SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 8 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Two-chained_RNA-102b556e/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Two-chained_RNA-102b556e/inputs/seq.fa: 2 curr_seq: _GCUCUCAAGGAGAACGGCGGCGCCAGACUGGCCGAGUACCACGCC_ curr_seq: _GGCGUGGUACUCGGCCAGUCUGGCGCCGCCGUCCUGCUUCAGAUC_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GCUCUCAAGGAGAACGGCGGCGCCAGACUGGCCGAGUACCACGCC chainId: B, chainSeq: GGCGUGGUACUCGGCCAGUCUGGCGCCGCCGUCCUGCUUCAGAUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 45 nucleotides chain B contains 45 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 460 n_atoms_counter: 460 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 90.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 90.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 800000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Two-chained_RNA-102b556e/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Two-chained_RNA-102b556e/inputs/seq.fa: 2 curr_seq: _GCUCUCAAGGAGAACGGCGGCGCCAGACUGGCCGAGUACCACGCC_ curr_seq: _GGCGUGGUACUCGGCCAGUCUGGCGCCGCCGUCCUGCUUCAGAUC_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GCUCUCAAGGAGAACGGCGGCGCCAGACUGGCCGAGUACCACGCC chainId: B, chainSeq: GGCGUGGUACUCGGCCAGUCUGGCGCCGCCGUCCUGCUUCAGAUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 45 nucleotides chain B contains 45 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 460 n_atoms_counter: 460 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 90.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 90.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 800000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.964 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Two-chained_RNA-102b556e/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Two-chained_RNA-102b556e/inputs/seq.fa: 2 curr_seq: _GCUCUCAAGGAGAACGGCGGCGCCAGACUGGCCGAGUACCACGCC_ curr_seq: _GGCGUGGUACUCGGCCAGUCUGGCGCCGCCGUCCUGCUUCAGAUC_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GCUCUCAAGGAGAACGGCGGCGCCAGACUGGCCGAGUACCACGCC chainId: B, chainSeq: GGCGUGGUACUCGGCCAGUCUGGCGCCGCCGUCCUGCUUCAGAUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 45 nucleotides chain B contains 45 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 460 n_atoms_counter: 460 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 90.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 90.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 800000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.029 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Two-chained_RNA-102b556e/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Two-chained_RNA-102b556e/inputs/seq.fa: 2 curr_seq: _GCUCUCAAGGAGAACGGCGGCGCCAGACUGGCCGAGUACCACGCC_ curr_seq: _GGCGUGGUACUCGGCCAGUCUGGCGCCGCCGUCCUGCUUCAGAUC_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GCUCUCAAGGAGAACGGCGGCGCCAGACUGGCCGAGUACCACGCC chainId: B, chainSeq: GGCGUGGUACUCGGCCAGUCUGGCGCCGCCGUCCUGCUUCAGAUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 45 nucleotides chain B contains 45 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 460 n_atoms_counter: 460 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 90.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 90.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 800000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.093 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Two-chained_RNA-102b556e/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Two-chained_RNA-102b556e/inputs/seq.fa: 2 curr_seq: _GCUCUCAAGGAGAACGGCGGCGCCAGACUGGCCGAGUACCACGCC_ curr_seq: _GGCGUGGUACUCGGCCAGUCUGGCGCCGCCGUCCUGCUUCAGAUC_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GCUCUCAAGGAGAACGGCGGCGCCAGACUGGCCGAGUACCACGCC chainId: B, chainSeq: GGCGUGGUACUCGGCCAGUCUGGCGCCGCCGUCCUGCUUCAGAUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 45 nucleotides chain B contains 45 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 460 n_atoms_counter: 460 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 90.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 90.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 800000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.157 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Two-chained_RNA-102b556e/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Two-chained_RNA-102b556e/inputs/seq.fa: 2 curr_seq: _GCUCUCAAGGAGAACGGCGGCGCCAGACUGGCCGAGUACCACGCC_ curr_seq: _GGCGUGGUACUCGGCCAGUCUGGCGCCGCCGUCCUGCUUCAGAUC_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GCUCUCAAGGAGAACGGCGGCGCCAGACUGGCCGAGUACCACGCC chainId: B, chainSeq: GGCGUGGUACUCGGCCAGUCUGGCGCCGCCGUCCUGCUUCAGAUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 45 nucleotides chain B contains 45 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 460 n_atoms_counter: 460 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 90.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 90.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 800000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.221 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Two-chained_RNA-102b556e/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Two-chained_RNA-102b556e/inputs/seq.fa: 2 curr_seq: _GCUCUCAAGGAGAACGGCGGCGCCAGACUGGCCGAGUACCACGCC_ curr_seq: _GGCGUGGUACUCGGCCAGUCUGGCGCCGCCGUCCUGCUUCAGAUC_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GCUCUCAAGGAGAACGGCGGCGCCAGACUGGCCGAGUACCACGCC chainId: B, chainSeq: GGCGUGGUACUCGGCCAGUCUGGCGCCGCCGUCCUGCUUCAGAUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 45 nucleotides chain B contains 45 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 460 n_atoms_counter: 460 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 90.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 90.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 800000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.286 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Two-chained_RNA-102b556e/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Two-chained_RNA-102b556e/inputs/seq.fa: 2 curr_seq: _GCUCUCAAGGAGAACGGCGGCGCCAGACUGGCCGAGUACCACGCC_ curr_seq: _GGCGUGGUACUCGGCCAGUCUGGCGCCGCCGUCCUGCUUCAGAUC_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GCUCUCAAGGAGAACGGCGGCGCCAGACUGGCCGAGUACCACGCC chainId: B, chainSeq: GGCGUGGUACUCGGCCAGUCUGGCGCCGCCGUCCUGCUUCAGAUC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 45 nucleotides chain B contains 45 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 460 n_atoms_counter: 460 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 90.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 90.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 800000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 8 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -358.980246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.980246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.980246 (E_RNA) where: Base-Base interactions energy: -7.989 where: short stacking energy: -7.989 Base-Backbone interact. energy: -0.000 local terms energy: -350.991227 where: bonds (distance) C4'-P energy: -87.442 bonds (distance) P-C4' energy: -82.308 flat angles C4'-P-C4' energy: -66.080 flat angles P-C4'-P energy: -75.589 tors. eta vs tors. theta energy: -39.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.964286 Total energy: -358.980246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.980246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.980246 (E_RNA) where: Base-Base interactions energy: -7.989 where: short stacking energy: -7.989 Base-Backbone interact. energy: -0.000 local terms energy: -350.991227 where: bonds (distance) C4'-P energy: -87.442 bonds (distance) P-C4' energy: -82.308 flat angles C4'-P-C4' energy: -66.080 flat angles P-C4'-P energy: -75.589 tors. eta vs tors. theta energy: -39.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.028571 Total energy: -358.980246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.980246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.980246 (E_RNA) where: Base-Base interactions energy: -7.989 where: short stacking energy: -7.989 Base-Backbone interact. energy: -0.000 local terms energy: -350.991227 where: bonds (distance) C4'-P energy: -87.442 bonds (distance) P-C4' energy: -82.308 flat angles C4'-P-C4' energy: -66.080 flat angles P-C4'-P energy: -75.589 tors. eta vs tors. theta energy: -39.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.092857 Total energy: -358.980246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.980246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.980246 (E_RNA) where: Base-Base interactions energy: -7.989 where: short stacking energy: -7.989 Base-Backbone interact. energy: -0.000 local terms energy: -350.991227 where: bonds (distance) C4'-P energy: -87.442 bonds (distance) P-C4' energy: -82.308 flat angles C4'-P-C4' energy: -66.080 flat angles P-C4'-P energy: -75.589 tors. eta vs tors. theta energy: -39.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.157143 Total energy: -358.980246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.980246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.980246 (E_RNA) where: Base-Base interactions energy: -7.989 where: short stacking energy: -7.989 Base-Backbone interact. energy: -0.000 local terms energy: -350.991227 where: bonds (distance) C4'-P energy: -87.442 bonds (distance) P-C4' energy: -82.308 flat angles C4'-P-C4' energy: -66.080 flat angles P-C4'-P energy: -75.589 tors. eta vs tors. theta energy: -39.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.221429 Total energy: -358.980246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.980246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.980246 (E_RNA) where: Base-Base interactions energy: -7.989 where: short stacking energy: -7.989 Base-Backbone interact. energy: -0.000 local terms energy: -350.991227 where: bonds (distance) C4'-P energy: -87.442 bonds (distance) P-C4' energy: -82.308 flat angles C4'-P-C4' energy: -66.080 flat angles P-C4'-P energy: -75.589 tors. eta vs tors. theta energy: -39.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.285714 Total energy: -358.980246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.980246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.980246 (E_RNA) where: Base-Base interactions energy: -7.989 where: short stacking energy: -7.989 Base-Backbone interact. energy: -0.000 local terms energy: -350.991227 where: bonds (distance) C4'-P energy: -87.442 bonds (distance) P-C4' energy: -82.308 flat angles C4'-P-C4' energy: -66.080 flat angles P-C4'-P energy: -75.589 tors. eta vs tors. theta energy: -39.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -358.980246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.980246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.980246 (E_RNA) where: Base-Base interactions energy: -7.989 where: short stacking energy: -7.989 Base-Backbone interact. energy: -0.000 local terms energy: -350.991227 where: bonds (distance) C4'-P energy: -87.442 bonds (distance) P-C4' energy: -82.308 flat angles C4'-P-C4' energy: -66.080 flat angles P-C4'-P energy: -75.589 tors. eta vs tors. theta energy: -39.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -408.165628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.165628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.165628 (E_RNA) where: Base-Base interactions energy: -168.916 where: short stacking energy: -162.686 Base-Backbone interact. energy: -0.011 local terms energy: -239.237888 where: bonds (distance) C4'-P energy: -54.558 bonds (distance) P-C4' energy: -58.991 flat angles C4'-P-C4' energy: -52.741 flat angles P-C4'-P energy: -38.051 tors. eta vs tors. theta energy: -34.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.964286 Total energy: -407.384712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.384712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.384712 (E_RNA) where: Base-Base interactions energy: -182.393 where: short stacking energy: -177.549 Base-Backbone interact. energy: 0.405 local terms energy: -225.396205 where: bonds (distance) C4'-P energy: -54.904 bonds (distance) P-C4' energy: -55.583 flat angles C4'-P-C4' energy: -49.862 flat angles P-C4'-P energy: -33.058 tors. eta vs tors. theta energy: -31.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.028571 Total energy: -397.842766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.842766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.842766 (E_RNA) where: Base-Base interactions energy: -170.047 where: short stacking energy: -170.047 Base-Backbone interact. energy: -0.003 local terms energy: -227.792091 where: bonds (distance) C4'-P energy: -48.899 bonds (distance) P-C4' energy: -56.729 flat angles C4'-P-C4' energy: -48.818 flat angles P-C4'-P energy: -31.523 tors. eta vs tors. theta energy: -41.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.092857 Total energy: -360.786773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.786773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.786773 (E_RNA) where: Base-Base interactions energy: -137.729 where: short stacking energy: -134.884 Base-Backbone interact. energy: 1.365 local terms energy: -224.422238 where: bonds (distance) C4'-P energy: -54.833 bonds (distance) P-C4' energy: -53.244 flat angles C4'-P-C4' energy: -57.875 flat angles P-C4'-P energy: -28.504 tors. eta vs tors. theta energy: -29.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.157143 Total energy: -359.646755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.646755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.646755 (E_RNA) where: Base-Base interactions energy: -14.919 where: short stacking energy: -14.919 Base-Backbone interact. energy: -0.000 local terms energy: -344.727713 where: bonds (distance) C4'-P energy: -85.534 bonds (distance) P-C4' energy: -79.539 flat angles C4'-P-C4' energy: -64.736 flat angles P-C4'-P energy: -74.867 tors. eta vs tors. theta energy: -40.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.221429 Total energy: -359.643344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.643344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.643344 (E_RNA) where: Base-Base interactions energy: -14.916 where: short stacking energy: -14.916 Base-Backbone interact. energy: -0.000 local terms energy: -344.727713 where: bonds (distance) C4'-P energy: -85.534 bonds (distance) P-C4' energy: -79.539 flat angles C4'-P-C4' energy: -64.736 flat angles P-C4'-P energy: -74.867 tors. eta vs tors. theta energy: -40.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.285714 Total energy: -359.454062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.454062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.454062 (E_RNA) where: Base-Base interactions energy: -14.912 where: short stacking energy: -14.912 Base-Backbone interact. energy: -0.000 local terms energy: -344.541567 where: bonds (distance) C4'-P energy: -85.534 bonds (distance) P-C4' energy: -79.542 flat angles C4'-P-C4' energy: -64.931 flat angles P-C4'-P energy: -74.732 tors. eta vs tors. theta energy: -39.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -357.165305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.165305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.165305 (E_RNA) where: Base-Base interactions energy: -9.187 where: short stacking energy: -9.187 Base-Backbone interact. energy: -0.000 local terms energy: -347.978511 where: bonds (distance) C4'-P energy: -86.970 bonds (distance) P-C4' energy: -80.283 flat angles C4'-P-C4' energy: -66.150 flat angles P-C4'-P energy: -75.077 tors. eta vs tors. theta energy: -39.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -463.252896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.252896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.252896 (E_RNA) where: Base-Base interactions energy: -195.530 where: short stacking energy: -188.044 Base-Backbone interact. energy: -0.941 local terms energy: -266.782081 where: bonds (distance) C4'-P energy: -63.267 bonds (distance) P-C4' energy: -63.591 flat angles C4'-P-C4' energy: -56.002 flat angles P-C4'-P energy: -39.361 tors. eta vs tors. theta energy: -44.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.964286 Total energy: -418.928314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.928314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.928314 (E_RNA) where: Base-Base interactions energy: -176.608 where: short stacking energy: -176.608 Base-Backbone interact. energy: -0.044 local terms energy: -242.275781 where: bonds (distance) C4'-P energy: -51.382 bonds (distance) P-C4' energy: -63.029 flat angles C4'-P-C4' energy: -61.564 flat angles P-C4'-P energy: -30.972 tors. eta vs tors. theta energy: -35.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.028571 Total energy: -391.956921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.956921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.956921 (E_RNA) where: Base-Base interactions energy: -163.551 where: short stacking energy: -163.551 Base-Backbone interact. energy: -0.045 local terms energy: -228.360565 where: bonds (distance) C4'-P energy: -61.917 bonds (distance) P-C4' energy: -58.447 flat angles C4'-P-C4' energy: -52.698 flat angles P-C4'-P energy: -31.430 tors. eta vs tors. theta energy: -23.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.092857 Total energy: -373.402695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.402695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.402695 (E_RNA) where: Base-Base interactions energy: -154.125 where: short stacking energy: -145.231 Base-Backbone interact. energy: -0.211 local terms energy: -219.066727 where: bonds (distance) C4'-P energy: -52.758 bonds (distance) P-C4' energy: -58.404 flat angles C4'-P-C4' energy: -49.651 flat angles P-C4'-P energy: -27.780 tors. eta vs tors. theta energy: -30.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.157143 Total energy: -351.299657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.299657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.299657 (E_RNA) where: Base-Base interactions energy: -127.778 where: short stacking energy: -127.778 Base-Backbone interact. energy: 0.811 local terms energy: -226.933046 where: bonds (distance) C4'-P energy: -59.449 bonds (distance) P-C4' energy: -59.419 flat angles C4'-P-C4' energy: -47.942 flat angles P-C4'-P energy: -33.782 tors. eta vs tors. theta energy: -26.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 2.600 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.221429 Total energy: -305.621938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.621938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.621938 (E_RNA) where: Base-Base interactions energy: -113.949 where: short stacking energy: -113.001 Base-Backbone interact. energy: -0.645 local terms energy: -191.027848 where: bonds (distance) C4'-P energy: -46.037 bonds (distance) P-C4' energy: -49.115 flat angles C4'-P-C4' energy: -53.975 flat angles P-C4'-P energy: -19.103 tors. eta vs tors. theta energy: -22.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.285714 Total energy: -286.118472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.118472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.118472 (E_RNA) where: Base-Base interactions energy: -112.965 where: short stacking energy: -109.805 Base-Backbone interact. energy: -0.156 local terms energy: -172.997386 where: bonds (distance) C4'-P energy: -53.190 bonds (distance) P-C4' energy: -57.323 flat angles C4'-P-C4' energy: -42.589 flat angles P-C4'-P energy: -12.069 tors. eta vs tors. theta energy: -7.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -274.384526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.384526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.384526 (E_RNA) where: Base-Base interactions energy: -116.561 where: short stacking energy: -113.140 Base-Backbone interact. energy: -0.184 local terms energy: -157.639452 where: bonds (distance) C4'-P energy: -53.509 bonds (distance) P-C4' energy: -41.127 flat angles C4'-P-C4' energy: -36.001 flat angles P-C4'-P energy: -10.331 tors. eta vs tors. theta energy: -16.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -446.410088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.410088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.410088 (E_RNA) where: Base-Base interactions energy: -190.781 where: short stacking energy: -181.939 Base-Backbone interact. energy: -0.047 local terms energy: -255.581524 where: bonds (distance) C4'-P energy: -59.075 bonds (distance) P-C4' energy: -62.088 flat angles C4'-P-C4' energy: -65.076 flat angles P-C4'-P energy: -32.505 tors. eta vs tors. theta energy: -36.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 4 Temperature: 0.964286 Total energy: -412.856661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.856661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.856661 (E_RNA) where: Base-Base interactions energy: -171.250 where: short stacking energy: -172.755 Base-Backbone interact. energy: -0.119 local terms energy: -242.381108 where: bonds (distance) C4'-P energy: -61.371 bonds (distance) P-C4' energy: -61.299 flat angles C4'-P-C4' energy: -58.863 flat angles P-C4'-P energy: -32.826 tors. eta vs tors. theta energy: -28.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.894 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 4 Temperature: 1.028571 Total energy: -386.251235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.251235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.251235 (E_RNA) where: Base-Base interactions energy: -166.442 where: short stacking energy: -166.442 Base-Backbone interact. energy: 1.587 local terms energy: -224.076251 where: bonds (distance) C4'-P energy: -49.033 bonds (distance) P-C4' energy: -56.607 flat angles C4'-P-C4' energy: -51.112 flat angles P-C4'-P energy: -27.411 tors. eta vs tors. theta energy: -39.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 2.680 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 4 Temperature: 1.092857 Total energy: -360.937044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.937044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.937044 (E_RNA) where: Base-Base interactions energy: -138.263 where: short stacking energy: -133.683 Base-Backbone interact. energy: -0.659 local terms energy: -223.280644 where: bonds (distance) C4'-P energy: -60.087 bonds (distance) P-C4' energy: -52.939 flat angles C4'-P-C4' energy: -42.896 flat angles P-C4'-P energy: -39.919 tors. eta vs tors. theta energy: -27.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.265 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 4 Temperature: 1.157143 Total energy: -338.344868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.344868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.344868 (E_RNA) where: Base-Base interactions energy: -142.164 where: short stacking energy: -137.664 Base-Backbone interact. energy: -0.226 local terms energy: -195.955000 where: bonds (distance) C4'-P energy: -43.986 bonds (distance) P-C4' energy: -52.173 flat angles C4'-P-C4' energy: -56.475 flat angles P-C4'-P energy: -21.644 tors. eta vs tors. theta energy: -21.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 4 Temperature: 1.221429 Total energy: -348.291425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.291425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.291425 (E_RNA) where: Base-Base interactions energy: -131.173 where: short stacking energy: -129.986 Base-Backbone interact. energy: -0.020 local terms energy: -217.098441 where: bonds (distance) C4'-P energy: -61.200 bonds (distance) P-C4' energy: -59.235 flat angles C4'-P-C4' energy: -41.786 flat angles P-C4'-P energy: -26.130 tors. eta vs tors. theta energy: -28.748 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 4 Temperature: 1.285714 Total energy: -266.387000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.387000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.387000 (E_RNA) where: Base-Base interactions energy: -91.990 where: short stacking energy: -91.067 Base-Backbone interact. energy: -1.004 local terms energy: -173.532236 where: bonds (distance) C4'-P energy: -46.237 bonds (distance) P-C4' energy: -55.831 flat angles C4'-P-C4' energy: -50.926 flat angles P-C4'-P energy: -19.980 tors. eta vs tors. theta energy: -0.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.139 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -250.418076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.418076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.418076 (E_RNA) where: Base-Base interactions energy: -96.815 where: short stacking energy: -96.815 Base-Backbone interact. energy: -0.388 local terms energy: -157.947267 where: bonds (distance) C4'-P energy: -48.880 bonds (distance) P-C4' energy: -48.029 flat angles C4'-P-C4' energy: -33.635 flat angles P-C4'-P energy: -26.554 tors. eta vs tors. theta energy: -0.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 4.732 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -475.719493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.719493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.719493 (E_RNA) where: Base-Base interactions energy: -217.479 where: short stacking energy: -217.479 Base-Backbone interact. energy: -0.167 local terms energy: -258.074188 where: bonds (distance) C4'-P energy: -58.360 bonds (distance) P-C4' energy: -64.227 flat angles C4'-P-C4' energy: -53.227 flat angles P-C4'-P energy: -33.047 tors. eta vs tors. theta energy: -49.213 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 5 Temperature: 0.964286 Total energy: -431.994945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.994945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.994945 (E_RNA) where: Base-Base interactions energy: -194.932 where: short stacking energy: -193.131 Base-Backbone interact. energy: 0.719 local terms energy: -237.781980 where: bonds (distance) C4'-P energy: -55.963 bonds (distance) P-C4' energy: -60.897 flat angles C4'-P-C4' energy: -50.923 flat angles P-C4'-P energy: -22.497 tors. eta vs tors. theta energy: -47.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 5 Temperature: 1.028571 Total energy: -371.725030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.725030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.725030 (E_RNA) where: Base-Base interactions energy: -150.237 where: short stacking energy: -142.420 Base-Backbone interact. energy: -0.225 local terms energy: -221.539596 where: bonds (distance) C4'-P energy: -52.826 bonds (distance) P-C4' energy: -54.077 flat angles C4'-P-C4' energy: -48.844 flat angles P-C4'-P energy: -35.211 tors. eta vs tors. theta energy: -30.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.277 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 5 Temperature: 1.092857 Total energy: -358.688765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.688765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.688765 (E_RNA) where: Base-Base interactions energy: -156.966 where: short stacking energy: -152.745 Base-Backbone interact. energy: -0.285 local terms energy: -201.437789 where: bonds (distance) C4'-P energy: -41.076 bonds (distance) P-C4' energy: -55.284 flat angles C4'-P-C4' energy: -56.067 flat angles P-C4'-P energy: -27.172 tors. eta vs tors. theta energy: -21.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 5 Temperature: 1.157143 Total energy: -337.469271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.469271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.469271 (E_RNA) where: Base-Base interactions energy: -126.829 where: short stacking energy: -124.030 Base-Backbone interact. energy: 0.443 local terms energy: -211.083405 where: bonds (distance) C4'-P energy: -53.623 bonds (distance) P-C4' energy: -53.383 flat angles C4'-P-C4' energy: -54.483 flat angles P-C4'-P energy: -27.001 tors. eta vs tors. theta energy: -22.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 5 Temperature: 1.221429 Total energy: -302.317886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.317886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.317886 (E_RNA) where: Base-Base interactions energy: -112.877 where: short stacking energy: -112.765 Base-Backbone interact. energy: 0.248 local terms energy: -189.688934 where: bonds (distance) C4'-P energy: -42.546 bonds (distance) P-C4' energy: -57.837 flat angles C4'-P-C4' energy: -39.484 flat angles P-C4'-P energy: -34.699 tors. eta vs tors. theta energy: -15.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 5 Temperature: 1.285714 Total energy: -241.510168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.510168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.510168 (E_RNA) where: Base-Base interactions energy: -84.066 where: short stacking energy: -73.209 Base-Backbone interact. energy: -0.209 local terms energy: -157.234660 where: bonds (distance) C4'-P energy: -36.722 bonds (distance) P-C4' energy: -50.624 flat angles C4'-P-C4' energy: -46.397 flat angles P-C4'-P energy: -22.087 tors. eta vs tors. theta energy: -1.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -231.709272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.709272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.709272 (E_RNA) where: Base-Base interactions energy: -87.881 where: short stacking energy: -87.494 Base-Backbone interact. energy: 1.281 local terms energy: -145.386269 where: bonds (distance) C4'-P energy: -58.296 bonds (distance) P-C4' energy: -43.593 flat angles C4'-P-C4' energy: -38.593 flat angles P-C4'-P energy: -9.816 tors. eta vs tors. theta energy: 4.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.278 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -462.902634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.902634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.902634 (E_RNA) where: Base-Base interactions energy: -214.141 where: short stacking energy: -214.141 Base-Backbone interact. energy: -0.223 local terms energy: -248.538855 where: bonds (distance) C4'-P energy: -60.720 bonds (distance) P-C4' energy: -61.007 flat angles C4'-P-C4' energy: -54.498 flat angles P-C4'-P energy: -25.944 tors. eta vs tors. theta energy: -46.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 6 Temperature: 0.964286 Total energy: -441.829323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.829323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.829323 (E_RNA) where: Base-Base interactions energy: -201.326 where: short stacking energy: -201.326 Base-Backbone interact. energy: -0.283 local terms energy: -240.219539 where: bonds (distance) C4'-P energy: -52.218 bonds (distance) P-C4' energy: -56.332 flat angles C4'-P-C4' energy: -53.625 flat angles P-C4'-P energy: -35.126 tors. eta vs tors. theta energy: -42.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 6 Temperature: 1.028571 Total energy: -374.795758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.795758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.795758 (E_RNA) where: Base-Base interactions energy: -161.980 where: short stacking energy: -161.980 Base-Backbone interact. energy: -0.486 local terms energy: -212.329781 where: bonds (distance) C4'-P energy: -36.207 bonds (distance) P-C4' energy: -60.668 flat angles C4'-P-C4' energy: -55.692 flat angles P-C4'-P energy: -22.892 tors. eta vs tors. theta energy: -36.871 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 6 Temperature: 1.092857 Total energy: -357.305311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.305311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.305311 (E_RNA) where: Base-Base interactions energy: -148.699 where: short stacking energy: -142.508 Base-Backbone interact. energy: -0.222 local terms energy: -211.071397 where: bonds (distance) C4'-P energy: -49.376 bonds (distance) P-C4' energy: -54.883 flat angles C4'-P-C4' energy: -49.407 flat angles P-C4'-P energy: -40.452 tors. eta vs tors. theta energy: -16.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 2.688 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 6 Temperature: 1.157143 Total energy: -308.639391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.639391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.639391 (E_RNA) where: Base-Base interactions energy: -126.955 where: short stacking energy: -121.838 Base-Backbone interact. energy: -0.549 local terms energy: -181.135382 where: bonds (distance) C4'-P energy: -39.844 bonds (distance) P-C4' energy: -56.831 flat angles C4'-P-C4' energy: -36.410 flat angles P-C4'-P energy: -28.894 tors. eta vs tors. theta energy: -19.155 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 6 Temperature: 1.221429 Total energy: -295.748067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.748067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.748067 (E_RNA) where: Base-Base interactions energy: -122.581 where: short stacking energy: -121.477 Base-Backbone interact. energy: 2.272 local terms energy: -175.439474 where: bonds (distance) C4'-P energy: -48.321 bonds (distance) P-C4' energy: -47.436 flat angles C4'-P-C4' energy: -35.828 flat angles P-C4'-P energy: -32.658 tors. eta vs tors. theta energy: -11.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 6 Temperature: 1.285714 Total energy: -244.751189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.751189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.751189 (E_RNA) where: Base-Base interactions energy: -91.070 where: short stacking energy: -84.215 Base-Backbone interact. energy: -1.034 local terms energy: -152.876551 where: bonds (distance) C4'-P energy: -46.610 bonds (distance) P-C4' energy: -55.933 flat angles C4'-P-C4' energy: -33.959 flat angles P-C4'-P energy: -25.005 tors. eta vs tors. theta energy: 8.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.229 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -249.264975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.264975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.264975 (E_RNA) where: Base-Base interactions energy: -96.337 where: short stacking energy: -83.320 Base-Backbone interact. energy: -0.131 local terms energy: -152.797657 where: bonds (distance) C4'-P energy: -44.785 bonds (distance) P-C4' energy: -48.096 flat angles C4'-P-C4' energy: -29.241 flat angles P-C4'-P energy: -29.473 tors. eta vs tors. theta energy: -1.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -447.841807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.841807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.841807 (E_RNA) where: Base-Base interactions energy: -192.453 where: short stacking energy: -189.595 Base-Backbone interact. energy: -0.080 local terms energy: -255.308706 where: bonds (distance) C4'-P energy: -56.592 bonds (distance) P-C4' energy: -59.558 flat angles C4'-P-C4' energy: -57.891 flat angles P-C4'-P energy: -37.731 tors. eta vs tors. theta energy: -43.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 7 Temperature: 0.964286 Total energy: -454.362445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.362445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.362445 (E_RNA) where: Base-Base interactions energy: -206.115 where: short stacking energy: -203.355 Base-Backbone interact. energy: -0.094 local terms energy: -248.153389 where: bonds (distance) C4'-P energy: -56.195 bonds (distance) P-C4' energy: -59.123 flat angles C4'-P-C4' energy: -58.573 flat angles P-C4'-P energy: -28.439 tors. eta vs tors. theta energy: -45.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 7 Temperature: 1.028571 Total energy: -409.409956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.409956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.409956 (E_RNA) where: Base-Base interactions energy: -173.330 where: short stacking energy: -166.870 Base-Backbone interact. energy: -0.599 local terms energy: -235.480103 where: bonds (distance) C4'-P energy: -54.013 bonds (distance) P-C4' energy: -59.142 flat angles C4'-P-C4' energy: -53.325 flat angles P-C4'-P energy: -40.271 tors. eta vs tors. theta energy: -28.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 7 Temperature: 1.092857 Total energy: -334.313998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.313998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.313998 (E_RNA) where: Base-Base interactions energy: -116.781 where: short stacking energy: -115.941 Base-Backbone interact. energy: -0.442 local terms energy: -217.091451 where: bonds (distance) C4'-P energy: -52.358 bonds (distance) P-C4' energy: -60.475 flat angles C4'-P-C4' energy: -55.168 flat angles P-C4'-P energy: -34.388 tors. eta vs tors. theta energy: -14.703 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 7 Temperature: 1.157143 Total energy: -338.636754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.636754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.636754 (E_RNA) where: Base-Base interactions energy: -122.012 where: short stacking energy: -115.447 Base-Backbone interact. energy: -0.352 local terms energy: -216.273580 where: bonds (distance) C4'-P energy: -61.679 bonds (distance) P-C4' energy: -51.253 flat angles C4'-P-C4' energy: -56.416 flat angles P-C4'-P energy: -25.283 tors. eta vs tors. theta energy: -21.642 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 7 Temperature: 1.221429 Total energy: -298.989181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.989181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.989181 (E_RNA) where: Base-Base interactions energy: -111.061 where: short stacking energy: -110.944 Base-Backbone interact. energy: -0.315 local terms energy: -187.702916 where: bonds (distance) C4'-P energy: -55.048 bonds (distance) P-C4' energy: -58.910 flat angles C4'-P-C4' energy: -42.598 flat angles P-C4'-P energy: -20.689 tors. eta vs tors. theta energy: -10.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.090 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 7 Temperature: 1.285714 Total energy: -238.870966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.870966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.870966 (E_RNA) where: Base-Base interactions energy: -86.785 where: short stacking energy: -85.877 Base-Backbone interact. energy: -0.687 local terms energy: -151.399332 where: bonds (distance) C4'-P energy: -45.206 bonds (distance) P-C4' energy: -46.285 flat angles C4'-P-C4' energy: -39.273 flat angles P-C4'-P energy: -17.520 tors. eta vs tors. theta energy: -3.115 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -206.717252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.717252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.717252 (E_RNA) where: Base-Base interactions energy: -54.349 where: short stacking energy: -47.659 Base-Backbone interact. energy: 0.258 local terms energy: -152.626415 where: bonds (distance) C4'-P energy: -53.145 bonds (distance) P-C4' energy: -49.841 flat angles C4'-P-C4' energy: -42.411 flat angles P-C4'-P energy: -17.812 tors. eta vs tors. theta energy: 10.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -451.645456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.645456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.645456 (E_RNA) where: Base-Base interactions energy: -202.209 where: short stacking energy: -198.122 Base-Backbone interact. energy: -0.113 local terms energy: -249.322922 where: bonds (distance) C4'-P energy: -47.986 bonds (distance) P-C4' energy: -60.899 flat angles C4'-P-C4' energy: -55.172 flat angles P-C4'-P energy: -42.714 tors. eta vs tors. theta energy: -42.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 8 Temperature: 0.964286 Total energy: -406.980420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.980420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.980420 (E_RNA) where: Base-Base interactions energy: -171.100 where: short stacking energy: -159.785 Base-Backbone interact. energy: -0.466 local terms energy: -236.985638 where: bonds (distance) C4'-P energy: -51.475 bonds (distance) P-C4' energy: -60.989 flat angles C4'-P-C4' energy: -54.908 flat angles P-C4'-P energy: -41.333 tors. eta vs tors. theta energy: -28.280 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.572 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 8 Temperature: 1.028571 Total energy: -404.785845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.785845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.785845 (E_RNA) where: Base-Base interactions energy: -176.505 where: short stacking energy: -174.388 Base-Backbone interact. energy: -0.251 local terms energy: -228.030521 where: bonds (distance) C4'-P energy: -52.519 bonds (distance) P-C4' energy: -42.058 flat angles C4'-P-C4' energy: -53.766 flat angles P-C4'-P energy: -40.419 tors. eta vs tors. theta energy: -39.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 8 Temperature: 1.092857 Total energy: -355.021096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.021096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.021096 (E_RNA) where: Base-Base interactions energy: -130.344 where: short stacking energy: -125.390 Base-Backbone interact. energy: -0.203 local terms energy: -224.474062 where: bonds (distance) C4'-P energy: -49.231 bonds (distance) P-C4' energy: -61.603 flat angles C4'-P-C4' energy: -58.990 flat angles P-C4'-P energy: -34.697 tors. eta vs tors. theta energy: -19.953 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 8 Temperature: 1.157143 Total energy: -320.698063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.698063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.698063 (E_RNA) where: Base-Base interactions energy: -135.654 where: short stacking energy: -123.092 Base-Backbone interact. energy: -0.345 local terms energy: -184.699416 where: bonds (distance) C4'-P energy: -51.560 bonds (distance) P-C4' energy: -57.272 flat angles C4'-P-C4' energy: -46.506 flat angles P-C4'-P energy: -22.026 tors. eta vs tors. theta energy: -7.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 8 Temperature: 1.221429 Total energy: -304.190663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.190663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.190663 (E_RNA) where: Base-Base interactions energy: -114.758 where: short stacking energy: -114.758 Base-Backbone interact. energy: 1.295 local terms energy: -191.337266 where: bonds (distance) C4'-P energy: -54.842 bonds (distance) P-C4' energy: -50.080 flat angles C4'-P-C4' energy: -34.568 flat angles P-C4'-P energy: -31.053 tors. eta vs tors. theta energy: -20.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.609 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 8 Temperature: 1.285714 Total energy: -262.785830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.785830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.785830 (E_RNA) where: Base-Base interactions energy: -105.365 where: short stacking energy: -97.840 Base-Backbone interact. energy: -0.877 local terms energy: -156.543839 where: bonds (distance) C4'-P energy: -44.430 bonds (distance) P-C4' energy: -51.142 flat angles C4'-P-C4' energy: -37.963 flat angles P-C4'-P energy: -20.403 tors. eta vs tors. theta energy: -2.605 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -262.980210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.980210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.980210 (E_RNA) where: Base-Base interactions energy: -115.565 where: short stacking energy: -96.577 Base-Backbone interact. energy: -1.826 local terms energy: -145.588492 where: bonds (distance) C4'-P energy: -37.834 bonds (distance) P-C4' energy: -51.805 flat angles C4'-P-C4' energy: -36.418 flat angles P-C4'-P energy: -14.990 tors. eta vs tors. theta energy: -4.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -460.920424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.920424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.920424 (E_RNA) where: Base-Base interactions energy: -198.417 where: short stacking energy: -197.095 Base-Backbone interact. energy: -0.279 local terms energy: -262.224425 where: bonds (distance) C4'-P energy: -60.571 bonds (distance) P-C4' energy: -62.362 flat angles C4'-P-C4' energy: -56.673 flat angles P-C4'-P energy: -40.022 tors. eta vs tors. theta energy: -42.597 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 9 Temperature: 0.964286 Total energy: -454.660393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.660393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.660393 (E_RNA) where: Base-Base interactions energy: -208.648 where: short stacking energy: -182.894 Base-Backbone interact. energy: -0.566 local terms energy: -245.446437 where: bonds (distance) C4'-P energy: -57.096 bonds (distance) P-C4' energy: -64.671 flat angles C4'-P-C4' energy: -58.004 flat angles P-C4'-P energy: -29.361 tors. eta vs tors. theta energy: -36.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 9 Temperature: 1.028571 Total energy: -403.698041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.698041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.698041 (E_RNA) where: Base-Base interactions energy: -162.289 where: short stacking energy: -158.769 Base-Backbone interact. energy: -0.470 local terms energy: -240.938799 where: bonds (distance) C4'-P energy: -60.484 bonds (distance) P-C4' energy: -58.412 flat angles C4'-P-C4' energy: -51.674 flat angles P-C4'-P energy: -34.722 tors. eta vs tors. theta energy: -35.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 9 Temperature: 1.092857 Total energy: -352.879800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.879800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.879800 (E_RNA) where: Base-Base interactions energy: -147.485 where: short stacking energy: -135.799 Base-Backbone interact. energy: -0.058 local terms energy: -205.336814 where: bonds (distance) C4'-P energy: -46.826 bonds (distance) P-C4' energy: -56.273 flat angles C4'-P-C4' energy: -52.616 flat angles P-C4'-P energy: -34.079 tors. eta vs tors. theta energy: -15.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 9 Temperature: 1.157143 Total energy: -326.792289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.792289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.792289 (E_RNA) where: Base-Base interactions energy: -121.552 where: short stacking energy: -119.974 Base-Backbone interact. energy: -0.517 local terms energy: -204.723278 where: bonds (distance) C4'-P energy: -56.777 bonds (distance) P-C4' energy: -58.369 flat angles C4'-P-C4' energy: -45.403 flat angles P-C4'-P energy: -29.092 tors. eta vs tors. theta energy: -15.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 9 Temperature: 1.221429 Total energy: -292.334690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.334690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.334690 (E_RNA) where: Base-Base interactions energy: -128.058 where: short stacking energy: -125.947 Base-Backbone interact. energy: 5.203 local terms energy: -169.479177 where: bonds (distance) C4'-P energy: -38.993 bonds (distance) P-C4' energy: -52.429 flat angles C4'-P-C4' energy: -44.507 flat angles P-C4'-P energy: -16.238 tors. eta vs tors. theta energy: -17.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 9 Temperature: 1.285714 Total energy: -255.709213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.709213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.709213 (E_RNA) where: Base-Base interactions energy: -92.790 where: short stacking energy: -79.506 Base-Backbone interact. energy: 0.562 local terms energy: -163.481596 where: bonds (distance) C4'-P energy: -48.647 bonds (distance) P-C4' energy: -41.647 flat angles C4'-P-C4' energy: -48.919 flat angles P-C4'-P energy: -27.592 tors. eta vs tors. theta energy: 3.324 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -231.604626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.604626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.604626 (E_RNA) where: Base-Base interactions energy: -84.788 where: short stacking energy: -79.771 Base-Backbone interact. energy: 0.400 local terms energy: -147.216784 where: bonds (distance) C4'-P energy: -42.238 bonds (distance) P-C4' energy: -54.771 flat angles C4'-P-C4' energy: -37.659 flat angles P-C4'-P energy: -17.280 tors. eta vs tors. theta energy: 4.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -488.280348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.280348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.280348 (E_RNA) where: Base-Base interactions energy: -221.072 where: short stacking energy: -206.595 Base-Backbone interact. energy: -1.825 local terms energy: -265.382900 where: bonds (distance) C4'-P energy: -63.208 bonds (distance) P-C4' energy: -52.136 flat angles C4'-P-C4' energy: -53.891 flat angles P-C4'-P energy: -45.563 tors. eta vs tors. theta energy: -50.584 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 10 Temperature: 0.964286 Total energy: -430.877108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.877108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.877108 (E_RNA) where: Base-Base interactions energy: -174.110 where: short stacking energy: -174.110 Base-Backbone interact. energy: -0.496 local terms energy: -256.271200 where: bonds (distance) C4'-P energy: -65.350 bonds (distance) P-C4' energy: -62.039 flat angles C4'-P-C4' energy: -55.473 flat angles P-C4'-P energy: -34.060 tors. eta vs tors. theta energy: -39.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 10 Temperature: 1.028571 Total energy: -419.485709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.485709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.485709 (E_RNA) where: Base-Base interactions energy: -177.247 where: short stacking energy: -169.157 Base-Backbone interact. energy: 0.417 local terms energy: -242.655796 where: bonds (distance) C4'-P energy: -57.433 bonds (distance) P-C4' energy: -61.188 flat angles C4'-P-C4' energy: -58.103 flat angles P-C4'-P energy: -29.520 tors. eta vs tors. theta energy: -36.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 10 Temperature: 1.092857 Total energy: -354.553533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.553533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.553533 (E_RNA) where: Base-Base interactions energy: -146.014 where: short stacking energy: -142.625 Base-Backbone interact. energy: -0.721 local terms energy: -210.324904 where: bonds (distance) C4'-P energy: -47.519 bonds (distance) P-C4' energy: -51.711 flat angles C4'-P-C4' energy: -62.259 flat angles P-C4'-P energy: -21.448 tors. eta vs tors. theta energy: -27.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 2.506 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 10 Temperature: 1.157143 Total energy: -323.161346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.161346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.161346 (E_RNA) where: Base-Base interactions energy: -118.870 where: short stacking energy: -118.870 Base-Backbone interact. energy: -1.198 local terms energy: -203.094051 where: bonds (distance) C4'-P energy: -61.978 bonds (distance) P-C4' energy: -54.532 flat angles C4'-P-C4' energy: -51.422 flat angles P-C4'-P energy: -26.421 tors. eta vs tors. theta energy: -8.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 10 Temperature: 1.221429 Total energy: -303.033411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.033411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.033411 (E_RNA) where: Base-Base interactions energy: -109.603 where: short stacking energy: -106.135 Base-Backbone interact. energy: -0.699 local terms energy: -192.731112 where: bonds (distance) C4'-P energy: -58.358 bonds (distance) P-C4' energy: -39.320 flat angles C4'-P-C4' energy: -57.231 flat angles P-C4'-P energy: -32.359 tors. eta vs tors. theta energy: -5.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 10 Temperature: 1.285714 Total energy: -267.625912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.625912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.625912 (E_RNA) where: Base-Base interactions energy: -84.151 where: short stacking energy: -81.390 Base-Backbone interact. energy: -1.432 local terms energy: -182.042917 where: bonds (distance) C4'-P energy: -44.112 bonds (distance) P-C4' energy: -50.190 flat angles C4'-P-C4' energy: -46.692 flat angles P-C4'-P energy: -29.651 tors. eta vs tors. theta energy: -11.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -242.958362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.958362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.958362 (E_RNA) where: Base-Base interactions energy: -92.097 where: short stacking energy: -83.111 Base-Backbone interact. energy: -0.416 local terms energy: -150.474267 where: bonds (distance) C4'-P energy: -49.726 bonds (distance) P-C4' energy: -45.942 flat angles C4'-P-C4' energy: -36.766 flat angles P-C4'-P energy: -18.276 tors. eta vs tors. theta energy: 0.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.029 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -511.097217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.097217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.097217 (E_RNA) where: Base-Base interactions energy: -242.661 where: short stacking energy: -240.126 Base-Backbone interact. energy: -0.051 local terms energy: -268.384714 where: bonds (distance) C4'-P energy: -49.185 bonds (distance) P-C4' energy: -58.973 flat angles C4'-P-C4' energy: -63.808 flat angles P-C4'-P energy: -41.537 tors. eta vs tors. theta energy: -54.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 11 Temperature: 0.964286 Total energy: -417.505846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.505846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.505846 (E_RNA) where: Base-Base interactions energy: -185.231 where: short stacking energy: -171.847 Base-Backbone interact. energy: 1.143 local terms energy: -233.417615 where: bonds (distance) C4'-P energy: -53.705 bonds (distance) P-C4' energy: -63.622 flat angles C4'-P-C4' energy: -49.785 flat angles P-C4'-P energy: -25.447 tors. eta vs tors. theta energy: -40.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 11 Temperature: 1.028571 Total energy: -388.510263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.510263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.510263 (E_RNA) where: Base-Base interactions energy: -166.352 where: short stacking energy: -162.090 Base-Backbone interact. energy: -0.054 local terms energy: -222.104061 where: bonds (distance) C4'-P energy: -54.793 bonds (distance) P-C4' energy: -62.820 flat angles C4'-P-C4' energy: -42.449 flat angles P-C4'-P energy: -30.481 tors. eta vs tors. theta energy: -31.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 11 Temperature: 1.092857 Total energy: -334.363773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.363773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.363773 (E_RNA) where: Base-Base interactions energy: -122.460 where: short stacking energy: -112.252 Base-Backbone interact. energy: -0.426 local terms energy: -211.477895 where: bonds (distance) C4'-P energy: -55.603 bonds (distance) P-C4' energy: -55.458 flat angles C4'-P-C4' energy: -59.545 flat angles P-C4'-P energy: -31.879 tors. eta vs tors. theta energy: -8.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 11 Temperature: 1.157143 Total energy: -321.025094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.025094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.025094 (E_RNA) where: Base-Base interactions energy: -116.027 where: short stacking energy: -108.436 Base-Backbone interact. energy: -0.352 local terms energy: -206.727592 where: bonds (distance) C4'-P energy: -60.517 bonds (distance) P-C4' energy: -56.307 flat angles C4'-P-C4' energy: -41.241 flat angles P-C4'-P energy: -27.877 tors. eta vs tors. theta energy: -20.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 2.082 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 11 Temperature: 1.221429 Total energy: -307.038679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.038679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.038679 (E_RNA) where: Base-Base interactions energy: -120.688 where: short stacking energy: -116.394 Base-Backbone interact. energy: 1.712 local terms energy: -188.062390 where: bonds (distance) C4'-P energy: -60.882 bonds (distance) P-C4' energy: -39.980 flat angles C4'-P-C4' energy: -33.311 flat angles P-C4'-P energy: -33.337 tors. eta vs tors. theta energy: -20.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 11 Temperature: 1.285714 Total energy: -259.179764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.179764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.179764 (E_RNA) where: Base-Base interactions energy: -89.398 where: short stacking energy: -88.167 Base-Backbone interact. energy: -0.626 local terms energy: -169.155784 where: bonds (distance) C4'-P energy: -46.484 bonds (distance) P-C4' energy: -40.443 flat angles C4'-P-C4' energy: -53.430 flat angles P-C4'-P energy: -25.104 tors. eta vs tors. theta energy: -3.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -231.305766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.305766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.305766 (E_RNA) where: Base-Base interactions energy: -82.457 where: short stacking energy: -71.209 Base-Backbone interact. energy: -0.889 local terms energy: -147.959312 where: bonds (distance) C4'-P energy: -54.518 bonds (distance) P-C4' energy: -49.366 flat angles C4'-P-C4' energy: -29.855 flat angles P-C4'-P energy: -15.732 tors. eta vs tors. theta energy: 1.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -524.131823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.131823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.131823 (E_RNA) where: Base-Base interactions energy: -250.651 where: short stacking energy: -233.115 Base-Backbone interact. energy: -0.203 local terms energy: -273.277870 where: bonds (distance) C4'-P energy: -54.615 bonds (distance) P-C4' energy: -59.558 flat angles C4'-P-C4' energy: -63.899 flat angles P-C4'-P energy: -42.651 tors. eta vs tors. theta energy: -52.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 12 Temperature: 0.964286 Total energy: -462.877933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.877933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.877933 (E_RNA) where: Base-Base interactions energy: -207.354 where: short stacking energy: -189.988 Base-Backbone interact. energy: -0.565 local terms energy: -254.965192 where: bonds (distance) C4'-P energy: -56.877 bonds (distance) P-C4' energy: -60.447 flat angles C4'-P-C4' energy: -65.029 flat angles P-C4'-P energy: -36.712 tors. eta vs tors. theta energy: -35.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.007 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 12 Temperature: 1.028571 Total energy: -402.526672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.526672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.526672 (E_RNA) where: Base-Base interactions energy: -167.210 where: short stacking energy: -162.694 Base-Backbone interact. energy: -0.404 local terms energy: -234.913113 where: bonds (distance) C4'-P energy: -57.974 bonds (distance) P-C4' energy: -56.505 flat angles C4'-P-C4' energy: -57.811 flat angles P-C4'-P energy: -30.823 tors. eta vs tors. theta energy: -31.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 12 Temperature: 1.092857 Total energy: -369.263007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.263007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.263007 (E_RNA) where: Base-Base interactions energy: -136.113 where: short stacking energy: -133.583 Base-Backbone interact. energy: 0.093 local terms energy: -233.243417 where: bonds (distance) C4'-P energy: -59.418 bonds (distance) P-C4' energy: -52.780 flat angles C4'-P-C4' energy: -52.939 flat angles P-C4'-P energy: -33.955 tors. eta vs tors. theta energy: -34.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 12 Temperature: 1.157143 Total energy: -333.818940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.818940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.818940 (E_RNA) where: Base-Base interactions energy: -133.614 where: short stacking energy: -125.056 Base-Backbone interact. energy: 1.243 local terms energy: -201.448051 where: bonds (distance) C4'-P energy: -47.582 bonds (distance) P-C4' energy: -48.915 flat angles C4'-P-C4' energy: -60.693 flat angles P-C4'-P energy: -28.789 tors. eta vs tors. theta energy: -15.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 12 Temperature: 1.221429 Total energy: -249.847811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.847811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.847811 (E_RNA) where: Base-Base interactions energy: -92.430 where: short stacking energy: -92.295 Base-Backbone interact. energy: 0.651 local terms energy: -158.068232 where: bonds (distance) C4'-P energy: -55.899 bonds (distance) P-C4' energy: -53.662 flat angles C4'-P-C4' energy: -22.495 flat angles P-C4'-P energy: -25.638 tors. eta vs tors. theta energy: -0.374 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 12 Temperature: 1.285714 Total energy: -246.845832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.845832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.845832 (E_RNA) where: Base-Base interactions energy: -88.594 where: short stacking energy: -78.527 Base-Backbone interact. energy: -0.644 local terms energy: -157.607594 where: bonds (distance) C4'-P energy: -42.172 bonds (distance) P-C4' energy: -52.149 flat angles C4'-P-C4' energy: -38.762 flat angles P-C4'-P energy: -30.966 tors. eta vs tors. theta energy: 6.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -231.069547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.069547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.069547 (E_RNA) where: Base-Base interactions energy: -79.267 where: short stacking energy: -68.282 Base-Backbone interact. energy: 0.101 local terms energy: -151.903983 where: bonds (distance) C4'-P energy: -42.445 bonds (distance) P-C4' energy: -41.449 flat angles C4'-P-C4' energy: -33.446 flat angles P-C4'-P energy: -37.966 tors. eta vs tors. theta energy: 3.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -540.672125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.672125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.672125 (E_RNA) where: Base-Base interactions energy: -262.434 where: short stacking energy: -235.269 Base-Backbone interact. energy: -0.352 local terms energy: -277.885575 where: bonds (distance) C4'-P energy: -63.881 bonds (distance) P-C4' energy: -53.293 flat angles C4'-P-C4' energy: -65.077 flat angles P-C4'-P energy: -46.911 tors. eta vs tors. theta energy: -48.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 13 Temperature: 0.964286 Total energy: -421.591127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.591127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.591127 (E_RNA) where: Base-Base interactions energy: -184.699 where: short stacking energy: -181.893 Base-Backbone interact. energy: -0.163 local terms energy: -238.311247 where: bonds (distance) C4'-P energy: -55.216 bonds (distance) P-C4' energy: -53.592 flat angles C4'-P-C4' energy: -57.845 flat angles P-C4'-P energy: -39.029 tors. eta vs tors. theta energy: -32.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.582 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 13 Temperature: 1.028571 Total energy: -372.938641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.938641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.938641 (E_RNA) where: Base-Base interactions energy: -166.795 where: short stacking energy: -149.562 Base-Backbone interact. energy: 0.711 local terms energy: -206.854383 where: bonds (distance) C4'-P energy: -46.492 bonds (distance) P-C4' energy: -62.511 flat angles C4'-P-C4' energy: -61.028 flat angles P-C4'-P energy: -22.573 tors. eta vs tors. theta energy: -14.250 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 13 Temperature: 1.092857 Total energy: -377.669474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.669474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.669474 (E_RNA) where: Base-Base interactions energy: -156.484 where: short stacking energy: -156.484 Base-Backbone interact. energy: 1.211 local terms energy: -222.396940 where: bonds (distance) C4'-P energy: -49.609 bonds (distance) P-C4' energy: -57.390 flat angles C4'-P-C4' energy: -47.039 flat angles P-C4'-P energy: -30.642 tors. eta vs tors. theta energy: -37.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 13 Temperature: 1.157143 Total energy: -344.355825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.355825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.355825 (E_RNA) where: Base-Base interactions energy: -135.009 where: short stacking energy: -123.928 Base-Backbone interact. energy: -1.400 local terms energy: -207.946778 where: bonds (distance) C4'-P energy: -42.125 bonds (distance) P-C4' energy: -57.959 flat angles C4'-P-C4' energy: -55.500 flat angles P-C4'-P energy: -40.856 tors. eta vs tors. theta energy: -11.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 13 Temperature: 1.221429 Total energy: -262.709579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.709579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.709579 (E_RNA) where: Base-Base interactions energy: -98.330 where: short stacking energy: -97.584 Base-Backbone interact. energy: 0.214 local terms energy: -164.593899 where: bonds (distance) C4'-P energy: -39.546 bonds (distance) P-C4' energy: -55.318 flat angles C4'-P-C4' energy: -37.465 flat angles P-C4'-P energy: -25.656 tors. eta vs tors. theta energy: -6.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 13 Temperature: 1.285714 Total energy: -297.154531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.154531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.154531 (E_RNA) where: Base-Base interactions energy: -131.760 where: short stacking energy: -115.223 Base-Backbone interact. energy: 4.804 local terms energy: -170.197885 where: bonds (distance) C4'-P energy: -50.378 bonds (distance) P-C4' energy: -46.823 flat angles C4'-P-C4' energy: -35.633 flat angles P-C4'-P energy: -34.622 tors. eta vs tors. theta energy: -2.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -257.229635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.229635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.229635 (E_RNA) where: Base-Base interactions energy: -87.371 where: short stacking energy: -78.854 Base-Backbone interact. energy: -0.410 local terms energy: -169.739109 where: bonds (distance) C4'-P energy: -52.055 bonds (distance) P-C4' energy: -62.589 flat angles C4'-P-C4' energy: -35.505 flat angles P-C4'-P energy: -14.844 tors. eta vs tors. theta energy: -4.747 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.291 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -514.587148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.587148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.587148 (E_RNA) where: Base-Base interactions energy: -250.935 where: short stacking energy: -214.188 Base-Backbone interact. energy: -0.230 local terms energy: -263.421799 where: bonds (distance) C4'-P energy: -59.393 bonds (distance) P-C4' energy: -64.211 flat angles C4'-P-C4' energy: -61.287 flat angles P-C4'-P energy: -33.900 tors. eta vs tors. theta energy: -44.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 14 Temperature: 0.964286 Total energy: -396.541608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.541608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.541608 (E_RNA) where: Base-Base interactions energy: -169.296 where: short stacking energy: -166.322 Base-Backbone interact. energy: -0.750 local terms energy: -226.495279 where: bonds (distance) C4'-P energy: -54.761 bonds (distance) P-C4' energy: -62.604 flat angles C4'-P-C4' energy: -54.239 flat angles P-C4'-P energy: -37.428 tors. eta vs tors. theta energy: -17.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 14 Temperature: 1.028571 Total energy: -368.458599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.458599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.458599 (E_RNA) where: Base-Base interactions energy: -153.110 where: short stacking energy: -138.433 Base-Backbone interact. energy: 1.875 local terms energy: -217.223542 where: bonds (distance) C4'-P energy: -55.239 bonds (distance) P-C4' energy: -58.803 flat angles C4'-P-C4' energy: -45.925 flat angles P-C4'-P energy: -36.332 tors. eta vs tors. theta energy: -20.926 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 14 Temperature: 1.092857 Total energy: -340.649055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.649055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.649055 (E_RNA) where: Base-Base interactions energy: -134.669 where: short stacking energy: -121.514 Base-Backbone interact. energy: -0.502 local terms energy: -205.478172 where: bonds (distance) C4'-P energy: -51.194 bonds (distance) P-C4' energy: -56.912 flat angles C4'-P-C4' energy: -54.978 flat angles P-C4'-P energy: -30.973 tors. eta vs tors. theta energy: -11.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 14 Temperature: 1.157143 Total energy: -318.851107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.851107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.851107 (E_RNA) where: Base-Base interactions energy: -135.200 where: short stacking energy: -92.417 Base-Backbone interact. energy: 1.654 local terms energy: -185.305279 where: bonds (distance) C4'-P energy: -54.079 bonds (distance) P-C4' energy: -55.733 flat angles C4'-P-C4' energy: -58.272 flat angles P-C4'-P energy: -17.127 tors. eta vs tors. theta energy: -0.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 14 Temperature: 1.221429 Total energy: -253.217650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.217650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.217650 (E_RNA) where: Base-Base interactions energy: -83.535 where: short stacking energy: -80.366 Base-Backbone interact. energy: -0.197 local terms energy: -169.484864 where: bonds (distance) C4'-P energy: -51.808 bonds (distance) P-C4' energy: -43.898 flat angles C4'-P-C4' energy: -46.390 flat angles P-C4'-P energy: -31.573 tors. eta vs tors. theta energy: 4.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 14 Temperature: 1.285714 Total energy: -271.781474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.781474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.781474 (E_RNA) where: Base-Base interactions energy: -93.917 where: short stacking energy: -76.262 Base-Backbone interact. energy: 0.337 local terms energy: -178.469571 where: bonds (distance) C4'-P energy: -59.312 bonds (distance) P-C4' energy: -52.988 flat angles C4'-P-C4' energy: -47.105 flat angles P-C4'-P energy: -28.890 tors. eta vs tors. theta energy: 9.