 201 Temperature: 1.200000 Total energy: -840.531782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.531782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.731782 (E_RNA) where: Base-Base interactions energy: -465.754 where: short stacking energy: -209.693 Base-Backbone interact. energy: 0.863 local terms energy: -247.841217 where: bonds (distance) C4'-P energy: -55.462 bonds (distance) P-C4' energy: -48.434 flat angles C4'-P-C4' energy: -54.732 flat angles P-C4'-P energy: -29.355 tors. eta vs tors. theta energy: -59.859 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 201 Temperature: 1.250000 Total energy: -829.542008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.542008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.942008 (E_RNA) where: Base-Base interactions energy: -467.961 where: short stacking energy: -205.304 Base-Backbone interact. energy: 1.090 local terms energy: -233.070920 where: bonds (distance) C4'-P energy: -45.054 bonds (distance) P-C4' energy: -49.823 flat angles C4'-P-C4' energy: -49.687 flat angles P-C4'-P energy: -38.876 tors. eta vs tors. theta energy: -49.631 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 201 Temperature: 1.300000 Total energy: -686.292316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.292316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.692316 (E_RNA) where: Base-Base interactions energy: -378.400 where: short stacking energy: -150.511 Base-Backbone interact. energy: -1.347 local terms energy: -176.945323 where: bonds (distance) C4'-P energy: -39.771 bonds (distance) P-C4' energy: -37.778 flat angles C4'-P-C4' energy: -46.888 flat angles P-C4'-P energy: -30.684 tors. eta vs tors. theta energy: -21.823 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 201 Temperature: 1.350000 Total energy: -693.561369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.561369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.961369 (E_RNA) where: Base-Base interactions energy: -368.178 where: short stacking energy: -144.255 Base-Backbone interact. energy: 1.021 local terms energy: -196.803888 where: bonds (distance) C4'-P energy: -50.342 bonds (distance) P-C4' energy: -45.866 flat angles C4'-P-C4' energy: -43.052 flat angles P-C4'-P energy: -29.382 tors. eta vs tors. theta energy: -28.162 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 202 Temperature: 0.900000 Total energy: -1087.483086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.483086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -957.883086 (E_RNA) where: Base-Base interactions energy: -637.527 where: short stacking energy: -273.430 Base-Backbone interact. energy: 1.025 local terms energy: -321.380737 where: bonds (distance) C4'-P energy: -59.577 bonds (distance) P-C4' energy: -62.247 flat angles C4'-P-C4' energy: -71.216 flat angles P-C4'-P energy: -42.660 tors. eta vs tors. theta energy: -85.680 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 202 Temperature: 0.950000 Total energy: -1077.490837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1077.490837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -947.890837 (E_RNA) where: Base-Base interactions energy: -644.097 where: short stacking energy: -275.153 Base-Backbone interact. energy: 0.064 local terms energy: -303.857890 where: bonds (distance) C4'-P energy: -52.127 bonds (distance) P-C4' energy: -53.672 flat angles C4'-P-C4' energy: -66.064 flat angles P-C4'-P energy: -48.212 tors. eta vs tors. theta energy: -83.783 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 202 Temperature: 1.000000 Total energy: -1035.621467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.621467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -906.021467 (E_RNA) where: Base-Base interactions energy: -612.246 where: short stacking energy: -278.339 Base-Backbone interact. energy: -0.418 local terms energy: -293.357471 where: bonds (distance) C4'-P energy: -48.624 bonds (distance) P-C4' energy: -52.446 flat angles C4'-P-C4' energy: -57.594 flat angles P-C4'-P energy: -45.319 tors. eta vs tors. theta energy: -89.373 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 202 Temperature: 1.050000 Total energy: -1019.571756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.571756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -895.371756 (E_RNA) where: Base-Base interactions energy: -621.260 where: short stacking energy: -241.943 Base-Backbone interact. energy: -2.068 local terms energy: -272.044007 where: bonds (distance) C4'-P energy: -55.983 bonds (distance) P-C4' energy: -55.236 flat angles C4'-P-C4' energy: -53.831 flat angles P-C4'-P energy: -33.649 tors. eta vs tors. theta energy: -73.345 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 202 Temperature: 1.100000 Total energy: -894.283516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.283516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.483516 (E_RNA) where: Base-Base interactions energy: -485.912 where: short stacking energy: -215.923 Base-Backbone interact. energy: 0.746 local terms energy: -281.317365 where: bonds (distance) C4'-P energy: -51.054 bonds (distance) P-C4' energy: -62.287 flat angles C4'-P-C4' energy: -66.663 flat angles P-C4'-P energy: -40.179 tors. eta vs tors. theta energy: -61.133 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 202 Temperature: 1.150000 Total energy: -844.176994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -844.176994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.176994 (E_RNA) where: Base-Base interactions energy: -471.015 where: short stacking energy: -212.244 Base-Backbone interact. energy: -1.806 local terms energy: -245.356430 where: bonds (distance) C4'-P energy: -42.546 bonds (distance) P-C4' energy: -47.630 flat angles C4'-P-C4' energy: -52.190 flat angles P-C4'-P energy: -41.775 tors. eta vs tors. theta energy: -61.215 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 202 Temperature: 1.200000 Total energy: -832.696040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.696040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.896040 (E_RNA) where: Base-Base interactions energy: -453.936 where: short stacking energy: -200.390 Base-Backbone interact. energy: -1.086 local terms energy: -249.873690 where: bonds (distance) C4'-P energy: -56.402 bonds (distance) P-C4' energy: -38.375 flat angles C4'-P-C4' energy: -57.513 flat angles P-C4'-P energy: -38.993 tors. eta vs tors. theta energy: -58.591 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 202 Temperature: 1.250000 Total energy: -811.836117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -811.836117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.636117 (E_RNA) where: Base-Base interactions energy: -456.706 where: short stacking energy: -214.246 Base-Backbone interact. energy: -0.247 local terms energy: -230.682898 where: bonds (distance) C4'-P energy: -47.587 bonds (distance) P-C4' energy: -51.408 flat angles C4'-P-C4' energy: -47.249 flat angles P-C4'-P energy: -28.460 tors. eta vs tors. theta energy: -55.978 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 202 Temperature: 1.300000 Total energy: -687.188323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.188323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.588323 (E_RNA) where: Base-Base interactions energy: -354.099 where: short stacking energy: -143.607 Base-Backbone interact. energy: -3.240 local terms energy: -200.249255 where: bonds (distance) C4'-P energy: -46.894 bonds (distance) P-C4' energy: -52.758 flat angles C4'-P-C4' energy: -49.283 flat angles P-C4'-P energy: -24.980 tors. eta vs tors. theta energy: -26.334 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 202 Temperature: 1.350000 Total energy: -669.519791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.519791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.319791 (E_RNA) where: Base-Base interactions energy: -354.554 where: short stacking energy: -137.477 Base-Backbone interact. energy: -0.779 local terms energy: -189.986728 where: bonds (distance) C4'-P energy: -44.817 bonds (distance) P-C4' energy: -42.098 flat angles C4'-P-C4' energy: -51.559 flat angles P-C4'-P energy: -28.921 tors. eta vs tors. theta energy: -22.591 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 203 Temperature: 0.900000 Total energy: -1090.868212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1090.868212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.268212 (E_RNA) where: Base-Base interactions energy: -658.437 where: short stacking energy: -286.478 Base-Backbone interact. energy: -0.293 local terms energy: -302.537965 where: bonds (distance) C4'-P energy: -50.374 bonds (distance) P-C4' energy: -54.447 flat angles C4'-P-C4' energy: -63.742 flat angles P-C4'-P energy: -45.485 tors. eta vs tors. theta energy: -88.490 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 203 Temperature: 0.950000 Total energy: -1041.215762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.215762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -915.215762 (E_RNA) where: Base-Base interactions energy: -613.187 where: short stacking energy: -271.256 Base-Backbone interact. energy: 5.410 local terms energy: -307.438657 where: bonds (distance) C4'-P energy: -52.469 bonds (distance) P-C4' energy: -56.819 flat angles C4'-P-C4' energy: -65.503 flat angles P-C4'-P energy: -52.660 tors. eta vs tors. theta energy: -79.988 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 203 Temperature: 1.000000 Total energy: -1048.971398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1048.971398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.371398 (E_RNA) where: Base-Base interactions energy: -616.192 where: short stacking energy: -252.886 Base-Backbone interact. energy: -3.180 local terms energy: -299.999298 where: bonds (distance) C4'-P energy: -53.954 bonds (distance) P-C4' energy: -54.061 flat angles C4'-P-C4' energy: -65.008 flat angles P-C4'-P energy: -48.872 tors. eta vs tors. theta energy: -78.104 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 203 Temperature: 1.050000 Total energy: -1001.895488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.895488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.295488 (E_RNA) where: Base-Base interactions energy: -602.162 where: short stacking energy: -230.467 Base-Backbone interact. energy: -1.447 local terms energy: -268.685636 where: bonds (distance) C4'-P energy: -54.531 bonds (distance) P-C4' energy: -44.158 flat angles C4'-P-C4' energy: -58.588 flat angles P-C4'-P energy: -42.514 tors. eta vs tors. theta energy: -68.895 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 203 Temperature: 1.100000 Total energy: -907.169689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.169689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.369689 (E_RNA) where: Base-Base interactions energy: -510.628 where: short stacking energy: -233.753 Base-Backbone interact. energy: -1.707 local terms energy: -267.035565 where: bonds (distance) C4'-P energy: -49.009 bonds (distance) P-C4' energy: -54.974 flat angles C4'-P-C4' energy: -55.482 flat angles P-C4'-P energy: -38.003 tors. eta vs tors. theta energy: -69.568 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 203 Temperature: 1.150000 Total energy: -855.464175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.464175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.864175 (E_RNA) where: Base-Base interactions energy: -477.578 where: short stacking energy: -228.588 Base-Backbone interact. energy: -0.444 local terms energy: -247.841669 where: bonds (distance) C4'-P energy: -46.122 bonds (distance) P-C4' energy: -49.601 flat angles C4'-P-C4' energy: -52.318 flat angles P-C4'-P energy: -32.904 tors. eta vs tors. theta energy: -66.897 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 203 Temperature: 1.200000 Total energy: -850.684763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.684763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.084763 (E_RNA) where: Base-Base interactions energy: -483.718 where: short stacking energy: -217.132 Base-Backbone interact. energy: -1.011 local terms energy: -236.355789 where: bonds (distance) C4'-P energy: -36.769 bonds (distance) P-C4' energy: -49.876 flat angles C4'-P-C4' energy: -55.018 flat angles P-C4'-P energy: -31.302 tors. eta vs tors. theta energy: -63.391 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 203 Temperature: 1.250000 Total energy: -743.226783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -743.226783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.426783 (E_RNA) where: Base-Base interactions energy: -395.188 where: short stacking energy: -169.021 Base-Backbone interact. energy: -1.079 local terms energy: -219.160278 where: bonds (distance) C4'-P energy: -44.771 bonds (distance) P-C4' energy: -56.960 flat angles C4'-P-C4' energy: -50.993 flat angles P-C4'-P energy: -29.479 tors. eta vs tors. theta energy: -36.956 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 203 Temperature: 1.300000 Total energy: -796.144181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -796.144181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.944181 (E_RNA) where: Base-Base interactions energy: -433.302 where: short stacking energy: -191.496 Base-Backbone interact. energy: -1.143 local terms energy: -237.499201 where: bonds (distance) C4'-P energy: -43.297 bonds (distance) P-C4' energy: -54.488 flat angles C4'-P-C4' energy: -52.600 flat angles P-C4'-P energy: -37.819 tors. eta vs tors. theta energy: -49.295 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 203 Temperature: 1.350000 Total energy: -650.549019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.549019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.549019 (E_RNA) where: Base-Base interactions energy: -328.574 where: short stacking energy: -137.081 Base-Backbone interact. energy: -0.495 local terms energy: -204.479993 where: bonds (distance) C4'-P energy: -52.014 bonds (distance) P-C4' energy: -57.443 flat angles C4'-P-C4' energy: -45.052 flat angles P-C4'-P energy: -33.792 tors. eta vs tors. theta energy: -16.179 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 204 Temperature: 0.900000 Total energy: -1102.362848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.362848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.762848 (E_RNA) where: Base-Base interactions energy: -667.032 where: short stacking energy: -283.107 Base-Backbone interact. energy: -0.602 local terms energy: -305.128593 where: bonds (distance) C4'-P energy: -59.284 bonds (distance) P-C4' energy: -53.408 flat angles C4'-P-C4' energy: -61.052 flat angles P-C4'-P energy: -44.899 tors. eta vs tors. theta energy: -86.485 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 204 Temperature: 0.950000 Total energy: -1021.811717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.811717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -895.811717 (E_RNA) where: Base-Base interactions energy: -606.378 where: short stacking energy: -257.207 Base-Backbone interact. energy: -0.843 local terms energy: -288.590902 where: bonds (distance) C4'-P energy: -57.277 bonds (distance) P-C4' energy: -50.658 flat angles C4'-P-C4' energy: -63.465 flat angles P-C4'-P energy: -40.843 tors. eta vs tors. theta energy: -76.347 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 204 Temperature: 1.000000 Total energy: -1033.783542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1033.783542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.983542 (E_RNA) where: Base-Base interactions energy: -618.755 where: short stacking energy: -261.763 Base-Backbone interact. energy: -0.090 local terms energy: -287.138087 where: bonds (distance) C4'-P energy: -51.057 bonds (distance) P-C4' energy: -54.661 flat angles C4'-P-C4' energy: -61.428 flat angles P-C4'-P energy: -46.870 tors. eta vs tors. theta energy: -73.122 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 204 Temperature: 1.050000 Total energy: -995.828583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -995.828583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.228583 (E_RNA) where: Base-Base interactions energy: -603.570 where: short stacking energy: -234.088 Base-Backbone interact. energy: -1.507 local terms energy: -261.151843 where: bonds (distance) C4'-P energy: -52.750 bonds (distance) P-C4' energy: -46.907 flat angles C4'-P-C4' energy: -48.944 flat angles P-C4'-P energy: -44.445 tors. eta vs tors. theta energy: -68.106 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 204 Temperature: 1.100000 Total energy: -904.341959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.341959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -781.941959 (E_RNA) where: Base-Base interactions energy: -514.182 where: short stacking energy: -239.097 Base-Backbone interact. energy: -0.404 local terms energy: -267.356462 where: bonds (distance) C4'-P energy: -53.008 bonds (distance) P-C4' energy: -53.889 flat angles C4'-P-C4' energy: -51.497 flat angles P-C4'-P energy: -41.575 tors. eta vs tors. theta energy: -67.388 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 204 Temperature: 1.150000 Total energy: -893.633845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.633845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.833845 (E_RNA) where: Base-Base interactions energy: -512.910 where: short stacking energy: -237.009 Base-Backbone interact. energy: 0.028 local terms energy: -252.952028 where: bonds (distance) C4'-P energy: -48.409 bonds (distance) P-C4' energy: -48.962 flat angles C4'-P-C4' energy: -55.898 flat angles P-C4'-P energy: -35.962 tors. eta vs tors. theta energy: -63.720 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 204 Temperature: 1.200000 Total energy: -858.256021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.256021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.256021 (E_RNA) where: Base-Base interactions energy: -484.091 where: short stacking energy: -214.737 Base-Backbone interact. energy: 1.933 local terms energy: -250.098554 where: bonds (distance) C4'-P energy: -41.999 bonds (distance) P-C4' energy: -47.795 flat angles C4'-P-C4' energy: -62.598 flat angles P-C4'-P energy: -31.788 tors. eta vs tors. theta energy: -65.918 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 204 Temperature: 1.250000 Total energy: -744.860287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.860287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.060287 (E_RNA) where: Base-Base interactions energy: -404.221 where: short stacking energy: -158.550 Base-Backbone interact. energy: -1.806 local terms energy: -211.033021 where: bonds (distance) C4'-P energy: -51.666 bonds (distance) P-C4' energy: -51.732 flat angles C4'-P-C4' energy: -46.927 flat angles P-C4'-P energy: -26.483 tors. eta vs tors. theta energy: -34.224 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 204 Temperature: 1.300000 Total energy: -796.308976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -796.308976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.108976 (E_RNA) where: Base-Base interactions energy: -451.968 where: short stacking energy: -203.477 Base-Backbone interact. energy: 0.791 local terms energy: -220.932014 where: bonds (distance) C4'-P energy: -49.759 bonds (distance) P-C4' energy: -24.818 flat angles C4'-P-C4' energy: -52.589 flat angles P-C4'-P energy: -35.715 tors. eta vs tors. theta energy: -58.051 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 204 Temperature: 1.350000 Total energy: -648.307706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.307706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.107706 (E_RNA) where: Base-Base interactions energy: -350.486 where: short stacking energy: -134.308 Base-Backbone interact. energy: -2.097 local terms energy: -171.525096 where: bonds (distance) C4'-P energy: -42.941 bonds (distance) P-C4' energy: -38.255 flat angles C4'-P-C4' energy: -40.533 flat angles P-C4'-P energy: -28.185 tors. eta vs tors. theta energy: -21.611 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 205 Temperature: 0.900000 Total energy: -1100.128999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1100.128999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -970.528999 (E_RNA) where: Base-Base interactions energy: -671.804 where: short stacking energy: -276.075 Base-Backbone interact. energy: -0.661 local terms energy: -298.064105 where: bonds (distance) C4'-P energy: -59.053 bonds (distance) P-C4' energy: -51.772 flat angles C4'-P-C4' energy: -61.710 flat angles P-C4'-P energy: -40.533 tors. eta vs tors. theta energy: -84.997 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 205 Temperature: 0.950000 Total energy: -1039.619526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.619526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.619526 (E_RNA) where: Base-Base interactions energy: -630.302 where: short stacking energy: -281.171 Base-Backbone interact. energy: -0.926 local terms energy: -282.390956 where: bonds (distance) C4'-P energy: -40.316 bonds (distance) P-C4' energy: -52.831 flat angles C4'-P-C4' energy: -59.181 flat angles P-C4'-P energy: -45.453 tors. eta vs tors. theta energy: -84.610 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 205 Temperature: 1.000000 Total energy: -1028.309289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1028.309289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.509289 (E_RNA) where: Base-Base interactions energy: -612.819 where: short stacking energy: -269.813 Base-Backbone interact. energy: -0.460 local terms energy: -287.231006 where: bonds (distance) C4'-P energy: -55.711 bonds (distance) P-C4' energy: -50.399 flat angles C4'-P-C4' energy: -56.856 flat angles P-C4'-P energy: -45.572 tors. eta vs tors. theta energy: -78.694 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 205 Temperature: 1.050000 Total energy: -995.215682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -995.215682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.415682 (E_RNA) where: Base-Base interactions energy: -610.767 where: short stacking energy: -232.008 Base-Backbone interact. energy: -0.659 local terms energy: -255.989968 where: bonds (distance) C4'-P energy: -51.048 bonds (distance) P-C4' energy: -43.541 flat angles C4'-P-C4' energy: -55.724 flat angles P-C4'-P energy: -35.601 tors. eta vs tors. theta energy: -70.076 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 205 Temperature: 1.100000 Total energy: -919.259098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -919.259098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.659098 (E_RNA) where: Base-Base interactions energy: -511.779 where: short stacking energy: -236.917 Base-Backbone interact. energy: -0.804 local terms energy: -277.076044 where: bonds (distance) C4'-P energy: -47.649 bonds (distance) P-C4' energy: -53.354 flat angles C4'-P-C4' energy: -59.728 flat angles P-C4'-P energy: -38.522 tors. eta vs tors. theta energy: -77.824 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 205 Temperature: 1.150000 Total energy: -887.291073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.291073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.691073 (E_RNA) where: Base-Base interactions energy: -507.426 where: short stacking energy: -223.478 Base-Backbone interact. energy: -0.602 local terms energy: -249.662559 where: bonds (distance) C4'-P energy: -52.519 bonds (distance) P-C4' energy: -46.751 flat angles C4'-P-C4' energy: -54.608 flat angles P-C4'-P energy: -31.506 tors. eta vs tors. theta energy: -64.280 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 205 Temperature: 1.200000 Total energy: -847.554971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -847.554971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.354971 (E_RNA) where: Base-Base interactions energy: -486.255 where: short stacking energy: -217.643 Base-Backbone interact. energy: -0.896 local terms energy: -236.203783 where: bonds (distance) C4'-P energy: -44.013 bonds (distance) P-C4' energy: -44.453 flat angles C4'-P-C4' energy: -41.764 flat angles P-C4'-P energy: -45.205 tors. eta vs tors. theta energy: -60.769 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 205 Temperature: 1.250000 Total energy: -791.797172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.797172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.997172 (E_RNA) where: Base-Base interactions energy: -429.974 where: short stacking energy: -185.853 Base-Backbone interact. energy: 0.876 local terms energy: -234.899452 where: bonds (distance) C4'-P energy: -49.587 bonds (distance) P-C4' energy: -45.702 flat angles C4'-P-C4' energy: -50.156 flat angles P-C4'-P energy: -35.282 tors. eta vs tors. theta energy: -54.173 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 205 Temperature: 1.300000 Total energy: -752.602285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.602285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.402285 (E_RNA) where: Base-Base interactions energy: -422.123 where: short stacking energy: -188.589 Base-Backbone interact. energy: -0.110 local terms energy: -206.169662 where: bonds (distance) C4'-P energy: -41.847 bonds (distance) P-C4' energy: -37.770 flat angles C4'-P-C4' energy: -49.406 flat angles P-C4'-P energy: -30.737 tors. eta vs tors. theta energy: -46.410 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 205 Temperature: 1.350000 Total energy: -669.426308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.426308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.426308 (E_RNA) where: Base-Base interactions energy: -381.463 where: short stacking energy: -129.878 Base-Backbone interact. energy: -1.554 local terms energy: -160.408896 where: bonds (distance) C4'-P energy: -40.133 bonds (distance) P-C4' energy: -39.854 flat angles C4'-P-C4' energy: -39.621 flat angles P-C4'-P energy: -20.257 tors. eta vs tors. theta energy: -20.544 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 206 Temperature: 0.900000 Total energy: -1098.256435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1098.256435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -970.456435 (E_RNA) where: Base-Base interactions energy: -662.962 where: short stacking energy: -282.427 Base-Backbone interact. energy: 1.236 local terms energy: -308.730443 where: bonds (distance) C4'-P energy: -53.149 bonds (distance) P-C4' energy: -53.483 flat angles C4'-P-C4' energy: -67.819 flat angles P-C4'-P energy: -47.510 tors. eta vs tors. theta energy: -86.770 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 206 Temperature: 0.950000 Total energy: -1052.892627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.892627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.292627 (E_RNA) where: Base-Base interactions energy: -623.092 where: short stacking energy: -277.002 Base-Backbone interact. energy: -1.629 local terms energy: -298.572160 where: bonds (distance) C4'-P energy: -49.786 bonds (distance) P-C4' energy: -60.907 flat angles C4'-P-C4' energy: -62.394 flat angles P-C4'-P energy: -40.349 tors. eta vs tors. theta energy: -85.136 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 206 Temperature: 1.000000 Total energy: -1051.972855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.972855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.372855 (E_RNA) where: Base-Base interactions energy: -617.856 where: short stacking energy: -276.035 Base-Backbone interact. energy: -1.448 local terms energy: -303.069027 where: bonds (distance) C4'-P energy: -59.832 bonds (distance) P-C4' energy: -52.453 flat angles C4'-P-C4' energy: -58.964 flat angles P-C4'-P energy: -42.886 tors. eta vs tors. theta energy: -88.933 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 206 Temperature: 1.050000 Total energy: -980.033458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.033458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -852.233458 (E_RNA) where: Base-Base interactions energy: -593.082 where: short stacking energy: -218.375 Base-Backbone interact. energy: -0.163 local terms energy: -258.988779 where: bonds (distance) C4'-P energy: -51.560 bonds (distance) P-C4' energy: -39.170 flat angles C4'-P-C4' energy: -54.885 flat angles P-C4'-P energy: -48.016 tors. eta vs tors. theta energy: -65.358 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 206 Temperature: 1.100000 Total energy: -884.756329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.756329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.756329 (E_RNA) where: Base-Base interactions energy: -487.706 where: short stacking energy: -215.665 Base-Backbone interact. energy: -0.062 local terms energy: -270.987797 where: bonds (distance) C4'-P energy: -50.686 bonds (distance) P-C4' energy: -52.573 flat angles C4'-P-C4' energy: -66.726 flat angles P-C4'-P energy: -37.369 tors. eta vs tors. theta energy: -63.634 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 206 Temperature: 1.150000 Total energy: -870.285456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -870.285456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.285456 (E_RNA) where: Base-Base interactions energy: -475.397 where: short stacking energy: -211.387 Base-Backbone interact. energy: 0.484 local terms energy: -269.372101 where: bonds (distance) C4'-P energy: -50.354 bonds (distance) P-C4' energy: -47.336 flat angles C4'-P-C4' energy: -58.082 flat angles P-C4'-P energy: -40.591 tors. eta vs tors. theta energy: -73.009 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 206 Temperature: 1.200000 Total energy: -858.929857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.929857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.929857 (E_RNA) where: Base-Base interactions energy: -487.419 where: short stacking energy: -226.762 Base-Backbone interact. energy: -1.600 local terms energy: -243.910886 where: bonds (distance) C4'-P energy: -48.335 bonds (distance) P-C4' energy: -48.344 flat angles C4'-P-C4' energy: -48.744 flat angles P-C4'-P energy: -30.799 tors. eta vs tors. theta energy: -67.688 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 206 Temperature: 1.250000 Total energy: -814.894194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.894194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.894194 (E_RNA) where: Base-Base interactions energy: -452.675 where: short stacking energy: -196.705 Base-Backbone interact. energy: 1.168 local terms energy: -237.387842 where: bonds (distance) C4'-P energy: -47.177 bonds (distance) P-C4' energy: -50.496 flat angles C4'-P-C4' energy: -48.043 flat angles P-C4'-P energy: -36.852 tors. eta vs tors. theta energy: -54.819 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 206 Temperature: 1.300000 Total energy: -730.504962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.504962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.904962 (E_RNA) where: Base-Base interactions energy: -377.443 where: short stacking energy: -144.984 Base-Backbone interact. energy: 1.052 local terms energy: -224.514771 where: bonds (distance) C4'-P energy: -54.356 bonds (distance) P-C4' energy: -50.447 flat angles C4'-P-C4' energy: -48.041 flat angles P-C4'-P energy: -37.060 tors. eta vs tors. theta energy: -34.610 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 206 Temperature: 1.350000 Total energy: -671.159052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.159052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.159052 (E_RNA) where: Base-Base interactions energy: -342.013 where: short stacking energy: -138.223 Base-Backbone interact. energy: -0.955 local terms energy: -202.191359 where: bonds (distance) C4'-P energy: -38.353 bonds (distance) P-C4' energy: -49.504 flat angles C4'-P-C4' energy: -49.598 flat angles P-C4'-P energy: -35.662 tors. eta vs tors. theta energy: -29.074 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 207 Temperature: 0.900000 Total energy: -1101.733329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1101.733329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.133329 (E_RNA) where: Base-Base interactions energy: -672.123 where: short stacking energy: -282.960 Base-Backbone interact. energy: 1.081 local terms energy: -301.091632 where: bonds (distance) C4'-P energy: -49.365 bonds (distance) P-C4' energy: -56.464 flat angles C4'-P-C4' energy: -63.745 flat angles P-C4'-P energy: -45.790 tors. eta vs tors. theta energy: -85.728 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 207 Temperature: 0.950000 Total energy: -1041.247983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.247983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.447983 (E_RNA) where: Base-Base interactions energy: -609.620 where: short stacking energy: -277.526 Base-Backbone interact. energy: -1.700 local terms energy: -302.127909 where: bonds (distance) C4'-P energy: -50.846 bonds (distance) P-C4' energy: -57.073 flat angles C4'-P-C4' energy: -67.688 flat angles P-C4'-P energy: -40.853 tors. eta vs tors. theta energy: -85.668 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 207 Temperature: 1.000000 Total energy: -1027.046772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1027.046772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -899.246772 (E_RNA) where: Base-Base interactions energy: -598.438 where: short stacking energy: -267.043 Base-Backbone interact. energy: -0.377 local terms energy: -300.431958 where: bonds (distance) C4'-P energy: -48.648 bonds (distance) P-C4' energy: -56.706 flat angles C4'-P-C4' energy: -62.637 flat angles P-C4'-P energy: -47.045 tors. eta vs tors. theta energy: -85.395 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 207 Temperature: 1.050000 Total energy: -982.132444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.132444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -854.332444 (E_RNA) where: Base-Base interactions energy: -582.362 where: short stacking energy: -235.368 Base-Backbone interact. energy: -1.570 local terms energy: -270.401028 where: bonds (distance) C4'-P energy: -49.842 bonds (distance) P-C4' energy: -52.757 flat angles C4'-P-C4' energy: -57.042 flat angles P-C4'-P energy: -39.667 tors. eta vs tors. theta energy: -71.093 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 207 Temperature: 1.100000 Total energy: -923.538204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -923.538204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -795.738204 (E_RNA) where: Base-Base interactions energy: -528.052 where: short stacking energy: -237.811 Base-Backbone interact. energy: -1.369 local terms energy: -266.316877 where: bonds (distance) C4'-P energy: -47.353 bonds (distance) P-C4' energy: -57.215 flat angles C4'-P-C4' energy: -51.647 flat angles P-C4'-P energy: -41.505 tors. eta vs tors. theta energy: -68.598 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 207 Temperature: 1.150000 Total energy: -922.337482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.337482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -796.337482 (E_RNA) where: Base-Base interactions energy: -523.905 where: short stacking energy: -225.817 Base-Backbone interact. energy: -1.663 local terms energy: -270.769573 where: bonds (distance) C4'-P energy: -48.451 bonds (distance) P-C4' energy: -62.081 flat angles C4'-P-C4' energy: -60.007 flat angles P-C4'-P energy: -36.728 tors. eta vs tors. theta energy: -63.502 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 207 Temperature: 1.200000 Total energy: -852.163939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -852.163939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.963939 (E_RNA) where: Base-Base interactions energy: -486.487 where: short stacking energy: -214.350 Base-Backbone interact. energy: -0.140 local terms energy: -241.336792 where: bonds (distance) C4'-P energy: -43.878 bonds (distance) P-C4' energy: -46.386 flat angles C4'-P-C4' energy: -57.324 flat angles P-C4'-P energy: -31.188 tors. eta vs tors. theta energy: -62.559 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 207 Temperature: 1.250000 Total energy: -793.861750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -793.861750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.861750 (E_RNA) where: Base-Base interactions energy: -426.265 where: short stacking energy: -194.133 Base-Backbone interact. energy: -1.428 local terms energy: -240.168257 where: bonds (distance) C4'-P energy: -46.517 bonds (distance) P-C4' energy: -50.703 flat angles C4'-P-C4' energy: -46.611 flat angles P-C4'-P energy: -39.928 tors. eta vs tors. theta energy: -56.409 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 207 Temperature: 1.300000 Total energy: -745.462271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.462271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.462271 (E_RNA) where: Base-Base interactions energy: -400.044 where: short stacking energy: -172.547 Base-Backbone interact. energy: -0.013 local terms energy: -219.405137 where: bonds (distance) C4'-P energy: -39.212 bonds (distance) P-C4' energy: -42.854 flat angles C4'-P-C4' energy: -51.781 flat angles P-C4'-P energy: -36.068 tors. eta vs tors. theta energy: -49.490 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 207 Temperature: 1.350000 Total energy: -660.894284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.894284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.494284 (E_RNA) where: Base-Base interactions energy: -340.493 where: short stacking energy: -142.315 Base-Backbone interact. energy: -1.300 local terms energy: -196.700544 where: bonds (distance) C4'-P energy: -49.109 bonds (distance) P-C4' energy: -44.637 flat angles C4'-P-C4' energy: -40.622 flat angles P-C4'-P energy: -34.046 tors. eta vs tors. theta energy: -28.286 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 208 Temperature: 0.900000 Total energy: -1091.801762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.801762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.001762 (E_RNA) where: Base-Base interactions energy: -668.506 where: short stacking energy: -280.231 Base-Backbone interact. energy: -1.543 local terms energy: -293.952450 where: bonds (distance) C4'-P energy: -46.850 bonds (distance) P-C4' energy: -60.538 flat angles C4'-P-C4' energy: -59.973 flat angles P-C4'-P energy: -39.802 tors. eta vs tors. theta energy: -86.790 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 208 Temperature: 0.950000 Total energy: -1052.243554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.243554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.443554 (E_RNA) where: Base-Base interactions energy: -649.113 where: short stacking energy: -279.443 Base-Backbone interact. energy: 3.719 local terms energy: -279.049647 where: bonds (distance) C4'-P energy: -51.071 bonds (distance) P-C4' energy: -58.000 flat angles C4'-P-C4' energy: -44.958 flat angles P-C4'-P energy: -39.790 tors. eta vs tors. theta energy: -85.231 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 208 Temperature: 1.000000 Total energy: -1026.337939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.337939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.337939 (E_RNA) where: Base-Base interactions energy: -615.226 where: short stacking energy: -235.352 Base-Backbone interact. energy: -3.828 local terms energy: -281.284679 where: bonds (distance) C4'-P energy: -50.762 bonds (distance) P-C4' energy: -56.254 flat angles C4'-P-C4' energy: -57.477 flat angles P-C4'-P energy: -38.117 tors. eta vs tors. theta energy: -78.674 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 208 Temperature: 1.050000 Total energy: -999.967419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.967419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -873.967419 (E_RNA) where: Base-Base interactions energy: -588.124 where: short stacking energy: -254.499 Base-Backbone interact. energy: -0.476 local terms energy: -285.367290 where: bonds (distance) C4'-P energy: -47.672 bonds (distance) P-C4' energy: -50.632 flat angles C4'-P-C4' energy: -53.282 flat angles P-C4'-P energy: -48.748 tors. eta vs tors. theta energy: -85.033 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 208 Temperature: 1.100000 Total energy: -918.427815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -918.427815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.827815 (E_RNA) where: Base-Base interactions energy: -525.388 where: short stacking energy: -232.354 Base-Backbone interact. energy: -0.875 local terms energy: -262.565285 where: bonds (distance) C4'-P energy: -46.928 bonds (distance) P-C4' energy: -51.664 flat angles C4'-P-C4' energy: -56.920 flat angles P-C4'-P energy: -38.370 tors. eta vs tors. theta energy: -68.684 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 208 Temperature: 1.150000 Total energy: -897.484761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.484761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.484761 (E_RNA) where: Base-Base interactions energy: -507.770 where: short stacking energy: -236.485 Base-Backbone interact. energy: -1.243 local terms energy: -262.471897 where: bonds (distance) C4'-P energy: -49.640 bonds (distance) P-C4' energy: -43.416 flat angles C4'-P-C4' energy: -56.967 flat angles P-C4'-P energy: -43.152 tors. eta vs tors. theta energy: -69.296 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 208 Temperature: 1.200000 Total energy: -822.492083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.492083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.092083 (E_RNA) where: Base-Base interactions energy: -458.001 where: short stacking energy: -207.763 Base-Backbone interact. energy: -1.551 local terms energy: -240.540046 where: bonds (distance) C4'-P energy: -47.007 bonds (distance) P-C4' energy: -49.051 flat angles C4'-P-C4' energy: -52.198 flat angles P-C4'-P energy: -28.623 tors. eta vs tors. theta energy: -63.660 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 208 Temperature: 1.250000 Total energy: -845.813221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.813221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.013221 (E_RNA) where: Base-Base interactions energy: -482.064 where: short stacking energy: -216.259 Base-Backbone interact. energy: -0.630 local terms energy: -235.319115 where: bonds (distance) C4'-P energy: -42.124 bonds (distance) P-C4' energy: -44.975 flat angles C4'-P-C4' energy: -53.822 flat angles P-C4'-P energy: -31.396 tors. eta vs tors. theta energy: -63.002 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 208 Temperature: 1.300000 Total energy: -760.119694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -760.119694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.319694 (E_RNA) where: Base-Base interactions energy: -420.399 where: short stacking energy: -182.868 Base-Backbone interact. energy: 0.724 local terms energy: -212.644563 where: bonds (distance) C4'-P energy: -29.512 bonds (distance) P-C4' energy: -54.742 flat angles C4'-P-C4' energy: -49.069 flat angles P-C4'-P energy: -36.038 tors. eta vs tors. theta energy: -43.284 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 208 Temperature: 1.350000 Total energy: -680.765899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.765899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.765899 (E_RNA) where: Base-Base interactions energy: -347.539 where: short stacking energy: -143.110 Base-Backbone interact. energy: -0.231 local terms energy: -206.995295 where: bonds (distance) C4'-P energy: -45.345 bonds (distance) P-C4' energy: -51.848 flat angles C4'-P-C4' energy: -41.854 flat angles P-C4'-P energy: -32.037 tors. eta vs tors. theta energy: -35.912 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 209 Temperature: 0.900000 Total energy: -1084.308762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1084.308762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -954.708762 (E_RNA) where: Base-Base interactions energy: -642.743 where: short stacking energy: -282.054 Base-Backbone interact. energy: -0.400 local terms energy: -311.565700 where: bonds (distance) C4'-P energy: -50.681 bonds (distance) P-C4' energy: -64.460 flat angles C4'-P-C4' energy: -67.914 flat angles P-C4'-P energy: -46.014 tors. eta vs tors. theta energy: -82.498 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 209 Temperature: 0.950000 Total energy: -1067.110034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.110034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.510034 (E_RNA) where: Base-Base interactions energy: -645.437 where: short stacking energy: -266.251 Base-Backbone interact. energy: -1.623 local terms energy: -290.450425 where: bonds (distance) C4'-P energy: -46.819 bonds (distance) P-C4' energy: -52.982 flat angles C4'-P-C4' energy: -70.115 flat angles P-C4'-P energy: -37.019 tors. eta vs tors. theta energy: -83.516 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 209 Temperature: 1.000000 Total energy: -1027.496757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1027.496757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.496757 (E_RNA) where: Base-Base interactions energy: -623.141 where: short stacking energy: -243.595 Base-Backbone interact. energy: -0.430 local terms energy: -277.925862 where: bonds (distance) C4'-P energy: -48.935 bonds (distance) P-C4' energy: -55.680 flat angles C4'-P-C4' energy: -55.266 flat angles P-C4'-P energy: -40.706 tors. eta vs tors. theta energy: -77.338 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 209 Temperature: 1.050000 Total energy: -1008.206473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.206473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.206473 (E_RNA) where: Base-Base interactions energy: -602.906 where: short stacking energy: -274.977 Base-Backbone interact. energy: 0.037 local terms energy: -279.337781 where: bonds (distance) C4'-P energy: -47.926 bonds (distance) P-C4' energy: -43.335 flat angles C4'-P-C4' energy: -59.505 flat angles P-C4'-P energy: -43.632 tors. eta vs tors. theta energy: -84.940 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 209 Temperature: 1.100000 Total energy: -912.429708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -912.429708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.629708 (E_RNA) where: Base-Base interactions energy: -525.526 where: short stacking energy: -237.772 Base-Backbone interact. energy: 1.521 local terms energy: -260.624465 where: bonds (distance) C4'-P energy: -56.610 bonds (distance) P-C4' energy: -47.725 flat angles C4'-P-C4' energy: -49.493 flat angles P-C4'-P energy: -31.175 tors. eta vs tors. theta energy: -75.621 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 209 Temperature: 1.150000 Total energy: -880.791468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.791468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.991468 (E_RNA) where: Base-Base interactions energy: -505.104 where: short stacking energy: -227.277 Base-Backbone interact. energy: -0.297 local terms energy: -247.591039 where: bonds (distance) C4'-P energy: -56.128 bonds (distance) P-C4' energy: -45.843 flat angles C4'-P-C4' energy: -45.362 flat angles P-C4'-P energy: -36.958 tors. eta vs tors. theta energy: -63.300 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 209 Temperature: 1.200000 Total energy: -818.494039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.494039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.894039 (E_RNA) where: Base-Base interactions energy: -450.874 where: short stacking energy: -197.789 Base-Backbone interact. energy: -0.419 local terms energy: -237.600937 where: bonds (distance) C4'-P energy: -34.415 bonds (distance) P-C4' energy: -52.643 flat angles C4'-P-C4' energy: -54.904 flat angles P-C4'-P energy: -34.615 tors. eta vs tors. theta energy: -61.024 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 209 Temperature: 1.250000 Total energy: -806.339789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.339789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.339789 (E_RNA) where: Base-Base interactions energy: -423.952 where: short stacking energy: -198.599 Base-Backbone interact. energy: -0.915 local terms energy: -255.472512 where: bonds (distance) C4'-P energy: -59.252 bonds (distance) P-C4' energy: -54.683 flat angles C4'-P-C4' energy: -48.658 flat angles P-C4'-P energy: -40.424 tors. eta vs tors. theta energy: -52.455 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 209 Temperature: 1.300000 Total energy: -735.501226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.501226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.501226 (E_RNA) where: Base-Base interactions energy: -412.337 where: short stacking energy: -180.410 Base-Backbone interact. energy: -2.409 local terms energy: -203.755480 where: bonds (distance) C4'-P energy: -49.576 bonds (distance) P-C4' energy: -40.605 flat angles C4'-P-C4' energy: -44.582 flat angles P-C4'-P energy: -31.909 tors. eta vs tors. theta energy: -37.084 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 209 Temperature: 1.350000 Total energy: -674.011938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.011938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.211938 (E_RNA) where: Base-Base interactions energy: -344.042 where: short stacking energy: -148.612 Base-Backbone interact. energy: -0.959 local terms energy: -201.211501 where: bonds (distance) C4'-P energy: -43.463 bonds (distance) P-C4' energy: -48.937 flat angles C4'-P-C4' energy: -47.013 flat angles P-C4'-P energy: -29.709 tors. eta vs tors. theta energy: -32.090 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 210 Temperature: 0.900000 Total energy: -1096.755536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.755536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -967.155536 (E_RNA) where: Base-Base interactions energy: -678.578 where: short stacking energy: -285.070 Base-Backbone interact. energy: -1.410 local terms energy: -287.167817 where: bonds (distance) C4'-P energy: -51.000 bonds (distance) P-C4' energy: -57.876 flat angles C4'-P-C4' energy: -55.659 flat angles P-C4'-P energy: -40.718 tors. eta vs tors. theta energy: -81.916 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 210 Temperature: 0.950000 Total energy: -1068.960253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.960253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.360253 (E_RNA) where: Base-Base interactions energy: -633.300 where: short stacking energy: -260.706 Base-Backbone interact. energy: -2.581 local terms energy: -303.479462 where: bonds (distance) C4'-P energy: -54.390 bonds (distance) P-C4' energy: -52.727 flat angles C4'-P-C4' energy: -68.724 flat angles P-C4'-P energy: -40.539 tors. eta vs tors. theta energy: -87.099 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 210 Temperature: 1.000000 Total energy: -1056.099475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1056.099475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.299475 (E_RNA) where: Base-Base interactions energy: -650.553 where: short stacking energy: -261.023 Base-Backbone interact. energy: -2.822 local terms energy: -274.924551 where: bonds (distance) C4'-P energy: -48.805 bonds (distance) P-C4' energy: -54.522 flat angles C4'-P-C4' energy: -58.154 flat angles P-C4'-P energy: -36.033 tors. eta vs tors. theta energy: -77.410 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 210 Temperature: 1.050000 Total energy: -1000.705186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1000.705186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -878.305186 (E_RNA) where: Base-Base interactions energy: -589.815 where: short stacking energy: -265.877 Base-Backbone interact. energy: -0.610 local terms energy: -287.879912 where: bonds (distance) C4'-P energy: -45.885 bonds (distance) P-C4' energy: -54.868 flat angles C4'-P-C4' energy: -54.944 flat angles P-C4'-P energy: -48.656 tors. eta vs tors. theta energy: -83.527 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 