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.269 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -247.274052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.274052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.274052 (E_RNA) where: Base-Base interactions energy: -102.319 where: short stacking energy: -67.148 Base-Backbone interact. energy: 0.123 local terms energy: -145.078304 where: bonds (distance) C4'-P energy: -52.944 bonds (distance) P-C4' energy: -49.097 flat angles C4'-P-C4' energy: -37.792 flat angles P-C4'-P energy: -13.232 tors. eta vs tors. theta energy: 7.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -553.804518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.804518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.804518 (E_RNA) where: Base-Base interactions energy: -259.239 where: short stacking energy: -215.756 Base-Backbone interact. energy: 0.640 local terms energy: -295.204865 where: bonds (distance) C4'-P energy: -60.452 bonds (distance) P-C4' energy: -67.825 flat angles C4'-P-C4' energy: -67.921 flat angles P-C4'-P energy: -41.358 tors. eta vs tors. theta energy: -57.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 15 Temperature: 0.964286 Total energy: -412.160600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.160600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.160600 (E_RNA) where: Base-Base interactions energy: -188.766 where: short stacking energy: -162.209 Base-Backbone interact. energy: -0.387 local terms energy: -223.007407 where: bonds (distance) C4'-P energy: -52.296 bonds (distance) P-C4' energy: -62.229 flat angles C4'-P-C4' energy: -58.041 flat angles P-C4'-P energy: -25.216 tors. eta vs tors. theta energy: -25.226 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 15 Temperature: 1.028571 Total energy: -385.813274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.813274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.813274 (E_RNA) where: Base-Base interactions energy: -172.493 where: short stacking energy: -157.684 Base-Backbone interact. energy: 4.450 local terms energy: -217.770388 where: bonds (distance) C4'-P energy: -55.781 bonds (distance) P-C4' energy: -60.325 flat angles C4'-P-C4' energy: -48.739 flat angles P-C4'-P energy: -34.265 tors. eta vs tors. theta energy: -18.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 15 Temperature: 1.092857 Total energy: -382.382056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.382056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.382056 (E_RNA) where: Base-Base interactions energy: -182.557 where: short stacking energy: -128.753 Base-Backbone interact. energy: -0.201 local terms energy: -199.624460 where: bonds (distance) C4'-P energy: -57.505 bonds (distance) P-C4' energy: -58.964 flat angles C4'-P-C4' energy: -43.285 flat angles P-C4'-P energy: -34.385 tors. eta vs tors. theta energy: -5.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 15 Temperature: 1.157143 Total energy: -298.601530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.601530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.601530 (E_RNA) where: Base-Base interactions energy: -117.887 where: short stacking energy: -113.967 Base-Backbone interact. energy: 0.084 local terms energy: -180.798168 where: bonds (distance) C4'-P energy: -53.579 bonds (distance) P-C4' energy: -51.276 flat angles C4'-P-C4' energy: -50.791 flat angles P-C4'-P energy: -16.237 tors. eta vs tors. theta energy: -8.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 15 Temperature: 1.221429 Total energy: -303.944008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.944008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.944008 (E_RNA) where: Base-Base interactions energy: -119.783 where: short stacking energy: -107.872 Base-Backbone interact. energy: 0.473 local terms energy: -184.633658 where: bonds (distance) C4'-P energy: -43.916 bonds (distance) P-C4' energy: -60.665 flat angles C4'-P-C4' energy: -37.442 flat angles P-C4'-P energy: -31.734 tors. eta vs tors. theta energy: -10.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 15 Temperature: 1.285714 Total energy: -284.745274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.745274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.745274 (E_RNA) where: Base-Base interactions energy: -100.659 where: short stacking energy: -101.148 Base-Backbone interact. energy: 2.318 local terms energy: -188.175120 where: bonds (distance) C4'-P energy: -51.107 bonds (distance) P-C4' energy: -49.561 flat angles C4'-P-C4' energy: -42.456 flat angles P-C4'-P energy: -36.172 tors. eta vs tors. theta energy: -8.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.771 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -251.369725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.369725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.369725 (E_RNA) where: Base-Base interactions energy: -87.726 where: short stacking energy: -74.966 Base-Backbone interact. energy: 2.460 local terms energy: -166.103520 where: bonds (distance) C4'-P energy: -42.304 bonds (distance) P-C4' energy: -60.729 flat angles C4'-P-C4' energy: -37.919 flat angles P-C4'-P energy: -27.982 tors. eta vs tors. theta energy: 2.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -546.449313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.449313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.449313 (E_RNA) where: Base-Base interactions energy: -277.892 where: short stacking energy: -232.934 Base-Backbone interact. energy: -0.174 local terms energy: -268.383216 where: bonds (distance) C4'-P energy: -53.789 bonds (distance) P-C4' energy: -59.237 flat angles C4'-P-C4' energy: -53.712 flat angles P-C4'-P energy: -43.575 tors. eta vs tors. theta energy: -58.071 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 16 Temperature: 0.964286 Total energy: -462.325347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.325347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.325347 (E_RNA) where: Base-Base interactions energy: -221.738 where: short stacking energy: -192.575 Base-Backbone interact. energy: 1.156 local terms energy: -241.743343 where: bonds (distance) C4'-P energy: -54.186 bonds (distance) P-C4' energy: -51.191 flat angles C4'-P-C4' energy: -57.636 flat angles P-C4'-P energy: -42.230 tors. eta vs tors. theta energy: -36.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 16 Temperature: 1.028571 Total energy: -393.817433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.817433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.817433 (E_RNA) where: Base-Base interactions energy: -184.675 where: short stacking energy: -155.907 Base-Backbone interact. energy: -1.264 local terms energy: -207.878655 where: bonds (distance) C4'-P energy: -46.855 bonds (distance) P-C4' energy: -47.679 flat angles C4'-P-C4' energy: -49.466 flat angles P-C4'-P energy: -33.292 tors. eta vs tors. theta energy: -30.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 16 Temperature: 1.092857 Total energy: -384.437617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.437617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.437617 (E_RNA) where: Base-Base interactions energy: -159.752 where: short stacking energy: -145.525 Base-Backbone interact. energy: -0.571 local terms energy: -224.114869 where: bonds (distance) C4'-P energy: -49.259 bonds (distance) P-C4' energy: -46.940 flat angles C4'-P-C4' energy: -61.401 flat angles P-C4'-P energy: -35.755 tors. eta vs tors. theta energy: -30.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 16 Temperature: 1.157143 Total energy: -315.999825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.999825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.999825 (E_RNA) where: Base-Base interactions energy: -107.936 where: short stacking energy: -107.692 Base-Backbone interact. energy: 0.308 local terms energy: -208.371437 where: bonds (distance) C4'-P energy: -49.016 bonds (distance) P-C4' energy: -60.859 flat angles C4'-P-C4' energy: -43.874 flat angles P-C4'-P energy: -46.014 tors. eta vs tors. theta energy: -8.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 16 Temperature: 1.221429 Total energy: -274.216216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.216216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.216216 (E_RNA) where: Base-Base interactions energy: -100.723 where: short stacking energy: -88.094 Base-Backbone interact. energy: -0.071 local terms energy: -173.422519 where: bonds (distance) C4'-P energy: -47.839 bonds (distance) P-C4' energy: -54.275 flat angles C4'-P-C4' energy: -43.615 flat angles P-C4'-P energy: -27.599 tors. eta vs tors. theta energy: -0.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 16 Temperature: 1.285714 Total energy: -308.898242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.898242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.898242 (E_RNA) where: Base-Base interactions energy: -110.074 where: short stacking energy: -108.818 Base-Backbone interact. energy: -0.356 local terms energy: -198.500300 where: bonds (distance) C4'-P energy: -51.758 bonds (distance) P-C4' energy: -52.887 flat angles C4'-P-C4' energy: -50.765 flat angles P-C4'-P energy: -32.198 tors. eta vs tors. theta energy: -10.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.032 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -218.790369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.790369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.790369 (E_RNA) where: Base-Base interactions energy: -65.529 where: short stacking energy: -50.561 Base-Backbone interact. energy: 5.140 local terms energy: -158.401656 where: bonds (distance) C4'-P energy: -50.225 bonds (distance) P-C4' energy: -51.079 flat angles C4'-P-C4' energy: -40.590 flat angles P-C4'-P energy: -26.762 tors. eta vs tors. theta energy: 10.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -538.704335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.704335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.704335 (E_RNA) where: Base-Base interactions energy: -268.978 where: short stacking energy: -226.353 Base-Backbone interact. energy: -0.215 local terms energy: -269.511936 where: bonds (distance) C4'-P energy: -58.238 bonds (distance) P-C4' energy: -56.173 flat angles C4'-P-C4' energy: -63.671 flat angles P-C4'-P energy: -37.037 tors. eta vs tors. theta energy: -54.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 17 Temperature: 0.964286 Total energy: -455.251256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.251256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.251256 (E_RNA) where: Base-Base interactions energy: -206.325 where: short stacking energy: -181.727 Base-Backbone interact. energy: -0.361 local terms energy: -248.565443 where: bonds (distance) C4'-P energy: -61.031 bonds (distance) P-C4' energy: -66.015 flat angles C4'-P-C4' energy: -56.399 flat angles P-C4'-P energy: -27.022 tors. eta vs tors. theta energy: -38.099 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 17 Temperature: 1.028571 Total energy: -399.562819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.562819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.562819 (E_RNA) where: Base-Base interactions energy: -188.018 where: short stacking energy: -147.022 Base-Backbone interact. energy: 2.708 local terms energy: -214.762659 where: bonds (distance) C4'-P energy: -45.940 bonds (distance) P-C4' energy: -60.072 flat angles C4'-P-C4' energy: -46.465 flat angles P-C4'-P energy: -42.495 tors. eta vs tors. theta energy: -19.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.509 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 17 Temperature: 1.092857 Total energy: -363.669120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.669120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.669120 (E_RNA) where: Base-Base interactions energy: -152.368 where: short stacking energy: -131.985 Base-Backbone interact. energy: 0.159 local terms energy: -211.460306 where: bonds (distance) C4'-P energy: -51.089 bonds (distance) P-C4' energy: -43.926 flat angles C4'-P-C4' energy: -54.926 flat angles P-C4'-P energy: -39.312 tors. eta vs tors. theta energy: -22.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 17 Temperature: 1.157143 Total energy: -316.303435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.303435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.303435 (E_RNA) where: Base-Base interactions energy: -120.242 where: short stacking energy: -118.346 Base-Backbone interact. energy: 0.439 local terms energy: -196.500131 where: bonds (distance) C4'-P energy: -47.830 bonds (distance) P-C4' energy: -43.797 flat angles C4'-P-C4' energy: -56.698 flat angles P-C4'-P energy: -37.347 tors. eta vs tors. theta energy: -10.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 17 Temperature: 1.221429 Total energy: -284.187631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.187631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.187631 (E_RNA) where: Base-Base interactions energy: -101.560 where: short stacking energy: -87.084 Base-Backbone interact. energy: -1.157 local terms energy: -181.469992 where: bonds (distance) C4'-P energy: -44.867 bonds (distance) P-C4' energy: -59.815 flat angles C4'-P-C4' energy: -40.808 flat angles P-C4'-P energy: -29.622 tors. eta vs tors. theta energy: -6.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 17 Temperature: 1.285714 Total energy: -266.778122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.778122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.778122 (E_RNA) where: Base-Base interactions energy: -99.384 where: short stacking energy: -97.893 Base-Backbone interact. energy: 0.348 local terms energy: -167.742154 where: bonds (distance) C4'-P energy: -36.042 bonds (distance) P-C4' energy: -52.935 flat angles C4'-P-C4' energy: -50.885 flat angles P-C4'-P energy: -17.513 tors. eta vs tors. theta energy: -10.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -222.845584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.845584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.845584 (E_RNA) where: Base-Base interactions energy: -86.690 where: short stacking energy: -74.554 Base-Backbone interact. energy: 0.717 local terms energy: -136.872698 where: bonds (distance) C4'-P energy: -49.774 bonds (distance) P-C4' energy: -36.090 flat angles C4'-P-C4' energy: -50.579 flat angles P-C4'-P energy: -12.054 tors. eta vs tors. theta energy: 11.624 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -552.727344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.727344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.727344 (E_RNA) where: Base-Base interactions energy: -276.906 where: short stacking energy: -234.120 Base-Backbone interact. energy: -0.359 local terms energy: -275.461993 where: bonds (distance) C4'-P energy: -54.778 bonds (distance) P-C4' energy: -58.446 flat angles C4'-P-C4' energy: -58.370 flat angles P-C4'-P energy: -46.957 tors. eta vs tors. theta energy: -56.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 18 Temperature: 0.964286 Total energy: -463.468538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.468538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.468538 (E_RNA) where: Base-Base interactions energy: -215.032 where: short stacking energy: -192.028 Base-Backbone interact. energy: -0.512 local terms energy: -247.924706 where: bonds (distance) C4'-P energy: -59.487 bonds (distance) P-C4' energy: -57.388 flat angles C4'-P-C4' energy: -63.467 flat angles P-C4'-P energy: -33.162 tors. eta vs tors. theta energy: -34.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 18 Temperature: 1.028571 Total energy: -420.917739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.917739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.917739 (E_RNA) where: Base-Base interactions energy: -184.729 where: short stacking energy: -163.055 Base-Backbone interact. energy: -1.402 local terms energy: -234.787245 where: bonds (distance) C4'-P energy: -52.217 bonds (distance) P-C4' energy: -63.418 flat angles C4'-P-C4' energy: -54.978 flat angles P-C4'-P energy: -33.983 tors. eta vs tors. theta energy: -30.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 18 Temperature: 1.092857 Total energy: -379.735345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.735345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.735345 (E_RNA) where: Base-Base interactions energy: -177.568 where: short stacking energy: -164.038 Base-Backbone interact. energy: -0.247 local terms energy: -203.096060 where: bonds (distance) C4'-P energy: -49.680 bonds (distance) P-C4' energy: -47.016 flat angles C4'-P-C4' energy: -46.230 flat angles P-C4'-P energy: -34.337 tors. eta vs tors. theta energy: -25.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.176 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 18 Temperature: 1.157143 Total energy: -307.253317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.253317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.253317 (E_RNA) where: Base-Base interactions energy: -120.162 where: short stacking energy: -105.325 Base-Backbone interact. energy: -1.168 local terms energy: -185.923069 where: bonds (distance) C4'-P energy: -51.328 bonds (distance) P-C4' energy: -53.241 flat angles C4'-P-C4' energy: -53.042 flat angles P-C4'-P energy: -26.065 tors. eta vs tors. theta energy: -2.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 18 Temperature: 1.221429 Total energy: -288.897805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.897805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.897805 (E_RNA) where: Base-Base interactions energy: -115.135 where: short stacking energy: -112.242 Base-Backbone interact. energy: -0.450 local terms energy: -173.312271 where: bonds (distance) C4'-P energy: -55.992 bonds (distance) P-C4' energy: -44.248 flat angles C4'-P-C4' energy: -49.478 flat angles P-C4'-P energy: -19.787 tors. eta vs tors. theta energy: -3.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 18 Temperature: 1.285714 Total energy: -279.008047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.008047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.008047 (E_RNA) where: Base-Base interactions energy: -100.404 where: short stacking energy: -92.329 Base-Backbone interact. energy: 0.974 local terms energy: -179.577754 where: bonds (distance) C4'-P energy: -58.041 bonds (distance) P-C4' energy: -43.761 flat angles C4'-P-C4' energy: -40.525 flat angles P-C4'-P energy: -35.198 tors. eta vs tors. theta energy: -2.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -231.528037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.528037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.528037 (E_RNA) where: Base-Base interactions energy: -82.261 where: short stacking energy: -74.754 Base-Backbone interact. energy: -0.829 local terms energy: -148.438346 where: bonds (distance) C4'-P energy: -37.201 bonds (distance) P-C4' energy: -43.439 flat angles C4'-P-C4' energy: -46.393 flat angles P-C4'-P energy: -29.973 tors. eta vs tors. theta energy: 8.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -561.890318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.890318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.890318 (E_RNA) where: Base-Base interactions energy: -286.364 where: short stacking energy: -247.934 Base-Backbone interact. energy: -0.407 local terms energy: -275.119651 where: bonds (distance) C4'-P energy: -56.856 bonds (distance) P-C4' energy: -60.858 flat angles C4'-P-C4' energy: -67.268 flat angles P-C4'-P energy: -33.075 tors. eta vs tors. theta energy: -57.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 19 Temperature: 0.964286 Total energy: -451.190957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.190957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.190957 (E_RNA) where: Base-Base interactions energy: -210.867 where: short stacking energy: -173.694 Base-Backbone interact. energy: 0.597 local terms energy: -240.920413 where: bonds (distance) C4'-P energy: -47.290 bonds (distance) P-C4' energy: -59.072 flat angles C4'-P-C4' energy: -54.990 flat angles P-C4'-P energy: -44.291 tors. eta vs tors. theta energy: -35.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 19 Temperature: 1.028571 Total energy: -389.502913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.502913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.502913 (E_RNA) where: Base-Base interactions energy: -173.074 where: short stacking energy: -144.378 Base-Backbone interact. energy: -0.800 local terms energy: -215.628725 where: bonds (distance) C4'-P energy: -47.365 bonds (distance) P-C4' energy: -55.060 flat angles C4'-P-C4' energy: -58.457 flat angles P-C4'-P energy: -31.622 tors. eta vs tors. theta energy: -23.125 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 19 Temperature: 1.092857 Total energy: -338.509354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.509354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.509354 (E_RNA) where: Base-Base interactions energy: -132.849 where: short stacking energy: -126.858 Base-Backbone interact. energy: 0.340 local terms energy: -206.000362 where: bonds (distance) C4'-P energy: -52.836 bonds (distance) P-C4' energy: -56.086 flat angles C4'-P-C4' energy: -49.434 flat angles P-C4'-P energy: -30.316 tors. eta vs tors. theta energy: -17.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 19 Temperature: 1.157143 Total energy: -299.524118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.524118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.524118 (E_RNA) where: Base-Base interactions energy: -105.358 where: short stacking energy: -97.837 Base-Backbone interact. energy: -0.963 local terms energy: -193.202677 where: bonds (distance) C4'-P energy: -50.263 bonds (distance) P-C4' energy: -45.689 flat angles C4'-P-C4' energy: -43.926 flat angles P-C4'-P energy: -38.572 tors. eta vs tors. theta energy: -14.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 19 Temperature: 1.221429 Total energy: -281.836626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.836626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.836626 (E_RNA) where: Base-Base interactions energy: -108.721 where: short stacking energy: -90.868 Base-Backbone interact. energy: 1.505 local terms energy: -174.620926 where: bonds (distance) C4'-P energy: -38.328 bonds (distance) P-C4' energy: -58.125 flat angles C4'-P-C4' energy: -43.255 flat angles P-C4'-P energy: -34.547 tors. eta vs tors. theta energy: -0.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 19 Temperature: 1.285714 Total energy: -256.172791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.172791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.172791 (E_RNA) where: Base-Base interactions energy: -95.283 where: short stacking energy: -89.593 Base-Backbone interact. energy: -0.970 local terms energy: -159.919698 where: bonds (distance) C4'-P energy: -53.340 bonds (distance) P-C4' energy: -55.225 flat angles C4'-P-C4' energy: -30.561 flat angles P-C4'-P energy: -22.060 tors. eta vs tors. theta energy: 1.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -230.055319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.055319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.055319 (E_RNA) where: Base-Base interactions energy: -79.025 where: short stacking energy: -71.581 Base-Backbone interact. energy: -0.502 local terms energy: -150.528689 where: bonds (distance) C4'-P energy: -45.883 bonds (distance) P-C4' energy: -48.099 flat angles C4'-P-C4' energy: -40.509 flat angles P-C4'-P energy: -24.093 tors. eta vs tors. theta energy: 8.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -570.732542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.732542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.732542 (E_RNA) where: Base-Base interactions energy: -299.113 where: short stacking energy: -237.446 Base-Backbone interact. energy: -0.284 local terms energy: -271.335179 where: bonds (distance) C4'-P energy: -48.100 bonds (distance) P-C4' energy: -65.674 flat angles C4'-P-C4' energy: -59.489 flat angles P-C4'-P energy: -39.578 tors. eta vs tors. theta energy: -58.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 20 Temperature: 0.964286 Total energy: -425.700430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.700430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.700430 (E_RNA) where: Base-Base interactions energy: -196.676 where: short stacking energy: -169.610 Base-Backbone interact. energy: -0.191 local terms energy: -228.833358 where: bonds (distance) C4'-P energy: -44.032 bonds (distance) P-C4' energy: -57.045 flat angles C4'-P-C4' energy: -56.529 flat angles P-C4'-P energy: -40.619 tors. eta vs tors. theta energy: -30.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 20 Temperature: 1.028571 Total energy: -414.517659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.517659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.517659 (E_RNA) where: Base-Base interactions energy: -204.842 where: short stacking energy: -180.608 Base-Backbone interact. energy: -0.289 local terms energy: -209.387193 where: bonds (distance) C4'-P energy: -47.911 bonds (distance) P-C4' energy: -57.638 flat angles C4'-P-C4' energy: -50.491 flat angles P-C4'-P energy: -29.248 tors. eta vs tors. theta energy: -24.099 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 20 Temperature: 1.092857 Total energy: -379.281114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.281114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.281114 (E_RNA) where: Base-Base interactions energy: -153.025 where: short stacking energy: -148.420 Base-Backbone interact. energy: 3.291 local terms energy: -229.547328 where: bonds (distance) C4'-P energy: -48.183 bonds (distance) P-C4' energy: -59.294 flat angles C4'-P-C4' energy: -58.243 flat angles P-C4'-P energy: -35.410 tors. eta vs tors. theta energy: -28.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 20 Temperature: 1.157143 Total energy: -294.095502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.095502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.095502 (E_RNA) where: Base-Base interactions energy: -102.091 where: short stacking energy: -80.062 Base-Backbone interact. energy: -0.958 local terms energy: -191.046708 where: bonds (distance) C4'-P energy: -38.902 bonds (distance) P-C4' energy: -57.755 flat angles C4'-P-C4' energy: -53.460 flat angles P-C4'-P energy: -40.375 tors. eta vs tors. theta energy: -0.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 20 Temperature: 1.221429 Total energy: -301.995882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.995882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.995882 (E_RNA) where: Base-Base interactions energy: -120.895 where: short stacking energy: -114.815 Base-Backbone interact. energy: 0.541 local terms energy: -181.641812 where: bonds (distance) C4'-P energy: -50.585 bonds (distance) P-C4' energy: -51.241 flat angles C4'-P-C4' energy: -52.605 flat angles P-C4'-P energy: -21.449 tors. eta vs tors. theta energy: -5.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 20 Temperature: 1.285714 Total energy: -258.867485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.867485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.867485 (E_RNA) where: Base-Base interactions energy: -95.185 where: short stacking energy: -80.508 Base-Backbone interact. energy: -1.296 local terms energy: -162.387253 where: bonds (distance) C4'-P energy: -44.867 bonds (distance) P-C4' energy: -46.696 flat angles C4'-P-C4' energy: -38.711 flat angles P-C4'-P energy: -28.515 tors. eta vs tors. theta energy: -3.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -240.723343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.723343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.723343 (E_RNA) where: Base-Base interactions energy: -81.647 where: short stacking energy: -79.085 Base-Backbone interact. energy: 0.124 local terms energy: -159.199932 where: bonds (distance) C4'-P energy: -47.800 bonds (distance) P-C4' energy: -59.228 flat angles C4'-P-C4' energy: -43.463 flat angles P-C4'-P energy: -10.770 tors. eta vs tors. theta energy: 2.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -568.549323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.549323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.549323 (E_RNA) where: Base-Base interactions energy: -312.430 where: short stacking energy: -236.846 Base-Backbone interact. energy: -0.863 local terms energy: -255.255663 where: bonds (distance) C4'-P energy: -49.880 bonds (distance) P-C4' energy: -63.452 flat angles C4'-P-C4' energy: -58.838 flat angles P-C4'-P energy: -33.161 tors. eta vs tors. theta energy: -49.925 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 21 Temperature: 0.964286 Total energy: -483.874633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.874633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.874633 (E_RNA) where: Base-Base interactions energy: -236.903 where: short stacking energy: -187.530 Base-Backbone interact. energy: 0.427 local terms energy: -247.399016 where: bonds (distance) C4'-P energy: -63.236 bonds (distance) P-C4' energy: -47.610 flat angles C4'-P-C4' energy: -61.026 flat angles P-C4'-P energy: -45.868 tors. eta vs tors. theta energy: -29.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 21 Temperature: 1.028571 Total energy: -439.800460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.800460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.800460 (E_RNA) where: Base-Base interactions energy: -200.108 where: short stacking energy: -169.161 Base-Backbone interact. energy: 0.088 local terms energy: -239.780840 where: bonds (distance) C4'-P energy: -49.310 bonds (distance) P-C4' energy: -58.411 flat angles C4'-P-C4' energy: -56.168 flat angles P-C4'-P energy: -35.945 tors. eta vs tors. theta energy: -39.946 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 21 Temperature: 1.092857 Total energy: -330.141534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.141534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.141534 (E_RNA) where: Base-Base interactions energy: -138.773 where: short stacking energy: -135.495 Base-Backbone interact. energy: -1.306 local terms energy: -190.062201 where: bonds (distance) C4'-P energy: -51.047 bonds (distance) P-C4' energy: -48.354 flat angles C4'-P-C4' energy: -47.138 flat angles P-C4'-P energy: -35.654 tors. eta vs tors. theta energy: -7.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 21 Temperature: 1.157143 Total energy: -349.150829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.150829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.150829 (E_RNA) where: Base-Base interactions energy: -147.248 where: short stacking energy: -134.724 Base-Backbone interact. energy: -0.130 local terms energy: -201.772559 where: bonds (distance) C4'-P energy: -58.906 bonds (distance) P-C4' energy: -46.820 flat angles C4'-P-C4' energy: -45.239 flat angles P-C4'-P energy: -35.644 tors. eta vs tors. theta energy: -15.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 21 Temperature: 1.221429 Total energy: -292.164124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.164124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.164124 (E_RNA) where: Base-Base interactions energy: -108.023 where: short stacking energy: -100.023 Base-Backbone interact. energy: 3.058 local terms energy: -187.198863 where: bonds (distance) C4'-P energy: -44.694 bonds (distance) P-C4' energy: -59.139 flat angles C4'-P-C4' energy: -45.069 flat angles P-C4'-P energy: -32.397 tors. eta vs tors. theta energy: -5.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 21 Temperature: 1.285714 Total energy: -236.480955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.480955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.480955 (E_RNA) where: Base-Base interactions energy: -81.937 where: short stacking energy: -73.134 Base-Backbone interact. energy: 1.579 local terms energy: -156.123079 where: bonds (distance) C4'-P energy: -43.807 bonds (distance) P-C4' energy: -49.753 flat angles C4'-P-C4' energy: -41.676 flat angles P-C4'-P energy: -34.057 tors. eta vs tors. theta energy: 13.169 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -233.482555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.482555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.482555 (E_RNA) where: Base-Base interactions energy: -78.910 where: short stacking energy: -74.512 Base-Backbone interact. energy: 0.505 local terms energy: -155.077779 where: bonds (distance) C4'-P energy: -51.854 bonds (distance) P-C4' energy: -52.116 flat angles C4'-P-C4' energy: -37.379 flat angles P-C4'-P energy: -28.190 tors. eta vs tors. theta energy: 14.461 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -570.685997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.685997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.685997 (E_RNA) where: Base-Base interactions energy: -307.499 where: short stacking energy: -227.090 Base-Backbone interact. energy: -0.434 local terms energy: -262.855201 where: bonds (distance) C4'-P energy: -56.724 bonds (distance) P-C4' energy: -59.768 flat angles C4'-P-C4' energy: -54.107 flat angles P-C4'-P energy: -40.504 tors. eta vs tors. theta energy: -51.753 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.103 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 22 Temperature: 0.964286 Total energy: -470.984660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.984660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.984660 (E_RNA) where: Base-Base interactions energy: -216.674 where: short stacking energy: -194.168 Base-Backbone interact. energy: 1.063 local terms energy: -255.373946 where: bonds (distance) C4'-P energy: -63.370 bonds (distance) P-C4' energy: -62.109 flat angles C4'-P-C4' energy: -53.932 flat angles P-C4'-P energy: -35.383 tors. eta vs tors. theta energy: -40.579 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 22 Temperature: 1.028571 Total energy: -437.034397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.034397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.034397 (E_RNA) where: Base-Base interactions energy: -198.199 where: short stacking energy: -174.173 Base-Backbone interact. energy: -0.177 local terms energy: -238.658704 where: bonds (distance) C4'-P energy: -47.182 bonds (distance) P-C4' energy: -56.485 flat angles C4'-P-C4' energy: -62.199 flat angles P-C4'-P energy: -36.254 tors. eta vs tors. theta energy: -36.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 22 Temperature: 1.092857 Total energy: -342.802192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.802192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.802192 (E_RNA) where: Base-Base interactions energy: -128.636 where: short stacking energy: -120.742 Base-Backbone interact. energy: -1.142 local terms energy: -213.023627 where: bonds (distance) C4'-P energy: -59.555 bonds (distance) P-C4' energy: -59.697 flat angles C4'-P-C4' energy: -48.587 flat angles P-C4'-P energy: -37.130 tors. eta vs tors. theta energy: -8.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 22 Temperature: 1.157143 Total energy: -311.193763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.193763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.193763 (E_RNA) where: Base-Base interactions energy: -115.614 where: short stacking energy: -114.133 Base-Backbone interact. energy: -0.377 local terms energy: -195.739217 where: bonds (distance) C4'-P energy: -53.203 bonds (distance) P-C4' energy: -64.174 flat angles C4'-P-C4' energy: -38.516 flat angles P-C4'-P energy: -28.036 tors. eta vs tors. theta energy: -11.810 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.537 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 22 Temperature: 1.221429 Total energy: -307.942775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.942775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.942775 (E_RNA) where: Base-Base interactions energy: -125.813 where: short stacking energy: -124.282 Base-Backbone interact. energy: -0.499 local terms energy: -181.630776 where: bonds (distance) C4'-P energy: -45.198 bonds (distance) P-C4' energy: -37.847 flat angles C4'-P-C4' energy: -40.725 flat angles P-C4'-P energy: -35.348 tors. eta vs tors. theta energy: -22.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 22 Temperature: 1.285714 Total energy: -226.739502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.739502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.739502 (E_RNA) where: Base-Base interactions energy: -100.275 where: short stacking energy: -95.379 Base-Backbone interact. energy: 0.598 local terms energy: -127.223376 where: bonds (distance) C4'-P energy: -44.808 bonds (distance) P-C4' energy: -48.797 flat angles C4'-P-C4' energy: -32.968 flat angles P-C4'-P energy: -14.826 tors. eta vs tors. theta energy: 14.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.161 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -246.352575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.352575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.352575 (E_RNA) where: Base-Base interactions energy: -98.624 where: short stacking energy: -93.785 Base-Backbone interact. energy: -0.746 local terms energy: -146.982137 where: bonds (distance) C4'-P energy: -42.686 bonds (distance) P-C4' energy: -47.682 flat angles C4'-P-C4' energy: -44.662 flat angles P-C4'-P energy: -17.630 tors. eta vs tors. theta energy: 5.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -581.061600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -581.061600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.061600 (E_RNA) where: Base-Base interactions energy: -309.427 where: short stacking energy: -240.803 Base-Backbone interact. energy: 1.945 local terms energy: -273.579238 where: bonds (distance) C4'-P energy: -57.381 bonds (distance) P-C4' energy: -60.227 flat angles C4'-P-C4' energy: -54.200 flat angles P-C4'-P energy: -41.456 tors. eta vs tors. theta energy: -60.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 23 Temperature: 0.964286 Total energy: -446.426864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.426864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.426864 (E_RNA) where: Base-Base interactions energy: -214.966 where: short stacking energy: -190.114 Base-Backbone interact. energy: -1.031 local terms energy: -230.429475 where: bonds (distance) C4'-P energy: -60.078 bonds (distance) P-C4' energy: -53.735 flat angles C4'-P-C4' energy: -47.658 flat angles P-C4'-P energy: -34.776 tors. eta vs tors. theta energy: -34.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 23 Temperature: 1.028571 Total energy: -424.699125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.699125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.699125 (E_RNA) where: Base-Base interactions energy: -185.418 where: short stacking energy: -167.247 Base-Backbone interact. energy: -0.603 local terms energy: -238.677739 where: bonds (distance) C4'-P energy: -56.972 bonds (distance) P-C4' energy: -56.267 flat angles C4'-P-C4' energy: -55.096 flat angles P-C4'-P energy: -37.691 tors. eta vs tors. theta energy: -32.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 23 Temperature: 1.092857 Total energy: -332.035136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.035136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.035136 (E_RNA) where: Base-Base interactions energy: -126.433 where: short stacking energy: -119.583 Base-Backbone interact. energy: -0.946 local terms energy: -205.167936 where: bonds (distance) C4'-P energy: -52.606 bonds (distance) P-C4' energy: -54.228 flat angles C4'-P-C4' energy: -46.809 flat angles P-C4'-P energy: -35.922 tors. eta vs tors. theta energy: -15.603 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.512 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 23 Temperature: 1.157143 Total energy: -315.631242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.631242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.631242 (E_RNA) where: Base-Base interactions energy: -134.071 where: short stacking energy: -130.822 Base-Backbone interact. energy: 1.423 local terms energy: -182.982662 where: bonds (distance) C4'-P energy: -48.988 bonds (distance) P-C4' energy: -50.941 flat angles C4'-P-C4' energy: -49.174 flat angles P-C4'-P energy: -21.373 tors. eta vs tors. theta energy: -12.507 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 23 Temperature: 1.221429 Total energy: -296.278558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.278558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.278558 (E_RNA) where: Base-Base interactions energy: -100.027 where: short stacking energy: -93.268 Base-Backbone interact. energy: -0.427 local terms energy: -195.824377 where: bonds (distance) C4'-P energy: -54.830 bonds (distance) P-C4' energy: -58.285 flat angles C4'-P-C4' energy: -46.241 flat angles P-C4'-P energy: -25.519 tors. eta vs tors. theta energy: -10.950 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 23 Temperature: 1.285714 Total energy: -265.042722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.042722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.042722 (E_RNA) where: Base-Base interactions energy: -108.243 where: short stacking energy: -97.455 Base-Backbone interact. energy: -1.045 local terms energy: -155.754657 where: bonds (distance) C4'-P energy: -34.653 bonds (distance) P-C4' energy: -51.494 flat angles C4'-P-C4' energy: -46.897 flat angles P-C4'-P energy: -28.212 tors. eta vs tors. theta energy: 5.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -257.859563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.859563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.859563 (E_RNA) where: Base-Base interactions energy: -85.349 where: short stacking energy: -70.719 Base-Backbone interact. energy: -1.567 local terms energy: -170.942867 where: bonds (distance) C4'-P energy: -62.336 bonds (distance) P-C4' energy: -46.428 flat angles C4'-P-C4' energy: -45.963 flat angles P-C4'-P energy: -25.062 tors. eta vs tors. theta energy: 8.847 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -573.132366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.132366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.132366 (E_RNA) where: Base-Base interactions energy: -298.377 where: short stacking energy: -222.528 Base-Backbone interact. energy: -0.074 local terms energy: -274.700611 where: bonds (distance) C4'-P energy: -56.600 bonds (distance) P-C4' energy: -63.162 flat angles C4'-P-C4' energy: -62.296 flat angles P-C4'-P energy: -36.423 tors. eta vs tors. theta energy: -56.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.019 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 24 Temperature: 0.964286 Total energy: -474.862373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.862373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.862373 (E_RNA) where: Base-Base interactions energy: -231.145 where: short stacking energy: -190.960 Base-Backbone interact. energy: 0.422 local terms energy: -244.139928 where: bonds (distance) C4'-P energy: -52.558 bonds (distance) P-C4' energy: -52.019 flat angles C4'-P-C4' energy: -61.506 flat angles P-C4'-P energy: -38.674 tors. eta vs tors. theta energy: -39.383 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 24 Temperature: 1.028571 Total energy: -410.340273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.340273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.340273 (E_RNA) where: Base-Base interactions energy: -188.547 where: short stacking energy: -153.106 Base-Backbone interact. energy: 1.584 local terms energy: -223.377468 where: bonds (distance) C4'-P energy: -50.641 bonds (distance) P-C4' energy: -51.606 flat angles C4'-P-C4' energy: -57.588 flat angles P-C4'-P energy: -39.204 tors. eta vs tors. theta energy: -24.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 24 Temperature: 1.092857 Total energy: -355.483343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.483343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.483343 (E_RNA) where: Base-Base interactions energy: -161.662 where: short stacking energy: -142.934 Base-Backbone interact. energy: -0.554 local terms energy: -193.267488 where: bonds (distance) C4'-P energy: -46.540 bonds (distance) P-C4' energy: -51.063 flat angles C4'-P-C4' energy: -45.773 flat angles P-C4'-P energy: -34.385 tors. eta vs tors. theta energy: -15.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 24 Temperature: 1.157143 Total energy: -320.345610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.345610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.345610 (E_RNA) where: Base-Base interactions energy: -110.137 where: short stacking energy: -101.586 Base-Backbone interact. energy: 1.803 local terms energy: -212.011052 where: bonds (distance) C4'-P energy: -59.796 bonds (distance) P-C4' energy: -58.465 flat angles C4'-P-C4' energy: -56.717 flat angles P-C4'-P energy: -25.875 tors. eta vs tors. theta energy: -11.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 24 Temperature: 1.221429 Total energy: -294.842642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.842642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.842642 (E_RNA) where: Base-Base interactions energy: -94.716 where: short stacking energy: -78.773 Base-Backbone interact. energy: -0.641 local terms energy: -199.485480 where: bonds (distance) C4'-P energy: -59.793 bonds (distance) P-C4' energy: -57.935 flat angles C4'-P-C4' energy: -50.518 flat angles P-C4'-P energy: -24.702 tors. eta vs tors. theta energy: -6.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 24 Temperature: 1.285714 Total energy: -268.775491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.775491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.775491 (E_RNA) where: Base-Base interactions energy: -99.177 where: short stacking energy: -76.993 Base-Backbone interact. energy: -0.413 local terms energy: -169.185529 where: bonds (distance) C4'-P energy: -54.058 bonds (distance) P-C4' energy: -48.728 flat angles C4'-P-C4' energy: -49.941 flat angles P-C4'-P energy: -24.092 tors. eta vs tors. theta energy: 7.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -249.032965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.032965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.032965 (E_RNA) where: Base-Base interactions energy: -86.568 where: short stacking energy: -82.034 Base-Backbone interact. energy: 3.177 local terms energy: -165.641869 where: bonds (distance) C4'-P energy: -50.297 bonds (distance) P-C4' energy: -55.977 flat angles C4'-P-C4' energy: -40.554 flat angles P-C4'-P energy: -24.877 tors. eta vs tors. theta energy: 6.063 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -575.783351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.783351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.783351 (E_RNA) where: Base-Base interactions energy: -306.593 where: short stacking energy: -244.460 Base-Backbone interact. energy: -0.426 local terms energy: -268.764941 where: bonds (distance) C4'-P energy: -52.043 bonds (distance) P-C4' energy: -58.062 flat angles C4'-P-C4' energy: -55.687 flat angles P-C4'-P energy: -42.025 tors. eta vs tors. theta energy: -60.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 25 Temperature: 0.964286 Total energy: -474.847979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.847979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.847979 (E_RNA) where: Base-Base interactions energy: -232.383 where: short stacking energy: -183.301 Base-Backbone interact. energy: 0.273 local terms energy: -242.737129 where: bonds (distance) C4'-P energy: -49.434 bonds (distance) P-C4' energy: -55.672 flat angles C4'-P-C4' energy: -59.137 flat angles P-C4'-P energy: -34.209 tors. eta vs tors. theta energy: -44.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 25 Temperature: 1.028571 Total energy: -399.171132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.171132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.171132 (E_RNA) where: Base-Base interactions energy: -171.155 where: short stacking energy: -152.960 Base-Backbone interact. energy: -0.610 local terms energy: -227.406084 where: bonds (distance) C4'-P energy: -46.111 bonds (distance) P-C4' energy: -55.101 flat angles C4'-P-C4' energy: -56.960 flat angles P-C4'-P energy: -31.124 tors. eta vs tors. theta energy: -38.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 25 Temperature: 1.092857 Total energy: -348.757073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.757073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.757073 (E_RNA) where: Base-Base interactions energy: -153.453 where: short stacking energy: -139.483 Base-Backbone interact. energy: 2.179 local terms energy: -197.483157 where: bonds (distance) C4'-P energy: -53.874 bonds (distance) P-C4' energy: -53.218 flat angles C4'-P-C4' energy: -44.956 flat angles P-C4'-P energy: -29.992 tors. eta vs tors. theta energy: -15.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 25 Temperature: 1.157143 Total energy: -313.025246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.025246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.025246 (E_RNA) where: Base-Base interactions energy: -134.002 where: short stacking energy: -116.943 Base-Backbone interact. energy: 1.566 local terms energy: -180.589198 where: bonds (distance) C4'-P energy: -38.926 bonds (distance) P-C4' energy: -51.450 flat angles C4'-P-C4' energy: -59.241 flat angles P-C4'-P energy: -23.109 tors. eta vs tors. theta energy: -7.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 25 Temperature: 1.221429 Total energy: -298.977209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.977209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.977209 (E_RNA) where: Base-Base interactions energy: -121.312 where: short stacking energy: -121.032 Base-Backbone interact. energy: -0.523 local terms energy: -177.141876 where: bonds (distance) C4'-P energy: -37.951 bonds (distance) P-C4' energy: -56.570 flat angles C4'-P-C4' energy: -53.213 flat angles P-C4'-P energy: -19.262 tors. eta vs tors. theta energy: -10.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 25 Temperature: 1.285714 Total energy: -280.453432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.453432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.453432 (E_RNA) where: Base-Base interactions energy: -88.761 where: short stacking energy: -88.749 Base-Backbone interact. energy: 0.961 local terms energy: -192.653104 where: bonds (distance) C4'-P energy: -51.210 bonds (distance) P-C4' energy: -63.277 flat angles C4'-P-C4' energy: -42.641 flat angles P-C4'-P energy: -34.344 tors. eta vs tors. theta energy: -1.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -242.514450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.514450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.514450 (E_RNA) where: Base-Base interactions energy: -82.396 where: short stacking energy: -66.459 Base-Backbone interact. energy: -1.010 local terms energy: -159.108202 where: bonds (distance) C4'-P energy: -40.725 bonds (distance) P-C4' energy: -55.109 flat angles C4'-P-C4' energy: -42.579 flat angles P-C4'-P energy: -31.750 tors. eta vs tors. theta energy: 11.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -598.872249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.872249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.872249 (E_RNA) where: Base-Base interactions energy: -329.757 where: short stacking energy: -223.114 Base-Backbone interact. energy: -0.138 local terms energy: -268.977418 where: bonds (distance) C4'-P energy: -55.925 bonds (distance) P-C4' energy: -67.628 flat angles C4'-P-C4' energy: -51.143 flat angles P-C4'-P energy: -46.859 tors. eta vs tors. theta energy: -47.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 26 Temperature: 0.964286 Total energy: -497.726183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.726183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.726183 (E_RNA) where: Base-Base interactions energy: -270.919 where: short stacking energy: -204.193 Base-Backbone interact. energy: -1.054 local terms energy: -226.004113 where: bonds (distance) C4'-P energy: -47.453 bonds (distance) P-C4' energy: -51.338 flat angles C4'-P-C4' energy: -49.256 flat angles P-C4'-P energy: -37.997 tors. eta vs tors. theta energy: -39.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.251 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 26 Temperature: 1.028571 Total energy: -396.266206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.266206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.266206 (E_RNA) where: Base-Base interactions energy: -171.061 where: short stacking energy: -148.747 Base-Backbone interact. energy: -0.368 local terms energy: -224.836836 where: bonds (distance) C4'-P energy: -54.172 bonds (distance) P-C4' energy: -54.433 flat angles C4'-P-C4' energy: -53.133 flat angles P-C4'-P energy: -35.002 tors. eta vs tors. theta energy: -28.097 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 26 Temperature: 1.092857 Total energy: -350.721551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.721551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.721551 (E_RNA) where: Base-Base interactions energy: -137.217 where: short stacking energy: -132.314 Base-Backbone interact. energy: -0.460 local terms energy: -213.044847 where: bonds (distance) C4'-P energy: -46.357 bonds (distance) P-C4' energy: -62.331 flat angles C4'-P-C4' energy: -56.132 flat angles P-C4'-P energy: -28.621 tors. eta vs tors. theta energy: -19.605 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 26 Temperature: 1.157143 Total energy: -322.205786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.205786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.205786 (E_RNA) where: Base-Base interactions energy: -134.692 where: short stacking energy: -133.184 Base-Backbone interact. energy: -0.167 local terms energy: -187.346165 where: bonds (distance) C4'-P energy: -52.246 bonds (distance) P-C4' energy: -44.760 flat angles C4'-P-C4' energy: -46.492 flat angles P-C4'-P energy: -26.425 tors. eta vs tors. theta energy: -17.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 26 Temperature: 1.221429 Total energy: -290.387066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.387066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.387066 (E_RNA) where: Base-Base interactions energy: -105.413 where: short stacking energy: -98.135 Base-Backbone interact. energy: 2.115 local terms energy: -187.088337 where: bonds (distance) C4'-P energy: -48.565 bonds (distance) P-C4' energy: -60.880 flat angles C4'-P-C4' energy: -52.216 flat angles P-C4'-P energy: -28.953 tors. eta vs tors. theta energy: 3.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 26 Temperature: 1.285714 Total energy: -267.907237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.907237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.907237 (E_RNA) where: Base-Base interactions energy: -121.061 where: short stacking energy: -80.068 Base-Backbone interact. energy: 2.281 local terms energy: -149.127933 where: bonds (distance) C4'-P energy: -44.543 bonds (distance) P-C4' energy: -45.283 flat angles C4'-P-C4' energy: -28.371 flat angles P-C4'-P energy: -24.763 tors. eta vs tors. theta energy: -6.167 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -254.376604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.376604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.376604 (E_RNA) where: Base-Base interactions energy: -87.551 where: short stacking energy: -81.751 Base-Backbone interact. energy: 0.006 local terms energy: -166.831289 where: bonds (distance) C4'-P energy: -38.763 bonds (distance) P-C4' energy: -53.864 flat angles C4'-P-C4' energy: -44.526 flat angles P-C4'-P energy: -30.800 tors. eta vs tors. theta energy: 1.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -605.366793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.366793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.366793 (E_RNA) where: Base-Base interactions energy: -329.327 where: short stacking energy: -227.075 Base-Backbone interact. energy: -0.447 local terms energy: -275.593220 where: bonds (distance) C4'-P energy: -63.355 bonds (distance) P-C4' energy: -65.379 flat angles C4'-P-C4' energy: -65.071 flat angles P-C4'-P energy: -32.156 tors. eta vs tors. theta energy: -49.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 27 Temperature: 0.964286 Total energy: -497.841419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.841419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.841419 (E_RNA) where: Base-Base interactions energy: -263.780 where: short stacking energy: -204.766 Base-Backbone interact. energy: 3.324 local terms energy: -237.385409 where: bonds (distance) C4'-P energy: -52.953 bonds (distance) P-C4' energy: -56.541 flat angles C4'-P-C4' energy: -62.165 flat angles P-C4'-P energy: -26.576 tors. eta vs tors. theta energy: -39.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 27 Temperature: 1.028571 Total energy: -383.918625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.918625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.918625 (E_RNA) where: Base-Base interactions energy: -161.883 where: short stacking energy: -158.247 Base-Backbone interact. energy: -0.272 local terms energy: -221.763829 where: bonds (distance) C4'-P energy: -55.253 bonds (distance) P-C4' energy: -55.209 flat angles C4'-P-C4' energy: -48.801 flat angles P-C4'-P energy: -36.240 tors. eta vs tors. theta energy: -26.261 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 27 Temperature: 1.092857 Total energy: -339.625701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.625701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.625701 (E_RNA) where: Base-Base interactions energy: -146.414 where: short stacking energy: -140.280 Base-Backbone interact. energy: 0.363 local terms energy: -193.574794 where: bonds (distance) C4'-P energy: -44.523 bonds (distance) P-C4' energy: -57.146 flat angles C4'-P-C4' energy: -52.939 flat angles P-C4'-P energy: -26.859 tors. eta vs tors. theta energy: -12.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 27 Temperature: 1.157143 Total energy: -339.874745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.874745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.874745 (E_RNA) where: Base-Base interactions energy: -135.748 where: short stacking energy: -134.690 Base-Backbone interact. energy: -0.368 local terms energy: -203.757873 where: bonds (distance) C4'-P energy: -53.609 bonds (distance) P-C4' energy: -58.419 flat angles C4'-P-C4' energy: -45.802 flat angles P-C4'-P energy: -28.665 tors. eta vs tors. theta energy: -17.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 27 Temperature: 1.221429 Total energy: -339.146465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.146465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.146465 (E_RNA) where: Base-Base interactions energy: -149.495 where: short stacking energy: -105.149 Base-Backbone interact. energy: -1.724 local terms energy: -187.927230 where: bonds (distance) C4'-P energy: -48.281 bonds (distance) P-C4' energy: -60.954 flat angles C4'-P-C4' energy: -45.771 flat angles P-C4'-P energy: -25.918 tors. eta vs tors. theta energy: -7.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 27 Temperature: 1.285714 Total energy: -254.955886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.955886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.955886 (E_RNA) where: Base-Base interactions energy: -95.899 where: short stacking energy: -92.959 Base-Backbone interact. energy: -0.911 local terms energy: -158.145835 where: bonds (distance) C4'-P energy: -43.386 bonds (distance) P-C4' energy: -40.859 flat angles C4'-P-C4' energy: -41.623 flat angles P-C4'-P energy: -35.901 tors. eta vs tors. theta energy: 3.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -248.396837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.396837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.396837 (E_RNA) where: Base-Base interactions energy: -87.451 where: short stacking energy: -79.344 Base-Backbone interact. energy: -0.706 local terms energy: -160.239598 where: bonds (distance) C4'-P energy: -57.043 bonds (distance) P-C4' energy: -45.246 flat angles C4'-P-C4' energy: -37.326 flat angles P-C4'-P energy: -24.099 tors. eta vs tors. theta energy: 3.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -617.573915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -617.573915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.573915 (E_RNA) where: Base-Base interactions energy: -342.332 where: short stacking energy: -229.170 Base-Backbone interact. energy: 0.256 local terms energy: -275.807094 where: bonds (distance) C4'-P energy: -58.929 bonds (distance) P-C4' energy: -65.541 flat angles C4'-P-C4' energy: -60.744 flat angles P-C4'-P energy: -36.861 tors. eta vs tors. theta energy: -53.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.309 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 28 Temperature: 0.964286 Total energy: -483.707073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.707073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.707073 (E_RNA) where: Base-Base interactions energy: -244.889 where: short stacking energy: -178.985 Base-Backbone interact. energy: 0.953 local terms energy: -239.771207 where: bonds (distance) C4'-P energy: -54.076 bonds (distance) P-C4' energy: -51.530 flat angles C4'-P-C4' energy: -53.070 flat angles P-C4'-P energy: -46.877 tors. eta vs tors. theta energy: -34.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 28 Temperature: 1.028571 Total energy: -407.328404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.328404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.328404 (E_RNA) where: Base-Base interactions energy: -164.660 where: short stacking energy: -160.578 Base-Backbone interact. energy: 0.526 local terms energy: -243.194188 where: bonds (distance) C4'-P energy: -56.932 bonds (distance) P-C4' energy: -62.934 flat angles C4'-P-C4' energy: -59.257 flat angles P-C4'-P energy: -35.652 tors. eta vs tors. theta energy: -28.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 28 Temperature: 1.092857 Total energy: -338.321906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.321906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.321906 (E_RNA) where: Base-Base interactions energy: -135.369 where: short stacking energy: -133.623 Base-Backbone interact. energy: -0.231 local terms energy: -202.721288 where: bonds (distance) C4'-P energy: -49.678 bonds (distance) P-C4' energy: -53.219 flat angles C4'-P-C4' energy: -52.543 flat angles P-C4'-P energy: -31.295 tors. eta vs tors. theta energy: -15.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 28 Temperature: 1.157143 Total energy: -359.774340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.774340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.774340 (E_RNA) where: Base-Base interactions energy: -171.221 where: short stacking energy: -127.223 Base-Backbone interact. energy: -0.040 local terms energy: -188.512943 where: bonds (distance) C4'-P energy: -45.086 bonds (distance) P-C4' energy: -45.232 flat angles C4'-P-C4' energy: -48.939 flat angles P-C4'-P energy: -32.730 tors. eta vs tors. theta energy: -16.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 28 Temperature: 1.221429 Total energy: -306.374224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.374224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.374224 (E_RNA) where: Base-Base interactions energy: -126.880 where: short stacking energy: -116.296 Base-Backbone interact. energy: 3.259 local terms energy: -182.752561 where: bonds (distance) C4'-P energy: -41.205 bonds (distance) P-C4' energy: -64.243 flat angles C4'-P-C4' energy: -45.293 flat angles P-C4'-P energy: -19.500 tors. eta vs tors. theta energy: -12.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 28 Temperature: 1.285714 Total energy: -247.162911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.162911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.162911 (E_RNA) where: Base-Base interactions energy: -87.576 where: short stacking energy: -73.423 Base-Backbone interact. energy: 2.696 local terms energy: -162.282653 where: bonds (distance) C4'-P energy: -47.627 bonds (distance) P-C4' energy: -58.210 flat angles C4'-P-C4' energy: -37.058 flat angles P-C4'-P energy: -29.222 tors. eta vs tors. theta energy: 9.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -239.210776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.210776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.210776 (E_RNA) where: Base-Base interactions energy: -94.466 where: short stacking energy: -68.150 Base-Backbone interact. energy: 0.364 local terms energy: -145.108583 where: bonds (distance) C4'-P energy: -36.063 bonds (distance) P-C4' energy: -40.307 flat angles C4'-P-C4' energy: -55.519 flat angles P-C4'-P energy: -22.713 tors. eta vs tors. theta energy: 9.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -607.599377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.599377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.599377 (E_RNA) where: Base-Base interactions energy: -345.012 where: short stacking energy: -227.120 Base-Backbone interact. energy: 0.862 local terms energy: -263.910657 where: bonds (distance) C4'-P energy: -58.811 bonds (distance) P-C4' energy: -60.505 flat angles C4'-P-C4' energy: -59.502 flat angles P-C4'-P energy: -38.234 tors. eta vs tors. theta energy: -46.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.461 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 29 Temperature: 0.964286 Total energy: -476.390369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.390369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.390369 (E_RNA) where: Base-Base interactions energy: -233.829 where: short stacking energy: -176.919 Base-Backbone interact. energy: -0.392 local terms energy: -242.169909 where: bonds (distance) C4'-P energy: -53.513 bonds (distance) P-C4' energy: -64.556 flat angles C4'-P-C4' energy: -58.116 flat angles P-C4'-P energy: -31.310 tors. eta vs tors. theta energy: -34.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 29 Temperature: 1.028571 Total energy: -413.190164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.190164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.190164 (E_RNA) where: Base-Base interactions energy: -176.555 where: short stacking energy: -164.809 Base-Backbone interact. energy: -0.288 local terms energy: -236.347179 where: bonds (distance) C4'-P energy: -57.235 bonds (distance) P-C4' energy: -58.015 flat angles C4'-P-C4' energy: -59.104 flat angles P-C4'-P energy: -25.514 tors. eta vs tors. theta energy: -36.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 29 Temperature: 1.092857 Total energy: -421.059700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.059700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.059700 (E_RNA) where: Base-Base interactions energy: -207.865 where: short stacking energy: -139.946 Base-Backbone interact. energy: -0.630 local terms energy: -212.564694 where: bonds (distance) C4'-P energy: -49.792 bonds (distance) P-C4' energy: -52.646 flat angles C4'-P-C4' energy: -49.496 flat angles P-C4'-P energy: -33.911 tors. eta vs tors. theta energy: -26.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 29 Temperature: 1.157143 Total energy: -302.322206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.322206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.322206 (E_RNA) where: Base-Base interactions energy: -120.373 where: short stacking energy: -108.110 Base-Backbone interact. energy: 1.002 local terms energy: -182.951335 where: bonds (distance) C4'-P energy: -51.343 bonds (distance) P-C4' energy: -51.013 flat angles C4'-P-C4' energy: -54.352 flat angles P-C4'-P energy: -21.299 tors. eta vs tors. theta energy: -4.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 29 Temperature: 1.221429 Total energy: -300.554512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.554512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.554512 (E_RNA) where: Base-Base interactions energy: -124.427 where: short stacking energy: -115.482 Base-Backbone interact. energy: 0.658 local terms energy: -176.785422 where: bonds (distance) C4'-P energy: -49.261 bonds (distance) P-C4' energy: -53.673 flat angles C4'-P-C4' energy: -51.693 flat angles P-C4'-P energy: -13.725 tors. eta vs tors. theta energy: -8.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 29 Temperature: 1.285714 Total energy: -246.236973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.236973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.236973 (E_RNA) where: Base-Base interactions energy: -78.479 where: short stacking energy: -73.075 Base-Backbone interact. energy: 0.823 local terms energy: -168.580956 where: bonds (distance) C4'-P energy: -52.414 bonds (distance) P-C4' energy: -51.416 flat angles C4'-P-C4' energy: -49.014 flat angles P-C4'-P energy: -18.174 tors. eta vs tors. theta energy: 2.437 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -255.613165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.613165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.613165 (E_RNA) where: Base-Base interactions energy: -79.327 where: short stacking energy: -69.834 Base-Backbone interact. energy: -0.393 local terms energy: -175.893386 where: bonds (distance) C4'-P energy: -51.611 bonds (distance) P-C4' energy: -43.467 flat angles C4'-P-C4' energy: -55.229 flat angles P-C4'-P energy: -25.652 tors. eta vs tors. theta energy: 0.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -596.878891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.878891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.878891 (E_RNA) where: Base-Base interactions energy: -334.375 where: short stacking energy: -211.784 Base-Backbone interact. energy: 0.523 local terms energy: -263.109394 where: bonds (distance) C4'-P energy: -59.549 bonds (distance) P-C4' energy: -61.041 flat angles C4'-P-C4' energy: -59.440 flat angles P-C4'-P energy: -35.851 tors. eta vs tors. theta energy: -47.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.083 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 30 Temperature: 0.964286 Total energy: -495.928082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.928082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.928082 (E_RNA) where: Base-Base interactions energy: -241.549 where: short stacking energy: -196.953 Base-Backbone interact. energy: -0.316 local terms energy: -254.062217 where: bonds (distance) C4'-P energy: -52.522 bonds (distance) P-C4' energy: -62.467 flat angles C4'-P-C4' energy: -62.591 flat angles P-C4'-P energy: -37.031 tors. eta vs tors. theta energy: -39.