210 Temperature: 1.100000 Total energy: -911.607874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -911.607874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.607874 (E_RNA) where: Base-Base interactions energy: -524.262 where: short stacking energy: -233.821 Base-Backbone interact. energy: -1.171 local terms energy: -260.174956 where: bonds (distance) C4'-P energy: -52.291 bonds (distance) P-C4' energy: -51.596 flat angles C4'-P-C4' energy: -60.401 flat angles P-C4'-P energy: -30.845 tors. eta vs tors. theta energy: -65.041 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 210 Temperature: 1.150000 Total energy: -897.803820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.803820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.203820 (E_RNA) where: Base-Base interactions energy: -513.296 where: short stacking energy: -225.811 Base-Backbone interact. energy: -0.600 local terms energy: -254.307767 where: bonds (distance) C4'-P energy: -55.074 bonds (distance) P-C4' energy: -35.633 flat angles C4'-P-C4' energy: -57.992 flat angles P-C4'-P energy: -37.676 tors. eta vs tors. theta energy: -67.932 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 210 Temperature: 1.200000 Total energy: -838.226729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.226729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.426729 (E_RNA) where: Base-Base interactions energy: -465.087 where: short stacking energy: -200.083 Base-Backbone interact. energy: -0.743 local terms energy: -244.597039 where: bonds (distance) C4'-P energy: -48.619 bonds (distance) P-C4' energy: -46.804 flat angles C4'-P-C4' energy: -60.583 flat angles P-C4'-P energy: -36.045 tors. eta vs tors. theta energy: -52.546 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 210 Temperature: 1.250000 Total energy: -797.278981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.278981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.278981 (E_RNA) where: Base-Base interactions energy: -427.721 where: short stacking energy: -203.809 Base-Backbone interact. energy: 0.503 local terms energy: -244.061364 where: bonds (distance) C4'-P energy: -45.327 bonds (distance) P-C4' energy: -52.802 flat angles C4'-P-C4' energy: -46.687 flat angles P-C4'-P energy: -33.993 tors. eta vs tors. theta energy: -65.253 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 210 Temperature: 1.300000 Total energy: -773.904815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -773.904815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.904815 (E_RNA) where: Base-Base interactions energy: -432.342 where: short stacking energy: -182.709 Base-Backbone interact. energy: -0.297 local terms energy: -215.265515 where: bonds (distance) C4'-P energy: -45.517 bonds (distance) P-C4' energy: -49.155 flat angles C4'-P-C4' energy: -54.905 flat angles P-C4'-P energy: -23.725 tors. eta vs tors. theta energy: -41.964 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 210 Temperature: 1.350000 Total energy: -671.141603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.141603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.741603 (E_RNA) where: Base-Base interactions energy: -345.542 where: short stacking energy: -145.229 Base-Backbone interact. energy: -1.140 local terms energy: -202.059750 where: bonds (distance) C4'-P energy: -46.815 bonds (distance) P-C4' energy: -46.458 flat angles C4'-P-C4' energy: -55.462 flat angles P-C4'-P energy: -24.145 tors. eta vs tors. theta energy: -29.180 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 211 Temperature: 0.900000 Total energy: -1077.774454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1077.774454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.974454 (E_RNA) where: Base-Base interactions energy: -651.626 where: short stacking energy: -270.903 Base-Backbone interact. energy: 0.137 local terms energy: -298.485036 where: bonds (distance) C4'-P energy: -57.098 bonds (distance) P-C4' energy: -53.699 flat angles C4'-P-C4' energy: -60.646 flat angles P-C4'-P energy: -41.137 tors. eta vs tors. theta energy: -85.905 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 211 Temperature: 0.950000 Total energy: -1077.247063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1077.247063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -947.647063 (E_RNA) where: Base-Base interactions energy: -650.578 where: short stacking energy: -292.173 Base-Backbone interact. energy: -1.247 local terms energy: -295.822160 where: bonds (distance) C4'-P energy: -50.261 bonds (distance) P-C4' energy: -51.375 flat angles C4'-P-C4' energy: -64.605 flat angles P-C4'-P energy: -41.328 tors. eta vs tors. theta energy: -88.253 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 211 Temperature: 1.000000 Total energy: -1036.057803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1036.057803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -906.457803 (E_RNA) where: Base-Base interactions energy: -641.472 where: short stacking energy: -249.042 Base-Backbone interact. energy: 0.145 local terms energy: -265.130494 where: bonds (distance) C4'-P energy: -56.847 bonds (distance) P-C4' energy: -49.112 flat angles C4'-P-C4' energy: -53.057 flat angles P-C4'-P energy: -39.487 tors. eta vs tors. theta energy: -66.628 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 211 Temperature: 1.050000 Total energy: -1014.854265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.854265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.054265 (E_RNA) where: Base-Base interactions energy: -589.334 where: short stacking energy: -263.243 Base-Backbone interact. energy: -1.216 local terms energy: -296.504362 where: bonds (distance) C4'-P energy: -48.326 bonds (distance) P-C4' energy: -58.888 flat angles C4'-P-C4' energy: -64.241 flat angles P-C4'-P energy: -41.171 tors. eta vs tors. theta energy: -83.879 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 211 Temperature: 1.100000 Total energy: -911.460779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -911.460779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.660779 (E_RNA) where: Base-Base interactions energy: -509.257 where: short stacking energy: -230.505 Base-Backbone interact. energy: 1.189 local terms energy: -275.592876 where: bonds (distance) C4'-P energy: -47.981 bonds (distance) P-C4' energy: -48.530 flat angles C4'-P-C4' energy: -61.859 flat angles P-C4'-P energy: -42.891 tors. eta vs tors. theta energy: -74.331 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 211 Temperature: 1.150000 Total energy: -843.202196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.202196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.402196 (E_RNA) where: Base-Base interactions energy: -488.028 where: short stacking energy: -207.147 Base-Backbone interact. energy: 0.104 local terms energy: -227.478626 where: bonds (distance) C4'-P energy: -43.436 bonds (distance) P-C4' energy: -44.825 flat angles C4'-P-C4' energy: -40.616 flat angles P-C4'-P energy: -41.525 tors. eta vs tors. theta energy: -57.076 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 211 Temperature: 1.200000 Total energy: -851.584679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -851.584679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.784679 (E_RNA) where: Base-Base interactions energy: -473.232 where: short stacking energy: -207.022 Base-Backbone interact. energy: -0.617 local terms energy: -249.935146 where: bonds (distance) C4'-P energy: -42.080 bonds (distance) P-C4' energy: -52.661 flat angles C4'-P-C4' energy: -54.059 flat angles P-C4'-P energy: -38.612 tors. eta vs tors. theta energy: -62.524 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 211 Temperature: 1.250000 Total energy: -784.147745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.147745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.947745 (E_RNA) where: Base-Base interactions energy: -444.635 where: short stacking energy: -204.048 Base-Backbone interact. energy: -0.068 local terms energy: -215.244896 where: bonds (distance) C4'-P energy: -31.005 bonds (distance) P-C4' energy: -38.270 flat angles C4'-P-C4' energy: -55.896 flat angles P-C4'-P energy: -34.678 tors. eta vs tors. theta energy: -55.396 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 211 Temperature: 1.300000 Total energy: -792.608998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -792.608998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.408998 (E_RNA) where: Base-Base interactions energy: -443.228 where: short stacking energy: -184.641 Base-Backbone interact. energy: 0.387 local terms energy: -225.567739 where: bonds (distance) C4'-P energy: -36.757 bonds (distance) P-C4' energy: -39.759 flat angles C4'-P-C4' energy: -53.796 flat angles P-C4'-P energy: -40.106 tors. eta vs tors. theta energy: -55.150 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 211 Temperature: 1.350000 Total energy: -666.985401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.985401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.785401 (E_RNA) where: Base-Base interactions energy: -346.379 where: short stacking energy: -138.532 Base-Backbone interact. energy: -0.793 local terms energy: -195.613972 where: bonds (distance) C4'-P energy: -27.634 bonds (distance) P-C4' energy: -59.207 flat angles C4'-P-C4' energy: -49.966 flat angles P-C4'-P energy: -30.109 tors. eta vs tors. theta energy: -28.698 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 212 Temperature: 0.900000 Total energy: -1116.013470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1116.013470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -988.213470 (E_RNA) where: Base-Base interactions energy: -664.451 where: short stacking energy: -285.993 Base-Backbone interact. energy: -1.030 local terms energy: -322.732983 where: bonds (distance) C4'-P energy: -60.452 bonds (distance) P-C4' energy: -60.557 flat angles C4'-P-C4' energy: -67.453 flat angles P-C4'-P energy: -45.962 tors. eta vs tors. theta energy: -88.310 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 212 Temperature: 0.950000 Total energy: -1057.317409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.317409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.717409 (E_RNA) where: Base-Base interactions energy: -628.939 where: short stacking energy: -261.563 Base-Backbone interact. energy: 3.481 local terms energy: -302.259172 where: bonds (distance) C4'-P energy: -49.102 bonds (distance) P-C4' energy: -53.571 flat angles C4'-P-C4' energy: -68.402 flat angles P-C4'-P energy: -44.762 tors. eta vs tors. theta energy: -86.422 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 212 Temperature: 1.000000 Total energy: -1031.568379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.568379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.968379 (E_RNA) where: Base-Base interactions energy: -614.079 where: short stacking energy: -233.299 Base-Backbone interact. energy: -4.718 local terms energy: -283.171035 where: bonds (distance) C4'-P energy: -54.041 bonds (distance) P-C4' energy: -53.581 flat angles C4'-P-C4' energy: -58.136 flat angles P-C4'-P energy: -39.987 tors. eta vs tors. theta energy: -77.425 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 212 Temperature: 1.050000 Total energy: -989.640313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.640313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -861.840313 (E_RNA) where: Base-Base interactions energy: -576.832 where: short stacking energy: -267.919 Base-Backbone interact. energy: -1.771 local terms energy: -283.237695 where: bonds (distance) C4'-P energy: -46.334 bonds (distance) P-C4' energy: -60.004 flat angles C4'-P-C4' energy: -64.583 flat angles P-C4'-P energy: -31.682 tors. eta vs tors. theta energy: -80.635 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 212 Temperature: 1.100000 Total energy: -886.286453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -886.286453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.686453 (E_RNA) where: Base-Base interactions energy: -487.329 where: short stacking energy: -234.301 Base-Backbone interact. energy: 1.558 local terms energy: -270.915315 where: bonds (distance) C4'-P energy: -46.484 bonds (distance) P-C4' energy: -58.237 flat angles C4'-P-C4' energy: -52.132 flat angles P-C4'-P energy: -44.427 tors. eta vs tors. theta energy: -69.636 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 212 Temperature: 1.150000 Total energy: -845.327076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.327076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.127076 (E_RNA) where: Base-Base interactions energy: -465.227 where: short stacking energy: -199.202 Base-Backbone interact. energy: -0.664 local terms energy: -255.236770 where: bonds (distance) C4'-P energy: -50.953 bonds (distance) P-C4' energy: -56.132 flat angles C4'-P-C4' energy: -53.724 flat angles P-C4'-P energy: -39.638 tors. eta vs tors. theta energy: -54.791 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 212 Temperature: 1.200000 Total energy: -837.189754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.189754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.389754 (E_RNA) where: Base-Base interactions energy: -471.691 where: short stacking energy: -199.322 Base-Backbone interact. energy: -1.038 local terms energy: -236.660209 where: bonds (distance) C4'-P energy: -43.772 bonds (distance) P-C4' energy: -52.093 flat angles C4'-P-C4' energy: -50.343 flat angles P-C4'-P energy: -37.582 tors. eta vs tors. theta energy: -52.871 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 212 Temperature: 1.250000 Total energy: -793.296200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -793.296200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.296200 (E_RNA) where: Base-Base interactions energy: -437.825 where: short stacking energy: -202.049 Base-Backbone interact. energy: -0.674 local terms energy: -228.797694 where: bonds (distance) C4'-P energy: -46.891 bonds (distance) P-C4' energy: -52.779 flat angles C4'-P-C4' energy: -48.960 flat angles P-C4'-P energy: -31.640 tors. eta vs tors. theta energy: -48.526 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 212 Temperature: 1.300000 Total energy: -801.005272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -801.005272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.205272 (E_RNA) where: Base-Base interactions energy: -444.628 where: short stacking energy: -181.967 Base-Backbone interact. energy: -0.746 local terms energy: -227.831182 where: bonds (distance) C4'-P energy: -47.851 bonds (distance) P-C4' energy: -34.438 flat angles C4'-P-C4' energy: -56.478 flat angles P-C4'-P energy: -35.740 tors. eta vs tors. theta energy: -53.324 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 212 Temperature: 1.350000 Total energy: -682.386301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.386301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.786301 (E_RNA) where: Base-Base interactions energy: -362.216 where: short stacking energy: -146.119 Base-Backbone interact. energy: 3.171 local terms energy: -193.740882 where: bonds (distance) C4'-P energy: -45.406 bonds (distance) P-C4' energy: -51.208 flat angles C4'-P-C4' energy: -41.973 flat angles P-C4'-P energy: -31.309 tors. eta vs tors. theta energy: -23.844 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 213 Temperature: 0.900000 Total energy: -1095.736346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.736346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.136346 (E_RNA) where: Base-Base interactions energy: -657.158 where: short stacking energy: -275.965 Base-Backbone interact. energy: -2.362 local terms energy: -306.616023 where: bonds (distance) C4'-P energy: -56.180 bonds (distance) P-C4' energy: -53.666 flat angles C4'-P-C4' energy: -62.024 flat angles P-C4'-P energy: -46.378 tors. eta vs tors. theta energy: -88.368 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 213 Temperature: 0.950000 Total energy: -1079.465949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1079.465949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.865949 (E_RNA) where: Base-Base interactions energy: -645.614 where: short stacking energy: -272.366 Base-Backbone interact. energy: -0.331 local terms energy: -303.921767 where: bonds (distance) C4'-P energy: -58.514 bonds (distance) P-C4' energy: -64.000 flat angles C4'-P-C4' energy: -61.796 flat angles P-C4'-P energy: -37.880 tors. eta vs tors. theta energy: -81.732 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 213 Temperature: 1.000000 Total energy: -1041.425201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.425201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.825201 (E_RNA) where: Base-Base interactions energy: -628.434 where: short stacking energy: -234.900 Base-Backbone interact. energy: -2.623 local terms energy: -280.767676 where: bonds (distance) C4'-P energy: -53.143 bonds (distance) P-C4' energy: -61.612 flat angles C4'-P-C4' energy: -54.950 flat angles P-C4'-P energy: -36.216 tors. eta vs tors. theta energy: -74.847 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 213 Temperature: 1.050000 Total energy: -971.294852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -971.294852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.694852 (E_RNA) where: Base-Base interactions energy: -564.120 where: short stacking energy: -246.006 Base-Backbone interact. energy: 0.072 local terms energy: -277.646685 where: bonds (distance) C4'-P energy: -58.492 bonds (distance) P-C4' energy: -47.372 flat angles C4'-P-C4' energy: -60.312 flat angles P-C4'-P energy: -34.561 tors. eta vs tors. theta energy: -76.910 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 213 Temperature: 1.100000 Total energy: -877.168851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.168851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.568851 (E_RNA) where: Base-Base interactions energy: -488.089 where: short stacking energy: -206.205 Base-Backbone interact. energy: -0.979 local terms energy: -258.500955 where: bonds (distance) C4'-P energy: -58.765 bonds (distance) P-C4' energy: -53.987 flat angles C4'-P-C4' energy: -55.173 flat angles P-C4'-P energy: -31.804 tors. eta vs tors. theta energy: -58.772 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 213 Temperature: 1.150000 Total energy: -856.161976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.161976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.161976 (E_RNA) where: Base-Base interactions energy: -479.926 where: short stacking energy: -213.567 Base-Backbone interact. energy: -1.117 local terms energy: -249.118947 where: bonds (distance) C4'-P energy: -47.058 bonds (distance) P-C4' energy: -47.005 flat angles C4'-P-C4' energy: -49.178 flat angles P-C4'-P energy: -41.639 tors. eta vs tors. theta energy: -64.238 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 213 Temperature: 1.200000 Total energy: -839.203098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -839.203098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.203098 (E_RNA) where: Base-Base interactions energy: -474.656 where: short stacking energy: -192.335 Base-Backbone interact. energy: 2.250 local terms energy: -240.796539 where: bonds (distance) C4'-P energy: -51.999 bonds (distance) P-C4' energy: -51.291 flat angles C4'-P-C4' energy: -53.876 flat angles P-C4'-P energy: -33.352 tors. eta vs tors. theta energy: -50.279 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 213 Temperature: 1.250000 Total energy: -800.425160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.425160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.225160 (E_RNA) where: Base-Base interactions energy: -460.084 where: short stacking energy: -205.789 Base-Backbone interact. energy: -0.932 local terms energy: -215.209719 where: bonds (distance) C4'-P energy: -29.857 bonds (distance) P-C4' energy: -38.780 flat angles C4'-P-C4' energy: -54.535 flat angles P-C4'-P energy: -30.312 tors. eta vs tors. theta energy: -61.727 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 213 Temperature: 1.300000 Total energy: -719.851395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.851395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.651395 (E_RNA) where: Base-Base interactions energy: -380.725 where: short stacking energy: -169.838 Base-Backbone interact. energy: -1.522 local terms energy: -213.404473 where: bonds (distance) C4'-P energy: -46.196 bonds (distance) P-C4' energy: -35.219 flat angles C4'-P-C4' energy: -49.168 flat angles P-C4'-P energy: -33.447 tors. eta vs tors. theta energy: -49.374 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 213 Temperature: 1.350000 Total energy: -711.810181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.810181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.010181 (E_RNA) where: Base-Base interactions energy: -369.384 where: short stacking energy: -145.496 Base-Backbone interact. energy: -0.854 local terms energy: -213.772872 where: bonds (distance) C4'-P energy: -39.778 bonds (distance) P-C4' energy: -56.767 flat angles C4'-P-C4' energy: -60.298 flat angles P-C4'-P energy: -31.594 tors. eta vs tors. theta energy: -25.336 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 214 Temperature: 0.900000 Total energy: -1085.298067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.298067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -957.498067 (E_RNA) where: Base-Base interactions energy: -648.791 where: short stacking energy: -283.417 Base-Backbone interact. energy: -0.393 local terms energy: -308.313844 where: bonds (distance) C4'-P energy: -57.490 bonds (distance) P-C4' energy: -53.768 flat angles C4'-P-C4' energy: -57.284 flat angles P-C4'-P energy: -52.418 tors. eta vs tors. theta energy: -87.354 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 214 Temperature: 0.950000 Total energy: -1071.811358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1071.811358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -942.211358 (E_RNA) where: Base-Base interactions energy: -636.256 where: short stacking energy: -267.608 Base-Backbone interact. energy: -0.339 local terms energy: -305.616036 where: bonds (distance) C4'-P energy: -53.183 bonds (distance) P-C4' energy: -58.306 flat angles C4'-P-C4' energy: -66.734 flat angles P-C4'-P energy: -41.616 tors. eta vs tors. theta energy: -85.777 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 214 Temperature: 1.000000 Total energy: -1019.113863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.113863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.513863 (E_RNA) where: Base-Base interactions energy: -612.967 where: short stacking energy: -237.099 Base-Backbone interact. energy: 0.267 local terms energy: -276.813448 where: bonds (distance) C4'-P energy: -45.833 bonds (distance) P-C4' energy: -59.064 flat angles C4'-P-C4' energy: -65.020 flat angles P-C4'-P energy: -34.514 tors. eta vs tors. theta energy: -72.382 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 214 Temperature: 1.050000 Total energy: -1002.023173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1002.023173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.623173 (E_RNA) where: Base-Base interactions energy: -583.616 where: short stacking energy: -249.587 Base-Backbone interact. energy: -2.116 local terms energy: -293.891502 where: bonds (distance) C4'-P energy: -48.556 bonds (distance) P-C4' energy: -50.414 flat angles C4'-P-C4' energy: -66.939 flat angles P-C4'-P energy: -46.446 tors. eta vs tors. theta energy: -81.537 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 214 Temperature: 1.100000 Total energy: -878.832232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.832232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.232232 (E_RNA) where: Base-Base interactions energy: -499.293 where: short stacking energy: -207.915 Base-Backbone interact. energy: -1.255 local terms energy: -248.684520 where: bonds (distance) C4'-P energy: -47.789 bonds (distance) P-C4' energy: -51.499 flat angles C4'-P-C4' energy: -58.116 flat angles P-C4'-P energy: -34.743 tors. eta vs tors. theta energy: -56.537 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 214 Temperature: 1.150000 Total energy: -873.504657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -873.504657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.704657 (E_RNA) where: Base-Base interactions energy: -481.808 where: short stacking energy: -214.098 Base-Backbone interact. energy: 0.385 local terms energy: -264.281284 where: bonds (distance) C4'-P energy: -46.647 bonds (distance) P-C4' energy: -59.050 flat angles C4'-P-C4' energy: -64.788 flat angles P-C4'-P energy: -34.388 tors. eta vs tors. theta energy: -59.408 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 214 Temperature: 1.200000 Total energy: -848.281184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.281184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.481184 (E_RNA) where: Base-Base interactions energy: -494.818 where: short stacking energy: -218.988 Base-Backbone interact. energy: -0.719 local terms energy: -224.943552 where: bonds (distance) C4'-P energy: -30.462 bonds (distance) P-C4' energy: -46.104 flat angles C4'-P-C4' energy: -53.774 flat angles P-C4'-P energy: -34.476 tors. eta vs tors. theta energy: -60.127 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 214 Temperature: 1.250000 Total energy: -804.199311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -804.199311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.399311 (E_RNA) where: Base-Base interactions energy: -432.178 where: short stacking energy: -195.135 Base-Backbone interact. energy: 1.546 local terms energy: -245.767184 where: bonds (distance) C4'-P energy: -52.737 bonds (distance) P-C4' energy: -57.405 flat angles C4'-P-C4' energy: -52.789 flat angles P-C4'-P energy: -33.024 tors. eta vs tors. theta energy: -49.812 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 214 Temperature: 1.300000 Total energy: -737.134024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.134024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.534024 (E_RNA) where: Base-Base interactions energy: -414.252 where: short stacking energy: -174.765 Base-Backbone interact. energy: 1.246 local terms energy: -203.527800 where: bonds (distance) C4'-P energy: -51.892 bonds (distance) P-C4' energy: -46.557 flat angles C4'-P-C4' energy: -46.211 flat angles P-C4'-P energy: -24.017 tors. eta vs tors. theta energy: -34.850 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 214 Temperature: 1.350000 Total energy: -667.060205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.060205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.260205 (E_RNA) where: Base-Base interactions energy: -350.483 where: short stacking energy: -138.286 Base-Backbone interact. energy: -0.689 local terms energy: -188.088224 where: bonds (distance) C4'-P energy: -29.561 bonds (distance) P-C4' energy: -51.109 flat angles C4'-P-C4' energy: -48.327 flat angles P-C4'-P energy: -30.593 tors. eta vs tors. theta energy: -28.498 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 215 Temperature: 0.900000 Total energy: -1118.484862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1118.484862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -988.884862 (E_RNA) where: Base-Base interactions energy: -657.783 where: short stacking energy: -294.076 Base-Backbone interact. energy: 4.177 local terms energy: -335.279700 where: bonds (distance) C4'-P energy: -55.472 bonds (distance) P-C4' energy: -67.130 flat angles C4'-P-C4' energy: -66.714 flat angles P-C4'-P energy: -54.898 tors. eta vs tors. theta energy: -91.066 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 215 Temperature: 0.950000 Total energy: -1052.081386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.081386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.281386 (E_RNA) where: Base-Base interactions energy: -637.737 where: short stacking energy: -244.506 Base-Backbone interact. energy: -3.423 local terms energy: -283.120956 where: bonds (distance) C4'-P energy: -50.449 bonds (distance) P-C4' energy: -52.531 flat angles C4'-P-C4' energy: -62.664 flat angles P-C4'-P energy: -43.335 tors. eta vs tors. theta energy: -74.142 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 215 Temperature: 1.000000 Total energy: -1053.695156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.695156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.095156 (E_RNA) where: Base-Base interactions energy: -618.317 where: short stacking energy: -270.983 Base-Backbone interact. energy: -2.574 local terms energy: -303.204212 where: bonds (distance) C4'-P energy: -53.111 bonds (distance) P-C4' energy: -58.413 flat angles C4'-P-C4' energy: -65.739 flat angles P-C4'-P energy: -46.211 tors. eta vs tors. theta energy: -79.731 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 215 Temperature: 1.050000 Total energy: -970.629047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -970.629047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.029047 (E_RNA) where: Base-Base interactions energy: -565.152 where: short stacking energy: -242.150 Base-Backbone interact. energy: -0.873 local terms energy: -275.004597 where: bonds (distance) C4'-P energy: -46.424 bonds (distance) P-C4' energy: -54.572 flat angles C4'-P-C4' energy: -60.974 flat angles P-C4'-P energy: -41.154 tors. eta vs tors. theta energy: -71.879 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 215 Temperature: 1.100000 Total energy: -914.927660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -914.927660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.127660 (E_RNA) where: Base-Base interactions energy: -528.612 where: short stacking energy: -241.863 Base-Backbone interact. energy: -2.740 local terms energy: -255.775691 where: bonds (distance) C4'-P energy: -40.632 bonds (distance) P-C4' energy: -59.765 flat angles C4'-P-C4' energy: -50.519 flat angles P-C4'-P energy: -29.477 tors. eta vs tors. theta energy: -75.382 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 215 Temperature: 1.150000 Total energy: -866.640267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.640267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.840267 (E_RNA) where: Base-Base interactions energy: -482.125 where: short stacking energy: -223.884 Base-Backbone interact. energy: 1.896 local terms energy: -258.610812 where: bonds (distance) C4'-P energy: -53.618 bonds (distance) P-C4' energy: -46.726 flat angles C4'-P-C4' energy: -54.352 flat angles P-C4'-P energy: -34.123 tors. eta vs tors. theta energy: -69.791 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 215 Temperature: 1.200000 Total energy: -829.626007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.626007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.026007 (E_RNA) where: Base-Base interactions energy: -471.727 where: short stacking energy: -214.403 Base-Backbone interact. energy: -0.355 local terms energy: -227.944098 where: bonds (distance) C4'-P energy: -44.213 bonds (distance) P-C4' energy: -41.775 flat angles C4'-P-C4' energy: -50.591 flat angles P-C4'-P energy: -32.939 tors. eta vs tors. theta energy: -58.427 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 215 Temperature: 1.250000 Total energy: -800.689084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.689084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.289084 (E_RNA) where: Base-Base interactions energy: -450.923 where: short stacking energy: -187.340 Base-Backbone interact. energy: -0.659 local terms energy: -226.706940 where: bonds (distance) C4'-P energy: -39.801 bonds (distance) P-C4' energy: -51.147 flat angles C4'-P-C4' energy: -55.421 flat angles P-C4'-P energy: -23.383 tors. eta vs tors. theta energy: -56.955 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 215 Temperature: 1.300000 Total energy: -723.830504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -723.830504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.030504 (E_RNA) where: Base-Base interactions energy: -405.387 where: short stacking energy: -167.900 Base-Backbone interact. energy: -0.480 local terms energy: -199.163364 where: bonds (distance) C4'-P energy: -44.562 bonds (distance) P-C4' energy: -46.641 flat angles C4'-P-C4' energy: -43.029 flat angles P-C4'-P energy: -23.557 tors. eta vs tors. theta energy: -41.374 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 215 Temperature: 1.350000 Total energy: -665.435427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.435427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.835427 (E_RNA) where: Base-Base interactions energy: -348.408 where: short stacking energy: -142.849 Base-Backbone interact. energy: -0.356 local terms energy: -196.071493 where: bonds (distance) C4'-P energy: -44.810 bonds (distance) P-C4' energy: -56.563 flat angles C4'-P-C4' energy: -38.332 flat angles P-C4'-P energy: -30.755 tors. eta vs tors. theta energy: -25.612 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 216 Temperature: 0.900000 Total energy: -1107.559034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1107.559034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -977.959034 (E_RNA) where: Base-Base interactions energy: -662.920 where: short stacking energy: -296.639 Base-Backbone interact. energy: -1.035 local terms energy: -314.003836 where: bonds (distance) C4'-P energy: -55.034 bonds (distance) P-C4' energy: -53.487 flat angles C4'-P-C4' energy: -65.204 flat angles P-C4'-P energy: -45.672 tors. eta vs tors. theta energy: -94.608 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 216 Temperature: 0.950000 Total energy: -1056.937921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1056.937921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -929.137921 (E_RNA) where: Base-Base interactions energy: -663.855 where: short stacking energy: -254.622 Base-Backbone interact. energy: -1.700 local terms energy: -263.582424 where: bonds (distance) C4'-P energy: -47.812 bonds (distance) P-C4' energy: -52.603 flat angles C4'-P-C4' energy: -57.957 flat angles P-C4'-P energy: -34.548 tors. eta vs tors. theta energy: -70.662 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 216 Temperature: 1.000000 Total energy: -1025.958739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.958739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -896.358739 (E_RNA) where: Base-Base interactions energy: -617.105 where: short stacking energy: -262.072 Base-Backbone interact. energy: 0.206 local terms energy: -279.459704 where: bonds (distance) C4'-P energy: -57.171 bonds (distance) P-C4' energy: -53.616 flat angles C4'-P-C4' energy: -54.941 flat angles P-C4'-P energy: -41.492 tors. eta vs tors. theta energy: -72.239 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 216 Temperature: 1.050000 Total energy: -971.078047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -971.078047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.478047 (E_RNA) where: Base-Base interactions energy: -567.342 where: short stacking energy: -234.167 Base-Backbone interact. energy: -0.320 local terms energy: -273.816235 where: bonds (distance) C4'-P energy: -50.497 bonds (distance) P-C4' energy: -49.819 flat angles C4'-P-C4' energy: -55.317 flat angles P-C4'-P energy: -39.721 tors. eta vs tors. theta energy: -78.461 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 216 Temperature: 1.100000 Total energy: -956.290811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -956.290811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -828.490811 (E_RNA) where: Base-Base interactions energy: -566.931 where: short stacking energy: -234.550 Base-Backbone interact. energy: 0.215 local terms energy: -261.775181 where: bonds (distance) C4'-P energy: -40.515 bonds (distance) P-C4' energy: -57.080 flat angles C4'-P-C4' energy: -51.568 flat angles P-C4'-P energy: -37.423 tors. eta vs tors. theta energy: -75.190 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 216 Temperature: 1.150000 Total energy: -860.826622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.826622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.426622 (E_RNA) where: Base-Base interactions energy: -486.457 where: short stacking energy: -208.290 Base-Backbone interact. energy: 0.473 local terms energy: -252.442906 where: bonds (distance) C4'-P energy: -55.001 bonds (distance) P-C4' energy: -44.952 flat angles C4'-P-C4' energy: -53.249 flat angles P-C4'-P energy: -37.806 tors. eta vs tors. theta energy: -61.435 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 216 Temperature: 1.200000 Total energy: -818.143992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.143992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.143992 (E_RNA) where: Base-Base interactions energy: -443.500 where: short stacking energy: -202.348 Base-Backbone interact. energy: -0.010 local terms energy: -248.634486 where: bonds (distance) C4'-P energy: -41.008 bonds (distance) P-C4' energy: -54.555 flat angles C4'-P-C4' energy: -55.220 flat angles P-C4'-P energy: -40.482 tors. eta vs tors. theta energy: -57.370 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 216 Temperature: 1.250000 Total energy: -824.908261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.908261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.108261 (E_RNA) where: Base-Base interactions energy: -458.275 where: short stacking energy: -195.583 Base-Backbone interact. energy: -0.826 local terms energy: -238.007417 where: bonds (distance) C4'-P energy: -45.637 bonds (distance) P-C4' energy: -46.645 flat angles C4'-P-C4' energy: -54.779 flat angles P-C4'-P energy: -34.958 tors. eta vs tors. theta energy: -55.989 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 216 Temperature: 1.300000 Total energy: -765.457434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.457434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.057434 (E_RNA) where: Base-Base interactions energy: -430.280 where: short stacking energy: -188.475 Base-Backbone interact. energy: 0.320 local terms energy: -213.096758 where: bonds (distance) C4'-P energy: -43.710 bonds (distance) P-C4' energy: -44.001 flat angles C4'-P-C4' energy: -40.527 flat angles P-C4'-P energy: -29.405 tors. eta vs tors. theta energy: -55.455 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 216 Temperature: 1.350000 Total energy: -649.300593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.300593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.500593 (E_RNA) where: Base-Base interactions energy: -328.510 where: short stacking energy: -139.059 Base-Backbone interact. energy: -0.019 local terms energy: -201.970969 where: bonds (distance) C4'-P energy: -44.753 bonds (distance) P-C4' energy: -49.734 flat angles C4'-P-C4' energy: -43.959 flat angles P-C4'-P energy: -33.003 tors. eta vs tors. theta energy: -30.522 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 217 Temperature: 0.900000 Total energy: -1112.724764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1112.724764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.124764 (E_RNA) where: Base-Base interactions energy: -671.639 where: short stacking energy: -298.426 Base-Backbone interact. energy: -0.327 local terms energy: -311.157881 where: bonds (distance) C4'-P energy: -51.147 bonds (distance) P-C4' energy: -55.238 flat angles C4'-P-C4' energy: -69.244 flat angles P-C4'-P energy: -45.090 tors. eta vs tors. theta energy: -90.438 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 217 Temperature: 0.950000 Total energy: -1076.484789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.484789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.284789 (E_RNA) where: Base-Base interactions energy: -654.093 where: short stacking energy: -245.030 Base-Backbone interact. energy: -1.236 local terms energy: -296.955664 where: bonds (distance) C4'-P energy: -56.577 bonds (distance) P-C4' energy: -58.055 flat angles C4'-P-C4' energy: -60.239 flat angles P-C4'-P energy: -46.055 tors. eta vs tors. theta energy: -76.030 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 217 Temperature: 1.000000 Total energy: -1047.835287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.835287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -918.235287 (E_RNA) where: Base-Base interactions energy: -635.289 where: short stacking energy: -265.211 Base-Backbone interact. energy: 0.530 local terms energy: -283.476231 where: bonds (distance) C4'-P energy: -57.126 bonds (distance) P-C4' energy: -49.614 flat angles C4'-P-C4' energy: -59.293 flat angles P-C4'-P energy: -45.341 tors. eta vs tors. theta energy: -72.102 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 217 Temperature: 1.050000 Total energy: -981.756331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -981.756331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.956331 (E_RNA) where: Base-Base interactions energy: -577.981 where: short stacking energy: -251.588 Base-Backbone interact. energy: 0.777 local terms energy: -276.752549 where: bonds (distance) C4'-P energy: -53.217 bonds (distance) P-C4' energy: -48.196 flat angles C4'-P-C4' energy: -62.097 flat angles P-C4'-P energy: -39.100 tors. eta vs tors. theta energy: -74.143 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 217 Temperature: 1.100000 Total energy: -949.555029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -949.555029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -825.355029 (E_RNA) where: Base-Base interactions energy: -563.754 where: short stacking energy: -236.121 Base-Backbone interact. energy: -1.341 local terms energy: -260.260371 where: bonds (distance) C4'-P energy: -50.302 bonds (distance) P-C4' energy: -43.138 flat angles C4'-P-C4' energy: -47.271 flat angles P-C4'-P energy: -40.866 tors. eta vs tors. theta energy: -78.684 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 217 Temperature: 1.150000 Total energy: -842.995137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -842.995137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.395137 (E_RNA) where: Base-Base interactions energy: -454.000 where: short stacking energy: -209.479 Base-Backbone interact. energy: -0.471 local terms energy: -258.924774 where: bonds (distance) C4'-P energy: -41.964 bonds (distance) P-C4' energy: -53.193 flat angles C4'-P-C4' energy: -58.855 flat angles P-C4'-P energy: -41.222 tors. eta vs tors. theta energy: -63.691 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 217 Temperature: 1.200000 Total energy: -855.964399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.964399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.164399 (E_RNA) where: Base-Base interactions energy: -469.348 where: short stacking energy: -216.079 Base-Backbone interact. energy: 1.478 local terms energy: -260.294593 where: bonds (distance) C4'-P energy: -38.114 bonds (distance) P-C4' energy: -51.328 flat angles C4'-P-C4' energy: -60.157 flat angles P-C4'-P energy: -39.430 tors. eta vs tors. theta energy: -71.266 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 217 Temperature: 1.250000 Total energy: -830.064221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -830.064221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.264221 (E_RNA) where: Base-Base interactions energy: -484.948 where: short stacking energy: -212.937 Base-Backbone interact. energy: -1.033 local terms energy: -216.283540 where: bonds (distance) C4'-P energy: -33.597 bonds (distance) P-C4' energy: -37.526 flat angles C4'-P-C4' energy: -48.137 flat angles P-C4'-P energy: -34.912 tors. eta vs tors. theta energy: -62.112 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 217 Temperature: 1.300000 Total energy: -779.685233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.685233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.485233 (E_RNA) where: Base-Base interactions energy: -420.383 where: short stacking energy: -174.173 Base-Backbone interact. energy: -0.287 local terms energy: -234.815173 where: bonds (distance) C4'-P energy: -48.138 bonds (distance) P-C4' energy: -47.981 flat angles C4'-P-C4' energy: -47.342 flat angles P-C4'-P energy: -32.840 tors. eta vs tors. theta energy: -58.513 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 217 Temperature: 1.350000 Total energy: -663.444329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.444329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.644329 (E_RNA) where: Base-Base interactions energy: -346.360 where: short stacking energy: -153.795 Base-Backbone interact. energy: -1.167 local terms energy: -188.117537 where: bonds (distance) C4'-P energy: -46.147 bonds (distance) P-C4' energy: -39.218 flat angles C4'-P-C4' energy: -37.531 flat angles P-C4'-P energy: -20.942 tors. eta vs tors. theta energy: -44.279 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 218 Temperature: 0.900000 Total energy: -1071.548204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1071.548204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -943.748204 (E_RNA) where: Base-Base interactions energy: -634.954 where: short stacking energy: -249.470 Base-Backbone interact. energy: -0.922 local terms energy: -307.872866 where: bonds (distance) C4'-P energy: -60.063 bonds (distance) P-C4' energy: -58.364 flat angles C4'-P-C4' energy: -67.447 flat angles P-C4'-P energy: -45.623 tors. eta vs tors. theta energy: -76.377 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 218 Temperature: 0.950000 Total energy: -1091.097854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.097854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.297854 (E_RNA) where: Base-Base interactions energy: -655.096 where: short stacking energy: -281.776 Base-Backbone interact. energy: -1.687 local terms energy: -306.515284 where: bonds (distance) C4'-P energy: -56.450 bonds (distance) P-C4' energy: -58.053 flat angles C4'-P-C4' energy: -64.974 flat angles P-C4'-P energy: -45.168 tors. eta vs tors. theta energy: -81.870 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 218 Temperature: 1.000000 Total energy: -990.210258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -990.210258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -862.410258 (E_RNA) where: Base-Base interactions energy: -570.658 where: short stacking energy: -259.630 Base-Backbone interact. energy: -0.549 local terms energy: -291.203773 where: bonds (distance) C4'-P energy: -55.282 bonds (distance) P-C4' energy: -52.121 flat angles C4'-P-C4' energy: -65.381 flat angles P-C4'-P energy: -39.659 tors. eta vs tors. theta energy: -78.761 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 218 Temperature: 1.050000 Total energy: -1032.811114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1032.811114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -903.211114 (E_RNA) where: Base-Base interactions energy: -613.935 where: short stacking energy: -262.319 Base-Backbone interact. energy: 0.742 local terms energy: -290.018087 where: bonds (distance) C4'-P energy: -59.331 bonds (distance) P-C4' energy: -53.742 flat angles C4'-P-C4' energy: -62.587 flat angles P-C4'-P energy: -36.620 tors. eta vs tors. theta energy: -77.739 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 218 Temperature: 1.100000 Total energy: -964.874665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.874665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.074665 (E_RNA) where: Base-Base interactions energy: -563.389 where: short stacking energy: -233.495 Base-Backbone interact. energy: -1.013 local terms energy: -272.672959 where: bonds (distance) C4'-P energy: -57.313 bonds (distance) P-C4' energy: -50.557 flat angles C4'-P-C4' energy: -49.845 flat angles P-C4'-P energy: -35.424 tors. eta vs tors. theta energy: -79.534 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 218 Temperature: 1.150000 Total energy: -877.510439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.510439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.910439 (E_RNA) where: Base-Base interactions energy: -486.611 where: short stacking energy: -207.089 Base-Backbone interact. energy: -0.525 local terms energy: -260.773826 where: bonds (distance) C4'-P energy: -51.218 bonds (distance) P-C4' energy: -58.211 flat angles C4'-P-C4' energy: -51.704 flat angles P-C4'-P energy: -36.789 tors. eta vs tors. theta energy: -62.851 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 218 Temperature: 1.200000 Total energy: -835.537792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.537792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.337792 (E_RNA) where: Base-Base interactions energy: -461.473 where: short stacking energy: -190.676 Base-Backbone interact. energy: -0.623 local terms energy: -249.241473 where: bonds (distance) C4'-P energy: -49.474 bonds (distance) P-C4' energy: -44.383 flat angles C4'-P-C4' energy: -56.697 flat angles P-C4'-P energy: -40.977 tors. eta vs tors. theta energy: -57.711 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 218 Temperature: 1.250000 Total energy: -810.719381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.719381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.919381 (E_RNA) where: Base-Base interactions energy: -425.669 where: short stacking energy: -183.194 Base-Backbone interact. energy: -1.266 local terms energy: -255.983966 where: bonds (distance) C4'-P energy: -49.421 bonds (distance) P-C4' energy: -54.224 flat angles C4'-P-C4' energy: -58.757 flat angles P-C4'-P energy: -33.570 tors. eta vs tors. theta energy: -60.012 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 218 Temperature: 1.300000 Total energy: -811.138503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -811.138503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.938503 (E_RNA) where: Base-Base interactions energy: -451.266 where: short stacking energy: -195.274 Base-Backbone interact. energy: -1.410 local terms energy: -234.262900 where: bonds (distance) C4'-P energy: -50.495 bonds (distance) P-C4' energy: -49.306 flat angles C4'-P-C4' energy: -41.266 flat angles P-C4'-P energy: -38.437 tors. eta vs tors. theta energy: -54.759 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 218 Temperature: 1.350000 Total energy: -671.812790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.812790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.412790 (E_RNA) where: Base-Base interactions energy: -370.896 where: short stacking energy: -161.701 Base-Backbone interact. energy: -0.683 local terms energy: -177.834298 where: bonds (distance) C4'-P energy: -37.608 bonds (distance) P-C4' energy: -38.001 flat angles C4'-P-C4' energy: -45.720 flat angles P-C4'-P energy: -19.995 tors. eta vs tors. theta energy: -36.510 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 219 Temperature: 0.900000 Total energy: -1085.576620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.576620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -959.576620 (E_RNA) where: Base-Base interactions energy: -658.866 where: short stacking energy: -257.698 Base-Backbone interact. energy: -2.247 local terms energy: -298.463442 where: bonds (distance) C4'-P energy: -59.080 bonds (distance) P-C4' energy: -57.737 flat angles C4'-P-C4' energy: -60.090 flat angles P-C4'-P energy: -40.084 tors. eta vs tors. theta energy: -81.472 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 219 Temperature: 0.950000 Total energy: -1068.314058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.314058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.514058 (E_RNA) where: Base-Base interactions energy: -639.269 where: short stacking energy: -260.679 Base-Backbone interact. energy: -1.224 local terms energy: -300.020650 where: bonds (distance) C4'-P energy: -48.320 bonds (distance) P-C4' energy: -58.863 flat angles C4'-P-C4' energy: -63.637 flat angles P-C4'-P energy: -48.716 tors. eta vs tors. theta energy: -80.484 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 219 Temperature: 1.000000 Total energy: -978.695891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.695891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -850.895891 (E_RNA) where: Base-Base interactions energy: -570.869 where: short stacking energy: -244.773 Base-Backbone interact. energy: -0.969 local terms energy: -279.057617 where: bonds (distance) C4'-P energy: -54.494 bonds (distance) P-C4' energy: -55.800 flat angles C4'-P-C4' energy: -56.523 flat angles P-C4'-P energy: -37.418 tors. eta vs tors. theta energy: -74.824 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 219 Temperature: 1.050000 Total energy: -1027.682496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1027.682496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -899.882496 (E_RNA) where: Base-Base interactions energy: -612.090 where: short stacking energy: -247.603 Base-Backbone interact. energy: -0.355 local terms energy: -287.437899 where: bonds (distance) C4'-P energy: -48.119 bonds (distance) P-C4' energy: -56.913 flat angles C4'-P-C4' energy: -61.944 flat angles P-C4'-P energy: -38.299 tors. eta vs tors. theta energy: -82.163 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 219 Temperature: 1.100000 Total energy: -940.551257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -940.551257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -818.151257 (E_RNA) where: Base-Base interactions energy: -577.214 where: short stacking energy: -234.686 Base-Backbone interact. energy: 1.934 local terms energy: -242.870645 where: bonds (distance) C4'-P energy: -51.540 bonds (distance) P-C4' energy: -41.401 flat angles C4'-P-C4' energy: -57.440 flat angles P-C4'-P energy: -26.143 tors. eta vs tors. theta energy: -66.346 Dist. restrs. and SS energy: -122.