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 30 Temperature: 1.028571 Total energy: -440.681984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.681984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.681984 (E_RNA) where: Base-Base interactions energy: -226.314 where: short stacking energy: -157.523 Base-Backbone interact. energy: -1.285 local terms energy: -213.083044 where: bonds (distance) C4'-P energy: -48.408 bonds (distance) P-C4' energy: -59.710 flat angles C4'-P-C4' energy: -50.204 flat angles P-C4'-P energy: -31.017 tors. eta vs tors. theta energy: -23.745 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 30 Temperature: 1.092857 Total energy: -377.143019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.143019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.143019 (E_RNA) where: Base-Base interactions energy: -167.930 where: short stacking energy: -163.604 Base-Backbone interact. energy: 0.546 local terms energy: -209.758784 where: bonds (distance) C4'-P energy: -46.103 bonds (distance) P-C4' energy: -50.659 flat angles C4'-P-C4' energy: -48.139 flat angles P-C4'-P energy: -39.592 tors. eta vs tors. theta energy: -25.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 30 Temperature: 1.157143 Total energy: -316.675225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.675225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.675225 (E_RNA) where: Base-Base interactions energy: -126.007 where: short stacking energy: -104.153 Base-Backbone interact. energy: -2.759 local terms energy: -187.908837 where: bonds (distance) C4'-P energy: -56.791 bonds (distance) P-C4' energy: -53.829 flat angles C4'-P-C4' energy: -52.703 flat angles P-C4'-P energy: -15.790 tors. eta vs tors. theta energy: -8.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 30 Temperature: 1.221429 Total energy: -261.474635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.474635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.474635 (E_RNA) where: Base-Base interactions energy: -88.285 where: short stacking energy: -87.365 Base-Backbone interact. energy: 0.518 local terms energy: -173.708192 where: bonds (distance) C4'-P energy: -49.881 bonds (distance) P-C4' energy: -51.563 flat angles C4'-P-C4' energy: -46.448 flat angles P-C4'-P energy: -33.145 tors. eta vs tors. theta energy: 7.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 30 Temperature: 1.285714 Total energy: -269.258181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.258181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.258181 (E_RNA) where: Base-Base interactions energy: -96.060 where: short stacking energy: -87.524 Base-Backbone interact. energy: 1.552 local terms energy: -174.750519 where: bonds (distance) C4'-P energy: -47.618 bonds (distance) P-C4' energy: -49.148 flat angles C4'-P-C4' energy: -44.632 flat angles P-C4'-P energy: -29.831 tors. eta vs tors. theta energy: -3.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -234.693883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.693883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.693883 (E_RNA) where: Base-Base interactions energy: -94.162 where: short stacking energy: -67.691 Base-Backbone interact. energy: 1.323 local terms energy: -141.854466 where: bonds (distance) C4'-P energy: -47.464 bonds (distance) P-C4' energy: -50.053 flat angles C4'-P-C4' energy: -38.474 flat angles P-C4'-P energy: -18.147 tors. eta vs tors. theta energy: 12.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -569.672521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.672521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.672521 (E_RNA) where: Base-Base interactions energy: -313.441 where: short stacking energy: -196.437 Base-Backbone interact. energy: -0.258 local terms energy: -255.973452 where: bonds (distance) C4'-P energy: -61.263 bonds (distance) P-C4' energy: -61.512 flat angles C4'-P-C4' energy: -60.741 flat angles P-C4'-P energy: -34.647 tors. eta vs tors. theta energy: -37.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 31 Temperature: 0.964286 Total energy: -486.609693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.609693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.609693 (E_RNA) where: Base-Base interactions energy: -234.697 where: short stacking energy: -173.896 Base-Backbone interact. energy: -0.419 local terms energy: -251.493294 where: bonds (distance) C4'-P energy: -53.566 bonds (distance) P-C4' energy: -61.787 flat angles C4'-P-C4' energy: -55.844 flat angles P-C4'-P energy: -40.555 tors. eta vs tors. theta energy: -39.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 31 Temperature: 1.028571 Total energy: -432.718603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.718603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.718603 (E_RNA) where: Base-Base interactions energy: -222.923 where: short stacking energy: -130.483 Base-Backbone interact. energy: -0.283 local terms energy: -209.512268 where: bonds (distance) C4'-P energy: -50.901 bonds (distance) P-C4' energy: -60.749 flat angles C4'-P-C4' energy: -52.620 flat angles P-C4'-P energy: -25.035 tors. eta vs tors. theta energy: -20.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 31 Temperature: 1.092857 Total energy: -374.618770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.618770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.618770 (E_RNA) where: Base-Base interactions energy: -155.095 where: short stacking energy: -144.138 Base-Backbone interact. energy: -0.849 local terms energy: -218.674083 where: bonds (distance) C4'-P energy: -52.284 bonds (distance) P-C4' energy: -60.357 flat angles C4'-P-C4' energy: -57.861 flat angles P-C4'-P energy: -22.347 tors. eta vs tors. theta energy: -25.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 31 Temperature: 1.157143 Total energy: -301.686371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.686371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.686371 (E_RNA) where: Base-Base interactions energy: -117.800 where: short stacking energy: -110.642 Base-Backbone interact. energy: 2.595 local terms energy: -186.480724 where: bonds (distance) C4'-P energy: -50.183 bonds (distance) P-C4' energy: -60.204 flat angles C4'-P-C4' energy: -41.356 flat angles P-C4'-P energy: -29.494 tors. eta vs tors. theta energy: -5.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 31 Temperature: 1.221429 Total energy: -287.513165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.513165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.513165 (E_RNA) where: Base-Base interactions energy: -107.529 where: short stacking energy: -104.252 Base-Backbone interact. energy: -0.902 local terms energy: -179.082436 where: bonds (distance) C4'-P energy: -49.895 bonds (distance) P-C4' energy: -54.561 flat angles C4'-P-C4' energy: -53.638 flat angles P-C4'-P energy: -22.642 tors. eta vs tors. theta energy: 1.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 31 Temperature: 1.285714 Total energy: -256.221148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.221148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.221148 (E_RNA) where: Base-Base interactions energy: -89.071 where: short stacking energy: -86.804 Base-Backbone interact. energy: -0.843 local terms energy: -166.307012 where: bonds (distance) C4'-P energy: -47.309 bonds (distance) P-C4' energy: -60.946 flat angles C4'-P-C4' energy: -31.304 flat angles P-C4'-P energy: -29.180 tors. eta vs tors. theta energy: 2.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -205.570330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.570330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.570330 (E_RNA) where: Base-Base interactions energy: -54.358 where: short stacking energy: -32.330 Base-Backbone interact. energy: 0.130 local terms energy: -151.341778 where: bonds (distance) C4'-P energy: -40.244 bonds (distance) P-C4' energy: -46.006 flat angles C4'-P-C4' energy: -36.588 flat angles P-C4'-P energy: -37.325 tors. eta vs tors. theta energy: 8.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -608.279063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.279063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.279063 (E_RNA) where: Base-Base interactions energy: -338.046 where: short stacking energy: -232.655 Base-Backbone interact. energy: -0.884 local terms energy: -270.430745 where: bonds (distance) C4'-P energy: -56.831 bonds (distance) P-C4' energy: -60.775 flat angles C4'-P-C4' energy: -63.500 flat angles P-C4'-P energy: -44.032 tors. eta vs tors. theta energy: -45.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.082 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 32 Temperature: 0.964286 Total energy: -515.762458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.762458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.762458 (E_RNA) where: Base-Base interactions energy: -263.189 where: short stacking energy: -202.124 Base-Backbone interact. energy: -0.854 local terms energy: -251.718652 where: bonds (distance) C4'-P energy: -53.836 bonds (distance) P-C4' energy: -49.486 flat angles C4'-P-C4' energy: -57.402 flat angles P-C4'-P energy: -42.877 tors. eta vs tors. theta energy: -48.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 32 Temperature: 1.028571 Total energy: -457.705866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.705866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.705866 (E_RNA) where: Base-Base interactions energy: -229.808 where: short stacking energy: -143.958 Base-Backbone interact. energy: 1.939 local terms energy: -229.836971 where: bonds (distance) C4'-P energy: -55.632 bonds (distance) P-C4' energy: -61.981 flat angles C4'-P-C4' energy: -50.882 flat angles P-C4'-P energy: -35.871 tors. eta vs tors. theta energy: -25.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 32 Temperature: 1.092857 Total energy: -402.362089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.362089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.362089 (E_RNA) where: Base-Base interactions energy: -153.307 where: short stacking energy: -151.275 Base-Backbone interact. energy: -0.284 local terms energy: -248.771755 where: bonds (distance) C4'-P energy: -57.737 bonds (distance) P-C4' energy: -63.257 flat angles C4'-P-C4' energy: -58.678 flat angles P-C4'-P energy: -45.328 tors. eta vs tors. theta energy: -23.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 32 Temperature: 1.157143 Total energy: -335.982805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.982805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.982805 (E_RNA) where: Base-Base interactions energy: -136.275 where: short stacking energy: -124.656 Base-Backbone interact. energy: -1.163 local terms energy: -198.544326 where: bonds (distance) C4'-P energy: -46.529 bonds (distance) P-C4' energy: -55.019 flat angles C4'-P-C4' energy: -51.380 flat angles P-C4'-P energy: -31.202 tors. eta vs tors. theta energy: -14.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 32 Temperature: 1.221429 Total energy: -255.175444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.175444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.175444 (E_RNA) where: Base-Base interactions energy: -89.577 where: short stacking energy: -87.146 Base-Backbone interact. energy: 0.256 local terms energy: -165.854759 where: bonds (distance) C4'-P energy: -53.362 bonds (distance) P-C4' energy: -60.200 flat angles C4'-P-C4' energy: -41.629 flat angles P-C4'-P energy: -17.303 tors. eta vs tors. theta energy: 6.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 32 Temperature: 1.285714 Total energy: -259.883677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.883677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.883677 (E_RNA) where: Base-Base interactions energy: -134.282 where: short stacking energy: -93.742 Base-Backbone interact. energy: -0.346 local terms energy: -125.256409 where: bonds (distance) C4'-P energy: -39.330 bonds (distance) P-C4' energy: -45.158 flat angles C4'-P-C4' energy: -27.079 flat angles P-C4'-P energy: -25.458 tors. eta vs tors. theta energy: 11.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -262.842582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.842582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.842582 (E_RNA) where: Base-Base interactions energy: -94.994 where: short stacking energy: -66.864 Base-Backbone interact. energy: -1.292 local terms energy: -166.556185 where: bonds (distance) C4'-P energy: -55.738 bonds (distance) P-C4' energy: -52.999 flat angles C4'-P-C4' energy: -50.473 flat angles P-C4'-P energy: -23.112 tors. eta vs tors. theta energy: 15.765 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -600.880982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.880982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.880982 (E_RNA) where: Base-Base interactions energy: -323.903 where: short stacking energy: -223.800 Base-Backbone interact. energy: 0.985 local terms energy: -278.481227 where: bonds (distance) C4'-P energy: -60.679 bonds (distance) P-C4' energy: -64.174 flat angles C4'-P-C4' energy: -61.297 flat angles P-C4'-P energy: -48.340 tors. eta vs tors. theta energy: -43.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.518 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 33 Temperature: 0.964286 Total energy: -538.520856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.520856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.520856 (E_RNA) where: Base-Base interactions energy: -290.174 where: short stacking energy: -217.446 Base-Backbone interact. energy: -0.353 local terms energy: -247.994444 where: bonds (distance) C4'-P energy: -52.099 bonds (distance) P-C4' energy: -61.783 flat angles C4'-P-C4' energy: -56.182 flat angles P-C4'-P energy: -30.443 tors. eta vs tors. theta energy: -47.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 33 Temperature: 1.028571 Total energy: -448.685018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.685018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.685018 (E_RNA) where: Base-Base interactions energy: -236.929 where: short stacking energy: -142.104 Base-Backbone interact. energy: -0.299 local terms energy: -212.469414 where: bonds (distance) C4'-P energy: -42.831 bonds (distance) P-C4' energy: -55.611 flat angles C4'-P-C4' energy: -50.432 flat angles P-C4'-P energy: -32.027 tors. eta vs tors. theta energy: -31.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.012 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 33 Temperature: 1.092857 Total energy: -393.084586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.084586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.084586 (E_RNA) where: Base-Base interactions energy: -170.817 where: short stacking energy: -167.044 Base-Backbone interact. energy: -0.480 local terms energy: -221.787318 where: bonds (distance) C4'-P energy: -53.366 bonds (distance) P-C4' energy: -50.572 flat angles C4'-P-C4' energy: -53.111 flat angles P-C4'-P energy: -27.065 tors. eta vs tors. theta energy: -37.673 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 33 Temperature: 1.157143 Total energy: -345.144682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.144682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.144682 (E_RNA) where: Base-Base interactions energy: -144.419 where: short stacking energy: -136.226 Base-Backbone interact. energy: 3.333 local terms energy: -204.058515 where: bonds (distance) C4'-P energy: -46.764 bonds (distance) P-C4' energy: -62.771 flat angles C4'-P-C4' energy: -35.528 flat angles P-C4'-P energy: -39.074 tors. eta vs tors. theta energy: -19.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 33 Temperature: 1.221429 Total energy: -306.843630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.843630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.843630 (E_RNA) where: Base-Base interactions energy: -142.482 where: short stacking energy: -97.648 Base-Backbone interact. energy: 0.510 local terms energy: -164.871459 where: bonds (distance) C4'-P energy: -37.221 bonds (distance) P-C4' energy: -61.217 flat angles C4'-P-C4' energy: -39.665 flat angles P-C4'-P energy: -26.276 tors. eta vs tors. theta energy: -0.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 33 Temperature: 1.285714 Total energy: -246.037164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.037164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.037164 (E_RNA) where: Base-Base interactions energy: -102.010 where: short stacking energy: -93.297 Base-Backbone interact. energy: -0.723 local terms energy: -143.304099 where: bonds (distance) C4'-P energy: -28.281 bonds (distance) P-C4' energy: -52.593 flat angles C4'-P-C4' energy: -37.281 flat angles P-C4'-P energy: -31.608 tors. eta vs tors. theta energy: 6.459 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -220.871401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.871401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.871401 (E_RNA) where: Base-Base interactions energy: -69.290 where: short stacking energy: -65.365 Base-Backbone interact. energy: -0.129 local terms energy: -151.452640 where: bonds (distance) C4'-P energy: -45.771 bonds (distance) P-C4' energy: -52.007 flat angles C4'-P-C4' energy: -41.941 flat angles P-C4'-P energy: -28.703 tors. eta vs tors. theta energy: 16.969 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -565.039686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.039686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.039686 (E_RNA) where: Base-Base interactions energy: -311.734 where: short stacking energy: -226.027 Base-Backbone interact. energy: -0.820 local terms energy: -252.486061 where: bonds (distance) C4'-P energy: -54.944 bonds (distance) P-C4' energy: -57.771 flat angles C4'-P-C4' energy: -54.309 flat angles P-C4'-P energy: -40.922 tors. eta vs tors. theta energy: -44.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 34 Temperature: 0.964286 Total energy: -541.542227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.542227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.542227 (E_RNA) where: Base-Base interactions energy: -285.940 where: short stacking energy: -227.006 Base-Backbone interact. energy: 0.236 local terms energy: -255.838127 where: bonds (distance) C4'-P energy: -56.428 bonds (distance) P-C4' energy: -60.725 flat angles C4'-P-C4' energy: -56.148 flat angles P-C4'-P energy: -28.856 tors. eta vs tors. theta energy: -53.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 34 Temperature: 1.028571 Total energy: -450.076435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.076435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.076435 (E_RNA) where: Base-Base interactions energy: -228.275 where: short stacking energy: -148.168 Base-Backbone interact. energy: -0.681 local terms energy: -221.120474 where: bonds (distance) C4'-P energy: -49.928 bonds (distance) P-C4' energy: -61.862 flat angles C4'-P-C4' energy: -46.954 flat angles P-C4'-P energy: -32.218 tors. eta vs tors. theta energy: -30.158 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 34 Temperature: 1.092857 Total energy: -366.415806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.415806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.415806 (E_RNA) where: Base-Base interactions energy: -164.176 where: short stacking energy: -154.289 Base-Backbone interact. energy: -0.090 local terms energy: -202.149555 where: bonds (distance) C4'-P energy: -51.550 bonds (distance) P-C4' energy: -58.116 flat angles C4'-P-C4' energy: -50.617 flat angles P-C4'-P energy: -18.577 tors. eta vs tors. theta energy: -23.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 34 Temperature: 1.157143 Total energy: -334.638451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.638451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.638451 (E_RNA) where: Base-Base interactions energy: -150.515 where: short stacking energy: -106.830 Base-Backbone interact. energy: -0.319 local terms energy: -183.804823 where: bonds (distance) C4'-P energy: -43.260 bonds (distance) P-C4' energy: -49.645 flat angles C4'-P-C4' energy: -47.508 flat angles P-C4'-P energy: -37.533 tors. eta vs tors. theta energy: -5.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 34 Temperature: 1.221429 Total energy: -289.503552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.503552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.503552 (E_RNA) where: Base-Base interactions energy: -123.749 where: short stacking energy: -115.556 Base-Backbone interact. energy: 0.415 local terms energy: -168.260499 where: bonds (distance) C4'-P energy: -46.331 bonds (distance) P-C4' energy: -56.070 flat angles C4'-P-C4' energy: -45.854 flat angles P-C4'-P energy: -24.298 tors. eta vs tors. theta energy: 4.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 2.091 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 34 Temperature: 1.285714 Total energy: -251.340076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.340076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.340076 (E_RNA) where: Base-Base interactions energy: -101.128 where: short stacking energy: -94.753 Base-Backbone interact. energy: -0.243 local terms energy: -149.969413 where: bonds (distance) C4'-P energy: -36.771 bonds (distance) P-C4' energy: -37.614 flat angles C4'-P-C4' energy: -52.041 flat angles P-C4'-P energy: -25.645 tors. eta vs tors. theta energy: 2.101 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -242.473012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.473012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.473012 (E_RNA) where: Base-Base interactions energy: -74.966 where: short stacking energy: -70.558 Base-Backbone interact. energy: 0.179 local terms energy: -167.686129 where: bonds (distance) C4'-P energy: -36.280 bonds (distance) P-C4' energy: -60.673 flat angles C4'-P-C4' energy: -49.154 flat angles P-C4'-P energy: -20.364 tors. eta vs tors. theta energy: -1.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -564.548392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.548392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.548392 (E_RNA) where: Base-Base interactions energy: -312.688 where: short stacking energy: -217.539 Base-Backbone interact. energy: 0.920 local terms energy: -252.780542 where: bonds (distance) C4'-P energy: -63.308 bonds (distance) P-C4' energy: -53.386 flat angles C4'-P-C4' energy: -56.937 flat angles P-C4'-P energy: -45.358 tors. eta vs tors. theta energy: -33.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 35 Temperature: 0.964286 Total energy: -500.820143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.820143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.820143 (E_RNA) where: Base-Base interactions energy: -279.028 where: short stacking energy: -176.716 Base-Backbone interact. energy: -0.904 local terms energy: -220.887816 where: bonds (distance) C4'-P energy: -54.343 bonds (distance) P-C4' energy: -47.824 flat angles C4'-P-C4' energy: -51.824 flat angles P-C4'-P energy: -35.490 tors. eta vs tors. theta energy: -31.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 35 Temperature: 1.028571 Total energy: -476.089337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.089337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.089337 (E_RNA) where: Base-Base interactions energy: -255.675 where: short stacking energy: -197.320 Base-Backbone interact. energy: -0.334 local terms energy: -220.079787 where: bonds (distance) C4'-P energy: -56.621 bonds (distance) P-C4' energy: -46.190 flat angles C4'-P-C4' energy: -49.316 flat angles P-C4'-P energy: -27.620 tors. eta vs tors. theta energy: -40.333 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 35 Temperature: 1.092857 Total energy: -367.510266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.510266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.510266 (E_RNA) where: Base-Base interactions energy: -159.766 where: short stacking energy: -127.625 Base-Backbone interact. energy: -1.009 local terms energy: -206.736064 where: bonds (distance) C4'-P energy: -56.533 bonds (distance) P-C4' energy: -52.716 flat angles C4'-P-C4' energy: -48.889 flat angles P-C4'-P energy: -46.293 tors. eta vs tors. theta energy: -2.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 35 Temperature: 1.157143 Total energy: -346.285530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.285530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.285530 (E_RNA) where: Base-Base interactions energy: -150.367 where: short stacking energy: -139.039 Base-Backbone interact. energy: 0.116 local terms energy: -196.034642 where: bonds (distance) C4'-P energy: -40.085 bonds (distance) P-C4' energy: -54.904 flat angles C4'-P-C4' energy: -49.577 flat angles P-C4'-P energy: -33.871 tors. eta vs tors. theta energy: -17.597 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 35 Temperature: 1.221429 Total energy: -308.433383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.433383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.433383 (E_RNA) where: Base-Base interactions energy: -131.073 where: short stacking energy: -121.395 Base-Backbone interact. energy: 0.786 local terms energy: -178.146441 where: bonds (distance) C4'-P energy: -48.726 bonds (distance) P-C4' energy: -41.344 flat angles C4'-P-C4' energy: -43.244 flat angles P-C4'-P energy: -34.137 tors. eta vs tors. theta energy: -10.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 35 Temperature: 1.285714 Total energy: -251.650259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.650259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.650259 (E_RNA) where: Base-Base interactions energy: -76.273 where: short stacking energy: -67.225 Base-Backbone interact. energy: 1.647 local terms energy: -177.024375 where: bonds (distance) C4'-P energy: -48.575 bonds (distance) P-C4' energy: -57.146 flat angles C4'-P-C4' energy: -37.955 flat angles P-C4'-P energy: -33.201 tors. eta vs tors. theta energy: -0.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -222.204733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.204733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.204733 (E_RNA) where: Base-Base interactions energy: -84.374 where: short stacking energy: -63.098 Base-Backbone interact. energy: -2.277 local terms energy: -135.554524 where: bonds (distance) C4'-P energy: -46.729 bonds (distance) P-C4' energy: -41.887 flat angles C4'-P-C4' energy: -39.905 flat angles P-C4'-P energy: -19.995 tors. eta vs tors. theta energy: 12.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -521.090418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.090418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.090418 (E_RNA) where: Base-Base interactions energy: -275.011 where: short stacking energy: -181.312 Base-Backbone interact. energy: -1.355 local terms energy: -244.724111 where: bonds (distance) C4'-P energy: -53.183 bonds (distance) P-C4' energy: -66.913 flat angles C4'-P-C4' energy: -60.726 flat angles P-C4'-P energy: -27.114 tors. eta vs tors. theta energy: -36.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 36 Temperature: 0.964286 Total energy: -536.379521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.379521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.379521 (E_RNA) where: Base-Base interactions energy: -285.233 where: short stacking energy: -190.526 Base-Backbone interact. energy: 0.602 local terms energy: -251.748928 where: bonds (distance) C4'-P energy: -61.033 bonds (distance) P-C4' energy: -63.196 flat angles C4'-P-C4' energy: -52.232 flat angles P-C4'-P energy: -37.026 tors. eta vs tors. theta energy: -38.261 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 36 Temperature: 1.028571 Total energy: -478.715939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.715939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.715939 (E_RNA) where: Base-Base interactions energy: -238.043 where: short stacking energy: -167.473 Base-Backbone interact. energy: -0.200 local terms energy: -240.472360 where: bonds (distance) C4'-P energy: -58.450 bonds (distance) P-C4' energy: -48.795 flat angles C4'-P-C4' energy: -64.222 flat angles P-C4'-P energy: -35.331 tors. eta vs tors. theta energy: -33.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 36 Temperature: 1.092857 Total energy: -388.108498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.108498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.108498 (E_RNA) where: Base-Base interactions energy: -179.158 where: short stacking energy: -136.099 Base-Backbone interact. energy: -1.710 local terms energy: -207.240561 where: bonds (distance) C4'-P energy: -53.178 bonds (distance) P-C4' energy: -62.777 flat angles C4'-P-C4' energy: -42.035 flat angles P-C4'-P energy: -30.142 tors. eta vs tors. theta energy: -19.109 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 36 Temperature: 1.157143 Total energy: -318.395715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.395715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.395715 (E_RNA) where: Base-Base interactions energy: -128.534 where: short stacking energy: -128.307 Base-Backbone interact. energy: 0.201 local terms energy: -190.063014 where: bonds (distance) C4'-P energy: -36.653 bonds (distance) P-C4' energy: -51.578 flat angles C4'-P-C4' energy: -40.478 flat angles P-C4'-P energy: -38.620 tors. eta vs tors. theta energy: -22.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 36 Temperature: 1.221429 Total energy: -302.804304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.804304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.804304 (E_RNA) where: Base-Base interactions energy: -103.847 where: short stacking energy: -102.168 Base-Backbone interact. energy: 1.320 local terms energy: -200.757796 where: bonds (distance) C4'-P energy: -56.210 bonds (distance) P-C4' energy: -47.155 flat angles C4'-P-C4' energy: -56.928 flat angles P-C4'-P energy: -32.202 tors. eta vs tors. theta energy: -8.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.481 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 36 Temperature: 1.285714 Total energy: -239.509259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.509259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.509259 (E_RNA) where: Base-Base interactions energy: -78.853 where: short stacking energy: -56.500 Base-Backbone interact. energy: 1.838 local terms energy: -162.493467 where: bonds (distance) C4'-P energy: -46.060 bonds (distance) P-C4' energy: -47.336 flat angles C4'-P-C4' energy: -49.606 flat angles P-C4'-P energy: -28.043 tors. eta vs tors. theta energy: 8.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -214.217106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.217106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.217106 (E_RNA) where: Base-Base interactions energy: -75.344 where: short stacking energy: -63.374 Base-Backbone interact. energy: -0.500 local terms energy: -138.373130 where: bonds (distance) C4'-P energy: -42.496 bonds (distance) P-C4' energy: -51.575 flat angles C4'-P-C4' energy: -33.072 flat angles P-C4'-P energy: -21.663 tors. eta vs tors. theta energy: 10.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -569.378693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.378693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.378693 (E_RNA) where: Base-Base interactions energy: -316.717 where: short stacking energy: -218.092 Base-Backbone interact. energy: -0.436 local terms energy: -252.225607 where: bonds (distance) C4'-P energy: -53.611 bonds (distance) P-C4' energy: -56.466 flat angles C4'-P-C4' energy: -57.676 flat angles P-C4'-P energy: -40.829 tors. eta vs tors. theta energy: -43.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 37 Temperature: 0.964286 Total energy: -561.250338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.250338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.250338 (E_RNA) where: Base-Base interactions energy: -310.205 where: short stacking energy: -220.474 Base-Backbone interact. energy: -0.684 local terms energy: -250.361507 where: bonds (distance) C4'-P energy: -59.179 bonds (distance) P-C4' energy: -59.697 flat angles C4'-P-C4' energy: -50.321 flat angles P-C4'-P energy: -29.909 tors. eta vs tors. theta energy: -51.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 37 Temperature: 1.028571 Total energy: -478.007232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.007232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.007232 (E_RNA) where: Base-Base interactions energy: -234.441 where: short stacking energy: -176.288 Base-Backbone interact. energy: -0.771 local terms energy: -242.795647 where: bonds (distance) C4'-P energy: -61.502 bonds (distance) P-C4' energy: -57.936 flat angles C4'-P-C4' energy: -58.061 flat angles P-C4'-P energy: -25.820 tors. eta vs tors. theta energy: -39.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 37 Temperature: 1.092857 Total energy: -420.043979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.043979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.043979 (E_RNA) where: Base-Base interactions energy: -211.720 where: short stacking energy: -168.366 Base-Backbone interact. energy: 0.719 local terms energy: -209.042765 where: bonds (distance) C4'-P energy: -41.208 bonds (distance) P-C4' energy: -57.920 flat angles C4'-P-C4' energy: -59.861 flat angles P-C4'-P energy: -32.270 tors. eta vs tors. theta energy: -17.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 37 Temperature: 1.157143 Total energy: -348.419090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.419090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.419090 (E_RNA) where: Base-Base interactions energy: -150.479 where: short stacking energy: -131.070 Base-Backbone interact. energy: -0.198 local terms energy: -199.611509 where: bonds (distance) C4'-P energy: -55.273 bonds (distance) P-C4' energy: -43.745 flat angles C4'-P-C4' energy: -50.017 flat angles P-C4'-P energy: -30.150 tors. eta vs tors. theta energy: -20.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.870 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 37 Temperature: 1.221429 Total energy: -321.301298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.301298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.301298 (E_RNA) where: Base-Base interactions energy: -130.198 where: short stacking energy: -123.381 Base-Backbone interact. energy: -0.917 local terms energy: -190.186618 where: bonds (distance) C4'-P energy: -60.196 bonds (distance) P-C4' energy: -58.582 flat angles C4'-P-C4' energy: -43.325 flat angles P-C4'-P energy: -16.531 tors. eta vs tors. theta energy: -11.552 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 37 Temperature: 1.285714 Total energy: -275.810039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.810039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.810039 (E_RNA) where: Base-Base interactions energy: -107.908 where: short stacking energy: -104.329 Base-Backbone interact. energy: -0.706 local terms energy: -167.196899 where: bonds (distance) C4'-P energy: -48.915 bonds (distance) P-C4' energy: -42.324 flat angles C4'-P-C4' energy: -44.648 flat angles P-C4'-P energy: -27.507 tors. eta vs tors. theta energy: -3.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -220.004797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.004797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.004797 (E_RNA) where: Base-Base interactions energy: -77.625 where: short stacking energy: -55.990 Base-Backbone interact. energy: 0.358 local terms energy: -142.736972 where: bonds (distance) C4'-P energy: -36.174 bonds (distance) P-C4' energy: -50.286 flat angles C4'-P-C4' energy: -41.739 flat angles P-C4'-P energy: -25.823 tors. eta vs tors. theta energy: 11.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -590.685375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.685375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.685375 (E_RNA) where: Base-Base interactions energy: -319.785 where: short stacking energy: -219.069 Base-Backbone interact. energy: -0.622 local terms energy: -270.278191 where: bonds (distance) C4'-P energy: -57.642 bonds (distance) P-C4' energy: -58.901 flat angles C4'-P-C4' energy: -57.526 flat angles P-C4'-P energy: -45.360 tors. eta vs tors. theta energy: -50.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 38 Temperature: 0.964286 Total energy: -515.506863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.506863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.506863 (E_RNA) where: Base-Base interactions energy: -275.401 where: short stacking energy: -175.897 Base-Backbone interact. energy: -0.498 local terms energy: -239.607473 where: bonds (distance) C4'-P energy: -64.595 bonds (distance) P-C4' energy: -65.053 flat angles C4'-P-C4' energy: -55.463 flat angles P-C4'-P energy: -31.775 tors. eta vs tors. theta energy: -22.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 38 Temperature: 1.028571 Total energy: -518.764331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.764331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.764331 (E_RNA) where: Base-Base interactions energy: -269.413 where: short stacking energy: -192.142 Base-Backbone interact. energy: 2.399 local terms energy: -251.750113 where: bonds (distance) C4'-P energy: -58.019 bonds (distance) P-C4' energy: -55.924 flat angles C4'-P-C4' energy: -60.009 flat angles P-C4'-P energy: -30.571 tors. eta vs tors. theta energy: -47.227 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 38 Temperature: 1.092857 Total energy: -387.554735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.554735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.554735 (E_RNA) where: Base-Base interactions energy: -193.576 where: short stacking energy: -131.823 Base-Backbone interact. energy: -2.140 local terms energy: -191.838538 where: bonds (distance) C4'-P energy: -49.863 bonds (distance) P-C4' energy: -47.723 flat angles C4'-P-C4' energy: -43.004 flat angles P-C4'-P energy: -35.223 tors. eta vs tors. theta energy: -16.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 38 Temperature: 1.157143 Total energy: -358.784299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.784299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.784299 (E_RNA) where: Base-Base interactions energy: -169.296 where: short stacking energy: -147.631 Base-Backbone interact. energy: -0.296 local terms energy: -190.555335 where: bonds (distance) C4'-P energy: -45.704 bonds (distance) P-C4' energy: -47.152 flat angles C4'-P-C4' energy: -54.134 flat angles P-C4'-P energy: -10.543 tors. eta vs tors. theta energy: -33.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.363 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 38 Temperature: 1.221429 Total energy: -323.369185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.369185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.369185 (E_RNA) where: Base-Base interactions energy: -154.244 where: short stacking energy: -113.282 Base-Backbone interact. energy: 2.141 local terms energy: -171.266559 where: bonds (distance) C4'-P energy: -47.688 bonds (distance) P-C4' energy: -49.627 flat angles C4'-P-C4' energy: -35.470 flat angles P-C4'-P energy: -32.271 tors. eta vs tors. theta energy: -6.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 38 Temperature: 1.285714 Total energy: -243.792484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.792484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.792484 (E_RNA) where: Base-Base interactions energy: -81.393 where: short stacking energy: -74.876 Base-Backbone interact. energy: 0.548 local terms energy: -162.947812 where: bonds (distance) C4'-P energy: -46.211 bonds (distance) P-C4' energy: -49.070 flat angles C4'-P-C4' energy: -50.705 flat angles P-C4'-P energy: -26.587 tors. eta vs tors. theta energy: 9.626 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -222.146644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.146644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.146644 (E_RNA) where: Base-Base interactions energy: -80.572 where: short stacking energy: -66.024 Base-Backbone interact. energy: 0.080 local terms energy: -141.655011 where: bonds (distance) C4'-P energy: -51.248 bonds (distance) P-C4' energy: -52.526 flat angles C4'-P-C4' energy: -31.800 flat angles P-C4'-P energy: -22.337 tors. eta vs tors. theta energy: 16.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -595.829005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.829005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.829005 (E_RNA) where: Base-Base interactions energy: -346.762 where: short stacking energy: -232.828 Base-Backbone interact. energy: -0.902 local terms energy: -248.165337 where: bonds (distance) C4'-P energy: -50.159 bonds (distance) P-C4' energy: -58.722 flat angles C4'-P-C4' energy: -58.398 flat angles P-C4'-P energy: -32.089 tors. eta vs tors. theta energy: -48.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 39 Temperature: 0.964286 Total energy: -519.245314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.245314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.245314 (E_RNA) where: Base-Base interactions energy: -288.911 where: short stacking energy: -202.966 Base-Backbone interact. energy: -1.234 local terms energy: -229.100909 where: bonds (distance) C4'-P energy: -61.280 bonds (distance) P-C4' energy: -55.676 flat angles C4'-P-C4' energy: -49.733 flat angles P-C4'-P energy: -34.739 tors. eta vs tors. theta energy: -27.673 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 39 Temperature: 1.028571 Total energy: -488.954927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.954927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.954927 (E_RNA) where: Base-Base interactions energy: -253.721 where: short stacking energy: -185.185 Base-Backbone interact. energy: -0.379 local terms energy: -234.855722 where: bonds (distance) C4'-P energy: -53.864 bonds (distance) P-C4' energy: -60.399 flat angles C4'-P-C4' energy: -56.975 flat angles P-C4'-P energy: -30.050 tors. eta vs tors. theta energy: -33.567 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 39 Temperature: 1.092857 Total energy: -399.346240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.346240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.346240 (E_RNA) where: Base-Base interactions energy: -217.426 where: short stacking energy: -151.655 Base-Backbone interact. energy: -0.996 local terms energy: -180.924393 where: bonds (distance) C4'-P energy: -40.672 bonds (distance) P-C4' energy: -44.581 flat angles C4'-P-C4' energy: -47.892 flat angles P-C4'-P energy: -30.590 tors. eta vs tors. theta energy: -17.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 39 Temperature: 1.157143 Total energy: -308.238991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.238991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.238991 (E_RNA) where: Base-Base interactions energy: -117.552 where: short stacking energy: -100.083 Base-Backbone interact. energy: -1.386 local terms energy: -189.300805 where: bonds (distance) C4'-P energy: -44.468 bonds (distance) P-C4' energy: -53.064 flat angles C4'-P-C4' energy: -53.589 flat angles P-C4'-P energy: -29.343 tors. eta vs tors. theta energy: -8.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 39 Temperature: 1.221429 Total energy: -291.454345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.454345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.454345 (E_RNA) where: Base-Base interactions energy: -128.781 where: short stacking energy: -83.362 Base-Backbone interact. energy: -1.151 local terms energy: -161.522573 where: bonds (distance) C4'-P energy: -42.747 bonds (distance) P-C4' energy: -50.366 flat angles C4'-P-C4' energy: -40.252 flat angles P-C4'-P energy: -30.549 tors. eta vs tors. theta energy: 2.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 39 Temperature: 1.285714 Total energy: -243.093319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.093319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.093319 (E_RNA) where: Base-Base interactions energy: -89.450 where: short stacking energy: -73.299 Base-Backbone interact. energy: -0.694 local terms energy: -152.949369 where: bonds (distance) C4'-P energy: -42.841 bonds (distance) P-C4' energy: -52.159 flat angles C4'-P-C4' energy: -40.714 flat angles P-C4'-P energy: -18.471 tors. eta vs tors. theta energy: 1.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -226.862882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.862882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.862882 (E_RNA) where: Base-Base interactions energy: -69.953 where: short stacking energy: -56.618 Base-Backbone interact. energy: -3.081 local terms energy: -153.947855 where: bonds (distance) C4'-P energy: -42.549 bonds (distance) P-C4' energy: -63.241 flat angles C4'-P-C4' energy: -37.955 flat angles P-C4'-P energy: -23.205 tors. eta vs tors. theta energy: 13.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.118 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -579.086794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.086794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.086794 (E_RNA) where: Base-Base interactions energy: -324.968 where: short stacking energy: -228.852 Base-Backbone interact. energy: -0.223 local terms energy: -253.895732 where: bonds (distance) C4'-P energy: -47.162 bonds (distance) P-C4' energy: -53.180 flat angles C4'-P-C4' energy: -61.684 flat angles P-C4'-P energy: -40.265 tors. eta vs tors. theta energy: -51.605 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 40 Temperature: 0.964286 Total energy: -502.152064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.152064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.152064 (E_RNA) where: Base-Base interactions energy: -265.705 where: short stacking energy: -172.456 Base-Backbone interact. energy: -0.812 local terms energy: -235.635591 where: bonds (distance) C4'-P energy: -66.023 bonds (distance) P-C4' energy: -61.691 flat angles C4'-P-C4' energy: -50.299 flat angles P-C4'-P energy: -29.224 tors. eta vs tors. theta energy: -28.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 40 Temperature: 1.028571 Total energy: -485.594957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.594957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.594957 (E_RNA) where: Base-Base interactions energy: -251.373 where: short stacking energy: -184.347 Base-Backbone interact. energy: 0.870 local terms energy: -235.091920 where: bonds (distance) C4'-P energy: -56.516 bonds (distance) P-C4' energy: -57.951 flat angles C4'-P-C4' energy: -48.218 flat angles P-C4'-P energy: -31.487 tors. eta vs tors. theta energy: -40.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 40 Temperature: 1.092857 Total energy: -402.447287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.447287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.447287 (E_RNA) where: Base-Base interactions energy: -201.717 where: short stacking energy: -148.694 Base-Backbone interact. energy: -0.410 local terms energy: -200.319612 where: bonds (distance) C4'-P energy: -43.778 bonds (distance) P-C4' energy: -60.042 flat angles C4'-P-C4' energy: -45.333 flat angles P-C4'-P energy: -32.474 tors. eta vs tors. theta energy: -18.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 40 Temperature: 1.157143 Total energy: -336.603975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.603975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.603975 (E_RNA) where: Base-Base interactions energy: -155.391 where: short stacking energy: -107.429 Base-Backbone interact. energy: 1.977 local terms energy: -183.190497 where: bonds (distance) C4'-P energy: -45.945 bonds (distance) P-C4' energy: -50.123 flat angles C4'-P-C4' energy: -42.719 flat angles P-C4'-P energy: -36.779 tors. eta vs tors. theta energy: -7.624 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 40 Temperature: 1.221429 Total energy: -289.695956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.695956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.695956 (E_RNA) where: Base-Base interactions energy: -110.274 where: short stacking energy: -102.877 Base-Backbone interact. energy: -0.671 local terms energy: -178.751349 where: bonds (distance) C4'-P energy: -42.657 bonds (distance) P-C4' energy: -46.666 flat angles C4'-P-C4' energy: -45.071 flat angles P-C4'-P energy: -39.909 tors. eta vs tors. theta energy: -4.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 40 Temperature: 1.285714 Total energy: -240.049376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.049376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.049376 (E_RNA) where: Base-Base interactions energy: -76.112 where: short stacking energy: -67.654 Base-Backbone interact. energy: -1.334 local terms energy: -162.604148 where: bonds (distance) C4'-P energy: -55.873 bonds (distance) P-C4' energy: -43.341 flat angles C4'-P-C4' energy: -35.863 flat angles P-C4'-P energy: -35.705 tors. eta vs tors. theta energy: 8.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -253.693620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.693620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.693620 (E_RNA) where: Base-Base interactions energy: -87.481 where: short stacking energy: -84.163 Base-Backbone interact. energy: -0.490 local terms energy: -165.722654 where: bonds (distance) C4'-P energy: -40.839 bonds (distance) P-C4' energy: -47.071 flat angles C4'-P-C4' energy: -41.765 flat angles P-C4'-P energy: -32.878 tors. eta vs tors. theta energy: -3.170 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -573.833637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.833637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.833637 (E_RNA) where: Base-Base interactions energy: -311.545 where: short stacking energy: -214.946 Base-Backbone interact. energy: -0.755 local terms energy: -261.534065 where: bonds (distance) C4'-P energy: -57.131 bonds (distance) P-C4' energy: -61.328 flat angles C4'-P-C4' energy: -61.265 flat angles P-C4'-P energy: -39.802 tors. eta vs tors. theta energy: -42.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 41 Temperature: 0.964286 Total energy: -539.746607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.746607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.746607 (E_RNA) where: Base-Base interactions energy: -282.875 where: short stacking energy: -184.837 Base-Backbone interact. energy: -1.182 local terms energy: -255.689332 where: bonds (distance) C4'-P energy: -55.132 bonds (distance) P-C4' energy: -59.097 flat angles C4'-P-C4' energy: -61.918 flat angles P-C4'-P energy: -36.895 tors. eta vs tors. theta energy: -42.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 41 Temperature: 1.028571 Total energy: -495.386903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.386903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.386903 (E_RNA) where: Base-Base interactions energy: -245.042 where: short stacking energy: -174.972 Base-Backbone interact. energy: -0.512 local terms energy: -249.833350 where: bonds (distance) C4'-P energy: -64.156 bonds (distance) P-C4' energy: -65.684 flat angles C4'-P-C4' energy: -60.775 flat angles P-C4'-P energy: -31.465 tors. eta vs tors. theta energy: -27.754 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 41 Temperature: 1.092857 Total energy: -422.874682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.874682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.874682 (E_RNA) where: Base-Base interactions energy: -221.630 where: short stacking energy: -140.918 Base-Backbone interact. energy: 0.105 local terms energy: -201.349506 where: bonds (distance) C4'-P energy: -52.325 bonds (distance) P-C4' energy: -53.187 flat angles C4'-P-C4' energy: -45.663 flat angles P-C4'-P energy: -27.894 tors. eta vs tors. theta energy: -22.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 41 Temperature: 1.157143 Total energy: -351.642063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.642063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.642063 (E_RNA) where: Base-Base interactions energy: -171.588 where: short stacking energy: -108.632 Base-Backbone interact. energy: 1.554 local terms energy: -181.607741 where: bonds (distance) C4'-P energy: -50.175 bonds (distance) P-C4' energy: -44.770 flat angles C4'-P-C4' energy: -48.806 flat angles P-C4'-P energy: -30.998 tors. eta vs tors. theta energy: -6.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 41 Temperature: 1.221429 Total energy: -278.010828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.010828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.010828 (E_RNA) where: Base-Base interactions energy: -89.056 where: short stacking energy: -87.966 Base-Backbone interact. energy: -0.330 local terms energy: -188.624511 where: bonds (distance) C4'-P energy: -50.417 bonds (distance) P-C4' energy: -56.276 flat angles C4'-P-C4' energy: -50.678 flat angles P-C4'-P energy: -23.987 tors. eta vs tors. theta energy: -7.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 41 Temperature: 1.285714 Total energy: -261.036841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.036841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.036841 (E_RNA) where: Base-Base interactions energy: -87.776 where: short stacking energy: -75.385 Base-Backbone interact. energy: 0.218 local terms energy: -173.478183 where: bonds (distance) C4'-P energy: -48.832 bonds (distance) P-C4' energy: -59.887 flat angles C4'-P-C4' energy: -47.857 flat angles P-C4'-P energy: -27.332 tors. eta vs tors. theta energy: 10.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -242.326933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.326933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.326933 (E_RNA) where: Base-Base interactions energy: -92.359 where: short stacking energy: -87.843 Base-Backbone interact. energy: -0.501 local terms energy: -149.466838 where: bonds (distance) C4'-P energy: -52.093 bonds (distance) P-C4' energy: -34.439 flat angles C4'-P-C4' energy: -37.219 flat angles P-C4'-P energy: -27.970 tors. eta vs tors. theta energy: 2.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -587.947876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.947876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.947876 (E_RNA) where: Base-Base interactions energy: -327.457 where: short stacking energy: -207.859 Base-Backbone interact. energy: -1.244 local terms energy: -259.247341 where: bonds (distance) C4'-P energy: -58.997 bonds (distance) P-C4' energy: -61.166 flat angles C4'-P-C4' energy: -51.221 flat angles P-C4'-P energy: -38.871 tors. eta vs tors. theta energy: -48.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 42 Temperature: 0.964286 Total energy: -550.603942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.603942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.603942 (E_RNA) where: Base-Base interactions energy: -305.617 where: short stacking energy: -212.199 Base-Backbone interact. energy: -0.337 local terms energy: -244.650249 where: bonds (distance) C4'-P energy: -52.719 bonds (distance) P-C4' energy: -55.160 flat angles C4'-P-C4' energy: -51.163 flat angles P-C4'-P energy: -37.672 tors. eta vs tors. theta energy: -47.937 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 42 Temperature: 1.028571 Total energy: -496.800615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.800615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.800615 (E_RNA) where: Base-Base interactions energy: -253.364 where: short stacking energy: -179.587 Base-Backbone interact. energy: 0.852 local terms energy: -244.288136 where: bonds (distance) C4'-P energy: -53.835 bonds (distance) P-C4' energy: -58.751 flat angles C4'-P-C4' energy: -63.170 flat angles P-C4'-P energy: -34.460 tors. eta vs tors. theta energy: -34.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 42 Temperature: 1.092857 Total energy: -391.439142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.439142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.439142 (E_RNA) where: Base-Base interactions energy: -188.966 where: short stacking energy: -131.895 Base-Backbone interact. energy: -0.251 local terms energy: -202.222571 where: bonds (distance) C4'-P energy: -50.956 bonds (distance) P-C4' energy: -58.070 flat angles C4'-P-C4' energy: -52.686 flat angles P-C4'-P energy: -19.257 tors. eta vs tors. theta energy: -21.253 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 42 Temperature: 1.157143 Total energy: -324.828391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.828391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.828391 (E_RNA) where: Base-Base interactions energy: -131.578 where: short stacking energy: -91.712 Base-Backbone interact. energy: -1.014 local terms energy: -192.236076 where: bonds (distance) C4'-P energy: -37.977 bonds (distance) P-C4' energy: -59.619 flat angles C4'-P-C4' energy: -53.189 flat angles P-C4'-P energy: -41.231 tors. eta vs tors. theta energy: -0.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 42 Temperature: 1.221429 Total energy: -272.096412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.096412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.096412 (E_RNA) where: Base-Base interactions energy: -103.861 where: short stacking energy: -89.972 Base-Backbone interact. energy: -1.003 local terms energy: -167.232398 where: bonds (distance) C4'-P energy: -52.683 bonds (distance) P-C4' energy: -46.443 flat angles C4'-P-C4' energy: -46.772 flat angles P-C4'-P energy: -31.793 tors. eta vs tors. theta energy: 10.459 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 42 Temperature: 1.285714 Total energy: -239.948176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.948176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.948176 (E_RNA) where: Base-Base interactions energy: -95.429 where: short stacking energy: -95.828 Base-Backbone interact. energy: -0.629 local terms energy: -143.890045 where: bonds (distance) C4'-P energy: -46.712 bonds (distance) P-C4' energy: -48.456 flat angles C4'-P-C4' energy: -36.695 flat angles P-C4'-P energy: -11.912 tors. eta vs tors. theta energy: -0.115 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -223.514808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.514808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.514808 (E_RNA) where: Base-Base interactions energy: -60.568 where: short stacking energy: -49.560 Base-Backbone interact. energy: -1.591 local terms energy: -161.355818 where: bonds (distance) C4'-P energy: -61.388 bonds (distance) P-C4' energy: -46.579 flat angles C4'-P-C4' energy: -43.245 flat angles P-C4'-P energy: -28.721 tors. eta vs tors. theta energy: 18.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -606.687347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.687347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.687347 (E_RNA) where: Base-Base interactions energy: -363.668 where: short stacking energy: -223.882 Base-Backbone interact. energy: -0.618 local terms energy: -242.401050 where: bonds (distance) C4'-P energy: -64.250 bonds (distance) P-C4' energy: -46.156 flat angles C4'-P-C4' energy: -56.125 flat angles P-C4'-P energy: -34.084 tors. eta vs tors. theta energy: -41.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 43 Temperature: 0.964286 Total energy: -516.343156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.343156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.343156 (E_RNA) where: Base-Base interactions energy: -269.331 where: short stacking energy: -181.784 Base-Backbone interact. energy: -0.634 local terms energy: -246.378831 where: bonds (distance) C4'-P energy: -59.537 bonds (distance) P-C4' energy: -65.165 flat angles C4'-P-C4' energy: -59.060 flat angles P-C4'-P energy: -30.329 tors. eta vs tors. theta energy: -32.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 43 Temperature: 1.028571 Total energy: -494.577642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.577642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.577642 (E_RNA) where: Base-Base interactions energy: -250.158 where: short stacking energy: -179.164 Base-Backbone interact. energy: -0.630 local terms energy: -243.789424 where: bonds (distance) C4'-P energy: -58.761 bonds (distance) P-C4' energy: -52.387 flat angles C4'-P-C4' energy: -51.795 flat angles P-C4'-P energy: -41.511 tors. eta vs tors. theta energy: -39.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 43 Temperature: 1.092857 Total energy: -431.881431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.881431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.881431 (E_RNA) where: Base-Base interactions energy: -224.198 where: short stacking energy: -170.704 Base-Backbone interact. energy: 1.170 local terms energy: -208.852663 where: bonds (distance) C4'-P energy: -49.696 bonds (distance) P-C4' energy: -55.090 flat angles C4'-P-C4' energy: -50.626 flat angles P-C4'-P energy: -26.762 tors. eta vs tors. theta energy: -26.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 43 Temperature: 1.157143 Total energy: -355.704808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.704808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.704808 (E_RNA) where: Base-Base interactions energy: -166.750 where: short stacking energy: -128.518 Base-Backbone interact. energy: -0.418 local terms energy: -189.304214 where: bonds (distance) C4'-P energy: -46.131 bonds (distance) P-C4' energy: -51.991 flat angles C4'-P-C4' energy: -45.770 flat angles P-C4'-P energy: -37.984 tors. eta vs tors. theta energy: -7.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.767 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 43 Temperature: 1.221429 Total energy: -278.516406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.516406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.516406 (E_RNA) where: Base-Base interactions energy: -101.631 where: short stacking energy: -88.516 Base-Backbone interact. energy: -1.101 local terms energy: -175.783936 where: bonds (distance) C4'-P energy: -45.620 bonds (distance) P-C4' energy: -55.277 flat angles C4'-P-C4' energy: -48.060 flat angles P-C4'-P energy: -25.835 tors. eta vs tors. theta energy: -0.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 43 Temperature: 1.285714 Total energy: -266.470534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.470534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.470534 (E_RNA) where: Base-Base interactions energy: -89.139 where: short stacking energy: -79.306 Base-Backbone interact. energy: -0.381 local terms energy: -176.950921 where: bonds (distance) C4'-P energy: -55.588 bonds (distance) P-C4' energy: -45.589 flat angles C4'-P-C4' energy: -43.978 flat angles P-C4'-P energy: -29.437 tors. eta vs tors. theta energy: -2.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -211.534870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.534870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.534870 (E_RNA) where: Base-Base interactions energy: -101.876 where: short stacking energy: -83.111 Base-Backbone interact. energy: 5.546 local terms energy: -115.204727 where: bonds (distance) C4'-P energy: -40.098 bonds (distance) P-C4' energy: -43.588 flat angles C4'-P-C4' energy: -35.520 flat angles P-C4'-P energy: -13.960 tors. eta vs tors. theta energy: 17.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -618.328583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.328583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.328583 (E_RNA) where: Base-Base interactions energy: -366.907 where: short stacking energy: -214.048 Base-Backbone interact. energy: -1.894 local terms energy: -249.527743 where: bonds (distance) C4'-P energy: -53.355 bonds (distance) P-C4' energy: -63.121 flat angles C4'-P-C4' energy: -54.355 flat angles P-C4'-P energy: -29.443 tors. eta vs tors. theta energy: -49.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 44 Temperature: 0.964286 Total energy: -535.772985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.772985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.772985 (E_RNA) where: Base-Base interactions energy: -279.912 where: short stacking energy: -188.235 Base-Backbone interact. energy: -0.418 local terms energy: -255.443197 where: bonds (distance) C4'-P energy: -60.811 bonds (distance) P-C4' energy: -66.226 flat angles C4'-P-C4' energy: -57.520 flat angles P-C4'-P energy: -36.701 tors. eta vs tors. theta energy: -34.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 44 Temperature: 1.028571 Total energy: -509.379747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.379747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.379747 (E_RNA) where: Base-Base interactions energy: -276.372 where: short stacking energy: -195.007 Base-Backbone interact. energy: -0.621 local terms energy: -232.386996 where: bonds (distance) C4'-P energy: -57.617 bonds (distance) P-C4' energy: -50.552 flat angles C4'-P-C4' energy: -51.000 flat angles P-C4'-P energy: -31.289 tors. eta vs tors. theta energy: -41.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 44 Temperature: 1.092857 Total energy: -449.238038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.238038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.238038 (E_RNA) where: Base-Base interactions energy: -207.124 where: short stacking energy: -152.946 Base-Backbone interact. energy: 0.574 local terms energy: -242.687854 where: bonds (distance) C4'-P energy: -48.843 bonds (distance) P-C4' energy: -56.639 flat angles C4'-P-C4' energy: -64.163 flat angles P-C4'-P energy: -37.354 tors. eta vs tors. theta energy: -35.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 44 Temperature: 1.157143 Total energy: -352.843167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.843167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.843167 (E_RNA) where: Base-Base interactions energy: -176.227 where: short stacking energy: -130.513 Base-Backbone interact. energy: 1.883 local terms energy: -178.498617 where: bonds (distance) C4'-P energy: -37.463 bonds (distance) P-C4' energy: -48.909 flat angles C4'-P-C4' energy: -48.208 flat angles P-C4'-P energy: -32.418 tors. eta vs tors. theta energy: -11.499 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 44 Temperature: 1.221429 Total energy: -276.113173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.113173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.113173 (E_RNA) where: Base-Base interactions energy: -110.728 where: short stacking energy: -94.075 Base-Backbone interact. energy: -0.636 local terms energy: -164.749857 where: bonds (distance) C4'-P energy: -30.348 bonds (distance) P-C4' energy: -55.924 flat angles C4'-P-C4' energy: -41.875 flat angles P-C4'-P energy: -27.624 tors. eta vs tors. theta energy: -8.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 44 Temperature: 1.285714 Total energy: -261.355820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.355820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.355820 (E_RNA) where: Base-Base interactions energy: -86.564 where: short stacking energy: -74.513 Base-Backbone interact. energy: -0.275 local terms energy: -174.516478 where: bonds (distance) C4'-P energy: -45.508 bonds (distance) P-C4' energy: -49.064 flat angles C4'-P-C4' energy: -54.454 flat angles P-C4'-P energy: -25.964 tors. eta vs tors. theta energy: 0.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -247.077801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.077801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.077801 (E_RNA) where: Base-Base interactions energy: -86.830 where: short stacking energy: -79.686 Base-Backbone interact. energy: -0.342 local terms energy: -159.905434 where: bonds (distance) C4'-P energy: -48.980 bonds (distance) P-C4' energy: -46.725 flat angles C4'-P-C4' energy: -40.129 flat angles P-C4'-P energy: -25.474 tors. eta vs tors. theta energy: 1.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -638.867896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.867896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.867896 (E_RNA) where: Base-Base interactions energy: -384.105 where: short stacking energy: -212.569 Base-Backbone interact. energy: -2.178 local terms energy: -252.584752 where: bonds (distance) C4'-P energy: -56.455 bonds (distance) P-C4' energy: -60.714 flat angles C4'-P-C4' energy: -62.380 flat angles P-C4'-P energy: -26.049 tors. eta vs tors. theta energy: -46.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 45 Temperature: 0.964286 Total energy: -516.760198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.760198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.760198 (E_RNA) where: Base-Base interactions energy: -282.701 where: short stacking energy: -181.063 Base-Backbone interact. energy: 2.021 local terms energy: -236.081004 where: bonds (distance) C4'-P energy: -53.395 bonds (distance) P-C4' energy: -57.809 flat angles C4'-P-C4' energy: -55.671 flat angles P-C4'-P energy: -36.001 tors. eta vs tors. theta energy: -33.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 45 Temperature: 1.028571 Total energy: -506.553065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.553065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.553065 (E_RNA) where: Base-Base interactions energy: -267.669 where: short stacking energy: -179.583 Base-Backbone interact. energy: -0.451 local terms energy: -238.433245 where: bonds (distance) C4'-P energy: -49.810 bonds (distance) P-C4' energy: -64.086 flat angles C4'-P-C4' energy: -55.514 flat angles P-C4'-P energy: -30.971 tors. eta vs tors. theta energy: -38.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 45 Temperature: 1.092857 Total energy: -409.008895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.008895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.008895 (E_RNA) where: Base-Base interactions energy: -194.099 where: short stacking energy: -137.634 Base-Backbone interact. energy: -0.092 local terms energy: -214.818048 where: bonds (distance) C4'-P energy: -52.637 bonds (distance) P-C4' energy: -48.363 flat angles C4'-P-C4' energy: -59.278 flat angles P-C4'-P energy: -26.863 tors. eta vs tors. theta energy: -27.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 45 Temperature: 1.157143 Total energy: -397.936024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.936024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.936024 (E_RNA) where: Base-Base interactions energy: -194.807 where: short stacking energy: -148.154 Base-Backbone interact. energy: 1.600 local terms energy: -204.728771 where: bonds (distance) C4'-P energy: -50.928 bonds (distance) P-C4' energy: -45.155 flat angles C4'-P-C4' energy: -48.234 flat angles P-C4'-P energy: -37.814 tors. eta vs tors. theta energy: -22.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 45 Temperature: 1.221429 Total energy: -292.460745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.460745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.460745 (E_RNA) where: Base-Base interactions energy: -120.795 where: short stacking energy: -93.265 Base-Backbone interact. energy: 1.478 local terms energy: -173.143497 where: bonds (distance) C4'-P energy: -40.553 bonds (distance) P-C4' energy: -50.146 flat angles C4'-P-C4' energy: -44.938 flat angles P-C4'-P energy: -36.462 tors. eta vs tors. theta energy: -1.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 45 Temperature: 1.285714 Total energy: -259.895863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.895863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.895863 (E_RNA) where: Base-Base interactions energy: -90.647 where: short stacking energy: -71.718 Base-Backbone interact. energy: -0.380 local terms energy: -168.868531 where: bonds (distance) C4'-P energy: -43.175 bonds (distance) P-C4' energy: -57.063 flat angles C4'-P-C4' energy: -38.621 flat angles P-C4'-P energy: -38.542 tors. eta vs tors. theta energy: 8.532 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -267.167614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.167614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.167614 (E_RNA) where: Base-Base interactions energy: -104.801 where: short stacking energy: -88.698 Base-Backbone interact. energy: 1.628 local terms energy: -164.369108 where: bonds (distance) C4'-P energy: -42.703 bonds (distance) P-C4' energy: -51.618 flat angles C4'-P-C4' energy: -48.419 flat angles P-C4'-P energy: -20.607 tors. eta vs tors. theta energy: -1.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.375 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -643.828548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.828548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.828548 (E_RNA) where: Base-Base interactions energy: -372.254 where: short stacking energy: -221.404 Base-Backbone interact. energy: -1.379 local terms energy: -270.195265 where: bonds (distance) C4'-P energy: -44.376 bonds (distance) P-C4' energy: -66.160 flat angles C4'-P-C4' energy: -62.389 flat angles P-C4'-P energy: -42.163 tors. eta vs tors. theta energy: -55.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 46 Temperature: 0.964286 Total energy: -552.495637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.495637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.495637 (E_RNA) where: Base-Base interactions energy: -292.271 where: short stacking energy: -204.363 Base-Backbone interact. energy: -0.565 local terms energy: -259.659376 where: bonds (distance) C4'-P energy: -53.393 bonds (distance) P-C4' energy: -61.116 flat angles C4'-P-C4' energy: -57.150 flat angles P-C4'-P energy: -47.194 tors. eta vs tors. theta energy: -40.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 46 Temperature: 1.028571 Total energy: -521.671069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.671069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.671069 (E_RNA) where: Base-Base interactions energy: -272.605 where: short stacking energy: -176.021 Base-Backbone interact. energy: -0.293 local terms energy: -248.773140 where: bonds (distance) C4'-P energy: -59.839 bonds (distance) P-C4' energy: -59.603 flat angles C4'-P-C4' energy: -59.308 flat angles P-C4'-P energy: -27.617 tors. eta vs tors. theta energy: -42.406 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 46 Temperature: 1.092857 Total energy: -444.414578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.414578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.414578 (E_RNA) where: Base-Base interactions energy: -238.682 where: short stacking energy: -177.495 Base-Backbone interact. energy: 0.842 local terms energy: -206.574949 where: bonds (distance) C4'-P energy: -48.109 bonds (distance) P-C4' energy: -46.666 flat angles C4'-P-C4' energy: -52.245 flat angles P-C4'-P energy: -28.747 tors. eta vs tors. theta energy: -30.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 46 Temperature: 1.157143 Total energy: -327.739526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.739526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.739526 (E_RNA) where: Base-Base interactions energy: -123.846 where: short stacking energy: -117.430 Base-Backbone interact. energy: -2.675 local terms energy: -201.218292 where: bonds (distance) C4'-P energy: -50.557 bonds (distance) P-C4' energy: -56.604 flat angles C4'-P-C4' energy: -47.866 flat angles P-C4'-P energy: -34.733 tors. eta vs tors. theta energy: -11.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 46 Temperature: 1.221429 Total energy: -334.890735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.890735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.890735 (E_RNA) where: Base-Base interactions energy: -136.661 where: short stacking energy: -108.330 Base-Backbone interact. energy: 0.781 local terms energy: -199.010850 where: bonds (distance) C4'-P energy: -54.668 bonds (distance) P-C4' energy: -53.745 flat angles C4'-P-C4' energy: -50.114 flat angles P-C4'-P energy: -32.563 tors. eta vs tors. theta energy: -7.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 46 Temperature: 1.285714 Total energy: -308.523185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.523185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.523185 (E_RNA) where: Base-Base interactions energy: -125.818 where: short stacking energy: -94.926 Base-Backbone interact. energy: -1.792 local terms energy: -180.914006 where: bonds (distance) C4'-P energy: -54.446 bonds (distance) P-C4' energy: -51.641 flat angles C4'-P-C4' energy: -44.844 flat angles P-C4'-P energy: -26.152 tors. eta vs tors. theta energy: -3.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -233.586838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.586838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.586838 (E_RNA) where: Base-Base interactions energy: -70.829 where: short stacking energy: -65.746 Base-Backbone interact. energy: -2.248 local terms energy: -161.885723 where: bonds (distance) C4'-P energy: -56.458 bonds (distance) P-C4' energy: -57.117 flat angles C4'-P-C4' energy: -38.633 flat angles P-C4'-P energy: -26.336 tors. eta vs tors. theta energy: 16.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.376 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -641.483446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -641.483446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -641.483446 (E_RNA) where: Base-Base interactions energy: -382.339 where: short stacking energy: -217.723 Base-Backbone interact. energy: 2.859 local terms energy: -262.003826 where: bonds (distance) C4'-P energy: -54.522 bonds (distance) P-C4' energy: -68.173 flat angles C4'-P-C4' energy: -57.654 flat angles P-C4'-P energy: -37.667 tors. eta vs tors. theta energy: -43.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 47 Temperature: 0.964286 Total energy: -549.152290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.152290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.152290 (E_RNA) where: Base-Base interactions energy: -309.517 where: short stacking energy: -189.833 Base-Backbone interact. energy: 0.537 local terms energy: -240.172540 where: bonds (distance) C4'-P energy: -53.054 bonds (distance) P-C4' energy: -62.350 flat angles C4'-P-C4' energy: -51.243 flat angles P-C4'-P energy: -37.950 tors. eta vs tors. theta energy: -35.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 47 Temperature: 1.028571 Total energy: -526.304737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.304737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.304737 (E_RNA) where: Base-Base interactions energy: -299.055 where: short stacking energy: -209.304 Base-Backbone interact. energy: 1.563 local terms energy: -228.812493 where: bonds (distance) C4'-P energy: -48.315 bonds (distance) P-C4' energy: -51.119 flat angles C4'-P-C4' energy: -51.081 flat angles P-C4'-P energy: -37.136 tors. eta vs tors. theta energy: -41.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 47 Temperature: 1.092857 Total energy: -390.347481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.347481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.347481 (E_RNA) where: Base-Base interactions energy: -186.086 where: short stacking energy: -135.458 Base-Backbone interact. energy: -0.499 local terms energy: -203.762835 where: bonds (distance) C4'-P energy: -44.395 bonds (distance) P-C4' energy: -56.493 flat angles C4'-P-C4' energy: -49.487 flat angles P-C4'-P energy: -37.767 tors. eta vs tors. theta energy: -15.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 47 Temperature: 1.157143 Total energy: -347.817092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.817092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.817092 (E_RNA) where: Base-Base interactions energy: -150.082 where: short stacking energy: -140.725 Base-Backbone interact. energy: -0.910 local terms energy: -196.825931 where: bonds (distance) C4'-P energy: -52.594 bonds (distance) P-C4' energy: -51.622 flat angles C4'-P-C4' energy: -45.246 flat angles P-C4'-P energy: -29.003 tors. eta vs tors. theta energy: -18.361 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 47 Temperature: 1.221429 Total energy: -356.436589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.436589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.436589 (E_RNA) where: Base-Base interactions energy: -166.849 where: short stacking energy: -128.551 Base-Backbone interact. energy: -0.699 local terms energy: -188.888530 where: bonds (distance) C4'-P energy: -57.816 bonds (distance) P-C4' energy: -42.734 flat angles C4'-P-C4' energy: -42.592 flat angles P-C4'-P energy: -30.501 tors. eta vs tors. theta energy: -15.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 47 Temperature: 1.285714 Total energy: -283.102906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.102906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.102906 (E_RNA) where: Base-Base interactions energy: -100.329 where: short stacking energy: -73.924 Base-Backbone interact. energy: -0.561 local terms energy: -182.213143 where: bonds (distance) C4'-P energy: -53.021 bonds (distance) P-C4' energy: -55.236 flat angles C4'-P-C4' energy: -49.511 flat angles P-C4'-P energy: -31.222 tors. eta vs tors. theta energy: 6.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -238.313488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.313488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.313488 (E_RNA) where: Base-Base interactions energy: -71.485 where: short stacking energy: -61.536 Base-Backbone interact. energy: 3.401 local terms energy: -170.230188 where: bonds (distance) C4'-P energy: -50.897 bonds (distance) P-C4' energy: -50.951 flat angles C4'-P-C4' energy: -49.968 flat angles P-C4'-P energy: -24.121 tors. eta vs tors. theta energy: 5.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -638.824259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.824259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.824259 (E_RNA) where: Base-Base interactions energy: -387.453 where: short stacking energy: -224.765 Base-Backbone interact. energy: -0.071 local terms energy: -251.300078 where: bonds (distance) C4'-P energy: -48.908 bonds (distance) P-C4' energy: -57.377 flat angles C4'-P-C4' energy: -56.443 flat angles P-C4'-P energy: -36.051 tors. eta vs tors. theta energy: -52.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 48 Temperature: 0.964286 Total energy: -580.755485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.755485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.755485 (E_RNA) where: Base-Base interactions energy: -316.581 where: short stacking energy: -190.186 Base-Backbone interact. energy: -0.300 local terms energy: -263.874130 where: bonds (distance) C4'-P energy: -59.273 bonds (distance) P-C4' energy: -60.434 flat angles C4'-P-C4' energy: -60.127 flat angles P-C4'-P energy: -45.851 tors. eta vs tors. theta energy: -38.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 48 Temperature: 1.028571 Total energy: -524.094328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.094328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.094328 (E_RNA) where: Base-Base interactions energy: -277.579 where: short stacking energy: -191.236 Base-Backbone interact. energy: 0.400 local terms energy: -246.915289 where: bonds (distance) C4'-P energy: -53.410 bonds (distance) P-C4' energy: -46.814 flat angles C4'-P-C4' energy: -61.470 flat angles P-C4'-P energy: -40.673 tors. eta vs tors. theta energy: -44.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 48 Temperature: 1.092857 Total energy: -414.476490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.476490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.476490 (E_RNA) where: Base-Base interactions energy: -206.624 where: short stacking energy: -162.494 Base-Backbone interact. energy: -0.966 local terms energy: -206.886333 where: bonds (distance) C4'-P energy: -48.622 bonds (distance) P-C4' energy: -57.379 flat angles C4'-P-C4' energy: -53.439 flat angles P-C4'-P energy: -25.160 tors. eta vs tors. theta energy: -22.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 48 Temperature: 1.157143 Total energy: -344.163499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.163499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.163499 (E_RNA) where: Base-Base interactions energy: -148.678 where: short stacking energy: -102.776 Base-Backbone interact. energy: -0.704 local terms energy: -194.781521 where: bonds (distance) C4'-P energy: -47.185 bonds (distance) P-C4' energy: -56.103 flat angles C4'-P-C4' energy: -54.947 flat angles P-C4'-P energy: -29.018 tors. eta vs tors. theta energy: -7.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 48 Temperature: 1.221429 Total energy: -347.038685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.038685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.038685 (E_RNA) where: Base-Base interactions energy: -159.589 where: short stacking energy: -134.114 Base-Backbone interact. energy: -1.238 local terms energy: -186.212213 where: bonds (distance) C4'-P energy: -51.667 bonds (distance) P-C4' energy: -44.670 flat angles C4'-P-C4' energy: -43.217 flat angles P-C4'-P energy: -30.388 tors. eta vs tors. theta energy: -16.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 48 Temperature: 1.285714 Total energy: -290.692545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.692545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.692545 (E_RNA) where: Base-Base interactions energy: -112.314 where: short stacking energy: -88.884 Base-Backbone interact. energy: 3.039 local terms energy: -181.417059 where: bonds (distance) C4'-P energy: -49.494 bonds (distance) P-C4' energy: -54.795 flat angles C4'-P-C4' energy: -46.021 flat angles P-C4'-P energy: -29.508 tors. eta vs tors. theta energy: -1.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -241.192138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.192138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.192138 (E_RNA) where: Base-Base interactions energy: -95.517 where: short stacking energy: -89.671 Base-Backbone interact. energy: 3.151 local terms energy: -148.826110 where: bonds (distance) C4'-P energy: -50.333 bonds (distance) P-C4' energy: -45.776 flat angles C4'-P-C4' energy: -34.325 flat angles P-C4'-P energy: -20.811 tors. eta vs tors. theta energy: 2.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -671.380881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.380881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.380881 (E_RNA) where: Base-Base interactions energy: -402.323 where: short stacking energy: -211.226 Base-Backbone interact. energy: -0.827 local terms energy: -268.231161 where: bonds (distance) C4'-P energy: -56.971 bonds (distance) P-C4' energy: -57.034 flat angles C4'-P-C4' energy: -63.536 flat angles P-C4'-P energy: -41.419 tors. eta vs tors. theta energy: -49.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 49 Temperature: 0.964286 Total energy: -596.761050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.761050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.761050 (E_RNA) where: Base-Base interactions energy: -332.080 where: short stacking energy: -207.269 Base-Backbone interact. energy: 1.921 local terms energy: -266.601787 where: bonds (distance) C4'-P energy: -56.930 bonds (distance) P-C4' energy: -56.897 flat angles C4'-P-C4' energy: -60.384 flat angles P-C4'-P energy: -45.116 tors. eta vs tors. theta energy: -47.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 49 Temperature: 1.028571 Total energy: -532.419078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.419078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.419078 (E_RNA) where: Base-Base interactions energy: -288.510 where: short stacking energy: -188.904 Base-Backbone interact. energy: 1.650 local terms energy: -245.558429 where: bonds (distance) C4'-P energy: -51.689 bonds (distance) P-C4' energy: -66.523 flat angles C4'-P-C4' energy: -57.740 flat angles P-C4'-P energy: -28.781 tors. eta vs tors. theta energy: -40.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 49 Temperature: 1.092857 Total energy: -447.998085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.998085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.998085 (E_RNA) where: Base-Base interactions energy: -219.564 where: short stacking energy: -156.229 Base-Backbone interact. energy: -0.807 local terms energy: -227.626508 where: bonds (distance) C4'-P energy: -55.339 bonds (distance) P-C4' energy: -56.406 flat angles C4'-P-C4' energy: -50.525 flat angles P-C4'-P energy: -38.845 tors. eta vs tors. theta energy: -26.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 49 Temperature: 1.157143 Total energy: -389.691196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.691196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.691196 (E_RNA) where: Base-Base interactions energy: -179.392 where: short stacking energy: -131.745 Base-Backbone interact. energy: -0.535 local terms energy: -209.764133 where: bonds (distance) C4'-P energy: -48.906 bonds (distance) P-C4' energy: -65.391 flat angles C4'-P-C4' energy: -44.170 flat angles P-C4'-P energy: -32.495 tors. eta vs tors. theta energy: -18.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 49 Temperature: 1.221429 Total energy: -326.176991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.176991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.176991 (E_RNA) where: Base-Base interactions energy: -144.361 where: short stacking energy: -116.482 Base-Backbone interact. energy: -1.553 local terms energy: -180.263383 where: bonds (distance) C4'-P energy: -56.008 bonds (distance) P-C4' energy: -46.857 flat angles C4'-P-C4' energy: -44.192 flat angles P-C4'-P energy: -24.833 tors. eta vs tors. theta energy: -8.374 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 49 Temperature: 1.285714 Total energy: -292.857685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.857685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.857685 (E_RNA) where: Base-Base interactions energy: -120.383 where: short stacking energy: -109.488 Base-Backbone interact. energy: -1.134 local terms energy: -171.340608 where: bonds (distance) C4'-P energy: -40.887 bonds (distance) P-C4' energy: -54.847 flat angles C4'-P-C4' energy: -53.653 flat angles P-C4'-P energy: -19.633 tors. eta vs tors. theta energy: -2.321 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -235.539847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.539847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.539847 (E_RNA) where: Base-Base interactions energy: -72.042 where: short stacking energy: -70.394 Base-Backbone interact. energy: -1.343 local terms energy: -162.154060 where: bonds (distance) C4'-P energy: -49.985 bonds (distance) P-C4' energy: -55.666 flat angles C4'-P-C4' energy: -31.298 flat angles P-C4'-P energy: -26.242 tors. eta vs tors. theta energy: 1.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -668.316503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.316503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.316503 (E_RNA) where: Base-Base interactions energy: -411.975 where: short stacking energy: -210.126 Base-Backbone interact. energy: -1.124 local terms energy: -255.217275 where: bonds (distance) C4'-P energy: -54.820 bonds (distance) P-C4' energy: -60.782 flat angles C4'-P-C4' energy: -53.115 flat angles P-C4'-P energy: -39.888 tors. eta vs tors. theta energy: -46.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 50 Temperature: 0.964286 Total energy: -587.649802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.649802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.649802 (E_RNA) where: Base-Base interactions energy: -333.305 where: short stacking energy: -202.161 Base-Backbone interact. energy: -0.663 local terms energy: -253.681324 where: bonds (distance) C4'-P energy: -55.897 bonds (distance) P-C4' energy: -55.255 flat angles C4'-P-C4' energy: -59.127 flat angles P-C4'-P energy: -37.868 tors. eta vs tors. theta energy: -45.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 50 Temperature: 1.028571 Total energy: -531.154744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.154744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.154744 (E_RNA) where: Base-Base interactions energy: -287.312 where: short stacking energy: -196.730 Base-Backbone interact. energy: -0.362 local terms energy: -243.480291 where: bonds (distance) C4'-P energy: -57.453 bonds (distance) P-C4' energy: -57.655 flat angles C4'-P-C4' energy: -49.853 flat angles P-C4'-P energy: -36.311 tors. eta vs tors. theta energy: -42.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 50 Temperature: 1.092857 Total energy: -433.376182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.376182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.376182 (E_RNA) where: Base-Base interactions energy: -217.401 where: short stacking energy: -161.196 Base-Backbone interact. energy: 0.012 local terms energy: -215.986699 where: bonds (distance) C4'-P energy: -48.821 bonds (distance) P-C4' energy: -52.858 flat angles C4'-P-C4' energy: -54.743 flat angles P-C4'-P energy: -35.061 tors. eta vs tors. theta energy: -24.503 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 50 Temperature: 1.157143 Total energy: -309.205130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.205130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.205130 (E_RNA) where: Base-Base interactions energy: -124.119 where: short stacking energy: -115.522 Base-Backbone interact. energy: 0.243 local terms energy: -185.329302 where: bonds (distance) C4'-P energy: -61.863 bonds (distance) P-C4' energy: -52.613 flat angles C4'-P-C4' energy: -40.446 flat angles P-C4'-P energy: -27.098 tors. eta vs tors. theta energy: -3.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 50 Temperature: 1.221429 Total energy: -308.681547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.681547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.681547 (E_RNA) where: Base-Base interactions energy: -129.698 where: short stacking energy: -82.793 Base-Backbone interact. energy: -1.513 local terms energy: -177.470757 where: bonds (distance) C4'-P energy: -47.115 bonds (distance) P-C4' energy: -52.959 flat angles C4'-P-C4' energy: -47.749 flat angles P-C4'-P energy: -30.175 tors. eta vs tors. theta energy: 0.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 50 Temperature: 1.285714 Total energy: -278.638576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.638576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.638576 (E_RNA) where: Base-Base interactions energy: -113.647 where: short stacking energy: -109.030 Base-Backbone interact. energy: -0.584 local terms energy: -164.407874 where: bonds (distance) C4'-P energy: -41.813 bonds (distance) P-C4' energy: -41.135 flat angles C4'-P-C4' energy: -41.421 flat angles P-C4'-P energy: -26.201 tors. eta vs tors. theta energy: -13.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -221.052181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.052181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.052181 (E_RNA) where: Base-Base interactions energy: -94.265 where: short stacking energy: -75.239 Base-Backbone interact. energy: -1.254 local terms energy: -125.533617 where: bonds (distance) C4'-P energy: -38.937 bonds (distance) P-C4' energy: -47.497 flat angles C4'-P-C4' energy: -27.603 flat angles P-C4'-P energy: -17.417 tors. eta vs tors. theta energy: 5.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -675.529218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.529218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.529218 (E_RNA) where: Base-Base interactions energy: -419.580 where: short stacking energy: -225.675 Base-Backbone interact. energy: -0.580 local terms energy: -255.368819 where: bonds (distance) C4'-P energy: -57.758 bonds (distance) P-C4' energy: -52.202 flat angles C4'-P-C4' energy: -59.007 flat angles P-C4'-P energy: -38.258 tors. eta vs tors. theta energy: -48.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 51 Temperature: 0.964286 Total energy: -582.956038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.956038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.956038 (E_RNA) where: Base-Base interactions energy: -337.591 where: short stacking energy: -216.295 Base-Backbone interact. energy: -0.356 local terms energy: -245.008952 where: bonds (distance) C4'-P energy: -51.197 bonds (distance) P-C4' energy: -54.848 flat angles C4'-P-C4' energy: -61.738 flat angles P-C4'-P energy: -27.874 tors. eta vs tors. theta energy: -49.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 51 Temperature: 1.028571 Total energy: -528.102773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.102773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.102773 (E_RNA) where: Base-Base interactions energy: -298.348 where: short stacking energy: -194.232 Base-Backbone interact. energy: -0.124 local terms energy: -229.631060 where: bonds (distance) C4'-P energy: -51.516 bonds (distance) P-C4' energy: -49.435 flat angles C4'-P-C4' energy: -53.122 flat angles P-C4'-P energy: -33.339 tors. eta vs tors. theta energy: -42.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 51 Temperature: 1.092857 Total energy: -379.366677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.366677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.366677 (E_RNA) where: Base-Base interactions energy: -177.861 where: short stacking energy: -120.292 Base-Backbone interact. energy: -0.128 local terms energy: -201.378236 where: bonds (distance) C4'-P energy: -50.484 bonds (distance) P-C4' energy: -62.237 flat angles C4'-P-C4' energy: -48.622 flat angles P-C4'-P energy: -28.789 tors. eta vs tors. theta energy: -11.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 51 Temperature: 1.157143 Total energy: -318.702107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.702107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.702107 (E_RNA) where: Base-Base interactions energy: -123.911 where: short stacking energy: -101.642 Base-Backbone interact. energy: -0.903 local terms energy: -193.887968 where: bonds (distance) C4'-P energy: -42.788 bonds (distance) P-C4' energy: -56.899 flat angles C4'-P-C4' energy: -54.534 flat angles P-C4'-P energy: -38.279 tors. eta vs tors. theta energy: -1.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 51 Temperature: 1.221429 Total energy: -269.306423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.306423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.306423 (E_RNA) where: Base-Base interactions energy: -97.542 where: short stacking energy: -93.662 Base-Backbone interact. energy: -1.571 local terms energy: -170.193135 where: bonds (distance) C4'-P energy: -46.338 bonds (distance) P-C4' energy: -44.706 flat angles C4'-P-C4' energy: -40.343 flat angles P-C4'-P energy: -29.853 tors. eta vs tors. theta energy: -8.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 51 Temperature: 1.285714 Total energy: -308.179512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.179512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.179512 (E_RNA) where: Base-Base interactions energy: -139.459 where: short stacking energy: -103.436 Base-Backbone interact. energy: -0.479 local terms energy: -168.242349 where: bonds (distance) C4'-P energy: -40.325 bonds (distance) P-C4' energy: -51.798 flat angles C4'-P-C4' energy: -43.514 flat angles P-C4'-P energy: -32.051 tors. eta vs tors. theta energy: -0.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -223.251783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.251783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.251783 (E_RNA) where: Base-Base interactions energy: -89.989 where: short stacking energy: -86.995 Base-Backbone interact. energy: -0.090 local terms energy: -133.172679 where: bonds (distance) C4'-P energy: -34.160 bonds (distance) P-C4' energy: -50.400 flat angles C4'-P-C4' energy: -37.334 flat angles P-C4'-P energy: -12.161 tors. eta vs tors. theta energy: 0.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -688.374917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.374917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.374917 (E_RNA) where: Base-Base interactions energy: -414.648 where: short stacking energy: -230.703 Base-Backbone interact. energy: 1.107 local terms energy: -274.834466 where: bonds (distance) C4'-P energy: -58.789 bonds (distance) P-C4' energy: -66.588 flat angles C4'-P-C4' energy: -62.576 flat angles P-C4'-P energy: -43.674 tors. eta vs tors. theta energy: -43.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 52 Temperature: 0.964286 Total energy: -547.631493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.631493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.631493 (E_RNA) where: Base-Base interactions energy: -302.739 where: short stacking energy: -187.028 Base-Backbone interact. energy: 2.047 local terms energy: -246.939958 where: bonds (distance) C4'-P energy: -59.856 bonds (distance) P-C4' energy: -51.907 flat angles C4'-P-C4' energy: -62.877 flat angles P-C4'-P energy: -33.032 tors. eta vs tors. theta energy: -39.269 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 52 Temperature: 1.028571 Total energy: -513.367666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.367666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.367666 (E_RNA) where: Base-Base interactions energy: -268.766 where: short stacking energy: -185.283 Base-Backbone interact. energy: 0.635 local terms energy: -245.388193 where: bonds (distance) C4'-P energy: -51.213 bonds (distance) P-C4' energy: -57.658 flat angles C4'-P-C4' energy: -60.253 flat angles P-C4'-P energy: -40.334 tors. eta vs tors. theta energy: -35.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.152 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 52 Temperature: 1.092857 Total energy: -394.449408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.449408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.449408 (E_RNA) where: Base-Base interactions energy: -168.429 where: short stacking energy: -123.831 Base-Backbone interact. energy: -0.745 local terms energy: -225.275497 where: bonds (distance) C4'-P energy: -60.196 bonds (distance) P-C4' energy: -57.801 flat angles C4'-P-C4' energy: -58.095 flat angles P-C4'-P energy: -38.377 tors. eta vs tors. theta energy: -10.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 52 Temperature: 1.157143 Total energy: -359.960253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.960253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.960253 (E_RNA) where: Base-Base interactions energy: -154.931 where: short stacking energy: -122.409 Base-Backbone interact. energy: 0.423 local terms energy: -205.452184 where: bonds (distance) C4'-P energy: -54.961 bonds (distance) P-C4' energy: -59.362 flat angles C4'-P-C4' energy: -51.115 flat angles P-C4'-P energy: -26.344 tors. eta vs tors. theta energy: -13.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 52 Temperature: 1.221429 Total energy: -296.904785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.904785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.904785 (E_RNA) where: Base-Base interactions energy: -113.550 where: short stacking energy: -106.000 Base-Backbone interact. energy: -0.859 local terms energy: -182.495278 where: bonds (distance) C4'-P energy: -47.794 bonds (distance) P-C4' energy: -44.883 flat angles C4'-P-C4' energy: -40.722 flat angles P-C4'-P energy: -35.803 tors. eta vs tors. theta energy: -13.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 52 Temperature: 1.285714 Total energy: -310.608077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.608077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.608077 (E_RNA) where: Base-Base interactions energy: -144.417 where: short stacking energy: -100.248 Base-Backbone interact. energy: -0.587 local terms energy: -165.604291 where: bonds (distance) C4'-P energy: -42.078 bonds (distance) P-C4' energy: -51.979 flat angles C4'-P-C4' energy: -49.223 flat angles P-C4'-P energy: -15.408 tors. eta vs tors. theta energy: -6.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -220.960288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.960288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.960288 (E_RNA) where: Base-Base interactions energy: -69.859 where: short stacking energy: -51.833 Base-Backbone interact. energy: -1.014 local terms energy: -150.087115 where: bonds (distance) C4'-P energy: -46.146 bonds (distance) P-C4' energy: -42.248 flat angles C4'-P-C4' energy: -52.777 flat angles P-C4'-P energy: -19.250 tors. eta vs tors. theta energy: 10.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -655.864561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.864561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.864561 (E_RNA) where: Base-Base interactions energy: -396.141 where: short stacking energy: -198.359 Base-Backbone interact. energy: -0.163 local terms energy: -259.560227 where: bonds (distance) C4'-P energy: -51.665 bonds (distance) P-C4' energy: -70.411 flat angles C4'-P-C4' energy: -62.124 flat angles P-C4'-P energy: -37.362 tors. eta vs tors. theta energy: -37.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 53 Temperature: 0.964286 Total energy: -562.668214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.668214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.668214 (E_RNA) where: Base-Base interactions energy: -314.445 where: short stacking energy: -195.587 Base-Backbone interact. energy: -0.859 local terms energy: -247.364036 where: bonds (distance) C4'-P energy: -50.225 bonds (distance) P-C4' energy: -65.819 flat angles C4'-P-C4' energy: -61.236 flat angles P-C4'-P energy: -35.362 tors. eta vs tors. theta energy: -34.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 53 Temperature: 1.028571 Total energy: -481.325651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.325651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.325651 (E_RNA) where: Base-Base interactions energy: -263.052 where: short stacking energy: -179.613 Base-Backbone interact. energy: -0.310 local terms energy: -217.964350 where: bonds (distance) C4'-P energy: -47.855 bonds (distance) P-C4' energy: -64.251 flat angles C4'-P-C4' energy: -42.678 flat angles P-C4'-P energy: -39.589 tors. eta vs tors. theta energy: -23.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 53 Temperature: 1.092857 Total energy: -398.299723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.299723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.299723 (E_RNA) where: Base-Base interactions energy: -198.776 where: short stacking energy: -156.977 Base-Backbone interact. energy: 0.192 local terms energy: -199.716227 where: bonds (distance) C4'-P energy: -44.996 bonds (distance) P-C4' energy: -52.286 flat angles C4'-P-C4' energy: -48.433 flat angles P-C4'-P energy: -37.986 tors. eta vs tors. theta energy: -16.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 53 Temperature: 1.157143 Total energy: -334.803101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.803101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.803101 (E_RNA) where: Base-Base interactions energy: -120.261 where: short stacking energy: -109.620 Base-Backbone interact. energy: -1.246 local terms energy: -213.295555 where: bonds (distance) C4'-P energy: -52.220 bonds (distance) P-C4' energy: -54.653 flat angles C4'-P-C4' energy: -58.026 flat angles P-C4'-P energy: -27.692 tors. eta vs tors. theta energy: -20.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 53 Temperature: 1.221429 Total energy: -330.969378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.969378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.969378 (E_RNA) where: Base-Base interactions energy: -150.244 where: short stacking energy: -106.274 Base-Backbone interact. energy: -0.174 local terms energy: -180.551571 where: bonds (distance) C4'-P energy: -45.948 bonds (distance) P-C4' energy: -54.236 flat angles C4'-P-C4' energy: -43.299 flat angles P-C4'-P energy: -15.705 tors. eta vs tors. theta energy: -21.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 53 Temperature: 1.285714 Total energy: -235.448373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.448373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.448373 (E_RNA) where: Base-Base interactions energy: -85.825 where: short stacking energy: -69.137 Base-Backbone interact. energy: -0.467 local terms energy: -149.155871 where: bonds (distance) C4'-P energy: -38.205 bonds (distance) P-C4' energy: -49.807 flat angles C4'-P-C4' energy: -47.922 flat angles P-C4'-P energy: -24.023 tors. eta vs tors. theta energy: 10.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -216.414004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.414004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.414004 (E_RNA) where: Base-Base interactions energy: -67.519 where: short stacking energy: -65.711 Base-Backbone interact. energy: -0.913 local terms energy: -147.982279 where: bonds (distance) C4'-P energy: -44.741 bonds (distance) P-C4' energy: -56.934 flat angles C4'-P-C4' energy: -37.889 flat angles P-C4'-P energy: -18.712 tors. eta vs tors. theta energy: 10.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -685.095250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.095250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.095250 (E_RNA) where: Base-Base interactions energy: -434.201 where: short stacking energy: -222.066 Base-Backbone interact. energy: 0.504 local terms energy: -251.398444 where: bonds (distance) C4'-P energy: -54.314 bonds (distance) P-C4' energy: -56.291 flat angles C4'-P-C4' energy: -54.294 flat angles P-C4'-P energy: -43.591 tors. eta vs tors. theta energy: -42.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 54 Temperature: 0.964286 Total energy: -574.192555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.192555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.192555 (E_RNA) where: Base-Base interactions energy: -332.243 where: short stacking energy: -187.309 Base-Backbone interact. energy: -0.479 local terms energy: -241.471384 where: bonds (distance) C4'-P energy: -64.206 bonds (distance) P-C4' energy: -49.208 flat angles C4'-P-C4' energy: -55.998 flat angles P-C4'-P energy: -40.749 tors. eta vs tors. theta energy: -31.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 54 Temperature: 1.028571 Total energy: -471.693572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.693572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.693572 (E_RNA) where: Base-Base interactions energy: -248.864 where: short stacking energy: -148.273 Base-Backbone interact. energy: 0.008 local terms energy: -222.996564 where: bonds (distance) C4'-P energy: -51.961 bonds (distance) P-C4' energy: -63.571 flat angles C4'-P-C4' energy: -49.233 flat angles P-C4'-P energy: -33.514 tors. eta vs tors. theta energy: -24.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.158 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 54 Temperature: 1.092857 Total energy: -372.373353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.373353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.373353 (E_RNA) where: Base-Base interactions energy: -175.995 where: short stacking energy: -132.160 Base-Backbone interact. energy: 0.915 local terms energy: -197.292812 where: bonds (distance) C4'-P energy: -55.664 bonds (distance) P-C4' energy: -48.341 flat angles C4'-P-C4' energy: -44.581 flat angles P-C4'-P energy: -34.920 tors. eta vs tors. theta energy: -13.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 54 Temperature: 1.157143 Total energy: -374.561493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.561493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.561493 (E_RNA) where: Base-Base interactions energy: -165.225 where: short stacking energy: -112.946 Base-Backbone interact. energy: -1.079 local terms energy: -208.257542 where: bonds (distance) C4'-P energy: -57.822 bonds (distance) P-C4' energy: -47.898 flat angles C4'-P-C4' energy: -57.664 flat angles P-C4'-P energy: -32.071 tors. eta vs tors. theta energy: -12.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 54 Temperature: 1.221429 Total energy: -294.686040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.686040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.686040 (E_RNA) where: Base-Base interactions energy: -118.846 where: short stacking energy: -113.824 Base-Backbone interact. energy: -0.488 local terms energy: -175.352241 where: bonds (distance) C4'-P energy: -43.759 bonds (distance) P-C4' energy: -56.492 flat angles C4'-P-C4' energy: -41.309 flat angles P-C4'-P energy: -30.447 tors. eta vs tors. theta energy: -3.345 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 54 Temperature: 1.285714 Total energy: -259.978344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.978344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.978344 (E_RNA) where: Base-Base interactions energy: -92.181 where: short stacking energy: -92.181 Base-Backbone interact. energy: 1.918 local terms energy: -169.715303 where: bonds (distance) C4'-P energy: -31.780 bonds (distance) P-C4' energy: -53.859 flat angles C4'-P-C4' energy: -46.175 flat angles P-C4'-P energy: -33.236 tors. eta vs tors. theta energy: -4.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -223.541437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.541437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.541437 (E_RNA) where: Base-Base interactions energy: -73.738 where: short stacking energy: -68.745 Base-Backbone interact. energy: -3.381 local terms energy: -146.422301 where: bonds (distance) C4'-P energy: -52.901 bonds (distance) P-C4' energy: -50.312 flat angles C4'-P-C4' energy: -34.054 flat angles P-C4'-P energy: -26.133 tors. eta vs tors. theta energy: 16.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -688.400276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.400276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.400276 (E_RNA) where: Base-Base interactions energy: -418.269 where: short stacking energy: -205.594 Base-Backbone interact. energy: -0.459 local terms energy: -269.672844 where: bonds (distance) C4'-P energy: -60.610 bonds (distance) P-C4' energy: -60.713 flat angles C4'-P-C4' energy: -63.055 flat angles P-C4'-P energy: -37.338 tors. eta vs tors. theta energy: -47.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 55 Temperature: 0.964286 Total energy: -587.790950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.790950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.790950 (E_RNA) where: Base-Base interactions energy: -335.354 where: short stacking energy: -206.328 Base-Backbone interact. energy: 1.422 local terms energy: -253.859142 where: bonds (distance) C4'-P energy: -49.851 bonds (distance) P-C4' energy: -56.746 flat angles C4'-P-C4' energy: -60.780 flat angles P-C4'-P energy: -42.857 tors. eta vs tors. theta energy: -43.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 55 Temperature: 1.028571 Total energy: -515.528290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.528290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.528290 (E_RNA) where: Base-Base interactions energy: -291.745 where: short stacking energy: -166.302 Base-Backbone interact. energy: 0.071 local terms energy: -223.854079 where: bonds (distance) C4'-P energy: -55.878 bonds (distance) P-C4' energy: -59.068 flat angles C4'-P-C4' energy: -51.495 flat angles P-C4'-P energy: -29.912 tors. eta vs tors. theta energy: -27.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 55 Temperature: 1.092857 Total energy: -397.694728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.694728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.694728 (E_RNA) where: Base-Base interactions energy: -197.207 where: short stacking energy: -130.884 Base-Backbone interact. energy: 0.553 local terms energy: -201.040539 where: bonds (distance) C4'-P energy: -45.670 bonds (distance) P-C4' energy: -62.551 flat angles C4'-P-C4' energy: -45.519 flat angles P-C4'-P energy: -35.453 tors. eta vs tors. theta energy: -11.847 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 55 Temperature: 1.157143 Total energy: -375.818524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.818524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.818524 (E_RNA) where: Base-Base interactions energy: -165.104 where: short stacking energy: -118.901 Base-Backbone interact. energy: 1.308 local terms energy: -212.022484 where: bonds (distance) C4'-P energy: -45.782 bonds (distance) P-C4' energy: -58.065 flat angles C4'-P-C4' energy: -51.849 flat angles P-C4'-P energy: -38.940 tors. eta vs tors. theta energy: -17.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 55 Temperature: 1.221429 Total energy: -294.208774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.208774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.208774 (E_RNA) where: Base-Base interactions energy: -130.707 where: short stacking energy: -118.064 Base-Backbone interact. energy: -0.189 local terms energy: -163.313162 where: bonds (distance) C4'-P energy: -51.605 bonds (distance) P-C4' energy: -39.800 flat angles C4'-P-C4' energy: -41.560 flat angles P-C4'-P energy: -20.802 tors. eta vs tors. theta energy: -9.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 55 Temperature: 1.285714 Total energy: -231.975042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.975042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.975042 (E_RNA) where: Base-Base interactions energy: -69.384 where: short stacking energy: -45.729 Base-Backbone interact. energy: 1.361 local terms energy: -163.951913 where: bonds (distance) C4'-P energy: -55.684 bonds (distance) P-C4' energy: -53.348 flat angles C4'-P-C4' energy: -45.176 flat angles P-C4'-P energy: -25.263 tors. eta vs tors. theta energy: 15.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -240.029209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.029209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.029209 (E_RNA) where: Base-Base interactions energy: -80.337 where: short stacking energy: -78.967 Base-Backbone interact. energy: -0.394 local terms energy: -159.298228 where: bonds (distance) C4'-P energy: -49.636 bonds (distance) P-C4' energy: -48.317 flat angles C4'-P-C4' energy: -45.416 flat angles P-C4'-P energy: -23.622 tors. eta vs tors. theta energy: 7.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -665.826790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.826790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.826790 (E_RNA) where: Base-Base interactions energy: -412.573 where: short stacking energy: -204.477 Base-Backbone interact. energy: -1.024 local terms energy: -252.229177 where: bonds (distance) C4'-P energy: -57.120 bonds (distance) P-C4' energy: -59.362 flat angles C4'-P-C4' energy: -54.189 flat angles P-C4'-P energy: -38.822 tors. eta vs tors. theta energy: -42.737 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 56 Temperature: 0.964286 Total energy: -607.011356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.011356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.011356 (E_RNA) where: Base-Base interactions energy: -347.075 where: short stacking energy: -188.997 Base-Backbone interact. energy: -1.104 local terms energy: -258.832795 where: bonds (distance) C4'-P energy: -63.831 bonds (distance) P-C4' energy: -51.595 flat angles C4'-P-C4' energy: -59.480 flat angles P-C4'-P energy: -44.334 tors. eta vs tors. theta energy: -39.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 56 Temperature: 1.028571 Total energy: -492.119253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.119253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.119253 (E_RNA) where: Base-Base interactions energy: -262.714 where: short stacking energy: -157.526 Base-Backbone interact. energy: 0.112 local terms energy: -229.517315 where: bonds (distance) C4'-P energy: -58.512 bonds (distance) P-C4' energy: -50.588 flat angles C4'-P-C4' energy: -52.258 flat angles P-C4'-P energy: -36.248 tors. eta vs tors. theta energy: -31.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 56 Temperature: 1.092857 Total energy: -418.272705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.272705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.272705 (E_RNA) where: Base-Base interactions energy: -210.001 where: short stacking energy: -140.628 Base-Backbone interact. energy: 0.630 local terms energy: -208.901388 where: bonds (distance) C4'-P energy: -54.541 bonds (distance) P-C4' energy: -58.650 flat angles C4'-P-C4' energy: -50.939 flat angles P-C4'-P energy: -35.619 tors. eta vs tors. theta energy: -9.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 56 Temperature: 1.157143 Total energy: -335.125470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.125470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.125470 (E_RNA) where: Base-Base interactions energy: -132.818 where: short stacking energy: -132.146 Base-Backbone interact. energy: -1.147 local terms energy: -201.160823 where: bonds (distance) C4'-P energy: -48.123 bonds (distance) P-C4' energy: -50.495 flat angles C4'-P-C4' energy: -46.457 flat angles P-C4'-P energy: -31.572 tors. eta vs tors. theta energy: -24.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 56 Temperature: 1.221429 Total energy: -325.086183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.086183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.086183 (E_RNA) where: Base-Base interactions energy: -163.507 where: short stacking energy: -126.527 Base-Backbone interact. energy: -2.029 local terms energy: -159.550419 where: bonds (distance) C4'-P energy: -35.515 bonds (distance) P-C4' energy: -50.101 flat angles C4'-P-C4' energy: -41.253 flat angles P-C4'-P energy: -22.458 tors. eta vs tors. theta energy: -10.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 56 Temperature: 1.285714 Total energy: -256.652869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.652869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.652869 (E_RNA) where: Base-Base interactions energy: -104.272 where: short stacking energy: -93.146 Base-Backbone interact. energy: -0.070 local terms energy: -152.310845 where: bonds (distance) C4'-P energy: -38.543 bonds (distance) P-C4' energy: -51.580 flat angles C4'-P-C4' energy: -43.173 flat angles P-C4'-P energy: -17.890 tors. eta vs tors. theta energy: -1.125 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -213.074975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.074975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.074975 (E_RNA) where: Base-Base interactions energy: -66.657 where: short stacking energy: -55.354 Base-Backbone interact. energy: -0.264 local terms energy: -146.154784 where: bonds (distance) C4'-P energy: -47.042 bonds (distance) P-C4' energy: -46.012 flat angles C4'-P-C4' energy: -35.643 flat angles P-C4'-P energy: -29.481 tors. eta vs tors. theta energy: 12.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -672.102996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.102996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.102996 (E_RNA) where: Base-Base interactions energy: -411.942 where: short stacking energy: -218.001 Base-Backbone interact. energy: -1.209 local terms energy: -258.952038 where: bonds (distance) C4'-P energy: -46.085 bonds (distance) P-C4' energy: -60.544 flat angles C4'-P-C4' energy: -58.018 flat angles P-C4'-P energy: -47.252 tors. eta vs tors. theta energy: -47.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 57 Temperature: 0.964286 Total energy: -587.354588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.354588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.354588 (E_RNA) where: Base-Base interactions energy: -375.048 where: short stacking energy: -197.103 Base-Backbone interact. energy: -1.279 local terms energy: -211.028070 where: bonds (distance) C4'-P energy: -53.926 bonds (distance) P-C4' energy: -54.184 flat angles C4'-P-C4' energy: -46.431 flat angles P-C4'-P energy: -25.569 tors. eta vs tors. theta energy: -30.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 57 Temperature: 1.028571 Total energy: -508.179576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.179576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.179576 (E_RNA) where: Base-Base interactions energy: -266.899 where: short stacking energy: -169.817 Base-Backbone interact. energy: -0.278 local terms energy: -241.001729 where: bonds (distance) C4'-P energy: -55.722 bonds (distance) P-C4' energy: -61.660 flat angles C4'-P-C4' energy: -57.739 flat angles P-C4'-P energy: -36.817 tors. eta vs tors. theta energy: -29.063 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 57 Temperature: 1.092857 Total energy: -415.326229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.326229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.326229 (E_RNA) where: Base-Base interactions energy: -210.287 where: short stacking energy: -152.685 Base-Backbone interact. energy: -0.277 local terms energy: -204.762591 where: bonds (distance) C4'-P energy: -42.717 bonds (distance) P-C4' energy: -59.606 flat angles C4'-P-C4' energy: -51.029 flat angles P-C4'-P energy: -20.028 tors. eta vs tors. theta energy: -31.384 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 57 Temperature: 1.157143 Total energy: -340.819934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.819934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.819934 (E_RNA) where: Base-Base interactions energy: -133.078 where: short stacking energy: -127.022 Base-Backbone interact. energy: 0.391 local terms energy: -208.132980 where: bonds (distance) C4'-P energy: -59.181 bonds (distance) P-C4' energy: -48.537 flat angles C4'-P-C4' energy: -55.146 flat angles P-C4'-P energy: -29.360 tors. eta vs tors. theta energy: -15.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 57 Temperature: 1.221429 Total energy: -320.664895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.664895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.664895 (E_RNA) where: Base-Base interactions energy: -144.168 where: short stacking energy: -111.919 Base-Backbone interact. energy: -1.876 local terms energy: -174.621193 where: bonds (distance) C4'-P energy: -44.344 bonds (distance) P-C4' energy: -52.372 flat angles C4'-P-C4' energy: -41.113 flat angles P-C4'-P energy: -24.839 tors. eta vs tors. theta energy: -11.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 57 Temperature: 1.285714 Total energy: -251.529160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.529160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.529160 (E_RNA) where: Base-Base interactions energy: -88.186 where: short stacking energy: -76.277 Base-Backbone interact. energy: -0.259 local terms energy: -163.083373 where: bonds (distance) C4'-P energy: -45.070 bonds (distance) P-C4' energy: -60.741 flat angles C4'-P-C4' energy: -35.614 flat angles P-C4'-P energy: -22.224 tors. eta vs tors. theta energy: 0.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -227.475380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.475380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.475380 (E_RNA) where: Base-Base interactions energy: -77.461 where: short stacking energy: -68.854 Base-Backbone interact. energy: -2.168 local terms energy: -147.846587 where: bonds (distance) C4'-P energy: -50.517 bonds (distance) P-C4' energy: -52.080 flat angles C4'-P-C4' energy: -35.872 flat angles P-C4'-P energy: -23.051 tors. eta vs tors. theta energy: 13.673 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -689.476157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.476157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.476157 (E_RNA) where: Base-Base interactions energy: -420.493 where: short stacking energy: -231.696 Base-Backbone interact. energy: 0.308 local terms energy: -269.291845 where: bonds (distance) C4'-P energy: -62.618 bonds (distance) P-C4' energy: -57.478 flat angles C4'-P-C4' energy: -52.236 flat angles P-C4'-P energy: -43.888 tors. eta vs tors. theta energy: -53.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 58 Temperature: 0.964286 Total energy: -603.371630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.371630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.371630 (E_RNA) where: Base-Base interactions energy: -352.286 where: short stacking energy: -190.980 Base-Backbone interact. energy: -1.357 local terms energy: -249.728217 where: bonds (distance) C4'-P energy: -66.741 bonds (distance) P-C4' energy: -61.307 flat angles C4'-P-C4' energy: -60.646 flat angles P-C4'-P energy: -27.573 tors. eta vs tors. theta energy: -33.461 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 58 Temperature: 1.028571 Total energy: -548.715095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.715095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.715095 (E_RNA) where: Base-Base interactions energy: -309.509 where: short stacking energy: -195.699 Base-Backbone interact. energy: -0.292 local terms energy: -238.914925 where: bonds (distance) C4'-P energy: -55.235 bonds (distance) P-C4' energy: -51.428 flat angles C4'-P-C4' energy: -50.845 flat angles P-C4'-P energy: -35.857 tors. eta vs tors. theta energy: -45.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 58 Temperature: 1.092857 Total energy: -416.636356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.636356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.636356 (E_RNA) where: Base-Base interactions energy: -215.838 where: short stacking energy: -121.253 Base-Backbone interact. energy: -0.816 local terms energy: -199.982275 where: bonds (distance) C4'-P energy: -48.775 bonds (distance) P-C4' energy: -58.240 flat angles C4'-P-C4' energy: -49.872 flat angles P-C4'-P energy: -30.962 tors. eta vs tors. theta energy: -12.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 58 Temperature: 1.157143 Total energy: -317.425625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.425625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.425625 (E_RNA) where: Base-Base interactions energy: -128.028 where: short stacking energy: -98.232 Base-Backbone interact. energy: -0.149 local terms energy: -189.247905 where: bonds (distance) C4'-P energy: -48.000 bonds (distance) P-C4' energy: -53.204 flat angles C4'-P-C4' energy: -52.265 flat angles P-C4'-P energy: -29.512 tors. eta vs tors. theta energy: -6.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 58 Temperature: 1.221429 Total energy: -303.785634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.785634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.785634 (E_RNA) where: Base-Base interactions energy: -109.884 where: short stacking energy: -106.890 Base-Backbone interact. energy: 0.413 local terms energy: -194.314367 where: bonds (distance) C4'-P energy: -39.837 bonds (distance) P-C4' energy: -60.275 flat angles C4'-P-C4' energy: -52.892 flat angles P-C4'-P energy: -31.299 tors. eta vs tors. theta energy: -10.011 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 58 Temperature: 1.285714 Total energy: -239.037538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.037538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.037538 (E_RNA) where: Base-Base interactions energy: -92.290 where: short stacking energy: -75.939 Base-Backbone interact. energy: 2.476 local terms energy: -149.224257 where: bonds (distance) C4'-P energy: -43.686 bonds (distance) P-C4' energy: -41.252 flat angles C4'-P-C4' energy: -32.420 flat angles P-C4'-P energy: -36.521 tors. eta vs tors. theta energy: 4.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -227.921656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.921656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.921656 (E_RNA) where: Base-Base interactions energy: -80.997 where: short stacking energy: -48.310 Base-Backbone interact. energy: 2.198 local terms energy: -149.123305 where: bonds (distance) C4'-P energy: -41.677 bonds (distance) P-C4' energy: -60.000 flat angles C4'-P-C4' energy: -38.416 flat angles P-C4'-P energy: -24.543 tors. eta vs tors. theta energy: 15.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -687.138219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.138219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.138219 (E_RNA) where: Base-Base interactions energy: -435.739 where: short stacking energy: -243.857 Base-Backbone interact. energy: 2.993 local terms energy: -254.392898 where: bonds (distance) C4'-P energy: -54.116 bonds (distance) P-C4' energy: -54.465 flat angles C4'-P-C4' energy: -50.981 flat angles P-C4'-P energy: -37.640 tors. eta vs tors. theta energy: -57.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 59 Temperature: 0.964286 Total energy: -597.337075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.337075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.337075 (E_RNA) where: Base-Base interactions energy: -336.762 where: short stacking energy: -182.634 Base-Backbone interact. energy: -1.163 local terms energy: -259.411706 where: bonds (distance) C4'-P energy: -56.315 bonds (distance) P-C4' energy: -64.732 flat angles C4'-P-C4' energy: -62.580 flat angles P-C4'-P energy: -35.277 tors. eta vs tors. theta energy: -40.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 59 Temperature: 1.028571 Total energy: -516.636143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.636143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.636143 (E_RNA) where: Base-Base interactions energy: -290.748 where: short stacking energy: -182.859 Base-Backbone interact. energy: -0.727 local terms energy: -225.161272 where: bonds (distance) C4'-P energy: -52.271 bonds (distance) P-C4' energy: -56.267 flat angles C4'-P-C4' energy: -45.866 flat angles P-C4'-P energy: -38.405 tors. eta vs tors. theta energy: -32.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 59 Temperature: 1.092857 Total energy: -476.365449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.365449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.365449 (E_RNA) where: Base-Base interactions energy: -249.222 where: short stacking energy: -165.123 Base-Backbone interact. energy: 1.383 local terms energy: -228.526636 where: bonds (distance) C4'-P energy: -51.784 bonds (distance) P-C4' energy: -57.516 flat angles C4'-P-C4' energy: -48.734 flat angles P-C4'-P energy: -39.630 tors. eta vs tors. theta energy: -30.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 59 Temperature: 1.157143 Total energy: -338.827649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.827649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.827649 (E_RNA) where: Base-Base interactions energy: -158.797 where: short stacking energy: -125.916 Base-Backbone interact. energy: -0.732 local terms energy: -179.299125 where: bonds (distance) C4'-P energy: -46.939 bonds (distance) P-C4' energy: -55.730 flat angles C4'-P-C4' energy: -52.232 flat angles P-C4'-P energy: -18.993 tors. eta vs tors. theta energy: -5.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 59 Temperature: 1.221429 Total energy: -321.220584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.220584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.220584 (E_RNA) where: Base-Base interactions energy: -129.383 where: short stacking energy: -107.801 Base-Backbone interact. energy: 0.253 local terms energy: -192.091265 where: bonds (distance) C4'-P energy: -47.240 bonds (distance) P-C4' energy: -55.802 flat angles C4'-P-C4' energy: -55.168 flat angles P-C4'-P energy: -24.831 tors. eta vs tors. theta energy: -9.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 59 Temperature: 1.285714 Total energy: -269.311207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.311207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.311207 (E_RNA) where: Base-Base interactions energy: -102.194 where: short stacking energy: -89.634 Base-Backbone interact. energy: -0.847 local terms energy: -166.270052 where: bonds (distance) C4'-P energy: -51.057 bonds (distance) P-C4' energy: -50.798 flat angles C4'-P-C4' energy: -47.848 flat angles P-C4'-P energy: -19.215 tors. eta vs tors. theta energy: 2.649 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -232.089731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.089731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.089731 (E_RNA) where: Base-Base interactions energy: -70.778 where: short stacking energy: -52.528 Base-Backbone interact. energy: -0.500 local terms energy: -160.811422 where: bonds (distance) C4'-P energy: -42.790 bonds (distance) P-C4' energy: -49.264 flat angles C4'-P-C4' energy: -40.192 flat angles P-C4'-P energy: -33.120 tors. eta vs tors. theta energy: 4.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -699.203737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.203737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.203737 (E_RNA) where: Base-Base interactions energy: -439.494 where: short stacking energy: -230.648 Base-Backbone interact. energy: 1.079 local terms energy: -260.788905 where: bonds (distance) C4'-P energy: -48.335 bonds (distance) P-C4' energy: -61.095 flat angles C4'-P-C4' energy: -58.426 flat angles P-C4'-P energy: -33.804 tors. eta vs tors. theta energy: -59.129 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 60 Temperature: 0.964286 Total energy: -594.423682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.423682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.423682 (E_RNA) where: Base-Base interactions energy: -369.012 where: short stacking energy: -189.664 Base-Backbone interact. energy: -2.090 local terms energy: -223.321294 where: bonds (distance) C4'-P energy: -46.966 bonds (distance) P-C4' energy: -53.238 flat angles C4'-P-C4' energy: -53.038 flat angles P-C4'-P energy: -30.593 tors. eta vs tors. theta energy: -39.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 60 Temperature: 1.028571 Total energy: -516.618681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.618681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.618681 (E_RNA) where: Base-Base interactions energy: -279.148 where: short stacking energy: -160.192 Base-Backbone interact. energy: -1.050 local terms energy: -236.420580 where: bonds (distance) C4'-P energy: -51.817 bonds (distance) P-C4' energy: -65.789 flat angles C4'-P-C4' energy: -50.666 flat angles P-C4'-P energy: -32.846 tors. eta vs tors. theta energy: -35.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 60 Temperature: 1.092857 Total energy: -426.478241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.478241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.478241 (E_RNA) where: Base-Base interactions energy: -202.043 where: short stacking energy: -146.916 Base-Backbone interact. energy: -1.493 local terms energy: -222.942231 where: bonds (distance) C4'-P energy: -56.833 bonds (distance) P-C4' energy: -54.895 flat angles C4'-P-C4' energy: -55.419 flat angles P-C4'-P energy: -39.447 tors. eta vs tors. theta energy: -16.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 60 Temperature: 1.157143 Total energy: -370.431375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.431375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.431375 (E_RNA) where: Base-Base interactions energy: -190.370 where: short stacking energy: -120.886 Base-Backbone interact. energy: 0.241 local terms energy: -180.302982 where: bonds (distance) C4'-P energy: -48.816 bonds (distance) P-C4' energy: -54.208 flat angles C4'-P-C4' energy: -37.976 flat angles P-C4'-P energy: -31.839 tors. eta vs tors. theta energy: -7.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 60 Temperature: 1.221429 Total energy: -323.471044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.471044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.471044 (E_RNA) where: Base-Base interactions energy: -147.248 where: short stacking energy: -112.635 Base-Backbone interact. energy: 0.523 local terms energy: -176.745863 where: bonds (distance) C4'-P energy: -45.179 bonds (distance) P-C4' energy: -47.359 flat angles C4'-P-C4' energy: -46.630 flat angles P-C4'-P energy: -33.809 tors. eta vs tors. theta energy: -3.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 60 Temperature: 1.285714 Total energy: -255.085592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.085592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.085592 (E_RNA) where: Base-Base interactions energy: -90.075 where: short stacking energy: -81.240 Base-Backbone interact. energy: -0.761 local terms energy: -164.250467 where: bonds (distance) C4'-P energy: -39.627 bonds (distance) P-C4' energy: -47.314 flat angles C4'-P-C4' energy: -43.185 flat angles P-C4'-P energy: -37.419 tors. eta vs tors. theta energy: 3.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -218.222982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.222982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.222982 (E_RNA) where: Base-Base interactions energy: -76.991 where: short stacking energy: -69.558 Base-Backbone interact. energy: 0.563 local terms energy: -141.794805 where: bonds (distance) C4'-P energy: -56.135 bonds (distance) P-C4' energy: -54.702 flat angles C4'-P-C4' energy: -36.972 flat angles P-C4'-P energy: -17.397 tors. eta vs tors. theta energy: 23.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -727.911153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.911153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.911153 (E_RNA) where: Base-Base interactions energy: -460.137 where: short stacking energy: -238.887 Base-Backbone interact. energy: -1.046 local terms energy: -266.728339 where: bonds (distance) C4'-P energy: -60.159 bonds (distance) P-C4' energy: -66.144 flat angles C4'-P-C4' energy: -55.559 flat angles P-C4'-P energy: -35.105 tors. eta vs tors. theta energy: -49.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 61 Temperature: 0.964286 Total energy: -599.861337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.861337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.861337 (E_RNA) where: Base-Base interactions energy: -361.990 where: short stacking energy: -212.053 Base-Backbone interact. energy: 1.085 local terms energy: -238.956199 where: bonds (distance) C4'-P energy: -49.395 bonds (distance) P-C4' energy: -58.266 flat angles C4'-P-C4' energy: -54.621 flat angles P-C4'-P energy: -34.429 tors. eta vs tors. theta energy: -42.