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 219 Temperature: 1.150000 Total energy: -859.832582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -859.832582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.232582 (E_RNA) where: Base-Base interactions energy: -477.479 where: short stacking energy: -219.835 Base-Backbone interact. energy: -1.232 local terms energy: -260.521629 where: bonds (distance) C4'-P energy: -45.204 bonds (distance) P-C4' energy: -57.132 flat angles C4'-P-C4' energy: -53.248 flat angles P-C4'-P energy: -41.502 tors. eta vs tors. theta energy: -63.436 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 219 Temperature: 1.200000 Total energy: -838.237413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.237413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.437413 (E_RNA) where: Base-Base interactions energy: -465.754 where: short stacking energy: -205.502 Base-Backbone interact. energy: 0.594 local terms energy: -245.277523 where: bonds (distance) C4'-P energy: -56.065 bonds (distance) P-C4' energy: -51.693 flat angles C4'-P-C4' energy: -42.218 flat angles P-C4'-P energy: -39.711 tors. eta vs tors. theta energy: -55.591 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 219 Temperature: 1.250000 Total energy: -798.918469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.918469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.118469 (E_RNA) where: Base-Base interactions energy: -462.762 where: short stacking energy: -180.913 Base-Backbone interact. energy: -1.388 local terms energy: -206.968370 where: bonds (distance) C4'-P energy: -45.298 bonds (distance) P-C4' energy: -35.332 flat angles C4'-P-C4' energy: -53.308 flat angles P-C4'-P energy: -28.562 tors. eta vs tors. theta energy: -44.468 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 219 Temperature: 1.300000 Total energy: -824.905723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.905723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.105723 (E_RNA) where: Base-Base interactions energy: -459.007 where: short stacking energy: -192.406 Base-Backbone interact. energy: -1.007 local terms energy: -237.091786 where: bonds (distance) C4'-P energy: -53.756 bonds (distance) P-C4' energy: -47.126 flat angles C4'-P-C4' energy: -50.830 flat angles P-C4'-P energy: -34.627 tors. eta vs tors. theta energy: -50.753 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 219 Temperature: 1.350000 Total energy: -680.748356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.748356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.948356 (E_RNA) where: Base-Base interactions energy: -344.443 where: short stacking energy: -147.366 Base-Backbone interact. energy: 0.738 local terms energy: -218.243598 where: bonds (distance) C4'-P energy: -42.552 bonds (distance) P-C4' energy: -58.144 flat angles C4'-P-C4' energy: -45.653 flat angles P-C4'-P energy: -36.273 tors. eta vs tors. theta energy: -35.622 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 220 Temperature: 0.900000 Total energy: -1096.037488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.037488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -968.237488 (E_RNA) where: Base-Base interactions energy: -643.788 where: short stacking energy: -270.917 Base-Backbone interact. energy: -1.107 local terms energy: -323.342264 where: bonds (distance) C4'-P energy: -59.119 bonds (distance) P-C4' energy: -65.431 flat angles C4'-P-C4' energy: -64.471 flat angles P-C4'-P energy: -47.185 tors. eta vs tors. theta energy: -87.137 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 220 Temperature: 0.950000 Total energy: -1068.931709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.931709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.331709 (E_RNA) where: Base-Base interactions energy: -648.687 where: short stacking energy: -241.391 Base-Backbone interact. energy: 0.170 local terms energy: -290.814146 where: bonds (distance) C4'-P energy: -48.958 bonds (distance) P-C4' energy: -58.245 flat angles C4'-P-C4' energy: -63.833 flat angles P-C4'-P energy: -47.703 tors. eta vs tors. theta energy: -72.075 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 220 Temperature: 1.000000 Total energy: -1046.820434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1046.820434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.020434 (E_RNA) where: Base-Base interactions energy: -632.174 where: short stacking energy: -263.294 Base-Backbone interact. energy: 0.804 local terms energy: -287.649914 where: bonds (distance) C4'-P energy: -49.384 bonds (distance) P-C4' energy: -61.254 flat angles C4'-P-C4' energy: -57.387 flat angles P-C4'-P energy: -39.083 tors. eta vs tors. theta energy: -80.542 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 220 Temperature: 1.050000 Total energy: -972.309361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.309361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -842.709361 (E_RNA) where: Base-Base interactions energy: -578.535 where: short stacking energy: -239.566 Base-Backbone interact. energy: -0.541 local terms energy: -263.632937 where: bonds (distance) C4'-P energy: -47.973 bonds (distance) P-C4' energy: -54.864 flat angles C4'-P-C4' energy: -54.115 flat angles P-C4'-P energy: -33.602 tors. eta vs tors. theta energy: -73.078 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 220 Temperature: 1.100000 Total energy: -920.230978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.230978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -792.430978 (E_RNA) where: Base-Base interactions energy: -523.970 where: short stacking energy: -223.490 Base-Backbone interact. energy: -2.223 local terms energy: -266.238077 where: bonds (distance) C4'-P energy: -52.798 bonds (distance) P-C4' energy: -56.423 flat angles C4'-P-C4' energy: -48.344 flat angles P-C4'-P energy: -39.285 tors. eta vs tors. theta energy: -69.387 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 220 Temperature: 1.150000 Total energy: -851.704599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -851.704599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.904599 (E_RNA) where: Base-Base interactions energy: -494.736 where: short stacking energy: -215.396 Base-Backbone interact. energy: 3.284 local terms energy: -232.452459 where: bonds (distance) C4'-P energy: -47.922 bonds (distance) P-C4' energy: -43.390 flat angles C4'-P-C4' energy: -47.142 flat angles P-C4'-P energy: -36.901 tors. eta vs tors. theta energy: -57.099 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 220 Temperature: 1.200000 Total energy: -845.490738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.490738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.290738 (E_RNA) where: Base-Base interactions energy: -476.221 where: short stacking energy: -208.338 Base-Backbone interact. energy: -0.285 local terms energy: -244.784489 where: bonds (distance) C4'-P energy: -48.495 bonds (distance) P-C4' energy: -43.969 flat angles C4'-P-C4' energy: -60.133 flat angles P-C4'-P energy: -35.430 tors. eta vs tors. theta energy: -56.757 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 220 Temperature: 1.250000 Total energy: -831.417817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.417817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.417817 (E_RNA) where: Base-Base interactions energy: -467.619 where: short stacking energy: -199.367 Base-Backbone interact. energy: -0.038 local terms energy: -237.761016 where: bonds (distance) C4'-P energy: -47.162 bonds (distance) P-C4' energy: -42.141 flat angles C4'-P-C4' energy: -59.919 flat angles P-C4'-P energy: -26.354 tors. eta vs tors. theta energy: -62.186 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 220 Temperature: 1.300000 Total energy: -776.006525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.006525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.206525 (E_RNA) where: Base-Base interactions energy: -451.673 where: short stacking energy: -186.525 Base-Backbone interact. energy: -0.546 local terms energy: -204.987094 where: bonds (distance) C4'-P energy: -51.840 bonds (distance) P-C4' energy: -39.931 flat angles C4'-P-C4' energy: -41.083 flat angles P-C4'-P energy: -26.247 tors. eta vs tors. theta energy: -45.887 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 220 Temperature: 1.350000 Total energy: -641.531067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -641.531067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.931067 (E_RNA) where: Base-Base interactions energy: -336.981 where: short stacking energy: -131.106 Base-Backbone interact. energy: -0.003 local terms energy: -183.946872 where: bonds (distance) C4'-P energy: -32.159 bonds (distance) P-C4' energy: -47.816 flat angles C4'-P-C4' energy: -41.122 flat angles P-C4'-P energy: -32.462 tors. eta vs tors. theta energy: -30.388 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 221 Temperature: 0.900000 Total energy: -1109.217605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1109.217605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -979.617605 (E_RNA) where: Base-Base interactions energy: -661.043 where: short stacking energy: -288.929 Base-Backbone interact. energy: -2.270 local terms energy: -316.304821 where: bonds (distance) C4'-P energy: -59.837 bonds (distance) P-C4' energy: -58.802 flat angles C4'-P-C4' energy: -63.998 flat angles P-C4'-P energy: -44.659 tors. eta vs tors. theta energy: -89.008 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 221 Temperature: 0.950000 Total energy: -1068.542963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.542963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -942.542963 (E_RNA) where: Base-Base interactions energy: -640.720 where: short stacking energy: -258.458 Base-Backbone interact. energy: -0.870 local terms energy: -300.953772 where: bonds (distance) C4'-P energy: -52.545 bonds (distance) P-C4' energy: -52.839 flat angles C4'-P-C4' energy: -70.193 flat angles P-C4'-P energy: -43.715 tors. eta vs tors. theta energy: -81.662 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 221 Temperature: 1.000000 Total energy: -1036.749212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1036.749212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -908.949212 (E_RNA) where: Base-Base interactions energy: -617.585 where: short stacking energy: -256.610 Base-Backbone interact. energy: -0.255 local terms energy: -291.108959 where: bonds (distance) C4'-P energy: -56.348 bonds (distance) P-C4' energy: -48.639 flat angles C4'-P-C4' energy: -64.325 flat angles P-C4'-P energy: -43.243 tors. eta vs tors. theta energy: -78.553 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 221 Temperature: 1.050000 Total energy: -982.892218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.892218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.092218 (E_RNA) where: Base-Base interactions energy: -563.734 where: short stacking energy: -246.241 Base-Backbone interact. energy: -2.472 local terms energy: -288.885895 where: bonds (distance) C4'-P energy: -54.354 bonds (distance) P-C4' energy: -51.532 flat angles C4'-P-C4' energy: -56.928 flat angles P-C4'-P energy: -51.728 tors. eta vs tors. theta energy: -74.344 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 221 Temperature: 1.100000 Total energy: -967.754476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -967.754476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -839.954476 (E_RNA) where: Base-Base interactions energy: -557.472 where: short stacking energy: -237.070 Base-Backbone interact. energy: -0.066 local terms energy: -282.416439 where: bonds (distance) C4'-P energy: -37.317 bonds (distance) P-C4' energy: -61.140 flat angles C4'-P-C4' energy: -61.610 flat angles P-C4'-P energy: -41.939 tors. eta vs tors. theta energy: -80.411 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 221 Temperature: 1.150000 Total energy: -862.429114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.429114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.629114 (E_RNA) where: Base-Base interactions energy: -485.355 where: short stacking energy: -227.155 Base-Backbone interact. energy: -0.570 local terms energy: -248.704241 where: bonds (distance) C4'-P energy: -49.905 bonds (distance) P-C4' energy: -52.640 flat angles C4'-P-C4' energy: -53.989 flat angles P-C4'-P energy: -21.069 tors. eta vs tors. theta energy: -71.102 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 221 Temperature: 1.200000 Total energy: -821.031738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -821.031738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.031738 (E_RNA) where: Base-Base interactions energy: -471.913 where: short stacking energy: -201.467 Base-Backbone interact. energy: 0.787 local terms energy: -223.905198 where: bonds (distance) C4'-P energy: -40.659 bonds (distance) P-C4' energy: -50.096 flat angles C4'-P-C4' energy: -41.052 flat angles P-C4'-P energy: -30.273 tors. eta vs tors. theta energy: -61.825 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 221 Temperature: 1.250000 Total energy: -794.055080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.055080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.455080 (E_RNA) where: Base-Base interactions energy: -434.850 where: short stacking energy: -199.538 Base-Backbone interact. energy: -0.962 local terms energy: -237.643740 where: bonds (distance) C4'-P energy: -53.958 bonds (distance) P-C4' energy: -55.813 flat angles C4'-P-C4' energy: -39.530 flat angles P-C4'-P energy: -32.409 tors. eta vs tors. theta energy: -55.934 Dist. restrs. and SS energy: -120.