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 61 Temperature: 1.028571 Total energy: -513.668397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.668397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.668397 (E_RNA) where: Base-Base interactions energy: -296.074 where: short stacking energy: -175.537 Base-Backbone interact. energy: -0.780 local terms energy: -216.814859 where: bonds (distance) C4'-P energy: -53.858 bonds (distance) P-C4' energy: -52.953 flat angles C4'-P-C4' energy: -54.962 flat angles P-C4'-P energy: -27.867 tors. eta vs tors. theta energy: -27.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 61 Temperature: 1.092857 Total energy: -437.523150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.523150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.523150 (E_RNA) where: Base-Base interactions energy: -234.131 where: short stacking energy: -170.757 Base-Backbone interact. energy: -0.066 local terms energy: -203.326656 where: bonds (distance) C4'-P energy: -44.605 bonds (distance) P-C4' energy: -56.731 flat angles C4'-P-C4' energy: -46.871 flat angles P-C4'-P energy: -27.269 tors. eta vs tors. theta energy: -27.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 61 Temperature: 1.157143 Total energy: -386.502958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.502958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.502958 (E_RNA) where: Base-Base interactions energy: -192.176 where: short stacking energy: -158.145 Base-Backbone interact. energy: -0.634 local terms energy: -193.692531 where: bonds (distance) C4'-P energy: -43.313 bonds (distance) P-C4' energy: -50.472 flat angles C4'-P-C4' energy: -44.434 flat angles P-C4'-P energy: -29.953 tors. eta vs tors. theta energy: -25.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 61 Temperature: 1.221429 Total energy: -319.568754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.568754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.568754 (E_RNA) where: Base-Base interactions energy: -140.361 where: short stacking energy: -112.240 Base-Backbone interact. energy: -0.515 local terms energy: -178.693205 where: bonds (distance) C4'-P energy: -46.144 bonds (distance) P-C4' energy: -45.842 flat angles C4'-P-C4' energy: -57.551 flat angles P-C4'-P energy: -18.912 tors. eta vs tors. theta energy: -10.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 61 Temperature: 1.285714 Total energy: -247.472147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.472147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.472147 (E_RNA) where: Base-Base interactions energy: -80.782 where: short stacking energy: -73.484 Base-Backbone interact. energy: 1.309 local terms energy: -167.999505 where: bonds (distance) C4'-P energy: -45.153 bonds (distance) P-C4' energy: -52.101 flat angles C4'-P-C4' energy: -40.604 flat angles P-C4'-P energy: -34.283 tors. eta vs tors. theta energy: 4.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -222.084164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.084164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.084164 (E_RNA) where: Base-Base interactions energy: -69.170 where: short stacking energy: -59.633 Base-Backbone interact. energy: 0.881 local terms energy: -153.794518 where: bonds (distance) C4'-P energy: -43.742 bonds (distance) P-C4' energy: -49.221 flat angles C4'-P-C4' energy: -46.295 flat angles P-C4'-P energy: -27.942 tors. eta vs tors. theta energy: 13.406 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -689.842729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.842729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.842729 (E_RNA) where: Base-Base interactions energy: -443.117 where: short stacking energy: -224.042 Base-Backbone interact. energy: -1.234 local terms energy: -245.490860 where: bonds (distance) C4'-P energy: -56.915 bonds (distance) P-C4' energy: -56.893 flat angles C4'-P-C4' energy: -47.403 flat angles P-C4'-P energy: -29.615 tors. eta vs tors. theta energy: -54.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 62 Temperature: 0.964286 Total energy: -591.947304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.947304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.947304 (E_RNA) where: Base-Base interactions energy: -340.315 where: short stacking energy: -190.150 Base-Backbone interact. energy: -0.737 local terms energy: -250.894809 where: bonds (distance) C4'-P energy: -57.293 bonds (distance) P-C4' energy: -52.912 flat angles C4'-P-C4' energy: -58.084 flat angles P-C4'-P energy: -39.738 tors. eta vs tors. theta energy: -42.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 62 Temperature: 1.028571 Total energy: -544.155644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.155644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.155644 (E_RNA) where: Base-Base interactions energy: -310.101 where: short stacking energy: -191.497 Base-Backbone interact. energy: -0.628 local terms energy: -233.426859 where: bonds (distance) C4'-P energy: -54.251 bonds (distance) P-C4' energy: -65.635 flat angles C4'-P-C4' energy: -49.506 flat angles P-C4'-P energy: -28.271 tors. eta vs tors. theta energy: -35.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 62 Temperature: 1.092857 Total energy: -437.575807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.575807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.575807 (E_RNA) where: Base-Base interactions energy: -220.328 where: short stacking energy: -146.866 Base-Backbone interact. energy: 0.773 local terms energy: -218.021379 where: bonds (distance) C4'-P energy: -47.802 bonds (distance) P-C4' energy: -64.912 flat angles C4'-P-C4' energy: -51.647 flat angles P-C4'-P energy: -27.496 tors. eta vs tors. theta energy: -26.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 62 Temperature: 1.157143 Total energy: -359.025814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.025814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.025814 (E_RNA) where: Base-Base interactions energy: -183.499 where: short stacking energy: -124.310 Base-Backbone interact. energy: 0.974 local terms energy: -176.500267 where: bonds (distance) C4'-P energy: -38.166 bonds (distance) P-C4' energy: -48.995 flat angles C4'-P-C4' energy: -57.820 flat angles P-C4'-P energy: -31.397 tors. eta vs tors. theta energy: -0.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 62 Temperature: 1.221429 Total energy: -320.238306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.238306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.238306 (E_RNA) where: Base-Base interactions energy: -142.750 where: short stacking energy: -104.020 Base-Backbone interact. energy: -0.138 local terms energy: -177.350052 where: bonds (distance) C4'-P energy: -56.541 bonds (distance) P-C4' energy: -51.202 flat angles C4'-P-C4' energy: -45.884 flat angles P-C4'-P energy: -20.642 tors. eta vs tors. theta energy: -3.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 62 Temperature: 1.285714 Total energy: -286.000854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.000854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.000854 (E_RNA) where: Base-Base interactions energy: -115.234 where: short stacking energy: -96.472 Base-Backbone interact. energy: 0.330 local terms energy: -171.097150 where: bonds (distance) C4'-P energy: -48.237 bonds (distance) P-C4' energy: -43.155 flat angles C4'-P-C4' energy: -48.098 flat angles P-C4'-P energy: -28.770 tors. eta vs tors. theta energy: -2.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -229.321616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.321616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.321616 (E_RNA) where: Base-Base interactions energy: -82.752 where: short stacking energy: -71.710 Base-Backbone interact. energy: 0.031 local terms energy: -146.600443 where: bonds (distance) C4'-P energy: -48.227 bonds (distance) P-C4' energy: -42.070 flat angles C4'-P-C4' energy: -41.432 flat angles P-C4'-P energy: -29.101 tors. eta vs tors. theta energy: 14.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -711.718711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.718711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.718711 (E_RNA) where: Base-Base interactions energy: -424.043 where: short stacking energy: -232.731 Base-Backbone interact. energy: -1.988 local terms energy: -285.688024 where: bonds (distance) C4'-P energy: -60.923 bonds (distance) P-C4' energy: -68.082 flat angles C4'-P-C4' energy: -59.678 flat angles P-C4'-P energy: -42.963 tors. eta vs tors. theta energy: -54.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 63 Temperature: 0.964286 Total energy: -599.663257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.663257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.663257 (E_RNA) where: Base-Base interactions energy: -363.715 where: short stacking energy: -202.836 Base-Backbone interact. energy: -0.079 local terms energy: -235.869057 where: bonds (distance) C4'-P energy: -63.285 bonds (distance) P-C4' energy: -55.864 flat angles C4'-P-C4' energy: -51.944 flat angles P-C4'-P energy: -28.476 tors. eta vs tors. theta energy: -36.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 63 Temperature: 1.028571 Total energy: -501.021260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.021260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.021260 (E_RNA) where: Base-Base interactions energy: -270.317 where: short stacking energy: -152.227 Base-Backbone interact. energy: 1.859 local terms energy: -232.562533 where: bonds (distance) C4'-P energy: -53.330 bonds (distance) P-C4' energy: -55.782 flat angles C4'-P-C4' energy: -59.187 flat angles P-C4'-P energy: -38.058 tors. eta vs tors. theta energy: -26.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 63 Temperature: 1.092857 Total energy: -484.929614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.929614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.929614 (E_RNA) where: Base-Base interactions energy: -254.294 where: short stacking energy: -175.892 Base-Backbone interact. energy: -0.480 local terms energy: -230.154872 where: bonds (distance) C4'-P energy: -52.667 bonds (distance) P-C4' energy: -58.743 flat angles C4'-P-C4' energy: -54.860 flat angles P-C4'-P energy: -33.561 tors. eta vs tors. theta energy: -30.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 63 Temperature: 1.157143 Total energy: -368.268863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.268863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.268863 (E_RNA) where: Base-Base interactions energy: -178.373 where: short stacking energy: -129.972 Base-Backbone interact. energy: -0.024 local terms energy: -189.871571 where: bonds (distance) C4'-P energy: -48.560 bonds (distance) P-C4' energy: -51.966 flat angles C4'-P-C4' energy: -43.332 flat angles P-C4'-P energy: -28.333 tors. eta vs tors. theta energy: -17.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 63 Temperature: 1.221429 Total energy: -332.944382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.944382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.944382 (E_RNA) where: Base-Base interactions energy: -138.645 where: short stacking energy: -100.248 Base-Backbone interact. energy: -0.225 local terms energy: -194.074866 where: bonds (distance) C4'-P energy: -54.612 bonds (distance) P-C4' energy: -53.859 flat angles C4'-P-C4' energy: -51.630 flat angles P-C4'-P energy: -26.334 tors. eta vs tors. theta energy: -7.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 63 Temperature: 1.285714 Total energy: -231.031686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.031686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.031686 (E_RNA) where: Base-Base interactions energy: -83.121 where: short stacking energy: -81.565 Base-Backbone interact. energy: -0.652 local terms energy: -147.258664 where: bonds (distance) C4'-P energy: -43.012 bonds (distance) P-C4' energy: -55.292 flat angles C4'-P-C4' energy: -35.026 flat angles P-C4'-P energy: -21.743 tors. eta vs tors. theta energy: 7.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -232.132428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.132428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.132428 (E_RNA) where: Base-Base interactions energy: -94.818 where: short stacking energy: -88.410 Base-Backbone interact. energy: -0.492 local terms energy: -136.823101 where: bonds (distance) C4'-P energy: -31.971 bonds (distance) P-C4' energy: -50.190 flat angles C4'-P-C4' energy: -30.978 flat angles P-C4'-P energy: -20.813 tors. eta vs tors. theta energy: -2.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -728.470443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.470443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.470443 (E_RNA) where: Base-Base interactions energy: -450.609 where: short stacking energy: -252.309 Base-Backbone interact. energy: -1.106 local terms energy: -276.755526 where: bonds (distance) C4'-P energy: -58.014 bonds (distance) P-C4' energy: -57.158 flat angles C4'-P-C4' energy: -55.203 flat angles P-C4'-P energy: -47.656 tors. eta vs tors. theta energy: -58.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 64 Temperature: 0.964286 Total energy: -604.931839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.931839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.931839 (E_RNA) where: Base-Base interactions energy: -356.763 where: short stacking energy: -207.501 Base-Backbone interact. energy: -2.207 local terms energy: -245.960973 where: bonds (distance) C4'-P energy: -53.547 bonds (distance) P-C4' energy: -53.176 flat angles C4'-P-C4' energy: -54.641 flat angles P-C4'-P energy: -41.457 tors. eta vs tors. theta energy: -43.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 64 Temperature: 1.028571 Total energy: -479.975405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.975405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.975405 (E_RNA) where: Base-Base interactions energy: -259.510 where: short stacking energy: -162.691 Base-Backbone interact. energy: -1.157 local terms energy: -219.307943 where: bonds (distance) C4'-P energy: -50.258 bonds (distance) P-C4' energy: -48.394 flat angles C4'-P-C4' energy: -58.463 flat angles P-C4'-P energy: -32.390 tors. eta vs tors. theta energy: -29.803 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 64 Temperature: 1.092857 Total energy: -454.454696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.454696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.454696 (E_RNA) where: Base-Base interactions energy: -239.757 where: short stacking energy: -154.435 Base-Backbone interact. energy: 0.904 local terms energy: -215.601890 where: bonds (distance) C4'-P energy: -62.769 bonds (distance) P-C4' energy: -58.825 flat angles C4'-P-C4' energy: -53.639 flat angles P-C4'-P energy: -24.234 tors. eta vs tors. theta energy: -16.135 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 64 Temperature: 1.157143 Total energy: -347.321848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.321848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.321848 (E_RNA) where: Base-Base interactions energy: -159.809 where: short stacking energy: -106.473 Base-Backbone interact. energy: -1.826 local terms energy: -185.687135 where: bonds (distance) C4'-P energy: -43.502 bonds (distance) P-C4' energy: -55.318 flat angles C4'-P-C4' energy: -46.654 flat angles P-C4'-P energy: -37.649 tors. eta vs tors. theta energy: -2.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 64 Temperature: 1.221429 Total energy: -343.362452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.362452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.362452 (E_RNA) where: Base-Base interactions energy: -145.932 where: short stacking energy: -120.557 Base-Backbone interact. energy: 0.162 local terms energy: -197.592264 where: bonds (distance) C4'-P energy: -56.265 bonds (distance) P-C4' energy: -43.844 flat angles C4'-P-C4' energy: -50.329 flat angles P-C4'-P energy: -31.485 tors. eta vs tors. theta energy: -15.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 64 Temperature: 1.285714 Total energy: -245.789669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.789669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.789669 (E_RNA) where: Base-Base interactions energy: -83.402 where: short stacking energy: -72.806 Base-Backbone interact. energy: -2.377 local terms energy: -160.009873 where: bonds (distance) C4'-P energy: -50.692 bonds (distance) P-C4' energy: -41.711 flat angles C4'-P-C4' energy: -56.795 flat angles P-C4'-P energy: -26.472 tors. eta vs tors. theta energy: 15.661 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -241.747191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.747191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.747191 (E_RNA) where: Base-Base interactions energy: -93.960 where: short stacking energy: -82.393 Base-Backbone interact. energy: -1.054 local terms energy: -146.732884 where: bonds (distance) C4'-P energy: -39.362 bonds (distance) P-C4' energy: -43.311 flat angles C4'-P-C4' energy: -44.055 flat angles P-C4'-P energy: -15.417 tors. eta vs tors. theta energy: -4.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -723.946296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -723.946296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.946296 (E_RNA) where: Base-Base interactions energy: -444.572 where: short stacking energy: -221.260 Base-Backbone interact. energy: -1.598 local terms energy: -277.776761 where: bonds (distance) C4'-P energy: -59.257 bonds (distance) P-C4' energy: -58.631 flat angles C4'-P-C4' energy: -63.061 flat angles P-C4'-P energy: -44.192 tors. eta vs tors. theta energy: -52.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 65 Temperature: 0.964286 Total energy: -583.896801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.896801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.896801 (E_RNA) where: Base-Base interactions energy: -357.936 where: short stacking energy: -195.592 Base-Backbone interact. energy: -0.957 local terms energy: -225.003903 where: bonds (distance) C4'-P energy: -57.444 bonds (distance) P-C4' energy: -60.026 flat angles C4'-P-C4' energy: -42.622 flat angles P-C4'-P energy: -36.095 tors. eta vs tors. theta energy: -28.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 65 Temperature: 1.028571 Total energy: -513.334160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.334160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.334160 (E_RNA) where: Base-Base interactions energy: -272.815 where: short stacking energy: -169.627 Base-Backbone interact. energy: -0.659 local terms energy: -239.859889 where: bonds (distance) C4'-P energy: -55.966 bonds (distance) P-C4' energy: -59.321 flat angles C4'-P-C4' energy: -51.415 flat angles P-C4'-P energy: -41.653 tors. eta vs tors. theta energy: -31.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 65 Temperature: 1.092857 Total energy: -450.483987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.483987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.483987 (E_RNA) where: Base-Base interactions energy: -240.119 where: short stacking energy: -149.886 Base-Backbone interact. energy: -0.993 local terms energy: -209.371950 where: bonds (distance) C4'-P energy: -48.652 bonds (distance) P-C4' energy: -48.474 flat angles C4'-P-C4' energy: -54.521 flat angles P-C4'-P energy: -27.064 tors. eta vs tors. theta energy: -30.661 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 65 Temperature: 1.157143 Total energy: -324.284432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.284432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.284432 (E_RNA) where: Base-Base interactions energy: -139.192 where: short stacking energy: -100.038 Base-Backbone interact. energy: 1.836 local terms energy: -186.927593 where: bonds (distance) C4'-P energy: -54.444 bonds (distance) P-C4' energy: -49.175 flat angles C4'-P-C4' energy: -42.591 flat angles P-C4'-P energy: -33.641 tors. eta vs tors. theta energy: -7.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 65 Temperature: 1.221429 Total energy: -316.877798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.877798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.877798 (E_RNA) where: Base-Base interactions energy: -131.650 where: short stacking energy: -106.190 Base-Backbone interact. energy: -0.297 local terms energy: -184.931034 where: bonds (distance) C4'-P energy: -52.609 bonds (distance) P-C4' energy: -52.800 flat angles C4'-P-C4' energy: -44.667 flat angles P-C4'-P energy: -23.914 tors. eta vs tors. theta energy: -10.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 65 Temperature: 1.285714 Total energy: -259.530869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.530869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.530869 (E_RNA) where: Base-Base interactions energy: -101.014 where: short stacking energy: -99.748 Base-Backbone interact. energy: 3.611 local terms energy: -162.127391 where: bonds (distance) C4'-P energy: -48.937 bonds (distance) P-C4' energy: -56.007 flat angles C4'-P-C4' energy: -34.276 flat angles P-C4'-P energy: -18.191 tors. eta vs tors. theta energy: -4.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -248.223840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.223840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.223840 (E_RNA) where: Base-Base interactions energy: -81.458 where: short stacking energy: -81.621 Base-Backbone interact. energy: -0.571 local terms energy: -166.194853 where: bonds (distance) C4'-P energy: -50.802 bonds (distance) P-C4' energy: -43.564 flat angles C4'-P-C4' energy: -49.212 flat angles P-C4'-P energy: -23.369 tors. eta vs tors. theta energy: 0.753 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -705.428410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.428410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.428410 (E_RNA) where: Base-Base interactions energy: -436.504 where: short stacking energy: -206.452 Base-Backbone interact. energy: -1.110 local terms energy: -267.815004 where: bonds (distance) C4'-P energy: -61.094 bonds (distance) P-C4' energy: -55.642 flat angles C4'-P-C4' energy: -63.287 flat angles P-C4'-P energy: -44.046 tors. eta vs tors. theta energy: -43.746 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 66 Temperature: 0.964286 Total energy: -622.753797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.753797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.753797 (E_RNA) where: Base-Base interactions energy: -368.787 where: short stacking energy: -199.762 Base-Backbone interact. energy: -2.391 local terms energy: -251.575683 where: bonds (distance) C4'-P energy: -57.839 bonds (distance) P-C4' energy: -58.253 flat angles C4'-P-C4' energy: -62.387 flat angles P-C4'-P energy: -38.206 tors. eta vs tors. theta energy: -34.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 66 Temperature: 1.028571 Total energy: -516.860760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.860760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.860760 (E_RNA) where: Base-Base interactions energy: -288.855 where: short stacking energy: -188.232 Base-Backbone interact. energy: -1.924 local terms energy: -226.081702 where: bonds (distance) C4'-P energy: -47.463 bonds (distance) P-C4' energy: -48.913 flat angles C4'-P-C4' energy: -54.725 flat angles P-C4'-P energy: -43.142 tors. eta vs tors. theta energy: -31.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 66 Temperature: 1.092857 Total energy: -499.201876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.201876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.201876 (E_RNA) where: Base-Base interactions energy: -268.907 where: short stacking energy: -150.161 Base-Backbone interact. energy: -1.292 local terms energy: -229.003045 where: bonds (distance) C4'-P energy: -46.079 bonds (distance) P-C4' energy: -57.539 flat angles C4'-P-C4' energy: -58.222 flat angles P-C4'-P energy: -37.990 tors. eta vs tors. theta energy: -29.174 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 66 Temperature: 1.157143 Total energy: -374.071952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.071952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.071952 (E_RNA) where: Base-Base interactions energy: -181.818 where: short stacking energy: -123.365 Base-Backbone interact. energy: 2.375 local terms energy: -194.628979 where: bonds (distance) C4'-P energy: -41.865 bonds (distance) P-C4' energy: -51.380 flat angles C4'-P-C4' energy: -52.004 flat angles P-C4'-P energy: -35.086 tors. eta vs tors. theta energy: -14.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 66 Temperature: 1.221429 Total energy: -317.652280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.652280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.652280 (E_RNA) where: Base-Base interactions energy: -126.204 where: short stacking energy: -79.141 Base-Backbone interact. energy: 0.129 local terms energy: -191.576393 where: bonds (distance) C4'-P energy: -46.862 bonds (distance) P-C4' energy: -58.694 flat angles C4'-P-C4' energy: -54.218 flat angles P-C4'-P energy: -32.879 tors. eta vs tors. theta energy: 1.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 66 Temperature: 1.285714 Total energy: -245.675398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.675398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.675398 (E_RNA) where: Base-Base interactions energy: -90.471 where: short stacking energy: -85.630 Base-Backbone interact. energy: -2.011 local terms energy: -153.193509 where: bonds (distance) C4'-P energy: -51.284 bonds (distance) P-C4' energy: -35.910 flat angles C4'-P-C4' energy: -44.245 flat angles P-C4'-P energy: -29.894 tors. eta vs tors. theta energy: 8.139 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -224.667344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.667344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.667344 (E_RNA) where: Base-Base interactions energy: -82.604 where: short stacking energy: -67.290 Base-Backbone interact. energy: 1.593 local terms energy: -143.656137 where: bonds (distance) C4'-P energy: -41.027 bonds (distance) P-C4' energy: -38.743 flat angles C4'-P-C4' energy: -49.017 flat angles P-C4'-P energy: -28.004 tors. eta vs tors. theta energy: 13.135 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -683.382178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.382178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.382178 (E_RNA) where: Base-Base interactions energy: -428.480 where: short stacking energy: -212.992 Base-Backbone interact. energy: -2.475 local terms energy: -252.427387 where: bonds (distance) C4'-P energy: -47.349 bonds (distance) P-C4' energy: -58.711 flat angles C4'-P-C4' energy: -62.234 flat angles P-C4'-P energy: -31.982 tors. eta vs tors. theta energy: -52.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 67 Temperature: 0.964286 Total energy: -597.372874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.372874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.372874 (E_RNA) where: Base-Base interactions energy: -367.552 where: short stacking energy: -185.285 Base-Backbone interact. energy: -0.498 local terms energy: -229.323553 where: bonds (distance) C4'-P energy: -52.572 bonds (distance) P-C4' energy: -57.120 flat angles C4'-P-C4' energy: -54.965 flat angles P-C4'-P energy: -36.752 tors. eta vs tors. theta energy: -27.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 67 Temperature: 1.028571 Total energy: -496.193741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.193741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.193741 (E_RNA) where: Base-Base interactions energy: -280.062 where: short stacking energy: -176.974 Base-Backbone interact. energy: 2.335 local terms energy: -218.467184 where: bonds (distance) C4'-P energy: -50.336 bonds (distance) P-C4' energy: -60.424 flat angles C4'-P-C4' energy: -49.890 flat angles P-C4'-P energy: -29.701 tors. eta vs tors. theta energy: -28.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 67 Temperature: 1.092857 Total energy: -474.852304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.852304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.852304 (E_RNA) where: Base-Base interactions energy: -251.068 where: short stacking energy: -149.123 Base-Backbone interact. energy: -0.375 local terms energy: -223.409940 where: bonds (distance) C4'-P energy: -59.352 bonds (distance) P-C4' energy: -52.328 flat angles C4'-P-C4' energy: -52.114 flat angles P-C4'-P energy: -30.698 tors. eta vs tors. theta energy: -28.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 67 Temperature: 1.157143 Total energy: -396.095268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.095268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.095268 (E_RNA) where: Base-Base interactions energy: -205.948 where: short stacking energy: -143.964 Base-Backbone interact. energy: -1.363 local terms energy: -188.784309 where: bonds (distance) C4'-P energy: -43.220 bonds (distance) P-C4' energy: -54.716 flat angles C4'-P-C4' energy: -21.025 flat angles P-C4'-P energy: -44.468 tors. eta vs tors. theta energy: -25.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 67 Temperature: 1.221429 Total energy: -351.948956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.948956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.948956 (E_RNA) where: Base-Base interactions energy: -178.272 where: short stacking energy: -109.492 Base-Backbone interact. energy: -0.984 local terms energy: -172.693548 where: bonds (distance) C4'-P energy: -50.527 bonds (distance) P-C4' energy: -48.655 flat angles C4'-P-C4' energy: -41.182 flat angles P-C4'-P energy: -27.245 tors. eta vs tors. theta energy: -5.085 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 67 Temperature: 1.285714 Total energy: -272.818000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.818000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.818000 (E_RNA) where: Base-Base interactions energy: -96.384 where: short stacking energy: -94.294 Base-Backbone interact. energy: 0.039 local terms energy: -176.472757 where: bonds (distance) C4'-P energy: -50.079 bonds (distance) P-C4' energy: -35.597 flat angles C4'-P-C4' energy: -63.000 flat angles P-C4'-P energy: -25.875 tors. eta vs tors. theta energy: -1.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -239.308451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.308451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.308451 (E_RNA) where: Base-Base interactions energy: -89.085 where: short stacking energy: -76.268 Base-Backbone interact. energy: 0.146 local terms energy: -150.369968 where: bonds (distance) C4'-P energy: -41.213 bonds (distance) P-C4' energy: -54.856 flat angles C4'-P-C4' energy: -53.527 flat angles P-C4'-P energy: -16.923 tors. eta vs tors. theta energy: 16.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -697.082406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.082406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.082406 (E_RNA) where: Base-Base interactions energy: -440.853 where: short stacking energy: -215.427 Base-Backbone interact. energy: -3.231 local terms energy: -252.998740 where: bonds (distance) C4'-P energy: -45.831 bonds (distance) P-C4' energy: -61.482 flat angles C4'-P-C4' energy: -65.737 flat angles P-C4'-P energy: -31.422 tors. eta vs tors. theta energy: -48.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 68 Temperature: 0.964286 Total energy: -619.255755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.255755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.255755 (E_RNA) where: Base-Base interactions energy: -383.645 where: short stacking energy: -190.977 Base-Backbone interact. energy: -1.637 local terms energy: -233.973343 where: bonds (distance) C4'-P energy: -53.000 bonds (distance) P-C4' energy: -61.899 flat angles C4'-P-C4' energy: -49.668 flat angles P-C4'-P energy: -34.177 tors. eta vs tors. theta energy: -35.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 68 Temperature: 1.028571 Total energy: -545.820831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.820831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.820831 (E_RNA) where: Base-Base interactions energy: -310.620 where: short stacking energy: -205.166 Base-Backbone interact. energy: -0.434 local terms energy: -234.766777 where: bonds (distance) C4'-P energy: -41.853 bonds (distance) P-C4' energy: -58.716 flat angles C4'-P-C4' energy: -50.170 flat angles P-C4'-P energy: -37.437 tors. eta vs tors. theta energy: -46.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 68 Temperature: 1.092857 Total energy: -482.214618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.214618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.214618 (E_RNA) where: Base-Base interactions energy: -261.421 where: short stacking energy: -179.206 Base-Backbone interact. energy: -0.085 local terms energy: -220.708731 where: bonds (distance) C4'-P energy: -57.268 bonds (distance) P-C4' energy: -57.636 flat angles C4'-P-C4' energy: -40.706 flat angles P-C4'-P energy: -26.863 tors. eta vs tors. theta energy: -38.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 68 Temperature: 1.157143 Total energy: -350.577117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.577117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.577117 (E_RNA) where: Base-Base interactions energy: -161.545 where: short stacking energy: -106.830 Base-Backbone interact. energy: 1.095 local terms energy: -190.127517 where: bonds (distance) C4'-P energy: -56.808 bonds (distance) P-C4' energy: -50.623 flat angles C4'-P-C4' energy: -43.939 flat angles P-C4'-P energy: -25.828 tors. eta vs tors. theta energy: -12.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 68 Temperature: 1.221429 Total energy: -344.925884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.925884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.925884 (E_RNA) where: Base-Base interactions energy: -171.813 where: short stacking energy: -101.141 Base-Backbone interact. energy: 0.347 local terms energy: -173.460464 where: bonds (distance) C4'-P energy: -44.932 bonds (distance) P-C4' energy: -53.924 flat angles C4'-P-C4' energy: -43.972 flat angles P-C4'-P energy: -24.710 tors. eta vs tors. theta energy: -5.923 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 68 Temperature: 1.285714 Total energy: -256.556412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.556412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.556412 (E_RNA) where: Base-Base interactions energy: -91.695 where: short stacking energy: -94.523 Base-Backbone interact. energy: 0.772 local terms energy: -165.633158 where: bonds (distance) C4'-P energy: -54.462 bonds (distance) P-C4' energy: -52.011 flat angles C4'-P-C4' energy: -35.548 flat angles P-C4'-P energy: -25.606 tors. eta vs tors. theta energy: 1.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -202.395696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.395696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.395696 (E_RNA) where: Base-Base interactions energy: -65.969 where: short stacking energy: -56.967 Base-Backbone interact. energy: -0.834 local terms energy: -135.593361 where: bonds (distance) C4'-P energy: -43.899 bonds (distance) P-C4' energy: -42.898 flat angles C4'-P-C4' energy: -36.906 flat angles P-C4'-P energy: -25.456 tors. eta vs tors. theta energy: 13.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -688.679970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.679970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.679970 (E_RNA) where: Base-Base interactions energy: -434.897 where: short stacking energy: -231.498 Base-Backbone interact. energy: -0.635 local terms energy: -253.148364 where: bonds (distance) C4'-P energy: -62.713 bonds (distance) P-C4' energy: -55.219 flat angles C4'-P-C4' energy: -55.348 flat angles P-C4'-P energy: -28.008 tors. eta vs tors. theta energy: -51.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 69 Temperature: 0.964286 Total energy: -626.349195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.349195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.349195 (E_RNA) where: Base-Base interactions energy: -394.455 where: short stacking energy: -203.033 Base-Backbone interact. energy: -0.188 local terms energy: -231.706432 where: bonds (distance) C4'-P energy: -48.690 bonds (distance) P-C4' energy: -59.505 flat angles C4'-P-C4' energy: -60.525 flat angles P-C4'-P energy: -35.853 tors. eta vs tors. theta energy: -27.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 69 Temperature: 1.028571 Total energy: -528.582268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.582268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.582268 (E_RNA) where: Base-Base interactions energy: -281.285 where: short stacking energy: -202.087 Base-Backbone interact. energy: -0.812 local terms energy: -246.485493 where: bonds (distance) C4'-P energy: -56.340 bonds (distance) P-C4' energy: -51.523 flat angles C4'-P-C4' energy: -61.554 flat angles P-C4'-P energy: -27.367 tors. eta vs tors. theta energy: -49.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 69 Temperature: 1.092857 Total energy: -515.068113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.068113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.068113 (E_RNA) where: Base-Base interactions energy: -288.643 where: short stacking energy: -178.540 Base-Backbone interact. energy: 2.158 local terms energy: -228.583018 where: bonds (distance) C4'-P energy: -46.490 bonds (distance) P-C4' energy: -59.470 flat angles C4'-P-C4' energy: -53.756 flat angles P-C4'-P energy: -37.173 tors. eta vs tors. theta energy: -31.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 69 Temperature: 1.157143 Total energy: -380.361714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.361714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.361714 (E_RNA) where: Base-Base interactions energy: -181.740 where: short stacking energy: -124.454 Base-Backbone interact. energy: -0.841 local terms energy: -197.781102 where: bonds (distance) C4'-P energy: -48.805 bonds (distance) P-C4' energy: -55.482 flat angles C4'-P-C4' energy: -48.572 flat angles P-C4'-P energy: -30.861 tors. eta vs tors. theta energy: -14.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 69 Temperature: 1.221429 Total energy: -371.895095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.895095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.895095 (E_RNA) where: Base-Base interactions energy: -190.338 where: short stacking energy: -129.917 Base-Backbone interact. energy: -1.333 local terms energy: -180.223986 where: bonds (distance) C4'-P energy: -48.647 bonds (distance) P-C4' energy: -53.658 flat angles C4'-P-C4' energy: -44.863 flat angles P-C4'-P energy: -28.208 tors. eta vs tors. theta energy: -4.848 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 69 Temperature: 1.285714 Total energy: -266.383855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.383855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.383855 (E_RNA) where: Base-Base interactions energy: -113.261 where: short stacking energy: -100.118 Base-Backbone interact. energy: -0.249 local terms energy: -152.874244 where: bonds (distance) C4'-P energy: -36.469 bonds (distance) P-C4' energy: -41.588 flat angles C4'-P-C4' energy: -39.486 flat angles P-C4'-P energy: -29.272 tors. eta vs tors. theta energy: -6.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -218.839291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.839291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.839291 (E_RNA) where: Base-Base interactions energy: -62.613 where: short stacking energy: -48.883 Base-Backbone interact. energy: 0.521 local terms energy: -156.746969 where: bonds (distance) C4'-P energy: -46.071 bonds (distance) P-C4' energy: -50.465 flat angles C4'-P-C4' energy: -46.832 flat angles P-C4'-P energy: -27.930 tors. eta vs tors. theta energy: 14.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -699.181391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.181391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.181391 (E_RNA) where: Base-Base interactions energy: -442.102 where: short stacking energy: -248.519 Base-Backbone interact. energy: -0.311 local terms energy: -256.768423 where: bonds (distance) C4'-P energy: -46.135 bonds (distance) P-C4' energy: -53.469 flat angles C4'-P-C4' energy: -61.758 flat angles P-C4'-P energy: -41.795 tors. eta vs tors. theta energy: -53.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 70 Temperature: 0.964286 Total energy: -612.375040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.375040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -612.375040 (E_RNA) where: Base-Base interactions energy: -375.012 where: short stacking energy: -206.847 Base-Backbone interact. energy: -1.711 local terms energy: -235.651910 where: bonds (distance) C4'-P energy: -51.334 bonds (distance) P-C4' energy: -54.404 flat angles C4'-P-C4' energy: -48.286 flat angles P-C4'-P energy: -45.474 tors. eta vs tors. theta energy: -36.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 70 Temperature: 1.028571 Total energy: -517.050775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.050775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.050775 (E_RNA) where: Base-Base interactions energy: -280.411 where: short stacking energy: -198.582 Base-Backbone interact. energy: -1.041 local terms energy: -235.599159 where: bonds (distance) C4'-P energy: -40.049 bonds (distance) P-C4' energy: -63.853 flat angles C4'-P-C4' energy: -50.559 flat angles P-C4'-P energy: -29.795 tors. eta vs tors. theta energy: -51.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 70 Temperature: 1.092857 Total energy: -533.151905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.151905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.151905 (E_RNA) where: Base-Base interactions energy: -318.519 where: short stacking energy: -179.307 Base-Backbone interact. energy: 0.741 local terms energy: -215.373636 where: bonds (distance) C4'-P energy: -50.826 bonds (distance) P-C4' energy: -45.916 flat angles C4'-P-C4' energy: -57.874 flat angles P-C4'-P energy: -29.266 tors. eta vs tors. theta energy: -31.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 70 Temperature: 1.157143 Total energy: -385.315703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.315703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.315703 (E_RNA) where: Base-Base interactions energy: -181.204 where: short stacking energy: -125.510 Base-Backbone interact. energy: -1.618 local terms energy: -202.494104 where: bonds (distance) C4'-P energy: -53.088 bonds (distance) P-C4' energy: -54.101 flat angles C4'-P-C4' energy: -50.446 flat angles P-C4'-P energy: -31.555 tors. eta vs tors. theta energy: -13.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 70 Temperature: 1.221429 Total energy: -338.772337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.772337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.772337 (E_RNA) where: Base-Base interactions energy: -166.770 where: short stacking energy: -111.070 Base-Backbone interact. energy: -0.981 local terms energy: -171.020964 where: bonds (distance) C4'-P energy: -38.941 bonds (distance) P-C4' energy: -55.305 flat angles C4'-P-C4' energy: -41.423 flat angles P-C4'-P energy: -26.343 tors. eta vs tors. theta energy: -9.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 70 Temperature: 1.285714 Total energy: -244.560031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.560031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.560031 (E_RNA) where: Base-Base interactions energy: -104.494 where: short stacking energy: -75.031 Base-Backbone interact. energy: -0.365 local terms energy: -139.701306 where: bonds (distance) C4'-P energy: -39.185 bonds (distance) P-C4' energy: -48.651 flat angles C4'-P-C4' energy: -36.749 flat angles P-C4'-P energy: -26.903 tors. eta vs tors. theta energy: 11.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -230.486914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.486914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.486914 (E_RNA) where: Base-Base interactions energy: -83.586 where: short stacking energy: -72.016 Base-Backbone interact. energy: 0.833 local terms energy: -147.733829 where: bonds (distance) C4'-P energy: -48.317 bonds (distance) P-C4' energy: -53.384 flat angles C4'-P-C4' energy: -37.472 flat angles P-C4'-P energy: -17.856 tors. eta vs tors. theta energy: 9.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -693.322323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.322323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.322323 (E_RNA) where: Base-Base interactions energy: -429.057 where: short stacking energy: -223.609 Base-Backbone interact. energy: -0.116 local terms energy: -264.148755 where: bonds (distance) C4'-P energy: -47.606 bonds (distance) P-C4' energy: -59.371 flat angles C4'-P-C4' energy: -62.921 flat angles P-C4'-P energy: -40.648 tors. eta vs tors. theta energy: -53.603 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 71 Temperature: 0.964286 Total energy: -614.205909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.205909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.205909 (E_RNA) where: Base-Base interactions energy: -383.909 where: short stacking energy: -205.067 Base-Backbone interact. energy: -2.737 local terms energy: -227.560287 where: bonds (distance) C4'-P energy: -56.047 bonds (distance) P-C4' energy: -60.823 flat angles C4'-P-C4' energy: -40.966 flat angles P-C4'-P energy: -39.462 tors. eta vs tors. theta energy: -30.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 71 Temperature: 1.028571 Total energy: -538.157236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.157236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.157236 (E_RNA) where: Base-Base interactions energy: -311.443 where: short stacking energy: -204.524 Base-Backbone interact. energy: -1.271 local terms energy: -225.443584 where: bonds (distance) C4'-P energy: -44.342 bonds (distance) P-C4' energy: -55.444 flat angles C4'-P-C4' energy: -44.847 flat angles P-C4'-P energy: -37.685 tors. eta vs tors. theta energy: -43.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 71 Temperature: 1.092857 Total energy: -522.732430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.732430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.732430 (E_RNA) where: Base-Base interactions energy: -313.425 where: short stacking energy: -165.963 Base-Backbone interact. energy: 1.026 local terms energy: -210.333148 where: bonds (distance) C4'-P energy: -61.189 bonds (distance) P-C4' energy: -49.475 flat angles C4'-P-C4' energy: -46.578 flat angles P-C4'-P energy: -30.957 tors. eta vs tors. theta energy: -22.135 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 71 Temperature: 1.157143 Total energy: -400.502485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.502485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.502485 (E_RNA) where: Base-Base interactions energy: -204.708 where: short stacking energy: -129.854 Base-Backbone interact. energy: -1.556 local terms energy: -194.238567 where: bonds (distance) C4'-P energy: -45.222 bonds (distance) P-C4' energy: -55.759 flat angles C4'-P-C4' energy: -49.813 flat angles P-C4'-P energy: -26.156 tors. eta vs tors. theta energy: -17.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 71 Temperature: 1.221429 Total energy: -315.542679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.542679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.542679 (E_RNA) where: Base-Base interactions energy: -147.293 where: short stacking energy: -92.393 Base-Backbone interact. energy: -0.784 local terms energy: -167.466253 where: bonds (distance) C4'-P energy: -44.807 bonds (distance) P-C4' energy: -53.416 flat angles C4'-P-C4' energy: -41.089 flat angles P-C4'-P energy: -38.927 tors. eta vs tors. theta energy: 10.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 71 Temperature: 1.285714 Total energy: -252.761557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.761557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.761557 (E_RNA) where: Base-Base interactions energy: -97.575 where: short stacking energy: -89.829 Base-Backbone interact. energy: 0.237 local terms energy: -155.423644 where: bonds (distance) C4'-P energy: -49.798 bonds (distance) P-C4' energy: -55.863 flat angles C4'-P-C4' energy: -46.236 flat angles P-C4'-P energy: -9.481 tors. eta vs tors. theta energy: 5.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -224.713223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.713223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.713223 (E_RNA) where: Base-Base interactions energy: -89.467 where: short stacking energy: -76.295 Base-Backbone interact. energy: 1.940 local terms energy: -137.186239 where: bonds (distance) C4'-P energy: -55.124 bonds (distance) P-C4' energy: -41.930 flat angles C4'-P-C4' energy: -29.395 flat angles P-C4'-P energy: -21.900 tors. eta vs tors. theta energy: 11.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -712.287505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.287505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.287505 (E_RNA) where: Base-Base interactions energy: -433.310 where: short stacking energy: -225.201 Base-Backbone interact. energy: -1.352 local terms energy: -277.624976 where: bonds (distance) C4'-P energy: -66.860 bonds (distance) P-C4' energy: -54.473 flat angles C4'-P-C4' energy: -57.153 flat angles P-C4'-P energy: -43.940 tors. eta vs tors. theta energy: -55.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 72 Temperature: 0.964286 Total energy: -645.178679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.178679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.178679 (E_RNA) where: Base-Base interactions energy: -416.446 where: short stacking energy: -201.956 Base-Backbone interact. energy: -0.271 local terms energy: -228.461576 where: bonds (distance) C4'-P energy: -54.093 bonds (distance) P-C4' energy: -53.440 flat angles C4'-P-C4' energy: -54.563 flat angles P-C4'-P energy: -34.280 tors. eta vs tors. theta energy: -32.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 72 Temperature: 1.028571 Total energy: -547.036769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.036769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.036769 (E_RNA) where: Base-Base interactions energy: -310.752 where: short stacking energy: -175.647 Base-Backbone interact. energy: 0.933 local terms energy: -237.217238 where: bonds (distance) C4'-P energy: -55.298 bonds (distance) P-C4' energy: -56.228 flat angles C4'-P-C4' energy: -59.277 flat angles P-C4'-P energy: -37.588 tors. eta vs tors. theta energy: -28.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 72 Temperature: 1.092857 Total energy: -505.480152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.480152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.480152 (E_RNA) where: Base-Base interactions energy: -261.568 where: short stacking energy: -166.317 Base-Backbone interact. energy: 0.119 local terms energy: -244.031663 where: bonds (distance) C4'-P energy: -42.595 bonds (distance) P-C4' energy: -63.202 flat angles C4'-P-C4' energy: -58.036 flat angles P-C4'-P energy: -37.310 tors. eta vs tors. theta energy: -42.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 72 Temperature: 1.157143 Total energy: -389.612375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.612375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.612375 (E_RNA) where: Base-Base interactions energy: -193.137 where: short stacking energy: -117.203 Base-Backbone interact. energy: 2.534 local terms energy: -199.010264 where: bonds (distance) C4'-P energy: -53.572 bonds (distance) P-C4' energy: -47.816 flat angles C4'-P-C4' energy: -47.863 flat angles P-C4'-P energy: -32.366 tors. eta vs tors. theta energy: -17.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 72 Temperature: 1.221429 Total energy: -355.754961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.754961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.754961 (E_RNA) where: Base-Base interactions energy: -168.259 where: short stacking energy: -136.651 Base-Backbone interact. energy: -0.462 local terms energy: -187.033579 where: bonds (distance) C4'-P energy: -42.882 bonds (distance) P-C4' energy: -55.608 flat angles C4'-P-C4' energy: -42.551 flat angles P-C4'-P energy: -30.675 tors. eta vs tors. theta energy: -15.318 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 72 Temperature: 1.285714 Total energy: -256.111653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.111653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.111653 (E_RNA) where: Base-Base interactions energy: -71.126 where: short stacking energy: -65.337 Base-Backbone interact. energy: -0.773 local terms energy: -184.213200 where: bonds (distance) C4'-P energy: -50.938 bonds (distance) P-C4' energy: -61.441 flat angles C4'-P-C4' energy: -57.343 flat angles P-C4'-P energy: -24.298 tors. eta vs tors. theta energy: 9.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -244.472621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.472621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.472621 (E_RNA) where: Base-Base interactions energy: -97.626 where: short stacking energy: -78.702 Base-Backbone interact. energy: -2.091 local terms energy: -144.756127 where: bonds (distance) C4'-P energy: -45.360 bonds (distance) P-C4' energy: -52.069 flat angles C4'-P-C4' energy: -38.585 flat angles P-C4'-P energy: -18.081 tors. eta vs tors. theta energy: 9.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -707.543078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.543078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.543078 (E_RNA) where: Base-Base interactions energy: -429.517 where: short stacking energy: -213.235 Base-Backbone interact. energy: -1.365 local terms energy: -276.661176 where: bonds (distance) C4'-P energy: -55.602 bonds (distance) P-C4' energy: -58.129 flat angles C4'-P-C4' energy: -60.600 flat angles P-C4'-P energy: -44.047 tors. eta vs tors. theta energy: -58.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 73 Temperature: 0.964286 Total energy: -648.489083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.489083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.489083 (E_RNA) where: Base-Base interactions energy: -436.343 where: short stacking energy: -190.095 Base-Backbone interact. energy: -1.912 local terms energy: -210.233687 where: bonds (distance) C4'-P energy: -51.886 bonds (distance) P-C4' energy: -61.247 flat angles C4'-P-C4' energy: -43.119 flat angles P-C4'-P energy: -28.728 tors. eta vs tors. theta energy: -25.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 73 Temperature: 1.028571 Total energy: -522.557812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.557812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.557812 (E_RNA) where: Base-Base interactions energy: -309.330 where: short stacking energy: -160.717 Base-Backbone interact. energy: -0.185 local terms energy: -213.042924 where: bonds (distance) C4'-P energy: -45.359 bonds (distance) P-C4' energy: -60.122 flat angles C4'-P-C4' energy: -54.905 flat angles P-C4'-P energy: -28.075 tors. eta vs tors. theta energy: -24.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 73 Temperature: 1.092857 Total energy: -495.945959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.945959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.945959 (E_RNA) where: Base-Base interactions energy: -263.806 where: short stacking energy: -180.275 Base-Backbone interact. energy: -1.158 local terms energy: -230.981791 where: bonds (distance) C4'-P energy: -50.925 bonds (distance) P-C4' energy: -62.788 flat angles C4'-P-C4' energy: -40.936 flat angles P-C4'-P energy: -30.209 tors. eta vs tors. theta energy: -46.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 73 Temperature: 1.157143 Total energy: -379.429716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.429716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.429716 (E_RNA) where: Base-Base interactions energy: -185.770 where: short stacking energy: -125.716 Base-Backbone interact. energy: 1.133 local terms energy: -194.793287 where: bonds (distance) C4'-P energy: -53.479 bonds (distance) P-C4' energy: -52.655 flat angles C4'-P-C4' energy: -45.032 flat angles P-C4'-P energy: -37.086 tors. eta vs tors. theta energy: -6.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 73 Temperature: 1.221429 Total energy: -365.265066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.265066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.265066 (E_RNA) where: Base-Base interactions energy: -177.069 where: short stacking energy: -133.875 Base-Backbone interact. energy: -1.049 local terms energy: -187.147557 where: bonds (distance) C4'-P energy: -45.456 bonds (distance) P-C4' energy: -57.758 flat angles C4'-P-C4' energy: -41.194 flat angles P-C4'-P energy: -29.699 tors. eta vs tors. theta energy: -13.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 73 Temperature: 1.285714 Total energy: -251.798831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.798831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.798831 (E_RNA) where: Base-Base interactions energy: -80.645 where: short stacking energy: -70.590 Base-Backbone interact. energy: 3.549 local terms energy: -174.702654 where: bonds (distance) C4'-P energy: -47.875 bonds (distance) P-C4' energy: -59.960 flat angles C4'-P-C4' energy: -47.374 flat angles P-C4'-P energy: -23.467 tors. eta vs tors. theta energy: 3.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -270.927857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.927857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.927857 (E_RNA) where: Base-Base interactions energy: -103.350 where: short stacking energy: -94.499 Base-Backbone interact. energy: 2.291 local terms energy: -169.868856 where: bonds (distance) C4'-P energy: -43.854 bonds (distance) P-C4' energy: -53.731 flat angles C4'-P-C4' energy: -47.241 flat angles P-C4'-P energy: -25.886 tors. eta vs tors. theta energy: 0.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -763.169870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.169870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.169870 (E_RNA) where: Base-Base interactions energy: -484.894 where: short stacking energy: -262.790 Base-Backbone interact. energy: -0.699 local terms energy: -277.577355 where: bonds (distance) C4'-P energy: -59.166 bonds (distance) P-C4' energy: -60.197 flat angles C4'-P-C4' energy: -58.252 flat angles P-C4'-P energy: -36.643 tors. eta vs tors. theta energy: -63.320 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 74 Temperature: 0.964286 Total energy: -680.034514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.034514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.034514 (E_RNA) where: Base-Base interactions energy: -444.222 where: short stacking energy: -196.612 Base-Backbone interact. energy: -1.912 local terms energy: -233.899803 where: bonds (distance) C4'-P energy: -54.397 bonds (distance) P-C4' energy: -60.586 flat angles C4'-P-C4' energy: -51.138 flat angles P-C4'-P energy: -33.687 tors. eta vs tors. theta energy: -34.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 74 Temperature: 1.028571 Total energy: -537.975905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.975905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.975905 (E_RNA) where: Base-Base interactions energy: -299.966 where: short stacking energy: -180.094 Base-Backbone interact. energy: -1.810 local terms energy: -236.199583 where: bonds (distance) C4'-P energy: -61.607 bonds (distance) P-C4' energy: -51.774 flat angles C4'-P-C4' energy: -48.207 flat angles P-C4'-P energy: -33.100 tors. eta vs tors. theta energy: -41.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 74 Temperature: 1.092857 Total energy: -457.911573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.911573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.911573 (E_RNA) where: Base-Base interactions energy: -230.559 where: short stacking energy: -152.346 Base-Backbone interact. energy: 0.918 local terms energy: -228.270686 where: bonds (distance) C4'-P energy: -50.071 bonds (distance) P-C4' energy: -55.394 flat angles C4'-P-C4' energy: -57.806 flat angles P-C4'-P energy: -33.532 tors. eta vs tors. theta energy: -31.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 74 Temperature: 1.157143 Total energy: -385.477226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.477226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.477226 (E_RNA) where: Base-Base interactions energy: -191.292 where: short stacking energy: -137.802 Base-Backbone interact. energy: -2.123 local terms energy: -192.062849 where: bonds (distance) C4'-P energy: -53.822 bonds (distance) P-C4' energy: -55.099 flat angles C4'-P-C4' energy: -43.188 flat angles P-C4'-P energy: -26.020 tors. eta vs tors. theta energy: -13.935 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 74 Temperature: 1.221429 Total energy: -367.619543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.619543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.619543 (E_RNA) where: Base-Base interactions energy: -153.930 where: short stacking energy: -122.407 Base-Backbone interact. energy: 1.674 local terms energy: -215.362839 where: bonds (distance) C4'-P energy: -52.921 bonds (distance) P-C4' energy: -53.190 flat angles C4'-P-C4' energy: -47.120 flat angles P-C4'-P energy: -40.657 tors. eta vs tors. theta energy: -21.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 74 Temperature: 1.285714 Total energy: -264.306581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.306581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.306581 (E_RNA) where: Base-Base interactions energy: -101.871 where: short stacking energy: -90.890 Base-Backbone interact. energy: 0.826 local terms energy: -163.261031 where: bonds (distance) C4'-P energy: -48.637 bonds (distance) P-C4' energy: -39.443 flat angles C4'-P-C4' energy: -44.511 flat angles P-C4'-P energy: -22.853 tors. eta vs tors. theta energy: -7.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -255.231638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.231638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.231638 (E_RNA) where: Base-Base interactions energy: -95.697 where: short stacking energy: -81.768 Base-Backbone interact. energy: 1.317 local terms energy: -160.852224 where: bonds (distance) C4'-P energy: -50.871 bonds (distance) P-C4' energy: -46.670 flat angles C4'-P-C4' energy: -36.872 flat angles P-C4'-P energy: -30.877 tors. eta vs tors. theta energy: 4.438 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -768.252150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.252150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.252150 (E_RNA) where: Base-Base interactions energy: -494.919 where: short stacking energy: -255.343 Base-Backbone interact. energy: -0.829 local terms energy: -272.504529 where: bonds (distance) C4'-P energy: -49.541 bonds (distance) P-C4' energy: -58.918 flat angles C4'-P-C4' energy: -63.954 flat angles P-C4'-P energy: -35.361 tors. eta vs tors. theta energy: -64.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 75 Temperature: 0.964286 Total energy: -715.830629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.830629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.830629 (E_RNA) where: Base-Base interactions energy: -468.771 where: short stacking energy: -226.028 Base-Backbone interact. energy: -0.054 local terms energy: -247.005660 where: bonds (distance) C4'-P energy: -59.410 bonds (distance) P-C4' energy: -48.115 flat angles C4'-P-C4' energy: -53.278 flat angles P-C4'-P energy: -44.022 tors. eta vs tors. theta energy: -42.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 75 Temperature: 1.028571 Total energy: -543.881466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.881466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.881466 (E_RNA) where: Base-Base interactions energy: -304.184 where: short stacking energy: -172.774 Base-Backbone interact. energy: -1.364 local terms energy: -238.334147 where: bonds (distance) C4'-P energy: -58.526 bonds (distance) P-C4' energy: -50.570 flat angles C4'-P-C4' energy: -58.146 flat angles P-C4'-P energy: -34.796 tors. eta vs tors. theta energy: -36.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 75 Temperature: 1.092857 Total energy: -463.423027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.423027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.423027 (E_RNA) where: Base-Base interactions energy: -255.726 where: short stacking energy: -167.033 Base-Backbone interact. energy: -0.483 local terms energy: -207.213127 where: bonds (distance) C4'-P energy: -56.041 bonds (distance) P-C4' energy: -47.419 flat angles C4'-P-C4' energy: -48.552 flat angles P-C4'-P energy: -28.469 tors. eta vs tors. theta energy: -26.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 75 Temperature: 1.157143 Total energy: -370.545909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.545909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.545909 (E_RNA) where: Base-Base interactions energy: -178.099 where: short stacking energy: -120.957 Base-Backbone interact. energy: 0.101 local terms energy: -192.547269 where: bonds (distance) C4'-P energy: -46.728 bonds (distance) P-C4' energy: -53.561 flat angles C4'-P-C4' energy: -51.628 flat angles P-C4'-P energy: -33.221 tors. eta vs tors. theta energy: -7.410 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 75 Temperature: 1.221429 Total energy: -317.392324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.392324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.392324 (E_RNA) where: Base-Base interactions energy: -144.749 where: short stacking energy: -110.221 Base-Backbone interact. energy: -0.897 local terms energy: -171.746003 where: bonds (distance) C4'-P energy: -41.992 bonds (distance) P-C4' energy: -56.071 flat angles C4'-P-C4' energy: -49.441 flat angles P-C4'-P energy: -22.352 tors. eta vs tors. theta energy: -1.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 75 Temperature: 1.285714 Total energy: -266.843306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.843306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.843306 (E_RNA) where: Base-Base interactions energy: -95.805 where: short stacking energy: -85.806 Base-Backbone interact. energy: 0.467 local terms energy: -171.505130 where: bonds (distance) C4'-P energy: -39.156 bonds (distance) P-C4' energy: -47.561 flat angles C4'-P-C4' energy: -53.467 flat angles P-C4'-P energy: -29.758 tors. eta vs tors. theta energy: -1.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -213.657927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.657927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.657927 (E_RNA) where: Base-Base interactions energy: -96.725 where: short stacking energy: -73.922 Base-Backbone interact. energy: -1.120 local terms energy: -115.813074 where: bonds (distance) C4'-P energy: -38.116 bonds (distance) P-C4' energy: -39.755 flat angles C4'-P-C4' energy: -32.509 flat angles P-C4'-P energy: -18.940 tors. eta vs tors. theta energy: 13.507 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -778.505375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.505375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.505375 (E_RNA) where: Base-Base interactions energy: -500.089 where: short stacking energy: -253.519 Base-Backbone interact. energy: -0.538 local terms energy: -277.878769 where: bonds (distance) C4'-P energy: -63.627 bonds (distance) P-C4' energy: -55.112 flat angles C4'-P-C4' energy: -58.656 flat angles P-C4'-P energy: -39.327 tors. eta vs tors. theta energy: -61.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 76 Temperature: 0.964286 Total energy: -733.238196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -733.238196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -733.238196 (E_RNA) where: Base-Base interactions energy: -500.778 where: short stacking energy: -237.257 Base-Backbone interact. energy: 0.766 local terms energy: -233.226403 where: bonds (distance) C4'-P energy: -46.142 bonds (distance) P-C4' energy: -54.104 flat angles C4'-P-C4' energy: -54.731 flat angles P-C4'-P energy: -34.172 tors. eta vs tors. theta energy: -44.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 76 Temperature: 1.028571 Total energy: -583.937105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.937105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.937105 (E_RNA) where: Base-Base interactions energy: -339.085 where: short stacking energy: -187.889 Base-Backbone interact. energy: -2.168 local terms energy: -242.684263 where: bonds (distance) C4'-P energy: -59.626 bonds (distance) P-C4' energy: -58.091 flat angles C4'-P-C4' energy: -61.905 flat angles P-C4'-P energy: -31.493 tors. eta vs tors. theta energy: -31.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 76 Temperature: 1.092857 Total energy: -468.090865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.090865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.090865 (E_RNA) where: Base-Base interactions energy: -253.935 where: short stacking energy: -158.350 Base-Backbone interact. energy: -1.497 local terms energy: -212.658176 where: bonds (distance) C4'-P energy: -51.584 bonds (distance) P-C4' energy: -54.554 flat angles C4'-P-C4' energy: -55.615 flat angles P-C4'-P energy: -28.283 tors. eta vs tors. theta energy: -22.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 76 Temperature: 1.157143 Total energy: -337.209739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.209739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.209739 (E_RNA) where: Base-Base interactions energy: -148.340 where: short stacking energy: -100.374 Base-Backbone interact. energy: -0.854 local terms energy: -188.015526 where: bonds (distance) C4'-P energy: -49.719 bonds (distance) P-C4' energy: -53.360 flat angles C4'-P-C4' energy: -34.333 flat angles P-C4'-P energy: -37.244 tors. eta vs tors. theta energy: -13.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 76 Temperature: 1.221429 Total energy: -295.284794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.284794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.284794 (E_RNA) where: Base-Base interactions energy: -124.374 where: short stacking energy: -69.370 Base-Backbone interact. energy: 1.049 local terms energy: -171.959797 where: bonds (distance) C4'-P energy: -54.073 bonds (distance) P-C4' energy: -53.515 flat angles C4'-P-C4' energy: -43.613 flat angles P-C4'-P energy: -26.130 tors. eta vs tors. theta energy: 5.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 76 Temperature: 1.285714 Total energy: -241.582990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.582990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.582990 (E_RNA) where: Base-Base interactions energy: -107.711 where: short stacking energy: -76.701 Base-Backbone interact. energy: 4.490 local terms energy: -138.361492 where: bonds (distance) C4'-P energy: -53.449 bonds (distance) P-C4' energy: -47.021 flat angles C4'-P-C4' energy: -27.519 flat angles P-C4'-P energy: -23.895 tors. eta vs tors. theta energy: 13.523 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -213.000150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.000150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.000150 (E_RNA) where: Base-Base interactions energy: -81.148 where: short stacking energy: -60.785 Base-Backbone interact. energy: -1.502 local terms energy: -130.350117 where: bonds (distance) C4'-P energy: -48.814 bonds (distance) P-C4' energy: -47.024 flat angles C4'-P-C4' energy: -31.615 flat angles P-C4'-P energy: -26.910 tors. eta vs tors. theta energy: 24.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -780.722663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -780.722663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.722663 (E_RNA) where: Base-Base interactions energy: -517.100 where: short stacking energy: -265.276 Base-Backbone interact. energy: -2.201 local terms energy: -261.422205 where: bonds (distance) C4'-P energy: -51.431 bonds (distance) P-C4' energy: -50.533 flat angles C4'-P-C4' energy: -61.683 flat angles P-C4'-P energy: -36.673 tors. eta vs tors. theta energy: -61.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 77 Temperature: 0.964286 Total energy: -715.786387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.786387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.786387 (E_RNA) where: Base-Base interactions energy: -476.235 where: short stacking energy: -224.462 Base-Backbone interact. energy: -1.326 local terms energy: -238.225121 where: bonds (distance) C4'-P energy: -40.464 bonds (distance) P-C4' energy: -55.877 flat angles C4'-P-C4' energy: -60.867 flat angles P-C4'-P energy: -40.727 tors. eta vs tors. theta energy: -40.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 77 Temperature: 1.028571 Total energy: -534.287857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.287857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.287857 (E_RNA) where: Base-Base interactions energy: -309.883 where: short stacking energy: -174.962 Base-Backbone interact. energy: -0.514 local terms energy: -223.890760 where: bonds (distance) C4'-P energy: -54.317 bonds (distance) P-C4' energy: -52.581 flat angles C4'-P-C4' energy: -50.015 flat angles P-C4'-P energy: -30.848 tors. eta vs tors. theta energy: -36.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 77 Temperature: 1.092857 Total energy: -448.445935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.445935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.445935 (E_RNA) where: Base-Base interactions energy: -237.263 where: short stacking energy: -138.524 Base-Backbone interact. energy: -2.113 local terms energy: -209.069676 where: bonds (distance) C4'-P energy: -49.087 bonds (distance) P-C4' energy: -55.012 flat angles C4'-P-C4' energy: -60.419 flat angles P-C4'-P energy: -30.229 tors. eta vs tors. theta energy: -14.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 77 Temperature: 1.157143 Total energy: -358.395468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.395468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.395468 (E_RNA) where: Base-Base interactions energy: -155.253 where: short stacking energy: -97.187 Base-Backbone interact. energy: -1.862 local terms energy: -201.279734 where: bonds (distance) C4'-P energy: -50.873 bonds (distance) P-C4' energy: -56.618 flat angles C4'-P-C4' energy: -46.334 flat angles P-C4'-P energy: -43.106 tors. eta vs tors. theta energy: -4.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 77 Temperature: 1.221429 Total energy: -265.074033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.074033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.074033 (E_RNA) where: Base-Base interactions energy: -79.030 where: short stacking energy: -69.838 Base-Backbone interact. energy: -1.169 local terms energy: -184.874998 where: bonds (distance) C4'-P energy: -58.535 bonds (distance) P-C4' energy: -53.898 flat angles C4'-P-C4' energy: -39.962 flat angles P-C4'-P energy: -41.993 tors. eta vs tors. theta energy: 9.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 77 Temperature: 1.285714 Total energy: -274.166876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.166876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.166876 (E_RNA) where: Base-Base interactions energy: -109.876 where: short stacking energy: -87.640 Base-Backbone interact. energy: 3.005 local terms energy: -167.294960 where: bonds (distance) C4'-P energy: -48.291 bonds (distance) P-C4' energy: -49.065 flat angles C4'-P-C4' energy: -41.467 flat angles P-C4'-P energy: -20.082 tors. eta vs tors. theta energy: -8.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -261.683777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.683777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.683777 (E_RNA) where: Base-Base interactions energy: -110.494 where: short stacking energy: -70.003 Base-Backbone interact. energy: -2.392 local terms energy: -148.797885 where: bonds (distance) C4'-P energy: -37.484 bonds (distance) P-C4' energy: -53.827 flat angles C4'-P-C4' energy: -41.222 flat angles P-C4'-P energy: -24.157 tors. eta vs tors. theta energy: 7.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -756.778767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.778767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.778767 (E_RNA) where: Base-Base interactions energy: -473.960 where: short stacking energy: -227.822 Base-Backbone interact. energy: 1.199 local terms energy: -284.017603 where: bonds (distance) C4'-P energy: -61.318 bonds (distance) P-C4' energy: -64.652 flat angles C4'-P-C4' energy: -62.806 flat angles P-C4'-P energy: -42.072 tors. eta vs tors. theta energy: -53.170 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 78 Temperature: 0.964286 Total energy: -732.433264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.433264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.433264 (E_RNA) where: Base-Base interactions energy: -476.893 where: short stacking energy: -222.512 Base-Backbone interact. energy: -0.596 local terms energy: -254.944371 where: bonds (distance) C4'-P energy: -56.865 bonds (distance) P-C4' energy: -53.356 flat angles C4'-P-C4' energy: -68.089 flat angles P-C4'-P energy: -31.216 tors. eta vs tors. theta energy: -45.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 78 Temperature: 1.028571 Total energy: -553.599758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.599758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.599758 (E_RNA) where: Base-Base interactions energy: -317.003 where: short stacking energy: -188.544 Base-Backbone interact. energy: -0.745 local terms energy: -235.852407 where: bonds (distance) C4'-P energy: -55.485 bonds (distance) P-C4' energy: -60.593 flat angles C4'-P-C4' energy: -45.660 flat angles P-C4'-P energy: -30.759 tors. eta vs tors. theta energy: -43.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 78 Temperature: 1.092857 Total energy: -456.152976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.152976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.152976 (E_RNA) where: Base-Base interactions energy: -234.834 where: short stacking energy: -159.456 Base-Backbone interact. energy: -1.304 local terms energy: -220.014920 where: bonds (distance) C4'-P energy: -42.280 bonds (distance) P-C4' energy: -58.774 flat angles C4'-P-C4' energy: -55.337 flat angles P-C4'-P energy: -30.949 tors. eta vs tors. theta energy: -32.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 78 Temperature: 1.157143 Total energy: -364.150385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.150385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.150385 (E_RNA) where: Base-Base interactions energy: -178.979 where: short stacking energy: -135.013 Base-Backbone interact. energy: -0.393 local terms energy: -184.778481 where: bonds (distance) C4'-P energy: -60.987 bonds (distance) P-C4' energy: -46.195 flat angles C4'-P-C4' energy: -40.341 flat angles P-C4'-P energy: -29.379 tors. eta vs tors. theta energy: -7.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 78 Temperature: 1.221429 Total energy: -256.173038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.173038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.173038 (E_RNA) where: Base-Base interactions energy: -116.980 where: short stacking energy: -99.606 Base-Backbone interact. energy: -0.835 local terms energy: -138.358152 where: bonds (distance) C4'-P energy: -35.934 bonds (distance) P-C4' energy: -42.254 flat angles C4'-P-C4' energy: -31.635 flat angles P-C4'-P energy: -27.524 tors. eta vs tors. theta energy: -1.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 78 Temperature: 1.285714 Total energy: -297.851254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.851254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.851254 (E_RNA) where: Base-Base interactions energy: -133.682 where: short stacking energy: -84.518 Base-Backbone interact. energy: -2.181 local terms energy: -161.988136 where: bonds (distance) C4'-P energy: -48.574 bonds (distance) P-C4' energy: -51.415 flat angles C4'-P-C4' energy: -40.043 flat angles P-C4'-P energy: -25.708 tors. eta vs tors. theta energy: 3.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -224.890950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.890950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.890950 (E_RNA) where: Base-Base interactions energy: -86.818 where: short stacking energy: -74.055 Base-Backbone interact. energy: -0.330 local terms energy: -137.742467 where: bonds (distance) C4'-P energy: -49.545 bonds (distance) P-C4' energy: -37.396 flat angles C4'-P-C4' energy: -33.789 flat angles P-C4'-P energy: -27.961 tors. eta vs tors. theta energy: 10.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -774.981804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -774.981804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.981804 (E_RNA) where: Base-Base interactions energy: -503.547 where: short stacking energy: -233.483 Base-Backbone interact. energy: -0.344 local terms energy: -271.090010 where: bonds (distance) C4'-P energy: -51.521 bonds (distance) P-C4' energy: -52.134 flat angles C4'-P-C4' energy: -68.640 flat angles P-C4'-P energy: -41.576 tors. eta vs tors. theta energy: -57.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 79 Temperature: 0.964286 Total energy: -738.639269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.639269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.639269 (E_RNA) where: Base-Base interactions energy: -500.315 where: short stacking energy: -233.581 Base-Backbone interact. energy: -1.150 local terms energy: -237.173941 where: bonds (distance) C4'-P energy: -52.936 bonds (distance) P-C4' energy: -56.308 flat angles C4'-P-C4' energy: -52.321 flat angles P-C4'-P energy: -35.967 tors. eta vs tors. theta energy: -39.642 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 79 Temperature: 1.028571 Total energy: -577.408931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.408931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.408931 (E_RNA) where: Base-Base interactions energy: -337.985 where: short stacking energy: -200.953 Base-Backbone interact. energy: 0.908 local terms energy: -240.331952 where: bonds (distance) C4'-P energy: -54.352 bonds (distance) P-C4' energy: -55.720 flat angles C4'-P-C4' energy: -56.317 flat angles P-C4'-P energy: -34.255 tors. eta vs tors. theta energy: -39.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 79 Temperature: 1.092857 Total energy: -418.892138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.892138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.892138 (E_RNA) where: Base-Base interactions energy: -208.374 where: short stacking energy: -145.197 Base-Backbone interact. energy: -1.568 local terms energy: -208.949892 where: bonds (distance) C4'-P energy: -44.614 bonds (distance) P-C4' energy: -60.928 flat angles C4'-P-C4' energy: -46.102 flat angles P-C4'-P energy: -31.573 tors. eta vs tors. theta energy: -25.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 79 Temperature: 1.157143 Total energy: -398.309751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.309751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.309751 (E_RNA) where: Base-Base interactions energy: -197.194 where: short stacking energy: -139.552 Base-Backbone interact. energy: -0.743 local terms energy: -200.372892 where: bonds (distance) C4'-P energy: -47.110 bonds (distance) P-C4' energy: -52.984 flat angles C4'-P-C4' energy: -52.453 flat angles P-C4'-P energy: -32.333 tors. eta vs tors. theta energy: -15.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 79 Temperature: 1.221429 Total energy: -305.411121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.411121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.411121 (E_RNA) where: Base-Base interactions energy: -142.319 where: short stacking energy: -109.543 Base-Backbone interact. energy: -1.135 local terms energy: -161.957164 where: bonds (distance) C4'-P energy: -31.355 bonds (distance) P-C4' energy: -49.765 flat angles C4'-P-C4' energy: -42.971 flat angles P-C4'-P energy: -30.164 tors. eta vs tors. theta energy: -7.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 79 Temperature: 1.285714 Total energy: -246.619226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.619226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.619226 (E_RNA) where: Base-Base interactions energy: -95.220 where: short stacking energy: -74.955 Base-Backbone interact. energy: -1.409 local terms energy: -149.990294 where: bonds (distance) C4'-P energy: -52.696 bonds (distance) P-C4' energy: -53.581 flat angles C4'-P-C4' energy: -17.084 flat angles P-C4'-P energy: -34.578 tors. eta vs tors. theta energy: 7.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -228.875495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.875495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.875495 (E_RNA) where: Base-Base interactions energy: -89.379 where: short stacking energy: -72.700 Base-Backbone interact. energy: 3.298 local terms energy: -142.794259 where: bonds (distance) C4'-P energy: -46.909 bonds (distance) P-C4' energy: -45.740 flat angles C4'-P-C4' energy: -37.255 flat angles P-C4'-P energy: -20.119 tors. eta vs tors. theta energy: 7.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -769.994282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.994282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.994282 (E_RNA) where: Base-Base interactions energy: -492.809 where: short stacking energy: -238.497 Base-Backbone interact. energy: -1.186 local terms energy: -275.999810 where: bonds (distance) C4'-P energy: -61.872 bonds (distance) P-C4' energy: -61.435 flat angles C4'-P-C4' energy: -63.643 flat angles P-C4'-P energy: -39.579 tors. eta vs tors. theta energy: -49.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 80 Temperature: 0.964286 Total energy: -716.982202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.982202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.982202 (E_RNA) where: Base-Base interactions energy: -482.166 where: short stacking energy: -229.816 Base-Backbone interact. energy: -1.093 local terms energy: -233.723072 where: bonds (distance) C4'-P energy: -56.466 bonds (distance) P-C4' energy: -56.822 flat angles C4'-P-C4' energy: -56.650 flat angles P-C4'-P energy: -26.187 tors. eta vs tors. theta energy: -37.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 80 Temperature: 1.028571 Total energy: -579.583432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.583432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.583432 (E_RNA) where: Base-Base interactions energy: -333.389 where: short stacking energy: -197.455 Base-Backbone interact. energy: 0.553 local terms energy: -246.747212 where: bonds (distance) C4'-P energy: -54.545 bonds (distance) P-C4' energy: -57.174 flat angles C4'-P-C4' energy: -60.851 flat angles P-C4'-P energy: -37.681 tors. eta vs tors. theta energy: -36.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 80 Temperature: 1.092857 Total energy: -443.274712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.274712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.274712 (E_RNA) where: Base-Base interactions energy: -226.011 where: short stacking energy: -152.121 Base-Backbone interact. energy: 0.171 local terms energy: -217.434621 where: bonds (distance) C4'-P energy: -46.108 bonds (distance) P-C4' energy: -60.070 flat angles C4'-P-C4' energy: -50.244 flat angles P-C4'-P energy: -32.496 tors. eta vs tors. theta energy: -28.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 80 Temperature: 1.157143 Total energy: -356.020721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.020721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.020721 (E_RNA) where: Base-Base interactions energy: -166.824 where: short stacking energy: -113.114 Base-Backbone interact. energy: 0.038 local terms energy: -189.235067 where: bonds (distance) C4'-P energy: -44.934 bonds (distance) P-C4' energy: -52.126 flat angles C4'-P-C4' energy: -58.431 flat angles P-C4'-P energy: -19.530 tors. eta vs tors. theta energy: -14.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 80 Temperature: 1.221429 Total energy: -308.008135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.008135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.008135 (E_RNA) where: Base-Base interactions energy: -133.848 where: short stacking energy: -73.722 Base-Backbone interact. energy: -1.628 local terms energy: -172.531411 where: bonds (distance) C4'-P energy: -51.050 bonds (distance) P-C4' energy: -61.804 flat angles C4'-P-C4' energy: -52.544 flat angles P-C4'-P energy: -21.014 tors. eta vs tors. theta energy: 13.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 80 Temperature: 1.285714 Total energy: -277.412747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.412747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.412747 (E_RNA) where: Base-Base interactions energy: -100.145 where: short stacking energy: -101.345 Base-Backbone interact. energy: 0.337 local terms energy: -177.605609 where: bonds (distance) C4'-P energy: -54.996 bonds (distance) P-C4' energy: -50.142 flat angles C4'-P-C4' energy: -38.996 flat angles P-C4'-P energy: -27.396 tors. eta vs tors. theta energy: -6.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -216.719417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.719417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.719417 (E_RNA) where: Base-Base interactions energy: -64.692 where: short stacking energy: -53.194 Base-Backbone interact. energy: -0.952 local terms energy: -152.443411 where: bonds (distance) C4'-P energy: -42.793 bonds (distance) P-C4' energy: -54.437 flat angles C4'-P-C4' energy: -43.038 flat angles P-C4'-P energy: -25.428 tors. eta vs tors. theta energy: 13.253 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.369 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -776.815279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.815279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.815279 (E_RNA) where: Base-Base interactions energy: -512.528 where: short stacking energy: -249.256 Base-Backbone interact. energy: -1.250 local terms energy: -263.037526 where: bonds (distance) C4'-P energy: -57.796 bonds (distance) P-C4' energy: -48.315 flat angles C4'-P-C4' energy: -59.230 flat angles P-C4'-P energy: -40.410 tors. eta vs tors. theta energy: -57.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 81 Temperature: 0.964286 Total energy: -705.530201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.530201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.530201 (E_RNA) where: Base-Base interactions energy: -474.376 where: short stacking energy: -227.528 Base-Backbone interact. energy: -0.160 local terms energy: -230.994120 where: bonds (distance) C4'-P energy: -57.726 bonds (distance) P-C4' energy: -58.136 flat angles C4'-P-C4' energy: -46.283 flat angles P-C4'-P energy: -29.814 tors. eta vs tors. theta energy: -39.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 81 Temperature: 1.028571 Total energy: -570.443958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.443958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.443958 (E_RNA) where: Base-Base interactions energy: -334.333 where: short stacking energy: -205.493 Base-Backbone interact. energy: 1.395 local terms energy: -237.505941 where: bonds (distance) C4'-P energy: -58.170 bonds (distance) P-C4' energy: -50.100 flat angles C4'-P-C4' energy: -48.631 flat angles P-C4'-P energy: -35.793 tors. eta vs tors. theta energy: -44.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 81 Temperature: 1.092857 Total energy: -462.460456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.460456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.460456 (E_RNA) where: Base-Base interactions energy: -245.827 where: short stacking energy: -165.380 Base-Backbone interact. energy: 2.989 local terms energy: -219.622296 where: bonds (distance) C4'-P energy: -52.647 bonds (distance) P-C4' energy: -54.132 flat angles C4'-P-C4' energy: -50.755 flat angles P-C4'-P energy: -24.601 tors. eta vs tors. theta energy: -37.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 81 Temperature: 1.157143 Total energy: -312.965604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.965604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.965604 (E_RNA) where: Base-Base interactions energy: -144.638 where: short stacking energy: -101.118 Base-Backbone interact. energy: -0.222 local terms energy: -168.105956 where: bonds (distance) C4'-P energy: -46.330 bonds (distance) P-C4' energy: -47.518 flat angles C4'-P-C4' energy: -42.577 flat angles P-C4'-P energy: -37.221 tors. eta vs tors. theta energy: 5.540 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 81 Temperature: 1.221429 Total energy: -262.859622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.859622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.859622 (E_RNA) where: Base-Base interactions energy: -88.490 where: short stacking energy: -80.383 Base-Backbone interact. energy: 1.841 local terms energy: -176.210772 where: bonds (distance) C4'-P energy: -51.718 bonds (distance) P-C4' energy: -55.841 flat angles C4'-P-C4' energy: -34.529 flat angles P-C4'-P energy: -31.729 tors. eta vs tors. theta energy: -2.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 81 Temperature: 1.285714 Total energy: -282.346413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.346413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.346413 (E_RNA) where: Base-Base interactions energy: -132.744 where: short stacking energy: -79.918 Base-Backbone interact. energy: 0.633 local terms energy: -150.235425 where: bonds (distance) C4'-P energy: -40.344 bonds (distance) P-C4' energy: -49.296 flat angles C4'-P-C4' energy: -38.607 flat angles P-C4'-P energy: -24.970 tors. eta vs tors. theta energy: 2.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -206.819050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.819050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.819050 (E_RNA) where: Base-Base interactions energy: -40.707 where: short stacking energy: -39.560 Base-Backbone interact. energy: -0.415 local terms energy: -165.697104 where: bonds (distance) C4'-P energy: -54.404 bonds (distance) P-C4' energy: -35.056 flat angles C4'-P-C4' energy: -48.244 flat angles P-C4'-P energy: -38.242 tors. eta vs tors. theta energy: 10.250 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -797.850404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.850404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.850404 (E_RNA) where: Base-Base interactions energy: -524.706 where: short stacking energy: -255.254 Base-Backbone interact. energy: -0.753 local terms energy: -272.391183 where: bonds (distance) C4'-P energy: -47.599 bonds (distance) P-C4' energy: -61.738 flat angles C4'-P-C4' energy: -66.018 flat angles P-C4'-P energy: -37.087 tors. eta vs tors. theta energy: -59.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 82 Temperature: 0.964286 Total energy: -705.251827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.251827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.251827 (E_RNA) where: Base-Base interactions energy: -464.817 where: short stacking energy: -220.202 Base-Backbone interact. energy: -2.331 local terms energy: -238.104058 where: bonds (distance) C4'-P energy: -47.525 bonds (distance) P-C4' energy: -61.843 flat angles C4'-P-C4' energy: -56.765 flat angles P-C4'-P energy: -29.387 tors. eta vs tors. theta energy: -42.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 82 Temperature: 1.028571 Total energy: -588.028031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.028031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.028031 (E_RNA) where: Base-Base interactions energy: -344.511 where: short stacking energy: -204.899 Base-Backbone interact. energy: 2.492 local terms energy: -246.009158 where: bonds (distance) C4'-P energy: -59.979 bonds (distance) P-C4' energy: -61.776 flat angles C4'-P-C4' energy: -51.375 flat angles P-C4'-P energy: -29.542 tors. eta vs tors. theta energy: -43.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 82 Temperature: 1.092857 Total energy: -512.757291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.757291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.757291 (E_RNA) where: Base-Base interactions energy: -259.566 where: short stacking energy: -182.595 Base-Backbone interact. energy: -0.052 local terms energy: -253.139028 where: bonds (distance) C4'-P energy: -44.948 bonds (distance) P-C4' energy: -62.703 flat angles C4'-P-C4' energy: -61.654 flat angles P-C4'-P energy: -39.643 tors. eta vs tors. theta energy: -44.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 82 Temperature: 1.157143 Total energy: -350.920271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.920271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.920271 (E_RNA) where: Base-Base interactions energy: -164.283 where: short stacking energy: -117.088 Base-Backbone interact. energy: -1.758 local terms energy: -184.879998 where: bonds (distance) C4'-P energy: -38.410 bonds (distance) P-C4' energy: -62.692 flat angles C4'-P-C4' energy: -45.524 flat angles P-C4'-P energy: -24.664 tors. eta vs tors. theta energy: -13.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 82 Temperature: 1.221429 Total energy: -324.598358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.598358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.598358 (E_RNA) where: Base-Base interactions energy: -138.413 where: short stacking energy: -107.294 Base-Backbone interact. energy: -1.701 local terms energy: -184.484093 where: bonds (distance) C4'-P energy: -52.614 bonds (distance) P-C4' energy: -51.631 flat angles C4'-P-C4' energy: -41.313 flat angles P-C4'-P energy: -22.728 tors. eta vs tors. theta energy: -16.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 82 Temperature: 1.285714 Total energy: -342.325553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.325553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.325553 (E_RNA) where: Base-Base interactions energy: -180.907 where: short stacking energy: -116.402 Base-Backbone interact. energy: -1.719 local terms energy: -159.699638 where: bonds (distance) C4'-P energy: -46.143 bonds (distance) P-C4' energy: -46.140 flat angles C4'-P-C4' energy: -37.078 flat angles P-C4'-P energy: -29.760 tors. eta vs tors. theta energy: -0.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -229.913311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.913311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.913311 (E_RNA) where: Base-Base interactions energy: -93.245 where: short stacking energy: -82.364 Base-Backbone interact. energy: -1.243 local terms energy: -135.424468 where: bonds (distance) C4'-P energy: -40.450 bonds (distance) P-C4' energy: -46.430 flat angles C4'-P-C4' energy: -35.660 flat angles P-C4'-P energy: -16.814 tors. eta vs tors. theta energy: 3.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -791.029788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.029788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.029788 (E_RNA) where: Base-Base interactions energy: -503.724 where: short stacking energy: -241.597 Base-Backbone interact. energy: -0.300 local terms energy: -287.006376 where: bonds (distance) C4'-P energy: -66.774 bonds (distance) P-C4' energy: -61.255 flat angles C4'-P-C4' energy: -58.481 flat angles P-C4'-P energy: -39.192 tors. eta vs tors. theta energy: -61.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 83 Temperature: 0.964286 Total energy: -734.609436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.609436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.609436 (E_RNA) where: Base-Base interactions energy: -502.053 where: short stacking energy: -246.017 Base-Backbone interact. energy: 2.550 local terms energy: -235.106520 where: bonds (distance) C4'-P energy: -54.916 bonds (distance) P-C4' energy: -58.063 flat angles C4'-P-C4' energy: -44.874 flat angles P-C4'-P energy: -24.539 tors. eta vs tors. theta energy: -52.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 83 Temperature: 1.028571 Total energy: -544.440479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.440479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.440479 (E_RNA) where: Base-Base interactions energy: -318.263 where: short stacking energy: -169.991 Base-Backbone interact. energy: -0.236 local terms energy: -225.941461 where: bonds (distance) C4'-P energy: -53.308 bonds (distance) P-C4' energy: -50.399 flat angles C4'-P-C4' energy: -58.025 flat angles P-C4'-P energy: -41.399 tors. eta vs tors. theta energy: -22.810 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 83 Temperature: 1.092857 Total energy: -471.361210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.361210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.361210 (E_RNA) where: Base-Base interactions energy: -263.112 where: short stacking energy: -136.076 Base-Backbone interact. energy: -0.911 local terms energy: -207.339000 where: bonds (distance) C4'-P energy: -54.693 bonds (distance) P-C4' energy: -53.329 flat angles C4'-P-C4' energy: -55.279 flat angles P-C4'-P energy: -19.518 tors. eta vs tors. theta energy: -24.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 83 Temperature: 1.157143 Total energy: -332.156233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.156233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.156233 (E_RNA) where: Base-Base interactions energy: -126.248 where: short stacking energy: -95.299 Base-Backbone interact. energy: -0.529 local terms energy: -205.378804 where: bonds (distance) C4'-P energy: -54.674 bonds (distance) P-C4' energy: -66.113 flat angles C4'-P-C4' energy: -55.691 flat angles P-C4'-P energy: -21.579 tors. eta vs tors. theta energy: -7.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 83 Temperature: 1.221429 Total energy: -340.669311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.669311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.669311 (E_RNA) where: Base-Base interactions energy: -161.201 where: short stacking energy: -125.931 Base-Backbone interact. energy: -0.947 local terms energy: -178.521194 where: bonds (distance) C4'-P energy: -46.744 bonds (distance) P-C4' energy: -52.868 flat angles C4'-P-C4' energy: -39.525 flat angles P-C4'-P energy: -26.341 tors. eta vs tors. theta energy: -13.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 83 Temperature: 1.285714 Total energy: -319.559847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.559847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.559847 (E_RNA) where: Base-Base interactions energy: -154.748 where: short stacking energy: -95.445 Base-Backbone interact. energy: 1.392 local terms energy: -166.203925 where: bonds (distance) C4'-P energy: -54.957 bonds (distance) P-C4' energy: -52.937 flat angles C4'-P-C4' energy: -35.251 flat angles P-C4'-P energy: -24.323 tors. eta vs tors. theta energy: 1.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -234.369762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.369762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.369762 (E_RNA) where: Base-Base interactions energy: -81.775 where: short stacking energy: -72.314 Base-Backbone interact. energy: 1.459 local terms energy: -154.053673 where: bonds (distance) C4'-P energy: -42.329 bonds (distance) P-C4' energy: -49.984 flat angles C4'-P-C4' energy: -35.143 flat angles P-C4'-P energy: -33.885 tors. eta vs tors. theta energy: 7.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -783.930196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.930196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.930196 (E_RNA) where: Base-Base interactions energy: -509.371 where: short stacking energy: -241.129 Base-Backbone interact. energy: -0.869 local terms energy: -273.690127 where: bonds (distance) C4'-P energy: -55.383 bonds (distance) P-C4' energy: -60.201 flat angles C4'-P-C4' energy: -57.534 flat angles P-C4'-P energy: -46.253 tors. eta vs tors. theta energy: -54.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 84 Temperature: 0.964286 Total energy: -734.266711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.266711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.266711 (E_RNA) where: Base-Base interactions energy: -492.138 where: short stacking energy: -229.445 Base-Backbone interact. energy: -1.365 local terms energy: -240.763971 where: bonds (distance) C4'-P energy: -46.256 bonds (distance) P-C4' energy: -58.605 flat angles C4'-P-C4' energy: -60.004 flat angles P-C4'-P energy: -30.309 tors. eta vs tors. theta energy: -45.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 84 Temperature: 1.028571 Total energy: -579.380564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.380564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.380564 (E_RNA) where: Base-Base interactions energy: -352.161 where: short stacking energy: -203.828 Base-Backbone interact. energy: -0.797 local terms energy: -226.423290 where: bonds (distance) C4'-P energy: -51.982 bonds (distance) P-C4' energy: -53.430 flat angles C4'-P-C4' energy: -46.735 flat angles P-C4'-P energy: -36.882 tors. eta vs tors. theta energy: -37.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 84 Temperature: 1.092857 Total energy: -511.990722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.990722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.990722 (E_RNA) where: Base-Base interactions energy: -300.137 where: short stacking energy: -172.599 Base-Backbone interact. energy: -0.494 local terms energy: -211.359042 where: bonds (distance) C4'-P energy: -48.087 bonds (distance) P-C4' energy: -53.025 flat angles C4'-P-C4' energy: -44.565 flat angles P-C4'-P energy: -29.227 tors. eta vs tors. theta energy: -36.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 84 Temperature: 1.157143 Total energy: -352.571184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.571184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.571184 (E_RNA) where: Base-Base interactions energy: -158.313 where: short stacking energy: -113.389 Base-Backbone interact. energy: -0.760 local terms energy: -193.497432 where: bonds (distance) C4'-P energy: -49.259 bonds (distance) P-C4' energy: -49.606 flat angles C4'-P-C4' energy: -45.889 flat angles P-C4'-P energy: -40.059 tors. eta vs tors. theta energy: -8.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 84 Temperature: 1.221429 Total energy: -342.844823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.844823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.844823 (E_RNA) where: Base-Base interactions energy: -146.561 where: short stacking energy: -96.480 Base-Backbone interact. energy: -1.895 local terms energy: -194.389052 where: bonds (distance) C4'-P energy: -42.482 bonds (distance) P-C4' energy: -58.666 flat angles C4'-P-C4' energy: -51.657 flat angles P-C4'-P energy: -27.348 tors. eta vs tors. theta energy: -14.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 84 Temperature: 1.285714 Total energy: -350.087712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.087712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.087712 (E_RNA) where: Base-Base interactions energy: -179.421 where: short stacking energy: -111.430 Base-Backbone interact. energy: 1.490 local terms energy: -172.157342 where: bonds (distance) C4'-P energy: -34.260 bonds (distance) P-C4' energy: -52.920 flat angles C4'-P-C4' energy: -48.717 flat angles P-C4'-P energy: -27.355 tors. eta vs tors. theta energy: -8.906 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -257.410915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.410915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.410915 (E_RNA) where: Base-Base interactions energy: -79.560 where: short stacking energy: -61.436 Base-Backbone interact. energy: -0.772 local terms energy: -177.078670 where: bonds (distance) C4'-P energy: -60.650 bonds (distance) P-C4' energy: -43.462 flat angles C4'-P-C4' energy: -46.468 flat angles P-C4'-P energy: -27.528 tors. eta vs tors. theta energy: 1.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -789.141390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.141390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.141390 (E_RNA) where: Base-Base interactions energy: -520.829 where: short stacking energy: -252.259 Base-Backbone interact. energy: 0.515 local terms energy: -268.827988 where: bonds (distance) C4'-P energy: -45.324 bonds (distance) P-C4' energy: -56.444 flat angles C4'-P-C4' energy: -63.393 flat angles P-C4'-P energy: -45.125 tors. eta vs tors. theta energy: -58.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 85 Temperature: 0.964286 Total energy: -716.306545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.306545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.306545 (E_RNA) where: Base-Base interactions energy: -479.736 where: short stacking energy: -224.087 Base-Backbone interact. energy: -1.828 local terms energy: -234.742339 where: bonds (distance) C4'-P energy: -51.648 bonds (distance) P-C4' energy: -55.224 flat angles C4'-P-C4' energy: -49.407 flat angles P-C4'-P energy: -27.009 tors. eta vs tors. theta energy: -51.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 85 Temperature: 1.028571 Total energy: -578.580476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.580476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.580476 (E_RNA) where: Base-Base interactions energy: -367.205 where: short stacking energy: -193.280 Base-Backbone interact. energy: 0.293 local terms energy: -211.667622 where: bonds (distance) C4'-P energy: -49.025 bonds (distance) P-C4' energy: -46.402 flat angles C4'-P-C4' energy: -49.753 flat angles P-C4'-P energy: -34.538 tors. eta vs tors. theta energy: -31.950 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 85 Temperature: 1.092857 Total energy: -521.347379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.347379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.347379 (E_RNA) where: Base-Base interactions energy: -309.064 where: short stacking energy: -158.623 Base-Backbone interact. energy: -0.840 local terms energy: -211.443853 where: bonds (distance) C4'-P energy: -51.045 bonds (distance) P-C4' energy: -54.270 flat angles C4'-P-C4' energy: -45.293 flat angles P-C4'-P energy: -32.587 tors. eta vs tors. theta energy: -28.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 85 Temperature: 1.157143 Total energy: -383.593464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.593464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.593464 (E_RNA) where: Base-Base interactions energy: -182.233 where: short stacking energy: -136.831 Base-Backbone interact. energy: 0.943 local terms energy: -202.302589 where: bonds (distance) C4'-P energy: -47.009 bonds (distance) P-C4' energy: -60.084 flat angles C4'-P-C4' energy: -45.429 flat angles P-C4'-P energy: -26.087 tors. eta vs tors. theta energy: -23.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 85 Temperature: 1.221429 Total energy: -382.767050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.767050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.767050 (E_RNA) where: Base-Base interactions energy: -187.233 where: short stacking energy: -128.533 Base-Backbone interact. energy: -0.523 local terms energy: -195.011213 where: bonds (distance) C4'-P energy: -43.491 bonds (distance) P-C4' energy: -49.853 flat angles C4'-P-C4' energy: -59.887 flat angles P-C4'-P energy: -27.382 tors. eta vs tors. theta energy: -14.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 85 Temperature: 1.285714 Total energy: -311.271062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.271062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.271062 (E_RNA) where: Base-Base interactions energy: -158.541 where: short stacking energy: -83.424 Base-Backbone interact. energy: -0.907 local terms energy: -151.823723 where: bonds (distance) C4'-P energy: -40.332 bonds (distance) P-C4' energy: -45.921 flat angles C4'-P-C4' energy: -45.692 flat angles P-C4'-P energy: -29.342 tors. eta vs tors. theta energy: 9.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -256.095651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.095651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.095651 (E_RNA) where: Base-Base interactions energy: -89.753 where: short stacking energy: -77.769 Base-Backbone interact. energy: 0.540 local terms energy: -168.255607 where: bonds (distance) C4'-P energy: -52.397 bonds (distance) P-C4' energy: -42.583 flat angles C4'-P-C4' energy: -49.995 flat angles P-C4'-P energy: -28.354 tors. eta vs tors. theta energy: 5.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.373 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -773.485682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -773.485682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -773.485682 (E_RNA) where: Base-Base interactions energy: -498.792 where: short stacking energy: -247.393 Base-Backbone interact. energy: -0.978 local terms energy: -273.715394 where: bonds (distance) C4'-P energy: -57.519 bonds (distance) P-C4' energy: -50.009 flat angles C4'-P-C4' energy: -69.591 flat angles P-C4'-P energy: -31.607 tors. eta vs tors. theta energy: -64.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 86 Temperature: 0.964286 Total energy: -705.438725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.438725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.438725 (E_RNA) where: Base-Base interactions energy: -474.854 where: short stacking energy: -231.827 Base-Backbone interact. energy: -1.244 local terms energy: -229.340187 where: bonds (distance) C4'-P energy: -43.089 bonds (distance) P-C4' energy: -62.370 flat angles C4'-P-C4' energy: -50.687 flat angles P-C4'-P energy: -25.325 tors. eta vs tors. theta energy: -47.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 86 Temperature: 1.028571 Total energy: -605.290831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.290831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.290831 (E_RNA) where: Base-Base interactions energy: -380.147 where: short stacking energy: -196.877 Base-Backbone interact. energy: -2.149 local terms energy: -222.994165 where: bonds (distance) C4'-P energy: -48.717 bonds (distance) P-C4' energy: -62.715 flat angles C4'-P-C4' energy: -56.660 flat angles P-C4'-P energy: -30.755 tors. eta vs tors. theta energy: -24.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 86 Temperature: 1.092857 Total energy: -517.835887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.835887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.835887 (E_RNA) where: Base-Base interactions energy: -288.647 where: short stacking energy: -146.931 Base-Backbone interact. energy: -0.937 local terms energy: -228.251874 where: bonds (distance) C4'-P energy: -58.661 bonds (distance) P-C4' energy: -63.218 flat angles C4'-P-C4' energy: -33.185 flat angles P-C4'-P energy: -44.356 tors. eta vs tors. theta energy: -28.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 86 Temperature: 1.157143 Total energy: -395.084816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.084816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.084816 (E_RNA) where: Base-Base interactions energy: -203.169 where: short stacking energy: -152.323 Base-Backbone interact. energy: -0.817 local terms energy: -191.099157 where: bonds (distance) C4'-P energy: -49.583 bonds (distance) P-C4' energy: -49.396 flat angles C4'-P-C4' energy: -46.218 flat angles P-C4'-P energy: -22.756 tors. eta vs tors. theta energy: -23.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 86 Temperature: 1.221429 Total energy: -335.329524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.329524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.329524 (E_RNA) where: Base-Base interactions energy: -165.368 where: short stacking energy: -111.481 Base-Backbone interact. energy: 0.740 local terms energy: -170.701434 where: bonds (distance) C4'-P energy: -42.753 bonds (distance) P-C4' energy: -55.859 flat angles C4'-P-C4' energy: -40.672 flat angles P-C4'-P energy: -21.501 tors. eta vs tors. theta energy: -9.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 86 Temperature: 1.285714 Total energy: -327.435988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.435988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.435988 (E_RNA) where: Base-Base interactions energy: -160.080 where: short stacking energy: -94.100 Base-Backbone interact. energy: -0.411 local terms energy: -166.945221 where: bonds (distance) C4'-P energy: -48.918 bonds (distance) P-C4' energy: -54.568 flat angles C4'-P-C4' energy: -45.441 flat angles P-C4'-P energy: -23.695 tors. eta vs tors. theta energy: 5.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -249.901136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.901136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.901136 (E_RNA) where: Base-Base interactions energy: -85.871 where: short stacking energy: -71.328 Base-Backbone interact. energy: -2.533 local terms energy: -161.497299 where: bonds (distance) C4'-P energy: -41.787 bonds (distance) P-C4' energy: -56.347 flat angles C4'-P-C4' energy: -41.154 flat angles P-C4'-P energy: -24.742 tors. eta vs tors. theta energy: 2.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -769.184485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.184485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.184485 (E_RNA) where: Base-Base interactions energy: -491.860 where: short stacking energy: -225.990 Base-Backbone interact. energy: -0.993 local terms energy: -276.331468 where: bonds (distance) C4'-P energy: -58.502 bonds (distance) P-C4' energy: -55.359 flat angles C4'-P-C4' energy: -63.234 flat angles P-C4'-P energy: -49.868 tors. eta vs tors. theta energy: -49.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 87 Temperature: 0.964286 Total energy: -729.418261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.418261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.418261 (E_RNA) where: Base-Base interactions energy: -480.901 where: short stacking energy: -229.095 Base-Backbone interact. energy: -1.397 local terms energy: -247.119655 where: bonds (distance) C4'-P energy: -56.663 bonds (distance) P-C4' energy: -47.188 flat angles C4'-P-C4' energy: -63.709 flat angles P-C4'-P energy: -35.607 tors. eta vs tors. theta energy: -43.953 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 87 Temperature: 1.028571 Total energy: -614.482602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.482602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.482602 (E_RNA) where: Base-Base interactions energy: -377.654 where: short stacking energy: -206.506 Base-Backbone interact. energy: -0.616 local terms energy: -236.212887 where: bonds (distance) C4'-P energy: -38.556 bonds (distance) P-C4' energy: -59.868 flat angles C4'-P-C4' energy: -63.100 flat angles P-C4'-P energy: -35.642 tors. eta vs tors. theta energy: -39.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 87 Temperature: 1.092857 Total energy: -508.486390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.486390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.486390 (E_RNA) where: Base-Base interactions energy: -299.771 where: short stacking energy: -163.399 Base-Backbone interact. energy: -1.818 local terms energy: -206.897519 where: bonds (distance) C4'-P energy: -49.604 bonds (distance) P-C4' energy: -51.001 flat angles C4'-P-C4' energy: -44.372 flat angles P-C4'-P energy: -38.266 tors. eta vs tors. theta energy: -23.655 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 87 Temperature: 1.157143 Total energy: -369.494993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.494993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.494993 (E_RNA) where: Base-Base interactions energy: -185.671 where: short stacking energy: -109.419 Base-Backbone interact. energy: -1.388 local terms energy: -182.435851 where: bonds (distance) C4'-P energy: -49.631 bonds (distance) P-C4' energy: -59.236 flat angles C4'-P-C4' energy: -24.237 flat angles P-C4'-P energy: -38.547 tors. eta vs tors. theta energy: -10.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 87 Temperature: 1.221429 Total energy: -346.462299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.462299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.462299 (E_RNA) where: Base-Base interactions energy: -168.606 where: short stacking energy: -94.013 Base-Backbone interact. energy: 0.081 local terms energy: -177.937405 where: bonds (distance) C4'-P energy: -51.633 bonds (distance) P-C4' energy: -63.324 flat angles C4'-P-C4' energy: -49.646 flat angles P-C4'-P energy: -13.185 tors. eta vs tors. theta energy: -0.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 87 Temperature: 1.285714 Total energy: -333.372284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.372284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.372284 (E_RNA) where: Base-Base interactions energy: -142.542 where: short stacking energy: -101.610 Base-Backbone interact. energy: -1.533 local terms energy: -189.297122 where: bonds (distance) C4'-P energy: -48.609 bonds (distance) P-C4' energy: -57.047 flat angles C4'-P-C4' energy: -50.530 flat angles P-C4'-P energy: -30.083 tors. eta vs tors. theta energy: -3.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -226.518895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.518895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.518895 (E_RNA) where: Base-Base interactions energy: -84.479 where: short stacking energy: -79.916 Base-Backbone interact. energy: -1.095 local terms energy: -141.424637 where: bonds (distance) C4'-P energy: -52.808 bonds (distance) P-C4' energy: -34.365 flat angles C4'-P-C4' energy: -43.241 flat angles P-C4'-P energy: -16.903 tors. eta vs tors. theta energy: 5.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.480 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -801.231059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -801.231059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -801.231059 (E_RNA) where: Base-Base interactions energy: -533.029 where: short stacking energy: -248.442 Base-Backbone interact. energy: -0.248 local terms energy: -267.954602 where: bonds (distance) C4'-P energy: -55.688 bonds (distance) P-C4' energy: -54.341 flat angles C4'-P-C4' energy: -56.828 flat angles P-C4'-P energy: -34.156 tors. eta vs tors. theta energy: -66.942 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 88 Temperature: 0.964286 Total energy: -712.135528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.135528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.135528 (E_RNA) where: Base-Base interactions energy: -464.066 where: short stacking energy: -226.544 Base-Backbone interact. energy: -2.110 local terms energy: -245.959126 where: bonds (distance) C4'-P energy: -50.691 bonds (distance) P-C4' energy: -57.602 flat angles C4'-P-C4' energy: -59.875 flat angles P-C4'-P energy: -35.244 tors. eta vs tors. theta energy: -42.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 88 Temperature: 1.028571 Total energy: -614.332074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.332074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.332074 (E_RNA) where: Base-Base interactions energy: -373.110 where: short stacking energy: -201.675 Base-Backbone interact. energy: 2.471 local terms energy: -243.692533 where: bonds (distance) C4'-P energy: -54.026 bonds (distance) P-C4' energy: -52.072 flat angles C4'-P-C4' energy: -59.219 flat angles P-C4'-P energy: -42.922 tors. eta vs tors. theta energy: -35.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 88 Temperature: 1.092857 Total energy: -531.939586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.939586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.939586 (E_RNA) where: Base-Base interactions energy: -307.350 where: short stacking energy: -165.891 Base-Backbone interact. energy: 0.816 local terms energy: -225.405432 where: bonds (distance) C4'-P energy: -60.016 bonds (distance) P-C4' energy: -47.869 flat angles C4'-P-C4' energy: -50.625 flat angles P-C4'-P energy: -44.033 tors. eta vs tors. theta energy: -22.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 88 Temperature: 1.157143 Total energy: -361.737433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.737433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.737433 (E_RNA) where: Base-Base interactions energy: -179.143 where: short stacking energy: -123.217 Base-Backbone interact. energy: -0.996 local terms energy: -181.598652 where: bonds (distance) C4'-P energy: -46.412 bonds (distance) P-C4' energy: -48.218 flat angles C4'-P-C4' energy: -42.206 flat angles P-C4'-P energy: -31.358 tors. eta vs tors. theta energy: -13.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 88 Temperature: 1.221429 Total energy: -316.797984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.797984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.797984 (E_RNA) where: Base-Base interactions energy: -151.835 where: short stacking energy: -108.393 Base-Backbone interact. energy: -0.033 local terms energy: -164.930024 where: bonds (distance) C4'-P energy: -53.777 bonds (distance) P-C4' energy: -46.944 flat angles C4'-P-C4' energy: -31.498 flat angles P-C4'-P energy: -35.384 tors. eta vs tors. theta energy: 2.673 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 88 Temperature: 1.285714 Total energy: -335.096232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.096232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.096232 (E_RNA) where: Base-Base interactions energy: -165.313 where: short stacking energy: -109.097 Base-Backbone interact. energy: 0.364 local terms energy: -170.147510 where: bonds (distance) C4'-P energy: -40.673 bonds (distance) P-C4' energy: -52.584 flat angles C4'-P-C4' energy: -45.083 flat angles P-C4'-P energy: -34.967 tors. eta vs tors. theta energy: 3.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -211.308158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.308158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.308158 (E_RNA) where: Base-Base interactions energy: -79.073 where: short stacking energy: -65.420 Base-Backbone interact. energy: 2.598 local terms energy: -134.833318 where: bonds (distance) C4'-P energy: -23.993 bonds (distance) P-C4' energy: -54.269 flat angles C4'-P-C4' energy: -42.638 flat angles P-C4'-P energy: -30.843 tors. eta vs tors. theta energy: 16.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -821.975488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -821.975488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -821.975488 (E_RNA) where: Base-Base interactions energy: -531.792 where: short stacking energy: -246.850 Base-Backbone interact. energy: -1.163 local terms energy: -289.020249 where: bonds (distance) C4'-P energy: -61.254 bonds (distance) P-C4' energy: -60.609 flat angles C4'-P-C4' energy: -58.128 flat angles P-C4'-P energy: -46.415 tors. eta vs tors. theta energy: -62.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 89 Temperature: 0.964286 Total energy: -712.608510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.608510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.608510 (E_RNA) where: Base-Base interactions energy: -458.432 where: short stacking energy: -224.651 Base-Backbone interact. energy: -1.135 local terms energy: -253.040733 where: bonds (distance) C4'-P energy: -53.185 bonds (distance) P-C4' energy: -59.349 flat angles C4'-P-C4' energy: -61.512 flat angles P-C4'-P energy: -34.039 tors. eta vs tors. theta energy: -44.957 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 89 Temperature: 1.028571 Total energy: -618.310370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.310370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.310370 (E_RNA) where: Base-Base interactions energy: -369.196 where: short stacking energy: -198.245 Base-Backbone interact. energy: -0.277 local terms energy: -248.836792 where: bonds (distance) C4'-P energy: -55.927 bonds (distance) P-C4' energy: -57.801 flat angles C4'-P-C4' energy: -62.983 flat angles P-C4'-P energy: -34.357 tors. eta vs tors. theta energy: -37.769 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 89 Temperature: 1.092857 Total energy: -495.947450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.947450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.947450 (E_RNA) where: Base-Base interactions energy: -304.847 where: short stacking energy: -148.962 Base-Backbone interact. energy: 0.661 local terms energy: -191.761679 where: bonds (distance) C4'-P energy: -47.444 bonds (distance) P-C4' energy: -52.076 flat angles C4'-P-C4' energy: -44.434 flat angles P-C4'-P energy: -26.935 tors. eta vs tors. theta energy: -20.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 89 Temperature: 1.157143 Total energy: -364.244647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.244647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.244647 (E_RNA) where: Base-Base interactions energy: -162.548 where: short stacking energy: -118.634 Base-Backbone interact. energy: 0.856 local terms energy: -202.552840 where: bonds (distance) C4'-P energy: -54.120 bonds (distance) P-C4' energy: -61.929 flat angles C4'-P-C4' energy: -43.231 flat angles P-C4'-P energy: -20.517 tors. eta vs tors. theta energy: -22.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 89 Temperature: 1.221429 Total energy: -355.352471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.352471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.352471 (E_RNA) where: Base-Base interactions energy: -178.399 where: short stacking energy: -115.199 Base-Backbone interact. energy: -0.060 local terms energy: -176.892791 where: bonds (distance) C4'-P energy: -48.331 bonds (distance) P-C4' energy: -61.327 flat angles C4'-P-C4' energy: -35.952 flat angles P-C4'-P energy: -27.279 tors. eta vs tors. theta energy: -4.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 89 Temperature: 1.285714 Total energy: -323.897440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.897440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.897440 (E_RNA) where: Base-Base interactions energy: -149.325 where: short stacking energy: -94.368 Base-Backbone interact. energy: -0.076 local terms energy: -174.497173 where: bonds (distance) C4'-P energy: -44.726 bonds (distance) P-C4' energy: -60.944 flat angles C4'-P-C4' energy: -48.945 flat angles P-C4'-P energy: -24.614 tors. eta vs tors. theta energy: 4.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -236.013699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.013699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.013699 (E_RNA) where: Base-Base interactions energy: -87.426 where: short stacking energy: -68.694 Base-Backbone interact. energy: 6.221 local terms energy: -154.808607 where: bonds (distance) C4'-P energy: -53.626 bonds (distance) P-C4' energy: -57.651 flat angles C4'-P-C4' energy: -37.537 flat angles P-C4'-P energy: -16.915 tors. eta vs tors. theta energy: 10.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -810.066169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.066169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -810.066169 (E_RNA) where: Base-Base interactions energy: -531.182 where: short stacking energy: -248.243 Base-Backbone interact. energy: -2.415 local terms energy: -276.469144 where: bonds (distance) C4'-P energy: -56.371 bonds (distance) P-C4' energy: -59.054 flat angles C4'-P-C4' energy: -59.210 flat angles P-C4'-P energy: -39.338 tors. eta vs tors. theta energy: -62.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 90 Temperature: 0.964286 Total energy: -712.951257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.951257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.951257 (E_RNA) where: Base-Base interactions energy: -452.184 where: short stacking energy: -212.066 Base-Backbone interact. energy: 0.725 local terms energy: -261.492638 where: bonds (distance) C4'-P energy: -52.189 bonds (distance) P-C4' energy: -58.404 flat angles C4'-P-C4' energy: -63.703 flat angles P-C4'-P energy: -40.593 tors. eta vs tors. theta energy: -46.603 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 90 Temperature: 1.028571 Total energy: -658.416235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.416235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.416235 (E_RNA) where: Base-Base interactions energy: -404.644 where: short stacking energy: -224.148 Base-Backbone interact. energy: -0.571 local terms energy: -253.200805 where: bonds (distance) C4'-P energy: -57.672 bonds (distance) P-C4' energy: -58.071 flat angles C4'-P-C4' energy: -57.745 flat angles P-C4'-P energy: -29.902 tors. eta vs tors. theta energy: -49.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 90 Temperature: 1.092857 Total energy: -488.642059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.642059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.642059 (E_RNA) where: Base-Base interactions energy: -274.997 where: short stacking energy: -169.564 Base-Backbone interact. energy: -1.003 local terms energy: -212.641120 where: bonds (distance) C4'-P energy: -53.877 bonds (distance) P-C4' energy: -46.466 flat angles C4'-P-C4' energy: -52.251 flat angles P-C4'-P energy: -35.635 tors. eta vs tors. theta energy: -24.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 90 Temperature: 1.157143 Total energy: -348.132619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.132619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.132619 (E_RNA) where: Base-Base interactions energy: -183.473 where: short stacking energy: -118.787 Base-Backbone interact. energy: 0.874 local terms energy: -165.533616 where: bonds (distance) C4'-P energy: -44.127 bonds (distance) P-C4' energy: -42.268 flat angles C4'-P-C4' energy: -44.570 flat angles P-C4'-P energy: -32.818 tors. eta vs tors. theta energy: -1.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 90 Temperature: 1.221429 Total energy: -340.359818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.359818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.359818 (E_RNA) where: Base-Base interactions energy: -163.582 where: short stacking energy: -111.753 Base-Backbone interact. energy: 4.673 local terms energy: -181.451204 where: bonds (distance) C4'-P energy: -51.603 bonds (distance) P-C4' energy: -51.325 flat angles C4'-P-C4' energy: -50.638 flat angles P-C4'-P energy: -19.369 tors. eta vs tors. theta energy: -8.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 90 Temperature: 1.285714 Total energy: -307.951927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.951927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.951927 (E_RNA) where: Base-Base interactions energy: -137.342 where: short stacking energy: -89.610 Base-Backbone interact. energy: -0.881 local terms energy: -169.728582 where: bonds (distance) C4'-P energy: -39.335 bonds (distance) P-C4' energy: -52.503 flat angles C4'-P-C4' energy: -47.523 flat angles P-C4'-P energy: -30.283 tors. eta vs tors. theta energy: -0.085 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -218.320304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.320304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.320304 (E_RNA) where: Base-Base interactions energy: -70.173 where: short stacking energy: -53.677 Base-Backbone interact. energy: 1.109 local terms energy: -149.255582 where: bonds (distance) C4'-P energy: -47.407 bonds (distance) P-C4' energy: -55.069 flat angles C4'-P-C4' energy: -36.325 flat angles P-C4'-P energy: -24.091 tors. eta vs tors. theta energy: 13.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -834.922869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.922869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.922869 (E_RNA) where: Base-Base interactions energy: -552.100 where: short stacking energy: -249.011 Base-Backbone interact. energy: -2.646 local terms energy: -280.177571 where: bonds (distance) C4'-P energy: -53.111 bonds (distance) P-C4' energy: -64.802 flat angles C4'-P-C4' energy: -65.827 flat angles P-C4'-P energy: -33.394 tors. eta vs tors. theta energy: -63.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 91 Temperature: 0.964286 Total energy: -675.154115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.154115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.154115 (E_RNA) where: Base-Base interactions energy: -405.666 where: short stacking energy: -230.234 Base-Backbone interact. energy: 0.280 local terms energy: -269.768205 where: bonds (distance) C4'-P energy: -66.871 bonds (distance) P-C4' energy: -62.082 flat angles C4'-P-C4' energy: -62.448 flat angles P-C4'-P energy: -32.423 tors. eta vs tors. theta energy: -45.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 91 Temperature: 1.028571 Total energy: -690.481971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.481971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.481971 (E_RNA) where: Base-Base interactions energy: -438.193 where: short stacking energy: -208.320 Base-Backbone interact. energy: -2.277 local terms energy: -250.012156 where: bonds (distance) C4'-P energy: -58.302 bonds (distance) P-C4' energy: -59.501 flat angles C4'-P-C4' energy: -55.574 flat angles P-C4'-P energy: -34.609 tors. eta vs tors. theta energy: -42.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 91 Temperature: 1.092857 Total energy: -508.218611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.218611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.218611 (E_RNA) where: Base-Base interactions energy: -301.223 where: short stacking energy: -167.150 Base-Backbone interact. energy: 1.172 local terms energy: -208.167643 where: bonds (distance) C4'-P energy: -49.051 bonds (distance) P-C4' energy: -46.701 flat angles C4'-P-C4' energy: -44.863 flat angles P-C4'-P energy: -34.835 tors. eta vs tors. theta energy: -32.719 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 91 Temperature: 1.157143 Total energy: -359.834149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.834149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.834149 (E_RNA) where: Base-Base interactions energy: -155.350 where: short stacking energy: -110.250 Base-Backbone interact. energy: 1.905 local terms energy: -206.389017 where: bonds (distance) C4'-P energy: -60.103 bonds (distance) P-C4' energy: -55.122 flat angles C4'-P-C4' energy: -49.857 flat angles P-C4'-P energy: -40.670 tors. eta vs tors. theta energy: -0.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 91 Temperature: 1.221429 Total energy: -327.722026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.722026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.722026 (E_RNA) where: Base-Base interactions energy: -151.681 where: short stacking energy: -100.546 Base-Backbone interact. energy: -1.182 local terms energy: -174.858557 where: bonds (distance) C4'-P energy: -45.054 bonds (distance) P-C4' energy: -49.671 flat angles C4'-P-C4' energy: -44.355 flat angles P-C4'-P energy: -34.485 tors. eta vs tors. theta energy: -1.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 91 Temperature: 1.285714 Total energy: -284.274028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.274028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.274028 (E_RNA) where: Base-Base interactions energy: -113.061 where: short stacking energy: -77.386 Base-Backbone interact. energy: -0.895 local terms energy: -170.317275 where: bonds (distance) C4'-P energy: -48.213 bonds (distance) P-C4' energy: -51.987 flat angles C4'-P-C4' energy: -49.780 flat angles P-C4'-P energy: -21.666 tors. eta vs tors. theta energy: 1.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -244.532192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.532192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.532192 (E_RNA) where: Base-Base interactions energy: -80.804 where: short stacking energy: -76.828 Base-Backbone interact. energy: 2.787 local terms energy: -166.515826 where: bonds (distance) C4'-P energy: -43.493 bonds (distance) P-C4' energy: -57.305 flat angles C4'-P-C4' energy: -33.590 flat angles P-C4'-P energy: -29.401 tors. eta vs tors. theta energy: -2.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -787.148019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -787.148019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.148019 (E_RNA) where: Base-Base interactions energy: -507.665 where: short stacking energy: -222.071 Base-Backbone interact. energy: -1.368 local terms energy: -278.115099 where: bonds (distance) C4'-P energy: -63.252 bonds (distance) P-C4' energy: -64.167 flat angles C4'-P-C4' energy: -57.373 flat angles P-C4'-P energy: -36.749 tors. eta vs tors. theta energy: -56.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 92 Temperature: 0.964286 Total energy: -670.240634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -670.240634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.240634 (E_RNA) where: Base-Base interactions energy: -402.705 where: short stacking energy: -231.963 Base-Backbone interact. energy: -1.049 local terms energy: -266.486703 where: bonds (distance) C4'-P energy: -60.494 bonds (distance) P-C4' energy: -59.074 flat angles C4'-P-C4' energy: -54.423 flat angles P-C4'-P energy: -44.683 tors. eta vs tors. theta energy: -47.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 92 Temperature: 1.028571 Total energy: -691.904585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.904585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.904585 (E_RNA) where: Base-Base interactions energy: -433.120 where: short stacking energy: -191.329 Base-Backbone interact. energy: -1.361 local terms energy: -257.423304 where: bonds (distance) C4'-P energy: -56.612 bonds (distance) P-C4' energy: -58.565 flat angles C4'-P-C4' energy: -55.908 flat angles P-C4'-P energy: -40.561 tors. eta vs tors. theta energy: -45.