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 221 Temperature: 1.300000 Total energy: -765.205953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.205953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.405953 (E_RNA) where: Base-Base interactions energy: -411.310 where: short stacking energy: -176.806 Base-Backbone interact. energy: 1.004 local terms energy: -227.100548 where: bonds (distance) C4'-P energy: -44.627 bonds (distance) P-C4' energy: -40.609 flat angles C4'-P-C4' energy: -55.963 flat angles P-C4'-P energy: -38.716 tors. eta vs tors. theta energy: -47.186 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 221 Temperature: 1.350000 Total energy: -738.091344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.091344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.291344 (E_RNA) where: Base-Base interactions energy: -393.423 where: short stacking energy: -167.807 Base-Backbone interact. energy: -0.388 local terms energy: -216.480181 where: bonds (distance) C4'-P energy: -51.371 bonds (distance) P-C4' energy: -40.247 flat angles C4'-P-C4' energy: -49.815 flat angles P-C4'-P energy: -37.802 tors. eta vs tors. theta energy: -37.245 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 222 Temperature: 0.900000 Total energy: -1093.830379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1093.830379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.230379 (E_RNA) where: Base-Base interactions energy: -668.564 where: short stacking energy: -253.913 Base-Backbone interact. energy: -1.747 local terms energy: -293.919483 where: bonds (distance) C4'-P energy: -57.797 bonds (distance) P-C4' energy: -49.854 flat angles C4'-P-C4' energy: -67.191 flat angles P-C4'-P energy: -44.327 tors. eta vs tors. theta energy: -74.751 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 222 Temperature: 0.950000 Total energy: -1067.590526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.590526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.990526 (E_RNA) where: Base-Base interactions energy: -645.001 where: short stacking energy: -276.501 Base-Backbone interact. energy: -0.104 local terms energy: -292.885142 where: bonds (distance) C4'-P energy: -46.864 bonds (distance) P-C4' energy: -51.988 flat angles C4'-P-C4' energy: -65.303 flat angles P-C4'-P energy: -41.998 tors. eta vs tors. theta energy: -86.733 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 222 Temperature: 1.000000 Total energy: -1066.762262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1066.762262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.762262 (E_RNA) where: Base-Base interactions energy: -641.634 where: short stacking energy: -283.288 Base-Backbone interact. energy: 0.252 local terms energy: -299.379736 where: bonds (distance) C4'-P energy: -53.473 bonds (distance) P-C4' energy: -56.997 flat angles C4'-P-C4' energy: -57.651 flat angles P-C4'-P energy: -45.929 tors. eta vs tors. theta energy: -85.329 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 222 Temperature: 1.050000 Total energy: -992.023292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -992.023292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -864.223292 (E_RNA) where: Base-Base interactions energy: -575.518 where: short stacking energy: -256.754 Base-Backbone interact. energy: 2.221 local terms energy: -290.925666 where: bonds (distance) C4'-P energy: -52.726 bonds (distance) P-C4' energy: -51.321 flat angles C4'-P-C4' energy: -60.522 flat angles P-C4'-P energy: -45.029 tors. eta vs tors. theta energy: -81.328 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 222 Temperature: 1.100000 Total energy: -956.824461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -956.824461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -830.824461 (E_RNA) where: Base-Base interactions energy: -577.234 where: short stacking energy: -249.207 Base-Backbone interact. energy: -1.621 local terms energy: -251.969700 where: bonds (distance) C4'-P energy: -48.785 bonds (distance) P-C4' energy: -50.031 flat angles C4'-P-C4' energy: -55.655 flat angles P-C4'-P energy: -27.665 tors. eta vs tors. theta energy: -69.834 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 222 Temperature: 1.150000 Total energy: -889.908708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.908708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.908708 (E_RNA) where: Base-Base interactions energy: -510.270 where: short stacking energy: -228.155 Base-Backbone interact. energy: 1.834 local terms energy: -255.472791 where: bonds (distance) C4'-P energy: -48.345 bonds (distance) P-C4' energy: -54.562 flat angles C4'-P-C4' energy: -54.896 flat angles P-C4'-P energy: -41.313 tors. eta vs tors. theta energy: -56.356 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 222 Temperature: 1.200000 Total energy: -845.604542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.604542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.804542 (E_RNA) where: Base-Base interactions energy: -452.862 where: short stacking energy: -195.204 Base-Backbone interact. energy: -0.816 local terms energy: -264.126293 where: bonds (distance) C4'-P energy: -61.434 bonds (distance) P-C4' energy: -55.987 flat angles C4'-P-C4' energy: -53.418 flat angles P-C4'-P energy: -37.342 tors. eta vs tors. theta energy: -55.945 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 222 Temperature: 1.250000 Total energy: -805.274403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -805.274403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.674403 (E_RNA) where: Base-Base interactions energy: -446.348 where: short stacking energy: -190.769 Base-Backbone interact. energy: -0.871 local terms energy: -228.455458 where: bonds (distance) C4'-P energy: -51.891 bonds (distance) P-C4' energy: -39.779 flat angles C4'-P-C4' energy: -56.999 flat angles P-C4'-P energy: -28.819 tors. eta vs tors. theta energy: -50.966 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 222 Temperature: 1.300000 Total energy: -686.408075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.408075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.408075 (E_RNA) where: Base-Base interactions energy: -369.858 where: short stacking energy: -163.100 Base-Backbone interact. energy: -0.123 local terms energy: -190.427021 where: bonds (distance) C4'-P energy: -50.413 bonds (distance) P-C4' energy: -42.507 flat angles C4'-P-C4' energy: -44.318 flat angles P-C4'-P energy: -20.408 tors. eta vs tors. theta energy: -32.781 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 222 Temperature: 1.350000 Total energy: -719.441734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.441734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.641734 (E_RNA) where: Base-Base interactions energy: -396.771 where: short stacking energy: -173.380 Base-Backbone interact. energy: 0.905 local terms energy: -195.776223 where: bonds (distance) C4'-P energy: -31.136 bonds (distance) P-C4' energy: -41.798 flat angles C4'-P-C4' energy: -50.414 flat angles P-C4'-P energy: -31.746 tors. eta vs tors. theta energy: -40.682 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) out arg RESULTS//1/VHL_HX5-6a8f7586_01 ================================== temp. level: 1, replica: 1 ===================================== Write number: 223 Temperature: 0.900000 Total energy: -1096.546294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.546294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.946294 (E_RNA) where: Base-Base interactions energy: -672.341 where: short stacking energy: -268.811 Base-Backbone interact. energy: -0.099 local terms energy: -294.506580 where: bonds (distance) C4'-P energy: -58.871 bonds (distance) P-C4' energy: -57.127 flat angles C4'-P-C4' energy: -58.456 flat angles P-C4'-P energy: -43.965 tors. eta vs tors. theta energy: -76.088 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 223 Temperature: 0.950000 Total energy: -1070.275660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1070.275660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -946.075660 (E_RNA) where: Base-Base interactions energy: -629.702 where: short stacking energy: -271.264 Base-Backbone interact. energy: 0.569 local terms energy: -316.941829 where: bonds (distance) C4'-P energy: -55.947 bonds (distance) P-C4' energy: -60.825 flat angles C4'-P-C4' energy: -65.312 flat angles P-C4'-P energy: -47.482 tors. eta vs tors. theta energy: -87.376 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 223 Temperature: 1.000000 Total energy: -1047.406469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.406469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -917.806469 (E_RNA) where: Base-Base interactions energy: -631.284 where: short stacking energy: -268.554 Base-Backbone interact. energy: -1.033 local terms energy: -285.489344 where: bonds (distance) C4'-P energy: -55.382 bonds (distance) P-C4' energy: -48.925 flat angles C4'-P-C4' energy: -53.821 flat angles P-C4'-P energy: -44.420 tors. eta vs tors. theta energy: -82.942 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 223 Temperature: 1.050000 Total energy: -963.016268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.016268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.416268 (E_RNA) where: Base-Base interactions energy: -550.240 where: short stacking energy: -249.742 Base-Backbone interact. energy: -1.712 local terms energy: -281.464134 where: bonds (distance) C4'-P energy: -54.883 bonds (distance) P-C4' energy: -50.652 flat angles C4'-P-C4' energy: -63.967 flat angles P-C4'-P energy: -39.324 tors. eta vs tors. theta energy: -72.637 Dist. restrs. and SS energy: -129.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 223 Temperature: 1.100000 Total energy: -960.353234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.353234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.153234 (E_RNA) where: Base-Base interactions energy: -560.204 where: short stacking energy: -240.557 Base-Backbone interact. energy: -1.669 local terms energy: -274.280068 where: bonds (distance) C4'-P energy: -47.075 bonds (distance) P-C4' energy: -59.770 flat angles C4'-P-C4' energy: -57.657 flat angles P-C4'-P energy: -37.284 tors. eta vs tors. theta energy: -72.494 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 223 Temperature: 1.150000 Total energy: -836.698180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.698180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.898180 (E_RNA) where: Base-Base interactions energy: -463.860 where: short stacking energy: -194.290 Base-Backbone interact. energy: 0.258 local terms energy: -245.296290 where: bonds (distance) C4'-P energy: -47.072 bonds (distance) P-C4' energy: -51.508 flat angles C4'-P-C4' energy: -49.461 flat angles P-C4'-P energy: -37.535 tors. eta vs tors. theta energy: -59.720 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 223 Temperature: 1.200000 Total energy: -814.309136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.309136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.509136 (E_RNA) where: Base-Base interactions energy: -453.506 where: short stacking energy: -187.230 Base-Backbone interact. energy: -0.629 local terms energy: -232.373676 where: bonds (distance) C4'-P energy: -53.059 bonds (distance) P-C4' energy: -39.058 flat angles C4'-P-C4' energy: -53.923 flat angles P-C4'-P energy: -35.942 tors. eta vs tors. theta energy: -50.393 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 223 Temperature: 1.250000 Total energy: -814.021962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.021962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.821962 (E_RNA) where: Base-Base interactions energy: -465.357 where: short stacking energy: -195.800 Base-Backbone interact. energy: -1.617 local terms energy: -222.848544 where: bonds (distance) C4'-P energy: -42.210 bonds (distance) P-C4' energy: -52.770 flat angles C4'-P-C4' energy: -49.799 flat angles P-C4'-P energy: -24.884 tors. eta vs tors. theta energy: -53.185 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 223 Temperature: 1.300000 Total energy: -689.313592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.313592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.513592 (E_RNA) where: Base-Base interactions energy: -358.904 where: short stacking energy: -150.213 Base-Backbone interact. energy: -2.038 local terms energy: -200.571444 where: bonds (distance) C4'-P energy: -36.810 bonds (distance) P-C4' energy: -47.359 flat angles C4'-P-C4' energy: -45.126 flat angles P-C4'-P energy: -34.611 tors. eta vs tors. theta energy: -36.666 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 223 Temperature: 1.350000 Total energy: -702.039102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.039102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.239102 (E_RNA) where: Base-Base interactions energy: -377.397 where: short stacking energy: -164.219 Base-Backbone interact. energy: -0.441 local terms energy: -205.401160 where: bonds (distance) C4'-P energy: -37.081 bonds (distance) P-C4' energy: -41.171 flat angles C4'-P-C4' energy: -50.971 flat angles P-C4'-P energy: -33.102 tors. eta vs tors. theta energy: -43.076 Dist. restrs. and SS energy: -118.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 224 Temperature: 0.900000 Total energy: -1096.558645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.558645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -968.758645 (E_RNA) where: Base-Base interactions energy: -661.998 where: short stacking energy: -254.468 Base-Backbone interact. energy: -1.545 local terms energy: -305.215285 where: bonds (distance) C4'-P energy: -65.105 bonds (distance) P-C4' energy: -56.709 flat angles C4'-P-C4' energy: -61.981 flat angles P-C4'-P energy: -42.019 tors. eta vs tors. theta energy: -79.402 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 224 Temperature: 0.950000 Total energy: -1055.112064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.112064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.312064 (E_RNA) where: Base-Base interactions energy: -632.577 where: short stacking energy: -276.827 Base-Backbone interact. energy: -0.573 local terms energy: -294.162266 where: bonds (distance) C4'-P energy: -54.276 bonds (distance) P-C4' energy: -51.039 flat angles C4'-P-C4' energy: -67.920 flat angles P-C4'-P energy: -41.422 tors. eta vs tors. theta energy: -79.506 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 224 Temperature: 1.000000 Total energy: -1076.608116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.608116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -950.608116 (E_RNA) where: Base-Base interactions energy: -636.404 where: short stacking energy: -263.872 Base-Backbone interact. energy: -1.822 local terms energy: -312.382471 where: bonds (distance) C4'-P energy: -57.492 bonds (distance) P-C4' energy: -56.176 flat angles C4'-P-C4' energy: -62.330 flat angles P-C4'-P energy: -47.213 tors. eta vs tors. theta energy: -89.171 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 224 Temperature: 1.050000 Total energy: -964.732316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.732316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.932316 (E_RNA) where: Base-Base interactions energy: -555.734 where: short stacking energy: -239.491 Base-Backbone interact. energy: -0.737 local terms energy: -280.460520 where: bonds (distance) C4'-P energy: -55.300 bonds (distance) P-C4' energy: -58.708 flat angles C4'-P-C4' energy: -52.260 flat angles P-C4'-P energy: -43.230 tors. eta vs tors. theta energy: -70.963 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 224 Temperature: 1.100000 Total energy: -974.780542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -974.780542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -848.780542 (E_RNA) where: Base-Base interactions energy: -577.941 where: short stacking energy: -246.766 Base-Backbone interact. energy: -1.347 local terms energy: -269.493238 where: bonds (distance) C4'-P energy: -54.222 bonds (distance) P-C4' energy: -53.989 flat angles C4'-P-C4' energy: -52.278 flat angles P-C4'-P energy: -36.943 tors. eta vs tors. theta energy: -72.061 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 224 Temperature: 1.150000 Total energy: -862.412626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.412626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.212626 (E_RNA) where: Base-Base interactions energy: -469.050 where: short stacking energy: -211.516 Base-Backbone interact. energy: -1.805 local terms energy: -267.357457 where: bonds (distance) C4'-P energy: -47.709 bonds (distance) P-C4' energy: -61.757 flat angles C4'-P-C4' energy: -56.052 flat angles P-C4'-P energy: -38.404 tors. eta vs tors. theta energy: -63.436 Dist. restrs. and SS energy: -124.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 224 Temperature: 1.200000 Total energy: -834.131331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.131331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.331331 (E_RNA) where: Base-Base interactions energy: -470.517 where: short stacking energy: -197.246 Base-Backbone interact. energy: -1.936 local terms energy: -233.878218 where: bonds (distance) C4'-P energy: -47.991 bonds (distance) P-C4' energy: -46.831 flat angles C4'-P-C4' energy: -52.691 flat angles P-C4'-P energy: -37.249 tors. eta vs tors. theta energy: -49.117 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 224 Temperature: 1.250000 Total energy: -829.773377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.773377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.773377 (E_RNA) where: Base-Base interactions energy: -459.625 where: short stacking energy: -203.324 Base-Backbone interact. energy: 1.597 local terms energy: -245.745645 where: bonds (distance) C4'-P energy: -53.327 bonds (distance) P-C4' energy: -41.549 flat angles C4'-P-C4' energy: -63.471 flat angles P-C4'-P energy: -29.807 tors. eta vs tors. theta energy: -57.592 Dist. restrs. and SS energy: -126.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 224 Temperature: 1.300000 Total energy: -752.880242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.880242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -625.080242 (E_RNA) where: Base-Base interactions energy: -418.262 where: short stacking energy: -181.137 Base-Backbone interact. energy: -1.331 local terms energy: -205.487213 where: bonds (distance) C4'-P energy: -40.990 bonds (distance) P-C4' energy: -43.010 flat angles C4'-P-C4' energy: -46.043 flat angles P-C4'-P energy: -29.862 tors. eta vs tors. theta energy: -45.582 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 224 Temperature: 1.350000 Total energy: -691.965379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.965379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.165379 (E_RNA) where: Base-Base interactions energy: -377.656 where: short stacking energy: -161.075 Base-Backbone interact. energy: -0.025 local terms energy: -186.484243 where: bonds (distance) C4'-P energy: -38.754 bonds (distance) P-C4' energy: -40.446 flat angles C4'-P-C4' energy: -38.733 flat angles P-C4'-P energy: -25.676 tors. eta vs tors. theta energy: -42.875 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)