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 92 Temperature: 1.092857 Total energy: -521.569263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.569263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.569263 (E_RNA) where: Base-Base interactions energy: -297.090 where: short stacking energy: -147.786 Base-Backbone interact. energy: -1.272 local terms energy: -223.207608 where: bonds (distance) C4'-P energy: -42.650 bonds (distance) P-C4' energy: -63.490 flat angles C4'-P-C4' energy: -46.060 flat angles P-C4'-P energy: -35.915 tors. eta vs tors. theta energy: -35.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 92 Temperature: 1.157143 Total energy: -358.442891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.442891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.442891 (E_RNA) where: Base-Base interactions energy: -172.583 where: short stacking energy: -121.577 Base-Backbone interact. energy: 0.640 local terms energy: -186.500036 where: bonds (distance) C4'-P energy: -48.087 bonds (distance) P-C4' energy: -51.970 flat angles C4'-P-C4' energy: -50.380 flat angles P-C4'-P energy: -30.070 tors. eta vs tors. theta energy: -5.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 92 Temperature: 1.221429 Total energy: -359.256738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.256738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.256738 (E_RNA) where: Base-Base interactions energy: -162.088 where: short stacking energy: -122.722 Base-Backbone interact. energy: -1.089 local terms energy: -196.080058 where: bonds (distance) C4'-P energy: -45.333 bonds (distance) P-C4' energy: -58.168 flat angles C4'-P-C4' energy: -41.831 flat angles P-C4'-P energy: -36.198 tors. eta vs tors. theta energy: -14.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 92 Temperature: 1.285714 Total energy: -314.259818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.259818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.259818 (E_RNA) where: Base-Base interactions energy: -152.353 where: short stacking energy: -113.251 Base-Backbone interact. energy: 5.514 local terms energy: -167.420345 where: bonds (distance) C4'-P energy: -44.950 bonds (distance) P-C4' energy: -54.399 flat angles C4'-P-C4' energy: -35.723 flat angles P-C4'-P energy: -27.064 tors. eta vs tors. theta energy: -5.284 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -251.899308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.899308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.899308 (E_RNA) where: Base-Base interactions energy: -86.069 where: short stacking energy: -68.923 Base-Backbone interact. energy: -0.814 local terms energy: -165.016254 where: bonds (distance) C4'-P energy: -52.840 bonds (distance) P-C4' energy: -40.339 flat angles C4'-P-C4' energy: -33.628 flat angles P-C4'-P energy: -38.534 tors. eta vs tors. theta energy: 0.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -810.475302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.475302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -810.475302 (E_RNA) where: Base-Base interactions energy: -525.512 where: short stacking energy: -251.110 Base-Backbone interact. energy: -0.917 local terms energy: -284.046129 where: bonds (distance) C4'-P energy: -58.102 bonds (distance) P-C4' energy: -64.853 flat angles C4'-P-C4' energy: -55.894 flat angles P-C4'-P energy: -46.263 tors. eta vs tors. theta energy: -58.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 93 Temperature: 0.964286 Total energy: -713.426990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.426990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.426990 (E_RNA) where: Base-Base interactions energy: -457.096 where: short stacking energy: -207.648 Base-Backbone interact. energy: 2.040 local terms energy: -258.370491 where: bonds (distance) C4'-P energy: -53.053 bonds (distance) P-C4' energy: -56.830 flat angles C4'-P-C4' energy: -52.176 flat angles P-C4'-P energy: -46.896 tors. eta vs tors. theta energy: -49.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 93 Temperature: 1.028571 Total energy: -657.817754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.817754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.817754 (E_RNA) where: Base-Base interactions energy: -406.096 where: short stacking energy: -212.260 Base-Backbone interact. energy: 2.208 local terms energy: -253.929621 where: bonds (distance) C4'-P energy: -54.556 bonds (distance) P-C4' energy: -58.873 flat angles C4'-P-C4' energy: -55.731 flat angles P-C4'-P energy: -41.078 tors. eta vs tors. theta energy: -43.692 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 93 Temperature: 1.092857 Total energy: -531.575748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.575748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.575748 (E_RNA) where: Base-Base interactions energy: -317.089 where: short stacking energy: -196.121 Base-Backbone interact. energy: 1.633 local terms energy: -216.119633 where: bonds (distance) C4'-P energy: -50.481 bonds (distance) P-C4' energy: -52.336 flat angles C4'-P-C4' energy: -51.311 flat angles P-C4'-P energy: -29.755 tors. eta vs tors. theta energy: -32.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 93 Temperature: 1.157143 Total energy: -359.139047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.139047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.139047 (E_RNA) where: Base-Base interactions energy: -159.630 where: short stacking energy: -91.936 Base-Backbone interact. energy: -1.672 local terms energy: -197.837357 where: bonds (distance) C4'-P energy: -50.059 bonds (distance) P-C4' energy: -55.970 flat angles C4'-P-C4' energy: -56.827 flat angles P-C4'-P energy: -33.700 tors. eta vs tors. theta energy: -1.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 93 Temperature: 1.221429 Total energy: -395.774136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.774136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.774136 (E_RNA) where: Base-Base interactions energy: -189.653 where: short stacking energy: -120.783 Base-Backbone interact. energy: 0.221 local terms energy: -206.342927 where: bonds (distance) C4'-P energy: -51.934 bonds (distance) P-C4' energy: -59.651 flat angles C4'-P-C4' energy: -53.746 flat angles P-C4'-P energy: -22.247 tors. eta vs tors. theta energy: -18.765 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 93 Temperature: 1.285714 Total energy: -296.920482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.920482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.920482 (E_RNA) where: Base-Base interactions energy: -139.756 where: short stacking energy: -94.842 Base-Backbone interact. energy: -0.032 local terms energy: -157.132212 where: bonds (distance) C4'-P energy: -50.827 bonds (distance) P-C4' energy: -55.314 flat angles C4'-P-C4' energy: -36.976 flat angles P-C4'-P energy: -19.025 tors. eta vs tors. theta energy: 5.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -223.410764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.410764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.410764 (E_RNA) where: Base-Base interactions energy: -78.741 where: short stacking energy: -63.926 Base-Backbone interact. energy: -0.633 local terms energy: -144.037024 where: bonds (distance) C4'-P energy: -46.943 bonds (distance) P-C4' energy: -45.305 flat angles C4'-P-C4' energy: -38.869 flat angles P-C4'-P energy: -23.850 tors. eta vs tors. theta energy: 10.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -823.836977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -823.836977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.836977 (E_RNA) where: Base-Base interactions energy: -534.678 where: short stacking energy: -247.090 Base-Backbone interact. energy: 0.642 local terms energy: -289.801081 where: bonds (distance) C4'-P energy: -62.058 bonds (distance) P-C4' energy: -59.066 flat angles C4'-P-C4' energy: -62.175 flat angles P-C4'-P energy: -43.030 tors. eta vs tors. theta energy: -63.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 94 Temperature: 0.964286 Total energy: -731.421559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.421559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.421559 (E_RNA) where: Base-Base interactions energy: -491.912 where: short stacking energy: -225.039 Base-Backbone interact. energy: -1.543 local terms energy: -237.966287 where: bonds (distance) C4'-P energy: -52.048 bonds (distance) P-C4' energy: -53.501 flat angles C4'-P-C4' energy: -60.265 flat angles P-C4'-P energy: -32.560 tors. eta vs tors. theta energy: -39.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 94 Temperature: 1.028571 Total energy: -656.276936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.276936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.276936 (E_RNA) where: Base-Base interactions energy: -398.835 where: short stacking energy: -211.439 Base-Backbone interact. energy: 1.200 local terms energy: -258.642504 where: bonds (distance) C4'-P energy: -55.944 bonds (distance) P-C4' energy: -59.316 flat angles C4'-P-C4' energy: -54.324 flat angles P-C4'-P energy: -39.251 tors. eta vs tors. theta energy: -49.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 94 Temperature: 1.092857 Total energy: -546.864220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.864220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.864220 (E_RNA) where: Base-Base interactions energy: -320.152 where: short stacking energy: -183.280 Base-Backbone interact. energy: -0.754 local terms energy: -225.958184 where: bonds (distance) C4'-P energy: -57.650 bonds (distance) P-C4' energy: -47.656 flat angles C4'-P-C4' energy: -53.745 flat angles P-C4'-P energy: -25.962 tors. eta vs tors. theta energy: -40.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 94 Temperature: 1.157143 Total energy: -388.917527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.917527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.917527 (E_RNA) where: Base-Base interactions energy: -209.046 where: short stacking energy: -150.241 Base-Backbone interact. energy: -0.519 local terms energy: -179.352660 where: bonds (distance) C4'-P energy: -41.656 bonds (distance) P-C4' energy: -46.015 flat angles C4'-P-C4' energy: -41.439 flat angles P-C4'-P energy: -33.510 tors. eta vs tors. theta energy: -16.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 94 Temperature: 1.221429 Total energy: -343.591021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.591021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.591021 (E_RNA) where: Base-Base interactions energy: -167.787 where: short stacking energy: -128.864 Base-Backbone interact. energy: -0.005 local terms energy: -175.799239 where: bonds (distance) C4'-P energy: -52.234 bonds (distance) P-C4' energy: -48.262 flat angles C4'-P-C4' energy: -48.786 flat angles P-C4'-P energy: -15.428 tors. eta vs tors. theta energy: -11.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 94 Temperature: 1.285714 Total energy: -306.623378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.623378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.623378 (E_RNA) where: Base-Base interactions energy: -145.530 where: short stacking energy: -107.034 Base-Backbone interact. energy: 0.073 local terms energy: -161.165864 where: bonds (distance) C4'-P energy: -40.152 bonds (distance) P-C4' energy: -44.378 flat angles C4'-P-C4' energy: -41.604 flat angles P-C4'-P energy: -24.345 tors. eta vs tors. theta energy: -10.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -227.298604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.298604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.298604 (E_RNA) where: Base-Base interactions energy: -84.199 where: short stacking energy: -68.168 Base-Backbone interact. energy: 1.348 local terms energy: -144.447875 where: bonds (distance) C4'-P energy: -44.417 bonds (distance) P-C4' energy: -42.876 flat angles C4'-P-C4' energy: -36.658 flat angles P-C4'-P energy: -32.371 tors. eta vs tors. theta energy: 11.875 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -820.754252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.754252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.754252 (E_RNA) where: Base-Base interactions energy: -535.268 where: short stacking energy: -258.322 Base-Backbone interact. energy: -1.478 local terms energy: -284.007711 where: bonds (distance) C4'-P energy: -61.110 bonds (distance) P-C4' energy: -57.633 flat angles C4'-P-C4' energy: -59.675 flat angles P-C4'-P energy: -40.673 tors. eta vs tors. theta energy: -64.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 95 Temperature: 0.964286 Total energy: -742.215241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.215241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -742.215241 (E_RNA) where: Base-Base interactions energy: -487.165 where: short stacking energy: -218.611 Base-Backbone interact. energy: -0.844 local terms energy: -254.206203 where: bonds (distance) C4'-P energy: -57.747 bonds (distance) P-C4' energy: -57.145 flat angles C4'-P-C4' energy: -53.138 flat angles P-C4'-P energy: -41.062 tors. eta vs tors. theta energy: -45.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 95 Temperature: 1.028571 Total energy: -660.068134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.068134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -660.068134 (E_RNA) where: Base-Base interactions energy: -426.722 where: short stacking energy: -218.788 Base-Backbone interact. energy: -0.291 local terms energy: -233.055248 where: bonds (distance) C4'-P energy: -61.796 bonds (distance) P-C4' energy: -50.190 flat angles C4'-P-C4' energy: -52.863 flat angles P-C4'-P energy: -28.310 tors. eta vs tors. theta energy: -39.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 95 Temperature: 1.092857 Total energy: -541.367029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.367029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.367029 (E_RNA) where: Base-Base interactions energy: -315.465 where: short stacking energy: -192.937 Base-Backbone interact. energy: 1.182 local terms energy: -227.084074 where: bonds (distance) C4'-P energy: -54.476 bonds (distance) P-C4' energy: -45.872 flat angles C4'-P-C4' energy: -58.460 flat angles P-C4'-P energy: -29.749 tors. eta vs tors. theta energy: -38.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 95 Temperature: 1.157143 Total energy: -425.166469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.166469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.166469 (E_RNA) where: Base-Base interactions energy: -210.637 where: short stacking energy: -145.837 Base-Backbone interact. energy: 2.648 local terms energy: -217.177142 where: bonds (distance) C4'-P energy: -58.091 bonds (distance) P-C4' energy: -53.453 flat angles C4'-P-C4' energy: -45.008 flat angles P-C4'-P energy: -40.288 tors. eta vs tors. theta energy: -20.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 95 Temperature: 1.221429 Total energy: -373.849467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.849467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.849467 (E_RNA) where: Base-Base interactions energy: -186.802 where: short stacking energy: -141.666 Base-Backbone interact. energy: -0.291 local terms energy: -186.755966 where: bonds (distance) C4'-P energy: -39.528 bonds (distance) P-C4' energy: -49.411 flat angles C4'-P-C4' energy: -57.736 flat angles P-C4'-P energy: -26.451 tors. eta vs tors. theta energy: -13.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 95 Temperature: 1.285714 Total energy: -296.357032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.357032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.357032 (E_RNA) where: Base-Base interactions energy: -119.243 where: short stacking energy: -70.378 Base-Backbone interact. energy: 2.603 local terms energy: -179.717524 where: bonds (distance) C4'-P energy: -48.037 bonds (distance) P-C4' energy: -58.922 flat angles C4'-P-C4' energy: -43.485 flat angles P-C4'-P energy: -29.650 tors. eta vs tors. theta energy: 0.375 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -254.421608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.421608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.421608 (E_RNA) where: Base-Base interactions energy: -92.818 where: short stacking energy: -86.836 Base-Backbone interact. energy: 0.346 local terms energy: -161.949719 where: bonds (distance) C4'-P energy: -43.827 bonds (distance) P-C4' energy: -55.909 flat angles C4'-P-C4' energy: -41.763 flat angles P-C4'-P energy: -20.747 tors. eta vs tors. theta energy: 0.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -825.085314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -825.085314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -825.085314 (E_RNA) where: Base-Base interactions energy: -553.201 where: short stacking energy: -270.457 Base-Backbone interact. energy: -1.070 local terms energy: -270.814441 where: bonds (distance) C4'-P energy: -51.672 bonds (distance) P-C4' energy: -54.191 flat angles C4'-P-C4' energy: -63.051 flat angles P-C4'-P energy: -34.024 tors. eta vs tors. theta energy: -67.875 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 96 Temperature: 0.964286 Total energy: -735.935617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.935617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.935617 (E_RNA) where: Base-Base interactions energy: -497.038 where: short stacking energy: -238.838 Base-Backbone interact. energy: -0.142 local terms energy: -238.755886 where: bonds (distance) C4'-P energy: -47.743 bonds (distance) P-C4' energy: -60.276 flat angles C4'-P-C4' energy: -54.021 flat angles P-C4'-P energy: -32.159 tors. eta vs tors. theta energy: -44.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 96 Temperature: 1.028571 Total energy: -649.275724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.275724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.275724 (E_RNA) where: Base-Base interactions energy: -406.920 where: short stacking energy: -197.198 Base-Backbone interact. energy: 0.123 local terms energy: -242.478320 where: bonds (distance) C4'-P energy: -50.710 bonds (distance) P-C4' energy: -60.043 flat angles C4'-P-C4' energy: -51.127 flat angles P-C4'-P energy: -40.661 tors. eta vs tors. theta energy: -39.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 96 Temperature: 1.092857 Total energy: -557.703055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.703055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.703055 (E_RNA) where: Base-Base interactions energy: -317.480 where: short stacking energy: -184.931 Base-Backbone interact. energy: 2.557 local terms energy: -242.780186 where: bonds (distance) C4'-P energy: -54.795 bonds (distance) P-C4' energy: -59.801 flat angles C4'-P-C4' energy: -61.452 flat angles P-C4'-P energy: -27.728 tors. eta vs tors. theta energy: -39.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 96 Temperature: 1.157143 Total energy: -389.764319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.764319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.764319 (E_RNA) where: Base-Base interactions energy: -201.725 where: short stacking energy: -128.073 Base-Backbone interact. energy: 0.004 local terms energy: -188.043220 where: bonds (distance) C4'-P energy: -47.031 bonds (distance) P-C4' energy: -61.667 flat angles C4'-P-C4' energy: -46.518 flat angles P-C4'-P energy: -28.357 tors. eta vs tors. theta energy: -4.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 96 Temperature: 1.221429 Total energy: -319.841898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.841898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.841898 (E_RNA) where: Base-Base interactions energy: -143.041 where: short stacking energy: -100.084 Base-Backbone interact. energy: 0.890 local terms energy: -177.690576 where: bonds (distance) C4'-P energy: -43.950 bonds (distance) P-C4' energy: -42.789 flat angles C4'-P-C4' energy: -50.442 flat angles P-C4'-P energy: -32.286 tors. eta vs tors. theta energy: -8.223 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 96 Temperature: 1.285714 Total energy: -314.663194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.663194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.663194 (E_RNA) where: Base-Base interactions energy: -132.480 where: short stacking energy: -85.299 Base-Backbone interact. energy: -0.687 local terms energy: -181.496786 where: bonds (distance) C4'-P energy: -51.403 bonds (distance) P-C4' energy: -50.882 flat angles C4'-P-C4' energy: -46.580 flat angles P-C4'-P energy: -28.888 tors. eta vs tors. theta energy: -3.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -250.028497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.028497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.028497 (E_RNA) where: Base-Base interactions energy: -83.030 where: short stacking energy: -71.581 Base-Backbone interact. energy: 2.282 local terms energy: -169.281386 where: bonds (distance) C4'-P energy: -48.553 bonds (distance) P-C4' energy: -44.998 flat angles C4'-P-C4' energy: -49.394 flat angles P-C4'-P energy: -27.967 tors. eta vs tors. theta energy: 1.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -809.614302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -809.614302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.614302 (E_RNA) where: Base-Base interactions energy: -530.852 where: short stacking energy: -249.416 Base-Backbone interact. energy: 1.912 local terms energy: -280.674371 where: bonds (distance) C4'-P energy: -56.060 bonds (distance) P-C4' energy: -62.237 flat angles C4'-P-C4' energy: -59.852 flat angles P-C4'-P energy: -34.105 tors. eta vs tors. theta energy: -68.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 97 Temperature: 0.964286 Total energy: -731.714515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.714515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.714515 (E_RNA) where: Base-Base interactions energy: -487.011 where: short stacking energy: -225.773 Base-Backbone interact. energy: 0.891 local terms energy: -245.594396 where: bonds (distance) C4'-P energy: -60.245 bonds (distance) P-C4' energy: -51.841 flat angles C4'-P-C4' energy: -52.500 flat angles P-C4'-P energy: -37.884 tors. eta vs tors. theta energy: -43.125 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 97 Temperature: 1.028571 Total energy: -635.833027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.833027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.833027 (E_RNA) where: Base-Base interactions energy: -399.441 where: short stacking energy: -210.952 Base-Backbone interact. energy: 2.878 local terms energy: -239.270217 where: bonds (distance) C4'-P energy: -44.894 bonds (distance) P-C4' energy: -56.905 flat angles C4'-P-C4' energy: -50.739 flat angles P-C4'-P energy: -40.663 tors. eta vs tors. theta energy: -46.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 97 Temperature: 1.092857 Total energy: -552.286525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.286525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.286525 (E_RNA) where: Base-Base interactions energy: -323.092 where: short stacking energy: -165.061 Base-Backbone interact. energy: 2.496 local terms energy: -231.690797 where: bonds (distance) C4'-P energy: -51.918 bonds (distance) P-C4' energy: -53.811 flat angles C4'-P-C4' energy: -59.669 flat angles P-C4'-P energy: -35.390 tors. eta vs tors. theta energy: -30.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 97 Temperature: 1.157143 Total energy: -432.560973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.560973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.560973 (E_RNA) where: Base-Base interactions energy: -218.728 where: short stacking energy: -148.824 Base-Backbone interact. energy: -0.402 local terms energy: -213.431018 where: bonds (distance) C4'-P energy: -49.361 bonds (distance) P-C4' energy: -50.831 flat angles C4'-P-C4' energy: -49.834 flat angles P-C4'-P energy: -33.894 tors. eta vs tors. theta energy: -29.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 97 Temperature: 1.221429 Total energy: -347.210082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.210082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.210082 (E_RNA) where: Base-Base interactions energy: -162.814 where: short stacking energy: -120.868 Base-Backbone interact. energy: -0.344 local terms energy: -184.051599 where: bonds (distance) C4'-P energy: -39.814 bonds (distance) P-C4' energy: -48.168 flat angles C4'-P-C4' energy: -52.511 flat angles P-C4'-P energy: -32.093 tors. eta vs tors. theta energy: -11.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 97 Temperature: 1.285714 Total energy: -309.072972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.072972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.072972 (E_RNA) where: Base-Base interactions energy: -132.805 where: short stacking energy: -89.794 Base-Backbone interact. energy: 1.176 local terms energy: -177.444206 where: bonds (distance) C4'-P energy: -51.148 bonds (distance) P-C4' energy: -57.861 flat angles C4'-P-C4' energy: -31.554 flat angles P-C4'-P energy: -26.561 tors. eta vs tors. theta energy: -10.321 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -205.886399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.886399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.886399 (E_RNA) where: Base-Base interactions energy: -68.455 where: short stacking energy: -59.259 Base-Backbone interact. energy: 2.258 local terms energy: -139.689385 where: bonds (distance) C4'-P energy: -55.197 bonds (distance) P-C4' energy: -57.507 flat angles C4'-P-C4' energy: -23.196 flat angles P-C4'-P energy: -24.679 tors. eta vs tors. theta energy: 20.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -819.841809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.841809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.841809 (E_RNA) where: Base-Base interactions energy: -532.849 where: short stacking energy: -266.894 Base-Backbone interact. energy: -1.249 local terms energy: -285.743707 where: bonds (distance) C4'-P energy: -59.640 bonds (distance) P-C4' energy: -61.628 flat angles C4'-P-C4' energy: -62.201 flat angles P-C4'-P energy: -36.149 tors. eta vs tors. theta energy: -66.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 98 Temperature: 0.964286 Total energy: -736.907867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.907867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.907867 (E_RNA) where: Base-Base interactions energy: -485.062 where: short stacking energy: -231.526 Base-Backbone interact. energy: -1.174 local terms energy: -250.671723 where: bonds (distance) C4'-P energy: -49.863 bonds (distance) P-C4' energy: -49.009 flat angles C4'-P-C4' energy: -65.671 flat angles P-C4'-P energy: -37.143 tors. eta vs tors. theta energy: -48.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 98 Temperature: 1.028571 Total energy: -646.568980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -646.568980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.568980 (E_RNA) where: Base-Base interactions energy: -394.104 where: short stacking energy: -201.032 Base-Backbone interact. energy: -0.741 local terms energy: -251.723481 where: bonds (distance) C4'-P energy: -52.066 bonds (distance) P-C4' energy: -65.957 flat angles C4'-P-C4' energy: -61.729 flat angles P-C4'-P energy: -35.875 tors. eta vs tors. theta energy: -36.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 98 Temperature: 1.092857 Total energy: -539.242413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.242413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.242413 (E_RNA) where: Base-Base interactions energy: -321.333 where: short stacking energy: -165.977 Base-Backbone interact. energy: 0.784 local terms energy: -218.693184 where: bonds (distance) C4'-P energy: -61.170 bonds (distance) P-C4' energy: -54.002 flat angles C4'-P-C4' energy: -47.482 flat angles P-C4'-P energy: -28.117 tors. eta vs tors. theta energy: -27.923 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 98 Temperature: 1.157143 Total energy: -383.811388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.811388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.811388 (E_RNA) where: Base-Base interactions energy: -193.379 where: short stacking energy: -119.125 Base-Backbone interact. energy: -1.391 local terms energy: -189.041370 where: bonds (distance) C4'-P energy: -39.172 bonds (distance) P-C4' energy: -57.528 flat angles C4'-P-C4' energy: -52.915 flat angles P-C4'-P energy: -36.426 tors. eta vs tors. theta energy: -3.000 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 98 Temperature: 1.221429 Total energy: -346.787265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.787265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.787265 (E_RNA) where: Base-Base interactions energy: -152.290 where: short stacking energy: -104.733 Base-Backbone interact. energy: -0.061 local terms energy: -194.436231 where: bonds (distance) C4'-P energy: -47.739 bonds (distance) P-C4' energy: -53.058 flat angles C4'-P-C4' energy: -33.448 flat angles P-C4'-P energy: -44.269 tors. eta vs tors. theta energy: -15.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 98 Temperature: 1.285714 Total energy: -278.282135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.282135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.282135 (E_RNA) where: Base-Base interactions energy: -116.307 where: short stacking energy: -88.368 Base-Backbone interact. energy: 1.895 local terms energy: -163.870165 where: bonds (distance) C4'-P energy: -48.438 bonds (distance) P-C4' energy: -50.414 flat angles C4'-P-C4' energy: -50.379 flat angles P-C4'-P energy: -10.612 tors. eta vs tors. theta energy: -4.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -237.822847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.822847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.822847 (E_RNA) where: Base-Base interactions energy: -78.625 where: short stacking energy: -69.299 Base-Backbone interact. energy: 2.536 local terms energy: -161.733326 where: bonds (distance) C4'-P energy: -45.835 bonds (distance) P-C4' energy: -50.250 flat angles C4'-P-C4' energy: -43.259 flat angles P-C4'-P energy: -32.113 tors. eta vs tors. theta energy: 9.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -811.472384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -811.472384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -811.472384 (E_RNA) where: Base-Base interactions energy: -536.663 where: short stacking energy: -259.229 Base-Backbone interact. energy: -1.290 local terms energy: -273.519569 where: bonds (distance) C4'-P energy: -50.146 bonds (distance) P-C4' energy: -59.689 flat angles C4'-P-C4' energy: -64.370 flat angles P-C4'-P energy: -35.584 tors. eta vs tors. theta energy: -63.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 99 Temperature: 0.964286 Total energy: -749.873329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -749.873329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.873329 (E_RNA) where: Base-Base interactions energy: -509.617 where: short stacking energy: -230.836 Base-Backbone interact. energy: 0.051 local terms energy: -240.306969 where: bonds (distance) C4'-P energy: -56.836 bonds (distance) P-C4' energy: -56.133 flat angles C4'-P-C4' energy: -52.850 flat angles P-C4'-P energy: -35.795 tors. eta vs tors. theta energy: -38.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 99 Temperature: 1.028571 Total energy: -644.706589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.706589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.706589 (E_RNA) where: Base-Base interactions energy: -395.669 where: short stacking energy: -213.771 Base-Backbone interact. energy: -1.124 local terms energy: -247.913459 where: bonds (distance) C4'-P energy: -51.474 bonds (distance) P-C4' energy: -47.195 flat angles C4'-P-C4' energy: -62.191 flat angles P-C4'-P energy: -41.506 tors. eta vs tors. theta energy: -45.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 99 Temperature: 1.092857 Total energy: -543.597206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.597206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.597206 (E_RNA) where: Base-Base interactions energy: -334.045 where: short stacking energy: -174.888 Base-Backbone interact. energy: -0.584 local terms energy: -208.968138 where: bonds (distance) C4'-P energy: -43.875 bonds (distance) P-C4' energy: -49.801 flat angles C4'-P-C4' energy: -52.615 flat angles P-C4'-P energy: -30.115 tors. eta vs tors. theta energy: -32.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 99 Temperature: 1.157143 Total energy: -408.279898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.279898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.279898 (E_RNA) where: Base-Base interactions energy: -206.143 where: short stacking energy: -130.400 Base-Backbone interact. energy: -0.406 local terms energy: -201.730561 where: bonds (distance) C4'-P energy: -46.206 bonds (distance) P-C4' energy: -57.959 flat angles C4'-P-C4' energy: -53.322 flat angles P-C4'-P energy: -25.821 tors. eta vs tors. theta energy: -18.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 99 Temperature: 1.221429 Total energy: -341.376422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.376422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.376422 (E_RNA) where: Base-Base interactions energy: -157.211 where: short stacking energy: -103.130 Base-Backbone interact. energy: -0.203 local terms energy: -183.961969 where: bonds (distance) C4'-P energy: -46.997 bonds (distance) P-C4' energy: -61.627 flat angles C4'-P-C4' energy: -45.735 flat angles P-C4'-P energy: -26.319 tors. eta vs tors. theta energy: -3.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 99 Temperature: 1.285714 Total energy: -255.181777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.181777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.181777 (E_RNA) where: Base-Base interactions energy: -88.829 where: short stacking energy: -66.661 Base-Backbone interact. energy: -0.518 local terms energy: -165.834895 where: bonds (distance) C4'-P energy: -47.833 bonds (distance) P-C4' energy: -48.999 flat angles C4'-P-C4' energy: -44.844 flat angles P-C4'-P energy: -22.994 tors. eta vs tors. theta energy: -1.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -207.987330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.987330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.987330 (E_RNA) where: Base-Base interactions energy: -75.943 where: short stacking energy: -65.267 Base-Backbone interact. energy: 5.529 local terms energy: -137.573103 where: bonds (distance) C4'-P energy: -38.041 bonds (distance) P-C4' energy: -50.186 flat angles C4'-P-C4' energy: -40.955 flat angles P-C4'-P energy: -19.870 tors. eta vs tors. theta energy: 11.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -766.515061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.515061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.515061 (E_RNA) where: Base-Base interactions energy: -523.044 where: short stacking energy: -243.557 Base-Backbone interact. energy: -1.641 local terms energy: -241.829272 where: bonds (distance) C4'-P energy: -53.186 bonds (distance) P-C4' energy: -62.399 flat angles C4'-P-C4' energy: -55.374 flat angles P-C4'-P energy: -23.524 tors. eta vs tors. theta energy: -47.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 100 Temperature: 0.964286 Total energy: -775.431176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.431176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.431176 (E_RNA) where: Base-Base interactions energy: -511.545 where: short stacking energy: -232.044 Base-Backbone interact. energy: -1.381 local terms energy: -262.505131 where: bonds (distance) C4'-P energy: -45.780 bonds (distance) P-C4' energy: -59.560 flat angles C4'-P-C4' energy: -55.430 flat angles P-C4'-P energy: -39.676 tors. eta vs tors. theta energy: -62.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 100 Temperature: 1.028571 Total energy: -659.660022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.660022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.660022 (E_RNA) where: Base-Base interactions energy: -412.132 where: short stacking energy: -218.826 Base-Backbone interact. energy: -1.119 local terms energy: -246.409542 where: bonds (distance) C4'-P energy: -54.222 bonds (distance) P-C4' energy: -56.956 flat angles C4'-P-C4' energy: -53.526 flat angles P-C4'-P energy: -37.474 tors. eta vs tors. theta energy: -44.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 100 Temperature: 1.092857 Total energy: -517.141202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.141202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.141202 (E_RNA) where: Base-Base interactions energy: -290.422 where: short stacking energy: -169.319 Base-Backbone interact. energy: 2.256 local terms energy: -228.975091 where: bonds (distance) C4'-P energy: -47.204 bonds (distance) P-C4' energy: -48.074 flat angles C4'-P-C4' energy: -56.830 flat angles P-C4'-P energy: -42.737 tors. eta vs tors. theta energy: -34.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 100 Temperature: 1.157143 Total energy: -390.845248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.845248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.845248 (E_RNA) where: Base-Base interactions energy: -206.934 where: short stacking energy: -138.162 Base-Backbone interact. energy: -1.296 local terms energy: -182.614838 where: bonds (distance) C4'-P energy: -50.623 bonds (distance) P-C4' energy: -45.170 flat angles C4'-P-C4' energy: -39.205 flat angles P-C4'-P energy: -27.201 tors. eta vs tors. theta energy: -20.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 100 Temperature: 1.221429 Total energy: -360.596646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.596646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.596646 (E_RNA) where: Base-Base interactions energy: -184.347 where: short stacking energy: -123.313 Base-Backbone interact. energy: -0.360 local terms energy: -175.889528 where: bonds (distance) C4'-P energy: -47.723 bonds (distance) P-C4' energy: -42.727 flat angles C4'-P-C4' energy: -50.041 flat angles P-C4'-P energy: -32.007 tors. eta vs tors. theta energy: -3.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 100 Temperature: 1.285714 Total energy: -247.828868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.828868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.828868 (E_RNA) where: Base-Base interactions energy: -92.787 where: short stacking energy: -70.851 Base-Backbone interact. energy: -0.561 local terms energy: -154.480076 where: bonds (distance) C4'-P energy: -36.582 bonds (distance) P-C4' energy: -45.301 flat angles C4'-P-C4' energy: -39.306 flat angles P-C4'-P energy: -36.435 tors. eta vs tors. theta energy: 3.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -251.604392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.604392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.604392 (E_RNA) where: Base-Base interactions energy: -103.941 where: short stacking energy: -92.450 Base-Backbone interact. energy: -0.910 local terms energy: -146.753516 where: bonds (distance) C4'-P energy: -44.118 bonds (distance) P-C4' energy: -44.111 flat angles C4'-P-C4' energy: -40.230 flat angles P-C4'-P energy: -19.270 tors. eta vs tors. theta energy: 0.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -773.676388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -773.676388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -773.676388 (E_RNA) where: Base-Base interactions energy: -523.891 where: short stacking energy: -241.308 Base-Backbone interact. energy: -1.136 local terms energy: -248.648898 where: bonds (distance) C4'-P energy: -57.812 bonds (distance) P-C4' energy: -58.573 flat angles C4'-P-C4' energy: -48.503 flat angles P-C4'-P energy: -32.433 tors. eta vs tors. theta energy: -51.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 101 Temperature: 0.964286 Total energy: -770.166682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.166682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.166682 (E_RNA) where: Base-Base interactions energy: -521.829 where: short stacking energy: -238.102 Base-Backbone interact. energy: -1.599 local terms energy: -246.738826 where: bonds (distance) C4'-P energy: -48.517 bonds (distance) P-C4' energy: -53.521 flat angles C4'-P-C4' energy: -54.657 flat angles P-C4'-P energy: -29.138 tors. eta vs tors. theta energy: -60.906 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 101 Temperature: 1.028571 Total energy: -653.893198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.893198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.893198 (E_RNA) where: Base-Base interactions energy: -406.031 where: short stacking energy: -216.706 Base-Backbone interact. energy: 1.639 local terms energy: -249.500712 where: bonds (distance) C4'-P energy: -49.350 bonds (distance) P-C4' energy: -62.512 flat angles C4'-P-C4' energy: -60.554 flat angles P-C4'-P energy: -29.536 tors. eta vs tors. theta energy: -47.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 101 Temperature: 1.092857 Total energy: -523.517039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.517039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.517039 (E_RNA) where: Base-Base interactions energy: -291.631 where: short stacking energy: -171.384 Base-Backbone interact. energy: 1.376 local terms energy: -233.261389 where: bonds (distance) C4'-P energy: -57.915 bonds (distance) P-C4' energy: -51.800 flat angles C4'-P-C4' energy: -58.542 flat angles P-C4'-P energy: -32.581 tors. eta vs tors. theta energy: -32.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 101 Temperature: 1.157143 Total energy: -389.696632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.696632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.696632 (E_RNA) where: Base-Base interactions energy: -197.110 where: short stacking energy: -124.435 Base-Backbone interact. energy: -1.251 local terms energy: -191.335684 where: bonds (distance) C4'-P energy: -42.701 bonds (distance) P-C4' energy: -50.190 flat angles C4'-P-C4' energy: -51.151 flat angles P-C4'-P energy: -28.185 tors. eta vs tors. theta energy: -19.109 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 101 Temperature: 1.221429 Total energy: -376.414179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.414179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.414179 (E_RNA) where: Base-Base interactions energy: -169.241 where: short stacking energy: -129.119 Base-Backbone interact. energy: 0.982 local terms energy: -208.155253 where: bonds (distance) C4'-P energy: -51.874 bonds (distance) P-C4' energy: -59.732 flat angles C4'-P-C4' energy: -49.501 flat angles P-C4'-P energy: -30.175 tors. eta vs tors. theta energy: -16.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 101 Temperature: 1.285714 Total energy: -288.634327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.634327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.634327 (E_RNA) where: Base-Base interactions energy: -110.246 where: short stacking energy: -101.920 Base-Backbone interact. energy: -0.731 local terms energy: -177.657092 where: bonds (distance) C4'-P energy: -41.408 bonds (distance) P-C4' energy: -51.321 flat angles C4'-P-C4' energy: -58.516 flat angles P-C4'-P energy: -21.244 tors. eta vs tors. theta energy: -5.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -233.117361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.117361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.117361 (E_RNA) where: Base-Base interactions energy: -86.184 where: short stacking energy: -87.684 Base-Backbone interact. energy: -0.322 local terms energy: -146.611102 where: bonds (distance) C4'-P energy: -48.351 bonds (distance) P-C4' energy: -41.043 flat angles C4'-P-C4' energy: -37.673 flat angles P-C4'-P energy: -28.333 tors. eta vs tors. theta energy: 8.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 102 Temperature: 0.900000 Total energy: -790.260422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -790.260422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.260422 (E_RNA) where: Base-Base interactions energy: -542.045 where: short stacking energy: -252.952 Base-Backbone interact. energy: 0.475 local terms energy: -248.690258 where: bonds (distance) C4'-P energy: -58.255 bonds (distance) P-C4' energy: -54.725 flat angles C4'-P-C4' energy: -52.317 flat angles P-C4'-P energy: -33.387 tors. eta vs tors. theta energy: -50.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 102 Temperature: 0.964286 Total energy: -758.945808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.945808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.945808 (E_RNA) where: Base-Base interactions energy: -511.784 where: short stacking energy: -236.972 Base-Backbone interact. energy: -0.993 local terms energy: -246.168998 where: bonds (distance) C4'-P energy: -53.442 bonds (distance) P-C4' energy: -56.156 flat angles C4'-P-C4' energy: -49.856 flat angles P-C4'-P energy: -30.155 tors. eta vs tors. theta energy: -56.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 102 Temperature: 1.028571 Total energy: -650.487298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.487298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.487298 (E_RNA) where: Base-Base interactions energy: -400.814 where: short stacking energy: -210.870 Base-Backbone interact. energy: -0.781 local terms energy: -248.892851 where: bonds (distance) C4'-P energy: -47.077 bonds (distance) P-C4' energy: -53.110 flat angles C4'-P-C4' energy: -58.633 flat angles P-C4'-P energy: -37.462 tors. eta vs tors. theta energy: -52.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 102 Temperature: 1.092857 Total energy: -484.173697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.173697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.173697 (E_RNA) where: Base-Base interactions energy: -266.059 where: short stacking energy: -140.639 Base-Backbone interact. energy: -0.961 local terms energy: -217.154471 where: bonds (distance) C4'-P energy: -48.553 bonds (distance) P-C4' energy: -61.223 flat angles C4'-P-C4' energy: -55.442 flat angles P-C4'-P energy: -33.416 tors. eta vs tors. theta energy: -18.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 102 Temperature: 1.157143 Total energy: -371.911989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.911989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.911989 (E_RNA) where: Base-Base interactions energy: -179.875 where: short stacking energy: -99.456 Base-Backbone interact. energy: -1.698 local terms energy: -190.339148 where: bonds (distance) C4'-P energy: -62.664 bonds (distance) P-C4' energy: -52.800 flat angles C4'-P-C4' energy: -50.642 flat angles P-C4'-P energy: -24.591 tors. eta vs tors. theta energy: 0.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 102 Temperature: 1.221429 Total energy: -339.698194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.698194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.698194 (E_RNA) where: Base-Base interactions energy: -165.102 where: short stacking energy: -107.473 Base-Backbone interact. energy: -1.319 local terms energy: -173.277620 where: bonds (distance) C4'-P energy: -49.881 bonds (distance) P-C4' energy: -56.489 flat angles C4'-P-C4' energy: -36.067 flat angles P-C4'-P energy: -25.372 tors. eta vs tors. theta energy: -5.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 102 Temperature: 1.285714 Total energy: -226.536411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.536411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.536411 (E_RNA) where: Base-Base interactions energy: -80.197 where: short stacking energy: -61.765 Base-Backbone interact. energy: -1.626 local terms energy: -144.713509 where: bonds (distance) C4'-P energy: -45.921 bonds (distance) P-C4' energy: -44.867 flat angles C4'-P-C4' energy: -26.230 flat angles P-C4'-P energy: -30.926 tors. eta vs tors. theta energy: 3.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 102 Temperature: 1.350000 Total energy: -247.060481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.060481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.060481 (E_RNA) where: Base-Base interactions energy: -77.407 where: short stacking energy: -73.823 Base-Backbone interact. energy: -1.234 local terms energy: -168.419354 where: bonds (distance) C4'-P energy: -48.134 bonds (distance) P-C4' energy: -57.146 flat angles C4'-P-C4' energy: -33.215 flat angles P-C4'-P energy: -23.348 tors. eta vs tors. theta energy: -6.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 103 Temperature: 0.900000 Total energy: -772.758830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.758830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.758830 (E_RNA) where: Base-Base interactions energy: -526.720 where: short stacking energy: -221.962 Base-Backbone interact. energy: -0.906 local terms energy: -245.133336 where: bonds (distance) C4'-P energy: -60.270 bonds (distance) P-C4' energy: -61.646 flat angles C4'-P-C4' energy: -54.171 flat angles P-C4'-P energy: -31.482 tors. eta vs tors. theta energy: -37.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 103 Temperature: 0.964286 Total energy: -760.547040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -760.547040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.547040 (E_RNA) where: Base-Base interactions energy: -515.945 where: short stacking energy: -224.077 Base-Backbone interact. energy: -0.408 local terms energy: -244.193577 where: bonds (distance) C4'-P energy: -47.288 bonds (distance) P-C4' energy: -50.516 flat angles C4'-P-C4' energy: -57.124 flat angles P-C4'-P energy: -41.245 tors. eta vs tors. theta energy: -48.021 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 103 Temperature: 1.028571 Total energy: -674.627993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.627993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.627993 (E_RNA) where: Base-Base interactions energy: -411.527 where: short stacking energy: -210.976 Base-Backbone interact. energy: 0.484 local terms energy: -263.584675 where: bonds (distance) C4'-P energy: -54.051 bonds (distance) P-C4' energy: -61.316 flat angles C4'-P-C4' energy: -64.577 flat angles P-C4'-P energy: -40.607 tors. eta vs tors. theta energy: -43.033 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 103 Temperature: 1.092857 Total energy: -503.207692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.207692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.207692 (E_RNA) where: Base-Base interactions energy: -275.223 where: short stacking energy: -144.929 Base-Backbone interact. energy: -1.247 local terms energy: -226.737590 where: bonds (distance) C4'-P energy: -54.690 bonds (distance) P-C4' energy: -49.389 flat angles C4'-P-C4' energy: -56.102 flat angles P-C4'-P energy: -39.190 tors. eta vs tors. theta energy: -27.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 103 Temperature: 1.157143 Total energy: -425.774073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.774073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.774073 (E_RNA) where: Base-Base interactions energy: -214.272 where: short stacking energy: -139.947 Base-Backbone interact. energy: -1.511 local terms energy: -209.991288 where: bonds (distance) C4'-P energy: -52.778 bonds (distance) P-C4' energy: -42.968 flat angles C4'-P-C4' energy: -60.812 flat angles P-C4'-P energy: -32.531 tors. eta vs tors. theta energy: -20.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 103 Temperature: 1.221429 Total energy: -309.254894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.254894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.254894 (E_RNA) where: Base-Base interactions energy: -130.863 where: short stacking energy: -88.769 Base-Backbone interact. energy: 0.327 local terms energy: -178.718263 where: bonds (distance) C4'-P energy: -48.437 bonds (distance) P-C4' energy: -53.483 flat angles C4'-P-C4' energy: -52.126 flat angles P-C4'-P energy: -27.467 tors. eta vs tors. theta energy: 2.795 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 103 Temperature: 1.285714 Total energy: -269.007393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.007393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.007393 (E_RNA) where: Base-Base interactions energy: -113.478 where: short stacking energy: -94.818 Base-Backbone interact. energy: 1.813 local terms energy: -157.342800 where: bonds (distance) C4'-P energy: -47.622 bonds (distance) P-C4' energy: -55.096 flat angles C4'-P-C4' energy: -26.598 flat angles P-C4'-P energy: -27.389 tors. eta vs tors. theta energy: -0.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 103 Temperature: 1.350000 Total energy: -270.694637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.694637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.694637 (E_RNA) where: Base-Base interactions energy: -102.157 where: short stacking energy: -98.244 Base-Backbone interact. energy: 1.059 local terms energy: -169.597112 where: bonds (distance) C4'-P energy: -36.902 bonds (distance) P-C4' energy: -55.452 flat angles C4'-P-C4' energy: -34.074 flat angles P-C4'-P energy: -32.038 tors. eta vs tors. theta energy: -11.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 104 Temperature: 0.900000 Total energy: -780.398428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -780.398428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.398428 (E_RNA) where: Base-Base interactions energy: -514.084 where: short stacking energy: -218.074 Base-Backbone interact. energy: 0.253 local terms energy: -266.567482 where: bonds (distance) C4'-P energy: -58.043 bonds (distance) P-C4' energy: -58.522 flat angles C4'-P-C4' energy: -57.408 flat angles P-C4'-P energy: -42.788 tors. eta vs tors. theta energy: -49.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 104 Temperature: 0.964286 Total energy: -744.749876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.749876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.749876 (E_RNA) where: Base-Base interactions energy: -510.975 where: short stacking energy: -226.400 Base-Backbone interact. energy: -1.481 local terms energy: -232.293917 where: bonds (distance) C4'-P energy: -51.127 bonds (distance) P-C4' energy: -59.127 flat angles C4'-P-C4' energy: -49.401 flat angles P-C4'-P energy: -35.305 tors. eta vs tors. theta energy: -37.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 104 Temperature: 1.028571 Total energy: -633.961925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.961925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.961925 (E_RNA) where: Base-Base interactions energy: -399.367 where: short stacking energy: -215.480 Base-Backbone interact. energy: -1.957 local terms energy: -232.638193 where: bonds (distance) C4'-P energy: -50.021 bonds (distance) P-C4' energy: -59.132 flat angles C4'-P-C4' energy: -46.372 flat angles P-C4'-P energy: -29.368 tors. eta vs tors. theta energy: -47.746 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 104 Temperature: 1.092857 Total energy: -513.870950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.870950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.870950 (E_RNA) where: Base-Base interactions energy: -297.454 where: short stacking energy: -176.052 Base-Backbone interact. energy: -2.297 local terms energy: -214.119994 where: bonds (distance) C4'-P energy: -38.821 bonds (distance) P-C4' energy: -51.412 flat angles C4'-P-C4' energy: -59.476 flat angles P-C4'-P energy: -30.826 tors. eta vs tors. theta energy: -33.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 104 Temperature: 1.157143 Total energy: -431.710951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.710951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.710951 (E_RNA) where: Base-Base interactions energy: -236.151 where: short stacking energy: -142.787 Base-Backbone interact. energy: -1.797 local terms energy: -193.762775 where: bonds (distance) C4'-P energy: -42.092 bonds (distance) P-C4' energy: -62.451 flat angles C4'-P-C4' energy: -44.209 flat angles P-C4'-P energy: -28.480 tors. eta vs tors. theta energy: -16.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 104 Temperature: 1.221429 Total energy: -320.260677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.260677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.260677 (E_RNA) where: Base-Base interactions energy: -132.334 where: short stacking energy: -105.556 Base-Backbone interact. energy: -1.034 local terms energy: -186.891881 where: bonds (distance) C4'-P energy: -58.226 bonds (distance) P-C4' energy: -52.360 flat angles C4'-P-C4' energy: -42.067 flat angles P-C4'-P energy: -30.268 tors. eta vs tors. theta energy: -3.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 104 Temperature: 1.285714 Total energy: -226.990651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.990651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.990651 (E_RNA) where: Base-Base interactions energy: -85.644 where: short stacking energy: -62.324 Base-Backbone interact. energy: -0.298 local terms energy: -141.049081 where: bonds (distance) C4'-P energy: -48.017 bonds (distance) P-C4' energy: -48.516 flat angles C4'-P-C4' energy: -38.034 flat angles P-C4'-P energy: -23.323 tors. eta vs tors. theta energy: 16.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 104 Temperature: 1.350000 Total energy: -229.346321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.346321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.346321 (E_RNA) where: Base-Base interactions energy: -69.946 where: short stacking energy: -63.120 Base-Backbone interact. energy: -1.205 local terms energy: -158.195550 where: bonds (distance) C4'-P energy: -53.880 bonds (distance) P-C4' energy: -54.563 flat angles C4'-P-C4' energy: -36.580 flat angles P-C4'-P energy: -28.336 tors. eta vs tors. theta energy: 15.163 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 105 Temperature: 0.900000 Total energy: -782.818515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.818515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.818515 (E_RNA) where: Base-Base interactions energy: -518.666 where: short stacking energy: -237.111 Base-Backbone interact. energy: -1.763 local terms energy: -262.389522 where: bonds (distance) C4'-P energy: -51.969 bonds (distance) P-C4' energy: -51.962 flat angles C4'-P-C4' energy: -63.301 flat angles P-C4'-P energy: -38.538 tors. eta vs tors. theta energy: -56.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 105 Temperature: 0.964286 Total energy: -734.512321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.512321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.512321 (E_RNA) where: Base-Base interactions energy: -487.093 where: short stacking energy: -212.514 Base-Backbone interact. energy: 0.022 local terms energy: -247.440994 where: bonds (distance) C4'-P energy: -58.264 bonds (distance) P-C4' energy: -65.507 flat angles C4'-P-C4' energy: -50.650 flat angles P-C4'-P energy: -34.557 tors. eta vs tors. theta energy: -38.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 105 Temperature: 1.028571 Total energy: -627.949739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -627.949739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -627.949739 (E_RNA) where: Base-Base interactions energy: -397.184 where: short stacking energy: -199.566 Base-Backbone interact. energy: -0.858 local terms energy: -229.993300 where: bonds (distance) C4'-P energy: -48.507 bonds (distance) P-C4' energy: -55.995 flat angles C4'-P-C4' energy: -47.927 flat angles P-C4'-P energy: -31.415 tors. eta vs tors. theta energy: -46.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.086 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 105 Temperature: 1.092857 Total energy: -536.919820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.919820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.919820 (E_RNA) where: Base-Base interactions energy: -309.755 where: short stacking energy: -178.928 Base-Backbone interact. energy: -0.574 local terms energy: -226.590718 where: bonds (distance) C4'-P energy: -59.198 bonds (distance) P-C4' energy: -48.741 flat angles C4'-P-C4' energy: -40.993 flat angles P-C4'-P energy: -37.818 tors. eta vs tors. theta energy: -39.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 105 Temperature: 1.157143 Total energy: -387.375544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.375544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.375544 (E_RNA) where: Base-Base interactions energy: -191.868 where: short stacking energy: -131.037 Base-Backbone interact. energy: -1.937 local terms energy: -193.570595 where: bonds (distance) C4'-P energy: -54.590 bonds (distance) P-C4' energy: -53.987 flat angles C4'-P-C4' energy: -45.118 flat angles P-C4'-P energy: -28.526 tors. eta vs tors. theta energy: -11.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 105 Temperature: 1.221429 Total energy: -330.264232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.264232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.264232 (E_RNA) where: Base-Base interactions energy: -156.821 where: short stacking energy: -107.386 Base-Backbone interact. energy: -1.214 local terms energy: -172.228807 where: bonds (distance) C4'-P energy: -50.503 bonds (distance) P-C4' energy: -40.531 flat angles C4'-P-C4' energy: -49.589 flat angles P-C4'-P energy: -21.158 tors. eta vs tors. theta energy: -10.447 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 105 Temperature: 1.285714 Total energy: -253.755537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.755537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.755537 (E_RNA) where: Base-Base interactions energy: -80.684 where: short stacking energy: -69.412 Base-Backbone interact. energy: 3.148 local terms energy: -176.219070 where: bonds (distance) C4'-P energy: -49.813 bonds (distance) P-C4' energy: -51.743 flat angles C4'-P-C4' energy: -46.585 flat angles P-C4'-P energy: -32.862 tors. eta vs tors. theta energy: 4.784 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 105 Temperature: 1.350000 Total energy: -240.596197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.596197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.596197 (E_RNA) where: Base-Base interactions energy: -89.792 where: short stacking energy: -87.898 Base-Backbone interact. energy: 4.415 local terms energy: -155.218961 where: bonds (distance) C4'-P energy: -50.642 bonds (distance) P-C4' energy: -48.700 flat angles C4'-P-C4' energy: -38.438 flat angles P-C4'-P energy: -24.596 tors. eta vs tors. theta energy: 7.158 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 106 Temperature: 0.900000 Total energy: -797.789643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.789643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.789643 (E_RNA) where: Base-Base interactions energy: -512.331 where: short stacking energy: -224.307 Base-Backbone interact. energy: -1.845 local terms energy: -283.613243 where: bonds (distance) C4'-P energy: -59.461 bonds (distance) P-C4' energy: -60.063 flat angles C4'-P-C4' energy: -61.515 flat angles P-C4'-P energy: -47.214 tors. eta vs tors. theta energy: -55.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 106 Temperature: 0.964286 Total energy: -738.255009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.255009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.255009 (E_RNA) where: Base-Base interactions energy: -485.059 where: short stacking energy: -223.416 Base-Backbone interact. energy: -0.223 local terms energy: -252.973051 where: bonds (distance) C4'-P energy: -50.377 bonds (distance) P-C4' energy: -62.563 flat angles C4'-P-C4' energy: -58.549 flat angles P-C4'-P energy: -36.263 tors. eta vs tors. theta energy: -45.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 106 Temperature: 1.028571 Total energy: -637.195816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -637.195816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.195816 (E_RNA) where: Base-Base interactions energy: -404.937 where: short stacking energy: -204.822 Base-Backbone interact. energy: 0.662 local terms energy: -232.920555 where: bonds (distance) C4'-P energy: -46.139 bonds (distance) P-C4' energy: -61.320 flat angles C4'-P-C4' energy: -48.978 flat angles P-C4'-P energy: -34.189 tors. eta vs tors. theta energy: -42.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 106 Temperature: 1.092857 Total energy: -542.552271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.552271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.552271 (E_RNA) where: Base-Base interactions energy: -305.652 where: short stacking energy: -154.102 Base-Backbone interact. energy: -0.749 local terms energy: -236.150650 where: bonds (distance) C4'-P energy: -52.428 bonds (distance) P-C4' energy: -54.318 flat angles C4'-P-C4' energy: -61.177 flat angles P-C4'-P energy: -32.912 tors. eta vs tors. theta energy: -35.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 106 Temperature: 1.157143 Total energy: -462.540673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.540673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.540673 (E_RNA) where: Base-Base interactions energy: -252.734 where: short stacking energy: -143.011 Base-Backbone interact. energy: -1.568 local terms energy: -208.238814 where: bonds (distance) C4'-P energy: -48.579 bonds (distance) P-C4' energy: -65.414 flat angles C4'-P-C4' energy: -43.094 flat angles P-C4'-P energy: -29.380 tors. eta vs tors. theta energy: -21.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 106 Temperature: 1.221429 Total energy: -310.525130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.525130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.525130 (E_RNA) where: Base-Base interactions energy: -141.314 where: short stacking energy: -104.623 Base-Backbone interact. energy: 2.057 local terms energy: -171.268350 where: bonds (distance) C4'-P energy: -46.178 bonds (distance) P-C4' energy: -55.015 flat angles C4'-P-C4' energy: -45.373 flat angles P-C4'-P energy: -22.877 tors. eta vs tors. theta energy: -1.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 106 Temperature: 1.285714 Total energy: -240.529388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.529388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.529388 (E_RNA) where: Base-Base interactions energy: -83.181 where: short stacking energy: -77.044 Base-Backbone interact. energy: 0.411 local terms energy: -157.759357 where: bonds (distance) C4'-P energy: -31.608 bonds (distance) P-C4' energy: -54.634 flat angles C4'-P-C4' energy: -42.565 flat angles P-C4'-P energy: -31.573 tors. eta vs tors. theta energy: 2.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 106 Temperature: 1.350000 Total energy: -202.637873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.637873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.637873 (E_RNA) where: Base-Base interactions energy: -76.288 where: short stacking energy: -68.045 Base-Backbone interact. energy: -1.353 local terms energy: -124.997318 where: bonds (distance) C4'-P energy: -45.900 bonds (distance) P-C4' energy: -45.620 flat angles C4'-P-C4' energy: -28.711 flat angles P-C4'-P energy: -26.765 tors. eta vs tors. theta energy: 21.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 107 Temperature: 0.900000 Total energy: -795.001187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.001187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -795.001187 (E_RNA) where: Base-Base interactions energy: -534.320 where: short stacking energy: -238.600 Base-Backbone interact. energy: -0.726 local terms energy: -259.955040 where: bonds (distance) C4'-P energy: -57.828 bonds (distance) P-C4' energy: -55.667 flat angles C4'-P-C4' energy: -57.474 flat angles P-C4'-P energy: -33.413 tors. eta vs tors. theta energy: -55.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 107 Temperature: 0.964286 Total energy: -744.820805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.820805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.820805 (E_RNA) where: Base-Base interactions energy: -497.141 where: short stacking energy: -211.288 Base-Backbone interact. energy: -1.341 local terms energy: -246.338514 where: bonds (distance) C4'-P energy: -53.052 bonds (distance) P-C4' energy: -62.381 flat angles C4'-P-C4' energy: -50.982 flat angles P-C4'-P energy: -38.361 tors. eta vs tors. theta energy: -41.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 107 Temperature: 1.028571 Total energy: -648.704159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.704159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.704159 (E_RNA) where: Base-Base interactions energy: -407.496 where: short stacking energy: -202.282 Base-Backbone interact. energy: -1.261 local terms energy: -239.946969 where: bonds (distance) C4'-P energy: -58.248 bonds (distance) P-C4' energy: -46.828 flat angles C4'-P-C4' energy: -57.437 flat angles P-C4'-P energy: -31.256 tors. eta vs tors. theta energy: -46.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 107 Temperature: 1.092857 Total energy: -539.983232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.983232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.983232 (E_RNA) where: Base-Base interactions energy: -325.006 where: short stacking energy: -177.573 Base-Backbone interact. energy: 0.857 local terms energy: -215.833480 where: bonds (distance) C4'-P energy: -45.497 bonds (distance) P-C4' energy: -49.881 flat angles C4'-P-C4' energy: -49.680 flat angles P-C4'-P energy: -38.767 tors. eta vs tors. theta energy: -32.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 107 Temperature: 1.157143 Total energy: -449.609864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.609864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.609864 (E_RNA) where: Base-Base interactions energy: -254.097 where: short stacking energy: -148.565 Base-Backbone interact. energy: 4.208 local terms energy: -199.720978 where: bonds (distance) C4'-P energy: -51.960 bonds (distance) P-C4' energy: -57.685 flat angles C4'-P-C4' energy: -32.347 flat angles P-C4'-P energy: -29.783 tors. eta vs tors. theta energy: -27.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 107 Temperature: 1.221429 Total energy: -322.877181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.877181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.877181 (E_RNA) where: Base-Base interactions energy: -158.967 where: short stacking energy: -122.390 Base-Backbone interact. energy: -0.045 local terms energy: -163.864791 where: bonds (distance) C4'-P energy: -47.077 bonds (distance) P-C4' energy: -50.876 flat angles C4'-P-C4' energy: -42.388 flat angles P-C4'-P energy: -21.463 tors. eta vs tors. theta energy: -2.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 107 Temperature: 1.285714 Total energy: -262.046460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.046460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.046460 (E_RNA) where: Base-Base interactions energy: -121.683 where: short stacking energy: -99.468 Base-Backbone interact. energy: 0.098 local terms energy: -140.461318 where: bonds (distance) C4'-P energy: -47.332 bonds (distance) P-C4' energy: -37.039 flat angles C4'-P-C4' energy: -44.758 flat angles P-C4'-P energy: -14.193 tors. eta vs tors. theta energy: 2.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 107 Temperature: 1.350000 Total energy: -221.336872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.336872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.336872 (E_RNA) where: Base-Base interactions energy: -71.443 where: short stacking energy: -58.990 Base-Backbone interact. energy: -2.067 local terms energy: -147.827042 where: bonds (distance) C4'-P energy: -41.841 bonds (distance) P-C4' energy: -48.254 flat angles C4'-P-C4' energy: -45.571 flat angles P-C4'-P energy: -25.269 tors. eta vs tors. theta energy: 13.108 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 108 Temperature: 0.900000 Total energy: -795.958393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.958393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -795.958393 (E_RNA) where: Base-Base interactions energy: -528.180 where: short stacking energy: -246.366 Base-Backbone interact. energy: 4.496 local terms energy: -272.274807 where: bonds (distance) C4'-P energy: -46.770 bonds (distance) P-C4' energy: -61.442 flat angles C4'-P-C4' energy: -58.222 flat angles P-C4'-P energy: -47.311 tors. eta vs tors. theta energy: -58.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 108 Temperature: 0.964286 Total energy: -767.756873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.756873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.756873 (E_RNA) where: Base-Base interactions energy: -518.686 where: short stacking energy: -247.831 Base-Backbone interact. energy: -1.863 local terms energy: -247.207984 where: bonds (distance) C4'-P energy: -57.943 bonds (distance) P-C4' energy: -49.550 flat angles C4'-P-C4' energy: -45.923 flat angles P-C4'-P energy: -44.572 tors. eta vs tors. theta energy: -49.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 108 Temperature: 1.028571 Total energy: -652.137999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -652.137999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.137999 (E_RNA) where: Base-Base interactions energy: -398.135 where: short stacking energy: -202.287 Base-Backbone interact. energy: -1.908 local terms energy: -252.094901 where: bonds (distance) C4'-P energy: -52.092 bonds (distance) P-C4' energy: -60.479 flat angles C4'-P-C4' energy: -57.722 flat angles P-C4'-P energy: -36.899 tors. eta vs tors. theta energy: -44.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 108 Temperature: 1.092857 Total energy: -547.699294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.699294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.699294 (E_RNA) where: Base-Base interactions energy: -304.189 where: short stacking energy: -159.283 Base-Backbone interact. energy: -0.145 local terms energy: -243.365806 where: bonds (distance) C4'-P energy: -55.172 bonds (distance) P-C4' energy: -52.131 flat angles C4'-P-C4' energy: -59.326 flat angles P-C4'-P energy: -38.057 tors. eta vs tors. theta energy: -38.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 108 Temperature: 1.157143 Total energy: -505.705528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.705528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.705528 (E_RNA) where: Base-Base interactions energy: -296.450 where: short stacking energy: -177.310 Base-Backbone interact. energy: 4.219 local terms energy: -213.474261 where: bonds (distance) C4'-P energy: -51.813 bonds (distance) P-C4' energy: -39.948 flat angles C4'-P-C4' energy: -58.411 flat angles P-C4'-P energy: -36.663 tors. eta vs tors. theta energy: -26.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 108 Temperature: 1.221429 Total energy: -323.624806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.624806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.624806 (E_RNA) where: Base-Base interactions energy: -158.456 where: short stacking energy: -119.287 Base-Backbone interact. energy: 2.382 local terms energy: -167.550887 where: bonds (distance) C4'-P energy: -41.956 bonds (distance) P-C4' energy: -47.744 flat angles C4'-P-C4' energy: -37.910 flat angles P-C4'-P energy: -29.915 tors. eta vs tors. theta energy: -10.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 108 Temperature: 1.285714 Total energy: -255.781624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.781624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.781624 (E_RNA) where: Base-Base interactions energy: -92.410 where: short stacking energy: -76.207 Base-Backbone interact. energy: -0.150 local terms energy: -163.221735 where: bonds (distance) C4'-P energy: -49.177 bonds (distance) P-C4' energy: -52.524 flat angles C4'-P-C4' energy: -42.628 flat angles P-C4'-P energy: -32.037 tors. eta vs tors. theta energy: 13.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 108 Temperature: 1.350000 Total energy: -205.930641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.930641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.930641 (E_RNA) where: Base-Base interactions energy: -61.631 where: short stacking energy: -51.457 Base-Backbone interact. energy: -2.072 local terms energy: -142.227571 where: bonds (distance) C4'-P energy: -43.785 bonds (distance) P-C4' energy: -50.104 flat angles C4'-P-C4' energy: -39.231 flat angles P-C4'-P energy: -26.067 tors. eta vs tors. theta energy: 16.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 109 Temperature: 0.900000 Total energy: -798.419019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.419019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -798.419019 (E_RNA) where: Base-Base interactions energy: -524.797 where: short stacking energy: -236.710 Base-Backbone interact. energy: 4.439 local terms energy: -278.061527 where: bonds (distance) C4'-P energy: -48.257 bonds (distance) P-C4' energy: -62.745 flat angles C4'-P-C4' energy: -56.789 flat angles P-C4'-P energy: -46.741 tors. eta vs tors. theta energy: -63.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 109 Temperature: 0.964286 Total energy: -781.801580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.801580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -781.801580 (E_RNA) where: Base-Base interactions energy: -528.827 where: short stacking energy: -239.235 Base-Backbone interact. energy: -0.872 local terms energy: -252.102467 where: bonds (distance) C4'-P energy: -53.757 bonds (distance) P-C4' energy: -53.320 flat angles C4'-P-C4' energy: -55.120 flat angles P-C4'-P energy: -37.998 tors. eta vs tors. theta energy: -51.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 109 Temperature: 1.028571 Total energy: -669.432383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.432383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.432383 (E_RNA) where: Base-Base interactions energy: -414.634 where: short stacking energy: -205.722 Base-Backbone interact. energy: 0.122 local terms energy: -254.919888 where: bonds (distance) C4'-P energy: -48.882 bonds (distance) P-C4' energy: -61.795 flat angles C4'-P-C4' energy: -60.473 flat angles P-C4'-P energy: -39.299 tors. eta vs tors. theta energy: -44.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 109 Temperature: 1.092857 Total energy: -535.666853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.666853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.666853 (E_RNA) where: Base-Base interactions energy: -320.697 where: short stacking energy: -175.177 Base-Backbone interact. energy: -0.390 local terms energy: -214.579614 where: bonds (distance) C4'-P energy: -56.637 bonds (distance) P-C4' energy: -45.785 flat angles C4'-P-C4' energy: -54.869 flat angles P-C4'-P energy: -28.393 tors. eta vs tors. theta energy: -28.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 109 Temperature: 1.157143 Total energy: -509.101803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.101803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.101803 (E_RNA) where: Base-Base interactions energy: -282.261 where: short stacking energy: -175.110 Base-Backbone interact. energy: 1.050 local terms energy: -227.890754 where: bonds (distance) C4'-P energy: -46.231 bonds (distance) P-C4' energy: -53.933 flat angles C4'-P-C4' energy: -52.730 flat angles P-C4'-P energy: -36.440 tors. eta vs tors. theta energy: -38.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 109 Temperature: 1.221429 Total energy: -347.379886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.379886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.379886 (E_RNA) where: Base-Base interactions energy: -171.552 where: short stacking energy: -126.758 Base-Backbone interact. energy: -0.507 local terms energy: -175.321192 where: bonds (distance) C4'-P energy: -53.838 bonds (distance) P-C4' energy: -53.115 flat angles C4'-P-C4' energy: -37.935 flat angles P-C4'-P energy: -19.241 tors. eta vs tors. theta energy: -11.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 109 Temperature: 1.285714 Total energy: -236.782764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.782764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.782764 (E_RNA) where: Base-Base interactions energy: -87.337 where: short stacking energy: -72.909 Base-Backbone interact. energy: 2.508 local terms energy: -151.953017 where: bonds (distance) C4'-P energy: -52.611 bonds (distance) P-C4' energy: -49.062 flat angles C4'-P-C4' energy: -43.367 flat angles P-C4'-P energy: -19.777 tors. eta vs tors. theta energy: 12.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 109 Temperature: 1.350000 Total energy: -229.621360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.621360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.621360 (E_RNA) where: Base-Base interactions energy: -73.437 where: short stacking energy: -69.792 Base-Backbone interact. energy: 0.901 local terms energy: -157.085279 where: bonds (distance) C4'-P energy: -29.939 bonds (distance) P-C4' energy: -48.802 flat angles C4'-P-C4' energy: -41.307 flat angles P-C4'-P energy: -30.147 tors. eta vs tors. theta energy: -6.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 110 Temperature: 0.900000 Total energy: -783.113446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.113446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.113446 (E_RNA) where: Base-Base interactions energy: -509.911 where: short stacking energy: -242.982 Base-Backbone interact. energy: -0.901 local terms energy: -272.301193 where: bonds (distance) C4'-P energy: -55.132 bonds (distance) P-C4' energy: -55.414 flat angles C4'-P-C4' energy: -66.036 flat angles P-C4'-P energy: -41.691 tors. eta vs tors. theta energy: -54.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 110 Temperature: 0.964286 Total energy: -778.178303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.178303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.178303 (E_RNA) where: Base-Base interactions energy: -526.958 where: short stacking energy: -245.778 Base-Backbone interact. energy: -1.231 local terms energy: -249.989186 where: bonds (distance) C4'-P energy: -58.462 bonds (distance) P-C4' energy: -48.230 flat angles C4'-P-C4' energy: -58.192 flat angles P-C4'-P energy: -39.127 tors. eta vs tors. theta energy: -45.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 110 Temperature: 1.028571 Total energy: -698.156177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.156177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.156177 (E_RNA) where: Base-Base interactions energy: -440.206 where: short stacking energy: -224.182 Base-Backbone interact. energy: 2.795 local terms energy: -260.744627 where: bonds (distance) C4'-P energy: -50.507 bonds (distance) P-C4' energy: -55.180 flat angles C4'-P-C4' energy: -55.311 flat angles P-C4'-P energy: -45.852 tors. eta vs tors. theta energy: -53.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 110 Temperature: 1.092857 Total energy: -562.196742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.196742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.196742 (E_RNA) where: Base-Base interactions energy: -330.576 where: short stacking energy: -178.100 Base-Backbone interact. energy: -1.785 local terms energy: -229.835923 where: bonds (distance) C4'-P energy: -45.154 bonds (distance) P-C4' energy: -58.362 flat angles C4'-P-C4' energy: -52.486 flat angles P-C4'-P energy: -39.645 tors. eta vs tors. theta energy: -34.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 110 Temperature: 1.157143 Total energy: -494.529371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.529371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.529371 (E_RNA) where: Base-Base interactions energy: -274.660 where: short stacking energy: -171.044 Base-Backbone interact. energy: -0.331 local terms energy: -219.538732 where: bonds (distance) C4'-P energy: -45.760 bonds (distance) P-C4' energy: -56.593 flat angles C4'-P-C4' energy: -52.319 flat angles P-C4'-P energy: -32.909 tors. eta vs tors. theta energy: -31.958 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 110 Temperature: 1.221429 Total energy: -346.984141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.984141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.984141 (E_RNA) where: Base-Base interactions energy: -176.220 where: short stacking energy: -135.044 Base-Backbone interact. energy: -0.745 local terms energy: -170.018583 where: bonds (distance) C4'-P energy: -41.746 bonds (distance) P-C4' energy: -54.764 flat angles C4'-P-C4' energy: -44.885 flat angles P-C4'-P energy: -19.809 tors. eta vs tors. theta energy: -8.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 110 Temperature: 1.285714 Total energy: -262.481294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.481294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.481294 (E_RNA) where: Base-Base interactions energy: -117.224 where: short stacking energy: -98.691 Base-Backbone interact. energy: -0.483 local terms energy: -144.774901 where: bonds (distance) C4'-P energy: -42.922 bonds (distance) P-C4' energy: -47.625 flat angles C4'-P-C4' energy: -36.480 flat angles P-C4'-P energy: -16.324 tors. eta vs tors. theta energy: -1.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 110 Temperature: 1.350000 Total energy: -241.896140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.896140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.896140 (E_RNA) where: Base-Base interactions energy: -78.031 where: short stacking energy: -70.048 Base-Backbone interact. energy: -0.838 local terms energy: -163.026891 where: bonds (distance) C4'-P energy: -41.322 bonds (distance) P-C4' energy: -52.043 flat angles C4'-P-C4' energy: -44.118 flat angles P-C4'-P energy: -33.759 tors. eta vs tors. theta energy: 8.215 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 111 Temperature: 0.900000 Total energy: -770.191819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.191819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.191819 (E_RNA) where: Base-Base interactions energy: -504.646 where: short stacking energy: -226.721 Base-Backbone interact. energy: -2.065 local terms energy: -263.481192 where: bonds (distance) C4'-P energy: -63.697 bonds (distance) P-C4' energy: -62.475 flat angles C4'-P-C4' energy: -44.619 flat angles P-C4'-P energy: -38.979 tors. eta vs tors. theta energy: -53.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 111 Temperature: 0.964286 Total energy: -770.859613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.859613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.859613 (E_RNA) where: Base-Base interactions energy: -522.946 where: short stacking energy: -240.623 Base-Backbone interact. energy: -2.148 local terms energy: -245.765932 where: bonds (distance) C4'-P energy: -58.250 bonds (distance) P-C4' energy: -56.210 flat angles C4'-P-C4' energy: -49.672 flat angles P-C4'-P energy: -33.168 tors. eta vs tors. theta energy: -48.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 111 Temperature: 1.028571 Total energy: -686.111947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.111947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.111947 (E_RNA) where: Base-Base interactions energy: -430.634 where: short stacking energy: -231.277 Base-Backbone interact. energy: 1.889 local terms energy: -257.367009 where: bonds (distance) C4'-P energy: -56.695 bonds (distance) P-C4' energy: -50.361 flat angles C4'-P-C4' energy: -61.069 flat angles P-C4'-P energy: -41.141 tors. eta vs tors. theta energy: -48.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 111 Temperature: 1.092857 Total energy: -573.675384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.675384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.675384 (E_RNA) where: Base-Base interactions energy: -366.367 where: short stacking energy: -198.337 Base-Backbone interact. energy: 0.007 local terms energy: -207.315460 where: bonds (distance) C4'-P energy: -47.973 bonds (distance) P-C4' energy: -40.596 flat angles C4'-P-C4' energy: -47.178 flat angles P-C4'-P energy: -36.449 tors. eta vs tors. theta energy: -35.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 111 Temperature: 1.157143 Total energy: -477.740055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.740055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.740055 (E_RNA) where: Base-Base interactions energy: -268.676 where: short stacking energy: -156.176 Base-Backbone interact. energy: -1.195 local terms energy: -207.869273 where: bonds (distance) C4'-P energy: -45.949 bonds (distance) P-C4' energy: -54.456 flat angles C4'-P-C4' energy: -55.213 flat angles P-C4'-P energy: -27.257 tors. eta vs tors. theta energy: -24.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 111 Temperature: 1.221429 Total energy: -393.260654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.260654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.260654 (E_RNA) where: Base-Base interactions energy: -185.149 where: short stacking energy: -143.964 Base-Backbone interact. energy: -0.264 local terms energy: -207.848149 where: bonds (distance) C4'-P energy: -40.761 bonds (distance) P-C4' energy: -60.503 flat angles C4'-P-C4' energy: -54.541 flat angles P-C4'-P energy: -21.363 tors. eta vs tors. theta energy: -30.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 111 Temperature: 1.285714 Total energy: -259.213777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.213777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.213777 (E_RNA) where: Base-Base interactions energy: -113.584 where: short stacking energy: -88.394 Base-Backbone interact. energy: 0.237 local terms energy: -145.866639 where: bonds (distance) C4'-P energy: -43.871 bonds (distance) P-C4' energy: -53.049 flat angles C4'-P-C4' energy: -47.879 flat angles P-C4'-P energy: -10.261 tors. eta vs tors. theta energy: 9.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 111 Temperature: 1.350000 Total energy: -242.965264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.965264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.965264 (E_RNA) where: Base-Base interactions energy: -97.451 where: short stacking energy: -76.608 Base-Backbone interact. energy: 1.212 local terms energy: -146.726338 where: bonds (distance) C4'-P energy: -39.519 bonds (distance) P-C4' energy: -49.078 flat angles C4'-P-C4' energy: -37.325 flat angles P-C4'-P energy: -27.581 tors. eta vs tors. theta energy: 6.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 112 Temperature: 0.900000 Total energy: -781.885473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.885473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -781.885473 (E_RNA) where: Base-Base interactions energy: -523.396 where: short stacking energy: -250.576 Base-Backbone interact. energy: -2.576 local terms energy: -255.913724 where: bonds (distance) C4'-P energy: -58.982 bonds (distance) P-C4' energy: -56.974 flat angles C4'-P-C4' energy: -57.129 flat angles P-C4'-P energy: -34.704 tors. eta vs tors. theta energy: -48.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 112 Temperature: 0.964286 Total energy: -757.021472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -757.021472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.021472 (E_RNA) where: Base-Base interactions energy: -497.821 where: short stacking energy: -216.374 Base-Backbone interact. energy: -1.741 local terms energy: -257.459399 where: bonds (distance) C4'-P energy: -55.207 bonds (distance) P-C4' energy: -56.334 flat angles C4'-P-C4' energy: -62.068 flat angles P-C4'-P energy: -35.820 tors. eta vs tors. theta energy: -48.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 112 Temperature: 1.028571 Total energy: -701.999715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.999715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.999715 (E_RNA) where: Base-Base interactions energy: -460.601 where: short stacking energy: -235.677 Base-Backbone interact. energy: -2.512 local terms energy: -238.887038 where: bonds (distance) C4'-P energy: -52.293 bonds (distance) P-C4' energy: -57.292 flat angles C4'-P-C4' energy: -49.780 flat angles P-C4'-P energy: -26.728 tors. eta vs tors. theta energy: -52.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 112 Temperature: 1.092857 Total energy: -574.924655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.924655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.924655 (E_RNA) where: Base-Base interactions energy: -360.182 where: short stacking energy: -184.596 Base-Backbone interact. energy: -1.576 local terms energy: -213.167174 where: bonds (distance) C4'-P energy: -44.211 bonds (distance) P-C4' energy: -54.326 flat angles C4'-P-C4' energy: -51.751 flat angles P-C4'-P energy: -29.127 tors. eta vs tors. theta energy: -33.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 112 Temperature: 1.157143 Total energy: -488.608543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.608543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.608543 (E_RNA) where: Base-Base interactions energy: -297.063 where: short stacking energy: -156.586 Base-Backbone interact. energy: -0.876 local terms energy: -190.669544 where: bonds (distance) C4'-P energy: -54.353 bonds (distance) P-C4' energy: -48.341 flat angles C4'-P-C4' energy: -38.681 flat angles P-C4'-P energy: -31.576 tors. eta vs tors. theta energy: -17.719 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 112 Temperature: 1.221429 Total energy: -352.106496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.106496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.106496 (E_RNA) where: Base-Base interactions energy: -171.723 where: short stacking energy: -125.428 Base-Backbone interact. energy: 1.214 local terms energy: -181.597611 where: bonds (distance) C4'-P energy: -39.474 bonds (distance) P-C4' energy: -50.726 flat angles C4'-P-C4' energy: -41.265 flat angles P-C4'-P energy: -32.268 tors. eta vs tors. theta energy: -17.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 112 Temperature: 1.285714 Total energy: -282.864090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.864090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.864090 (E_RNA) where: Base-Base interactions energy: -112.052 where: short stacking energy: -93.108 Base-Backbone interact. energy: -0.202 local terms energy: -170.609409 where: bonds (distance) C4'-P energy: -40.376 bonds (distance) P-C4' energy: -58.581 flat angles C4'-P-C4' energy: -41.717 flat angles P-C4'-P energy: -19.458 tors. eta vs tors. theta energy: -10.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 112 Temperature: 1.350000 Total energy: -232.672565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.672565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.672565 (E_RNA) where: Base-Base interactions energy: -69.722 where: short stacking energy: -58.422 Base-Backbone interact. energy: -1.901 local terms energy: -161.049462 where: bonds (distance) C4'-P energy: -50.617 bonds (distance) P-C4' energy: -56.612 flat angles C4'-P-C4' energy: -31.070 flat angles P-C4'-P energy: -28.191 tors. eta vs tors. theta energy: 5.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 113 Temperature: 0.900000 Total energy: -785.232265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.232265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.232265 (E_RNA) where: Base-Base interactions energy: -520.392 where: short stacking energy: -252.051 Base-Backbone interact. energy: -0.319 local terms energy: -264.521564 where: bonds (distance) C4'-P energy: -56.311 bonds (distance) P-C4' energy: -61.018 flat angles C4'-P-C4' energy: -59.392 flat angles P-C4'-P energy: -39.292 tors. eta vs tors. theta energy: -48.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 113 Temperature: 0.964286 Total energy: -751.215459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.215459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.215459 (E_RNA) where: Base-Base interactions energy: -482.539 where: short stacking energy: -220.112 Base-Backbone interact. energy: 2.566 local terms energy: -271.242401 where: bonds (distance) C4'-P energy: -61.643 bonds (distance) P-C4' energy: -66.408 flat angles C4'-P-C4' energy: -60.742 flat angles P-C4'-P energy: -27.309 tors. eta vs tors. theta energy: -55.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 113 Temperature: 1.028571 Total energy: -701.172667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.172667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.172667 (E_RNA) where: Base-Base interactions energy: -433.533 where: short stacking energy: -217.231 Base-Backbone interact. energy: -1.924 local terms energy: -265.715526 where: bonds (distance) C4'-P energy: -57.447 bonds (distance) P-C4' energy: -60.524 flat angles C4'-P-C4' energy: -60.940 flat angles P-C4'-P energy: -42.366 tors. eta vs tors. theta energy: -44.439 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 113 Temperature: 1.092857 Total energy: -567.445487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.445487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.445487 (E_RNA) where: Base-Base interactions energy: -354.747 where: short stacking energy: -169.953 Base-Backbone interact. energy: -0.250 local terms energy: -212.448267 where: bonds (distance) C4'-P energy: -50.297 bonds (distance) P-C4' energy: -51.707 flat angles C4'-P-C4' energy: -51.354 flat angles P-C4'-P energy: -22.609 tors. eta vs tors. theta energy: -36.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 113 Temperature: 1.157143 Total energy: -474.392938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.392938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.392938 (E_RNA) where: Base-Base interactions energy: -279.390 where: short stacking energy: -139.446 Base-Backbone interact. energy: -2.425 local terms energy: -192.577531 where: bonds (distance) C4'-P energy: -48.012 bonds (distance) P-C4' energy: -50.465 flat angles C4'-P-C4' energy: -49.344 flat angles P-C4'-P energy: -25.021 tors. eta vs tors. theta energy: -19.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 113 Temperature: 1.221429 Total energy: -294.226705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.226705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.226705 (E_RNA) where: Base-Base interactions energy: -111.708 where: short stacking energy: -105.983 Base-Backbone interact. energy: 6.722 local terms energy: -189.240564 where: bonds (distance) C4'-P energy: -47.243 bonds (distance) P-C4' energy: -61.814 flat angles C4'-P-C4' energy: -41.183 flat angles P-C4'-P energy: -35.799 tors. eta vs tors. theta energy: -3.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 113 Temperature: 1.285714 Total energy: -338.308991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.308991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.308991 (E_RNA) where: Base-Base interactions energy: -164.252 where: short stacking energy: -110.780 Base-Backbone interact. energy: -0.623 local terms energy: -173.433364 where: bonds (distance) C4'-P energy: -44.084 bonds (distance) P-C4' energy: -50.183 flat angles C4'-P-C4' energy: -44.776 flat angles P-C4'-P energy: -21.897 tors. eta vs tors. theta energy: -12.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 113 Temperature: 1.350000 Total energy: -219.882642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.882642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.882642 (E_RNA) where: Base-Base interactions energy: -71.216 where: short stacking energy: -61.543 Base-Backbone interact. energy: -1.009 local terms energy: -147.657476 where: bonds (distance) C4'-P energy: -40.443 bonds (distance) P-C4' energy: -58.217 flat angles C4'-P-C4' energy: -38.310 flat angles P-C4'-P energy: -29.356 tors. eta vs tors. theta energy: 18.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 114 Temperature: 0.900000 Total energy: -757.450636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -757.450636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.450636 (E_RNA) where: Base-Base interactions energy: -511.802 where: short stacking energy: -242.496 Base-Backbone interact. energy: -1.631 local terms energy: -244.018260 where: bonds (distance) C4'-P energy: -53.542 bonds (distance) P-C4' energy: -52.686 flat angles C4'-P-C4' energy: -48.326 flat angles P-C4'-P energy: -44.383 tors. eta vs tors. theta energy: -45.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 114 Temperature: 0.964286 Total energy: -750.841877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.841877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.841877 (E_RNA) where: Base-Base interactions energy: -499.060 where: short stacking energy: -237.370 Base-Backbone interact. energy: -0.388 local terms energy: -251.394001 where: bonds (distance) C4'-P energy: -52.614 bonds (distance) P-C4' energy: -57.697 flat angles C4'-P-C4' energy: -56.850 flat angles P-C4'-P energy: -40.056 tors. eta vs tors. theta energy: -44.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 114 Temperature: 1.028571 Total energy: -663.046328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.046328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.046328 (E_RNA) where: Base-Base interactions energy: -420.327 where: short stacking energy: -195.985 Base-Backbone interact. energy: 0.508 local terms energy: -243.227645 where: bonds (distance) C4'-P energy: -56.452 bonds (distance) P-C4' energy: -65.526 flat angles C4'-P-C4' energy: -56.619 flat angles P-C4'-P energy: -29.604 tors. eta vs tors. theta energy: -35.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 114 Temperature: 1.092857 Total energy: -589.969962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.969962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.969962 (E_RNA) where: Base-Base interactions energy: -370.292 where: short stacking energy: -189.256 Base-Backbone interact. energy: -1.935 local terms energy: -217.743593 where: bonds (distance) C4'-P energy: -51.793 bonds (distance) P-C4' energy: -47.999 flat angles C4'-P-C4' energy: -49.610 flat angles P-C4'-P energy: -35.199 tors. eta vs tors. theta energy: -33.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 114 Temperature: 1.157143 Total energy: -468.890105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.890105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.890105 (E_RNA) where: Base-Base interactions energy: -263.179 where: short stacking energy: -129.838 Base-Backbone interact. energy: -1.661 local terms energy: -204.050062 where: bonds (distance) C4'-P energy: -56.248 bonds (distance) P-C4' energy: -51.737 flat angles C4'-P-C4' energy: -50.711 flat angles P-C4'-P energy: -34.760 tors. eta vs tors. theta energy: -10.594 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 114 Temperature: 1.221429 Total energy: -260.435071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.435071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.435071 (E_RNA) where: Base-Base interactions energy: -94.315 where: short stacking energy: -93.393 Base-Backbone interact. energy: -0.909 local terms energy: -165.210916 where: bonds (distance) C4'-P energy: -44.665 bonds (distance) P-C4' energy: -57.123 flat angles C4'-P-C4' energy: -43.540 flat angles P-C4'-P energy: -22.914 tors. eta vs tors. theta energy: 3.031 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 114 Temperature: 1.285714 Total energy: -321.579039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.579039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.579039 (E_RNA) where: Base-Base interactions energy: -153.605 where: short stacking energy: -81.351 Base-Backbone interact. energy: -0.003 local terms energy: -167.970748 where: bonds (distance) C4'-P energy: -52.379 bonds (distance) P-C4' energy: -55.285 flat angles C4'-P-C4' energy: -34.901 flat angles P-C4'-P energy: -21.415 tors. eta vs tors. theta energy: -3.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 114 Temperature: 1.350000 Total energy: -245.968495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.968495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.968495 (E_RNA) where: Base-Base interactions energy: -75.906 where: short stacking energy: -63.113 Base-Backbone interact. energy: 1.853 local terms energy: -171.915218 where: bonds (distance) C4'-P energy: -44.902 bonds (distance) P-C4' energy: -64.692 flat angles C4'-P-C4' energy: -47.086 flat angles P-C4'-P energy: -23.264 tors. eta vs tors. theta energy: 8.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 115 Temperature: 0.900000 Total energy: -779.310251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.310251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.310251 (E_RNA) where: Base-Base interactions energy: -519.122 where: short stacking energy: -240.254 Base-Backbone interact. energy: -1.040 local terms energy: -259.148351 where: bonds (distance) C4'-P energy: -45.535 bonds (distance) P-C4' energy: -61.381 flat angles C4'-P-C4' energy: -55.176 flat angles P-C4'-P energy: -44.982 tors. eta vs tors. theta energy: -52.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 115 Temperature: 0.964286 Total energy: -779.637128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.637128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.637128 (E_RNA) where: Base-Base interactions energy: -501.167 where: short stacking energy: -253.512 Base-Backbone interact. energy: 1.184 local terms energy: -279.653885 where: bonds (distance) C4'-P energy: -58.076 bonds (distance) P-C4' energy: -62.295 flat angles C4'-P-C4' energy: -57.472 flat angles P-C4'-P energy: -41.118 tors. eta vs tors. theta energy: -60.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 115 Temperature: 1.028571 Total energy: -672.639625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.639625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.639625 (E_RNA) where: Base-Base interactions energy: -448.471 where: short stacking energy: -205.090 Base-Backbone interact. energy: 4.865 local terms energy: -229.033475 where: bonds (distance) C4'-P energy: -47.239 bonds (distance) P-C4' energy: -54.769 flat angles C4'-P-C4' energy: -56.623 flat angles P-C4'-P energy: -35.335 tors. eta vs tors. theta energy: -35.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 115 Temperature: 1.092857 Total energy: -600.243257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.243257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.243257 (E_RNA) where: Base-Base interactions energy: -362.524 where: short stacking energy: -217.836 Base-Backbone interact. energy: -0.293 local terms energy: -237.426518 where: bonds (distance) C4'-P energy: -46.967 bonds (distance) P-C4' energy: -50.938 flat angles C4'-P-C4' energy: -60.325 flat angles P-C4'-P energy: -34.216 tors. eta vs tors. theta energy: -44.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 115 Temperature: 1.157143 Total energy: -504.564983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.564983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.564983 (E_RNA) where: Base-Base interactions energy: -296.667 where: short stacking energy: -144.694 Base-Backbone interact. energy: -0.917 local terms energy: -206.981101 where: bonds (distance) C4'-P energy: -54.765 bonds (distance) P-C4' energy: -58.625 flat angles C4'-P-C4' energy: -50.014 flat angles P-C4'-P energy: -30.630 tors. eta vs tors. theta energy: -12.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 115 Temperature: 1.221429 Total energy: -356.532875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.532875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.532875 (E_RNA) where: Base-Base interactions energy: -177.654 where: short stacking energy: -143.363 Base-Backbone interact. energy: 4.572 local terms energy: -183.450535 where: bonds (distance) C4'-P energy: -38.951 bonds (distance) P-C4' energy: -51.171 flat angles C4'-P-C4' energy: -44.470 flat angles P-C4'-P energy: -25.382 tors. eta vs tors. theta energy: -23.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 115 Temperature: 1.285714 Total energy: -256.227457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.227457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.227457 (E_RNA) where: Base-Base interactions energy: -107.040 where: short stacking energy: -96.474 Base-Backbone interact. energy: -1.526 local terms energy: -147.661016 where: bonds (distance) C4'-P energy: -51.431 bonds (distance) P-C4' energy: -46.030 flat angles C4'-P-C4' energy: -35.106 flat angles P-C4'-P energy: -14.335 tors. eta vs tors. theta energy: -0.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 115 Temperature: 1.350000 Total energy: -223.409379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.409379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.409379 (E_RNA) where: Base-Base interactions energy: -81.977 where: short stacking energy: -59.372 Base-Backbone interact. energy: -0.363 local terms energy: -141.069454 where: bonds (distance) C4'-P energy: -46.426 bonds (distance) P-C4' energy: -44.126 flat angles C4'-P-C4' energy: -36.913 flat angles P-C4'-P energy: -22.489 tors. eta vs tors. theta energy: 8.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 116 Temperature: 0.900000 Total energy: -794.903678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.903678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.903678 (E_RNA) where: Base-Base interactions energy: -532.313 where: short stacking energy: -254.284 Base-Backbone interact. energy: -1.696 local terms energy: -260.894848 where: bonds (distance) C4'-P energy: -47.936 bonds (distance) P-C4' energy: -57.102 flat angles C4'-P-C4' energy: -62.068 flat angles P-C4'-P energy: -37.146 tors. eta vs tors. theta energy: -56.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 116 Temperature: 0.964286 Total energy: -786.803982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.803982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.803982 (E_RNA) where: Base-Base interactions energy: -507.796 where: short stacking energy: -243.972 Base-Backbone interact. energy: -0.847 local terms energy: -278.161110 where: bonds (distance) C4'-P energy: -59.361 bonds (distance) P-C4' energy: -56.503 flat angles C4'-P-C4' energy: -68.116 flat angles P-C4'-P energy: -38.037 tors. eta vs tors. theta energy: -56.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 116 Temperature: 1.028571 Total energy: -687.281574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.281574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.281574 (E_RNA) where: Base-Base interactions energy: -438.984 where: short stacking energy: -212.011 Base-Backbone interact. energy: -0.390 local terms energy: -247.907640 where: bonds (distance) C4'-P energy: -54.175 bonds (distance) P-C4' energy: -58.012 flat angles C4'-P-C4' energy: -52.078 flat angles P-C4'-P energy: -42.292 tors. eta vs tors. theta energy: -41.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 116 Temperature: 1.092857 Total energy: -595.988289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.988289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.988289 (E_RNA) where: Base-Base interactions energy: -362.280 where: short stacking energy: -201.531 Base-Backbone interact. energy: -0.484 local terms energy: -233.223966 where: bonds (distance) C4'-P energy: -50.847 bonds (distance) P-C4' energy: -65.627 flat angles C4'-P-C4' energy: -46.666 flat angles P-C4'-P energy: -29.871 tors. eta vs tors. theta energy: -40.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 116 Temperature: 1.157143 Total energy: -518.245457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.245457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.245457 (E_RNA) where: Base-Base interactions energy: -303.643 where: short stacking energy: -171.988 Base-Backbone interact. energy: -1.334 local terms energy: -213.267989 where: bonds (distance) C4'-P energy: -56.066 bonds (distance) P-C4' energy: -46.716 flat angles C4'-P-C4' energy: -45.906 flat angles P-C4'-P energy: -30.992 tors. eta vs tors. theta energy: -33.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 116 Temperature: 1.221429 Total energy: -367.437447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.437447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.437447 (E_RNA) where: Base-Base interactions energy: -150.931 where: short stacking energy: -121.668 Base-Backbone interact. energy: -1.225 local terms energy: -215.281500 where: bonds (distance) C4'-P energy: -47.948 bonds (distance) P-C4' energy: -52.682 flat angles C4'-P-C4' energy: -59.557 flat angles P-C4'-P energy: -37.860 tors. eta vs tors. theta energy: -17.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 116 Temperature: 1.285714 Total energy: -240.924547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.924547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.924547 (E_RNA) where: Base-Base interactions energy: -93.041 where: short stacking energy: -87.969 Base-Backbone interact. energy: 0.026 local terms energy: -147.909983 where: bonds (distance) C4'-P energy: -62.675 bonds (distance) P-C4' energy: -48.225 flat angles C4'-P-C4' energy: -48.765 flat angles P-C4'-P energy: -6.754 tors. eta vs tors. theta energy: 18.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 116 Temperature: 1.350000 Total energy: -234.372598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.372598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.372598 (E_RNA) where: Base-Base interactions energy: -75.899 where: short stacking energy: -70.435 Base-Backbone interact. energy: -1.412 local terms energy: -157.061122 where: bonds (distance) C4'-P energy: -50.301 bonds (distance) P-C4' energy: -44.677 flat angles C4'-P-C4' energy: -47.117 flat angles P-C4'-P energy: -22.360 tors. eta vs tors. theta energy: 7.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 117 Temperature: 0.900000 Total energy: -812.135299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.135299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.135299 (E_RNA) where: Base-Base interactions energy: -530.413 where: short stacking energy: -249.830 Base-Backbone interact. energy: -1.913 local terms energy: -279.808721 where: bonds (distance) C4'-P energy: -62.354 bonds (distance) P-C4' energy: -60.865 flat angles C4'-P-C4' energy: -57.588 flat angles P-C4'-P energy: -38.221 tors. eta vs tors. theta energy: -60.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 117 Temperature: 0.964286 Total energy: -756.644553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.644553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.644553 (E_RNA) where: Base-Base interactions energy: -500.574 where: short stacking energy: -254.106 Base-Backbone interact. energy: -1.513 local terms energy: -254.557905 where: bonds (distance) C4'-P energy: -50.655 bonds (distance) P-C4' energy: -53.609 flat angles C4'-P-C4' energy: -56.014 flat angles P-C4'-P energy: -41.467 tors. eta vs tors. theta energy: -52.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 117 Temperature: 1.028571 Total energy: -703.019346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.019346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.019346 (E_RNA) where: Base-Base interactions energy: -457.809 where: short stacking energy: -235.129 Base-Backbone interact. energy: -0.437 local terms energy: -245.239578 where: bonds (distance) C4'-P energy: -61.499 bonds (distance) P-C4' energy: -54.042 flat angles C4'-P-C4' energy: -52.655 flat angles P-C4'-P energy: -32.106 tors. eta vs tors. theta energy: -44.937 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.466 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 117 Temperature: 1.092857 Total energy: -602.637824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.637824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.637824 (E_RNA) where: Base-Base interactions energy: -361.925 where: short stacking energy: -205.852 Base-Backbone interact. energy: -1.661 local terms energy: -239.052476 where: bonds (distance) C4'-P energy: -52.417 bonds (distance) P-C4' energy: -53.612 flat angles C4'-P-C4' energy: -54.437 flat angles P-C4'-P energy: -35.295 tors. eta vs tors. theta energy: -43.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 117 Temperature: 1.157143 Total energy: -485.549095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.549095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.549095 (E_RNA) where: Base-Base interactions energy: -275.957 where: short stacking energy: -150.829 Base-Backbone interact. energy: -0.658 local terms energy: -208.933877 where: bonds (distance) C4'-P energy: -45.486 bonds (distance) P-C4' energy: -53.718 flat angles C4'-P-C4' energy: -54.062 flat angles P-C4'-P energy: -30.540 tors. eta vs tors. theta energy: -25.128 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 117 Temperature: 1.221429 Total energy: -357.979846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.979846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.979846 (E_RNA) where: Base-Base interactions energy: -184.766 where: short stacking energy: -122.747 Base-Backbone interact. energy: -0.293 local terms energy: -172.921290 where: bonds (distance) C4'-P energy: -40.745 bonds (distance) P-C4' energy: -48.765 flat angles C4'-P-C4' energy: -47.581 flat angles P-C4'-P energy: -27.356 tors. eta vs tors. theta energy: -8.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 117 Temperature: 1.285714 Total energy: -272.905878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.905878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.905878 (E_RNA) where: Base-Base interactions energy: -102.868 where: short stacking energy: -87.882 Base-Backbone interact. energy: 3.400 local terms energy: -173.438069 where: bonds (distance) C4'-P energy: -44.928 bonds (distance) P-C4' energy: -49.246 flat angles C4'-P-C4' energy: -40.266 flat angles P-C4'-P energy: -39.992 tors. eta vs tors. theta energy: 0.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 117 Temperature: 1.350000 Total energy: -191.378152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.378152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.378152 (E_RNA) where: Base-Base interactions energy: -61.059 where: short stacking energy: -47.465 Base-Backbone interact. energy: -1.051 local terms energy: -129.268425 where: bonds (distance) C4'-P energy: -47.090 bonds (distance) P-C4' energy: -46.009 flat angles C4'-P-C4' energy: -41.727 flat angles P-C4'-P energy: -15.511 tors. eta vs tors. theta energy: 21.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 118 Temperature: 0.900000 Total energy: -777.371887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.371887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.371887 (E_RNA) where: Base-Base interactions energy: -515.128 where: short stacking energy: -234.827 Base-Backbone interact. energy: -0.704 local terms energy: -261.540198 where: bonds (distance) C4'-P energy: -52.250 bonds (distance) P-C4' energy: -60.954 flat angles C4'-P-C4' energy: -53.654 flat angles P-C4'-P energy: -43.347 tors. eta vs tors. theta energy: -51.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 118 Temperature: 0.964286 Total energy: -764.804306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -764.804306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -764.804306 (E_RNA) where: Base-Base interactions energy: -506.102 where: short stacking energy: -245.290 Base-Backbone interact. energy: -0.694 local terms energy: -258.008810 where: bonds (distance) C4'-P energy: -58.104 bonds (distance) P-C4' energy: -53.225 flat angles C4'-P-C4' energy: -63.340 flat angles P-C4'-P energy: -31.363 tors. eta vs tors. theta energy: -51.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 118 Temperature: 1.028571 Total energy: -730.761829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.761829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.761829 (E_RNA) where: Base-Base interactions energy: -481.612 where: short stacking energy: -255.786 Base-Backbone interact. energy: 2.904 local terms energy: -252.054112 where: bonds (distance) C4'-P energy: -48.119 bonds (distance) P-C4' energy: -53.931 flat angles C4'-P-C4' energy: -60.050 flat angles P-C4'-P energy: -37.129 tors. eta vs tors. theta energy: -52.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 118 Temperature: 1.092857 Total energy: -583.703096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.703096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.703096 (E_RNA) where: Base-Base interactions energy: -350.220 where: short stacking energy: -197.670 Base-Backbone interact. energy: -0.549 local terms energy: -232.934842 where: bonds (distance) C4'-P energy: -44.474 bonds (distance) P-C4' energy: -49.341 flat angles C4'-P-C4' energy: -52.090 flat angles P-C4'-P energy: -37.673 tors. eta vs tors. theta energy: -49.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 118 Temperature: 1.157143 Total energy: -449.100119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.100119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.100119 (E_RNA) where: Base-Base interactions energy: -247.187 where: short stacking energy: -135.620 Base-Backbone interact. energy: -0.556 local terms energy: -201.357096 where: bonds (distance) C4'-P energy: -51.045 bonds (distance) P-C4' energy: -56.026 flat angles C4'-P-C4' energy: -51.529 flat angles P-C4'-P energy: -23.352 tors. eta vs tors. theta energy: -19.406 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 118 Temperature: 1.221429 Total energy: -394.213397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.213397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.213397 (E_RNA) where: Base-Base interactions energy: -190.243 where: short stacking energy: -110.764 Base-Backbone interact. energy: -1.675 local terms energy: -202.294842 where: bonds (distance) C4'-P energy: -48.774 bonds (distance) P-C4' energy: -57.707 flat angles C4'-P-C4' energy: -45.056 flat angles P-C4'-P energy: -33.144 tors. eta vs tors. theta energy: -17.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 118 Temperature: 1.285714 Total energy: -263.732669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.732669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.732669 (E_RNA) where: Base-Base interactions energy: -96.053 where: short stacking energy: -92.171 Base-Backbone interact. energy: 0.193 local terms energy: -167.872279 where: bonds (distance) C4'-P energy: -36.549 bonds (distance) P-C4' energy: -53.822 flat angles C4'-P-C4' energy: -54.665 flat angles P-C4'-P energy: -27.515 tors. eta vs tors. theta energy: 4.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 118 Temperature: 1.350000 Total energy: -221.515941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.515941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.515941 (E_RNA) where: Base-Base interactions energy: -65.490 where: short stacking energy: -61.786 Base-Backbone interact. energy: -0.607 local terms energy: -155.419272 where: bonds (distance) C4'-P energy: -49.398 bonds (distance) P-C4' energy: -55.593 flat angles C4'-P-C4' energy: -42.456 flat angles P-C4'-P energy: -18.938 tors. eta vs tors. theta energy: 10.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 119 Temperature: 0.900000 Total energy: -784.795297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.795297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.795297 (E_RNA) where: Base-Base interactions energy: -513.464 where: short stacking energy: -241.585 Base-Backbone interact. energy: -0.235 local terms energy: -271.096877 where: bonds (distance) C4'-P energy: -55.614 bonds (distance) P-C4' energy: -60.241 flat angles C4'-P-C4' energy: -57.847 flat angles P-C4'-P energy: -45.165 tors. eta vs tors. theta energy: -52.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 119 Temperature: 0.964286 Total energy: -744.019813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.019813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.019813 (E_RNA) where: Base-Base interactions energy: -486.449 where: short stacking energy: -250.262 Base-Backbone interact. energy: -0.842 local terms energy: -256.728380 where: bonds (distance) C4'-P energy: -46.057 bonds (distance) P-C4' energy: -60.290 flat angles C4'-P-C4' energy: -54.804 flat angles P-C4'-P energy: -34.097 tors. eta vs tors. theta energy: -61.480 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 119 Temperature: 1.028571 Total energy: -752.491923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.491923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.491923 (E_RNA) where: Base-Base interactions energy: -512.981 where: short stacking energy: -246.461 Base-Backbone interact. energy: -1.656 local terms energy: -237.855418 where: bonds (distance) C4'-P energy: -37.858 bonds (distance) P-C4' energy: -63.409 flat angles C4'-P-C4' energy: -49.761 flat angles P-C4'-P energy: -33.649 tors. eta vs tors. theta energy: -53.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 119 Temperature: 1.092857 Total energy: -606.767802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.767802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.767802 (E_RNA) where: Base-Base interactions energy: -385.798 where: short stacking energy: -183.170 Base-Backbone interact. energy: 1.344 local terms energy: -222.313466 where: bonds (distance) C4'-P energy: -47.239 bonds (distance) P-C4' energy: -56.133 flat angles C4'-P-C4' energy: -51.352 flat angles P-C4'-P energy: -38.893 tors. eta vs tors. theta energy: -28.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 119 Temperature: 1.157143 Total energy: -474.551581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.551581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.551581 (E_RNA) where: Base-Base interactions energy: -250.515 where: short stacking energy: -132.772 Base-Backbone interact. energy: -0.969 local terms energy: -223.067665 where: bonds (distance) C4'-P energy: -56.368 bonds (distance) P-C4' energy: -55.769 flat angles C4'-P-C4' energy: -51.124 flat angles P-C4'-P energy: -28.153 tors. eta vs tors. theta energy: -31.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 119 Temperature: 1.221429 Total energy: -368.186668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.186668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.186668 (E_RNA) where: Base-Base interactions energy: -194.295 where: short stacking energy: -119.872 Base-Backbone interact. energy: -1.844 local terms energy: -172.047824 where: bonds (distance) C4'-P energy: -46.060 bonds (distance) P-C4' energy: -49.593 flat angles C4'-P-C4' energy: -45.893 flat angles P-C4'-P energy: -19.023 tors. eta vs tors. theta energy: -11.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 119 Temperature: 1.285714 Total energy: -247.754155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.754155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.754155 (E_RNA) where: Base-Base interactions energy: -84.311 where: short stacking energy: -79.933 Base-Backbone interact. energy: 0.906 local terms energy: -164.348471 where: bonds (distance) C4'-P energy: -34.044 bonds (distance) P-C4' energy: -56.347 flat angles C4'-P-C4' energy: -44.943 flat angles P-C4'-P energy: -35.924 tors. eta vs tors. theta energy: 6.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 119 Temperature: 1.350000 Total energy: -222.245292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.245292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.245292 (E_RNA) where: Base-Base interactions energy: -83.474 where: short stacking energy: -72.151 Base-Backbone interact. energy: 0.954 local terms energy: -139.724949 where: bonds (distance) C4'-P energy: -51.932 bonds (distance) P-C4' energy: -37.875 flat angles C4'-P-C4' energy: -46.621 flat angles P-C4'-P energy: -17.793 tors. eta vs tors. theta energy: 14.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 120 Temperature: 0.900000 Total energy: -784.693143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.693143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.693143 (E_RNA) where: Base-Base interactions energy: -502.215 where: short stacking energy: -263.847 Base-Backbone interact. energy: 0.166 local terms energy: -282.644260 where: bonds (distance) C4'-P energy: -58.724 bonds (distance) P-C4' energy: -59.991 flat angles C4'-P-C4' energy: -67.693 flat angles P-C4'-P energy: -33.640 tors. eta vs tors. theta energy: -62.596 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 120 Temperature: 0.964286 Total energy: -752.832367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.832367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.832367 (E_RNA) where: Base-Base interactions energy: -494.977 where: short stacking energy: -220.595 Base-Backbone interact. energy: -3.342 local terms energy: -254.513161 where: bonds (distance) C4'-P energy: -51.954 bonds (distance) P-C4' energy: -51.566 flat angles C4'-P-C4' energy: -63.713 flat angles P-C4'-P energy: -41.748 tors. eta vs tors. theta energy: -45.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 120 Temperature: 1.028571 Total energy: -713.951291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.951291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.951291 (E_RNA) where: Base-Base interactions energy: -477.871 where: short stacking energy: -217.904 Base-Backbone interact. energy: -0.434 local terms energy: -235.646048 where: bonds (distance) C4'-P energy: -47.594 bonds (distance) P-C4' energy: -67.710 flat angles C4'-P-C4' energy: -53.133 flat angles P-C4'-P energy: -30.573 tors. eta vs tors. theta energy: -36.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 120 Temperature: 1.092857 Total energy: -623.137667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -623.137667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -623.137667 (E_RNA) where: Base-Base interactions energy: -369.897 where: short stacking energy: -182.980 Base-Backbone interact. energy: -0.673 local terms energy: -252.567256 where: bonds (distance) C4'-P energy: -57.555 bonds (distance) P-C4' energy: -65.694 flat angles C4'-P-C4' energy: -58.877 flat angles P-C4'-P energy: -36.044 tors. eta vs tors. theta energy: -34.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 120 Temperature: 1.157143 Total energy: -483.589943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.589943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.589943 (E_RNA) where: Base-Base interactions energy: -272.310 where: short stacking energy: -148.833 Base-Backbone interact. energy: -1.480 local terms energy: -209.799834 where: bonds (distance) C4'-P energy: -53.506 bonds (distance) P-C4' energy: -54.977 flat angles C4'-P-C4' energy: -54.619 flat angles P-C4'-P energy: -24.930 tors. eta vs tors. theta energy: -21.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 120 Temperature: 1.221429 Total energy: -372.515337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.515337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.515337 (E_RNA) where: Base-Base interactions energy: -173.150 where: short stacking energy: -104.377 Base-Backbone interact. energy: -0.090 local terms energy: -199.275697 where: bonds (distance) C4'-P energy: -41.832 bonds (distance) P-C4' energy: -55.152 flat angles C4'-P-C4' energy: -57.849 flat angles P-C4'-P energy: -32.545 tors. eta vs tors. theta energy: -11.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 120 Temperature: 1.285714 Total energy: -259.558485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.558485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.558485 (E_RNA) where: Base-Base interactions energy: -101.915 where: short stacking energy: -84.401 Base-Backbone interact. energy: -0.379 local terms energy: -157.264025 where: bonds (distance) C4'-P energy: -39.503 bonds (distance) P-C4' energy: -59.369 flat angles C4'-P-C4' energy: -37.366 flat angles P-C4'-P energy: -30.145 tors. eta vs tors. theta energy: 9.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 120 Temperature: 1.350000 Total energy: -236.315415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.315415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.315415 (E_RNA) where: Base-Base interactions energy: -91.391 where: short stacking energy: -74.090 Base-Backbone interact. energy: 0.881 local terms energy: -145.806122 where: bonds (distance) C4'-P energy: -43.943 bonds (distance) P-C4' energy: -55.390 flat angles C4'-P-C4' energy: -31.802 flat angles P-C4'-P energy: -23.265 tors. eta vs tors. theta energy: 8.594 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 121 Temperature: 0.900000 Total energy: -769.126747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.126747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.126747 (E_RNA) where: Base-Base interactions energy: -491.569 where: short stacking energy: -252.565 Base-Backbone interact. energy: -0.813 local terms energy: -276.745122 where: bonds (distance) C4'-P energy: -51.745 bonds (distance) P-C4' energy: -58.654 flat angles C4'-P-C4' energy: -60.377 flat angles P-C4'-P energy: -44.481 tors. eta vs tors. theta energy: -61.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 121 Temperature: 0.964286 Total energy: -728.155644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.155644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.155644 (E_RNA) where: Base-Base interactions energy: -484.350 where: short stacking energy: -203.003 Base-Backbone interact. energy: -0.650 local terms energy: -243.155604 where: bonds (distance) C4'-P energy: -59.495 bonds (distance) P-C4' energy: -55.209 flat angles C4'-P-C4' energy: -54.004 flat angles P-C4'-P energy: -37.991 tors. eta vs tors. theta energy: -36.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 121 Temperature: 1.028571 Total energy: -700.725075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.725075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.725075 (E_RNA) where: Base-Base interactions energy: -461.775 where: short stacking energy: -180.649 Base-Backbone interact. energy: -1.216 local terms energy: -237.733762 where: bonds (distance) C4'-P energy: -46.788 bonds (distance) P-C4' energy: -63.433 flat angles C4'-P-C4' energy: -47.485 flat angles P-C4'-P energy: -41.274 tors. eta vs tors. theta energy: -38.753 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 121 Temperature: 1.092857 Total energy: -586.395686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.395686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.395686 (E_RNA) where: Base-Base interactions energy: -366.179 where: short stacking energy: -190.547 Base-Backbone interact. energy: -0.650 local terms energy: -219.567329 where: bonds (distance) C4'-P energy: -45.145 bonds (distance) P-C4' energy: -48.811 flat angles C4'-P-C4' energy: -60.458 flat angles P-C4'-P energy: -30.414 tors. eta vs tors. theta energy: -34.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 121 Temperature: 1.157143 Total energy: -468.648657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.648657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.648657 (E_RNA) where: Base-Base interactions energy: -267.814 where: short stacking energy: -158.264 Base-Backbone interact. energy: 1.063 local terms energy: -201.897983 where: bonds (distance) C4'-P energy: -47.108 bonds (distance) P-C4' energy: -48.929 flat angles C4'-P-C4' energy: -46.418 flat angles P-C4'-P energy: -29.808 tors. eta vs tors. theta energy: -29.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 121 Temperature: 1.221429 Total energy: -343.641218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.641218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.641218 (E_RNA) where: Base-Base interactions energy: -172.210 where: short stacking energy: -108.894 Base-Backbone interact. energy: -0.152 local terms energy: -171.278780 where: bonds (distance) C4'-P energy: -46.424 bonds (distance) P-C4' energy: -43.046 flat angles C4'-P-C4' energy: -42.768 flat angles P-C4'-P energy: -30.767 tors. eta vs tors. theta energy: -8.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 121 Temperature: 1.285714 Total energy: -265.415488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.415488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.415488 (E_RNA) where: Base-Base interactions energy: -99.092 where: short stacking energy: -92.521 Base-Backbone interact. energy: 0.855 local terms energy: -167.178467 where: bonds (distance) C4'-P energy: -42.739 bonds (distance) P-C4' energy: -57.065 flat angles C4'-P-C4' energy: -34.822 flat angles P-C4'-P energy: -34.777 tors. eta vs tors. theta energy: 2.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 121 Temperature: 1.350000 Total energy: -237.077606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.077606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.077606 (E_RNA) where: Base-Base interactions energy: -94.017 where: short stacking energy: -74.799 Base-Backbone interact. energy: 4.676 local terms energy: -147.737479 where: bonds (distance) C4'-P energy: -56.524 bonds (distance) P-C4' energy: -49.918 flat angles C4'-P-C4' energy: -27.283 flat angles P-C4'-P energy: -20.814 tors. eta vs tors. theta energy: 6.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 122 Temperature: 0.900000 Total energy: -756.599009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.599009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.599009 (E_RNA) where: Base-Base interactions energy: -529.770 where: short stacking energy: -230.713 Base-Backbone interact. energy: -2.232 local terms energy: -224.596748 where: bonds (distance) C4'-P energy: -52.588 bonds (distance) P-C4' energy: -50.695 flat angles C4'-P-C4' energy: -47.864 flat angles P-C4'-P energy: -23.234 tors. eta vs tors. theta energy: -50.215 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 122 Temperature: 0.964286 Total energy: -746.188712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.188712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.188712 (E_RNA) where: Base-Base interactions energy: -488.371 where: short stacking energy: -264.573 Base-Backbone interact. energy: -0.567 local terms energy: -257.250341 where: bonds (distance) C4'-P energy: -46.919 bonds (distance) P-C4' energy: -60.724 flat angles C4'-P-C4' energy: -49.568 flat angles P-C4'-P energy: -40.063 tors. eta vs tors. theta energy: -59.976 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 122 Temperature: 1.028571 Total energy: -700.998868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.998868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.998868 (E_RNA) where: Base-Base interactions energy: -463.000 where: short stacking energy: -201.753 Base-Backbone interact. energy: -1.378 local terms energy: -236.621421 where: bonds (distance) C4'-P energy: -57.584 bonds (distance) P-C4' energy: -60.821 flat angles C4'-P-C4' energy: -46.633 flat angles P-C4'-P energy: -35.424 tors. eta vs tors. theta energy: -36.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 122 Temperature: 1.092857 Total energy: -598.369953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.369953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.369953 (E_RNA) where: Base-Base interactions energy: -367.553 where: short stacking energy: -202.851 Base-Backbone interact. energy: -1.685 local terms energy: -229.131787 where: bonds (distance) C4'-P energy: -40.646 bonds (distance) P-C4' energy: -53.044 flat angles C4'-P-C4' energy: -57.964 flat angles P-C4'-P energy: -38.604 tors. eta vs tors. theta energy: -38.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 122 Temperature: 1.157143 Total energy: -454.168156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.168156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.168156 (E_RNA) where: Base-Base interactions energy: -240.672 where: short stacking energy: -145.026 Base-Backbone interact. energy: 5.776 local terms energy: -219.272545 where: bonds (distance) C4'-P energy: -50.339 bonds (distance) P-C4' energy: -53.680 flat angles C4'-P-C4' energy: -61.147 flat angles P-C4'-P energy: -28.451 tors. eta vs tors. theta energy: -25.655 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 122 Temperature: 1.221429 Total energy: -351.954538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.954538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.954538 (E_RNA) where: Base-Base interactions energy: -153.737 where: short stacking energy: -108.058 Base-Backbone interact. energy: -1.063 local terms energy: -197.153946 where: bonds (distance) C4'-P energy: -64.103 bonds (distance) P-C4' energy: -55.946 flat angles C4'-P-C4' energy: -48.877 flat angles P-C4'-P energy: -28.234 tors. eta vs tors. theta energy: 0.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 122 Temperature: 1.285714 Total energy: -257.531876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.531876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.531876 (E_RNA) where: Base-Base interactions energy: -114.145 where: short stacking energy: -91.349 Base-Backbone interact. energy: -1.887 local terms energy: -141.500187 where: bonds (distance) C4'-P energy: -35.974 bonds (distance) P-C4' energy: -40.940 flat angles C4'-P-C4' energy: -37.876 flat angles P-C4'-P energy: -27.198 tors. eta vs tors. theta energy: 0.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 122 Temperature: 1.350000 Total energy: -215.298801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.298801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.298801 (E_RNA) where: Base-Base interactions energy: -88.507 where: short stacking energy: -73.365 Base-Backbone interact. energy: -0.838 local terms energy: -125.953664 where: bonds (distance) C4'-P energy: -35.739 bonds (distance) P-C4' energy: -46.808 flat angles C4'-P-C4' energy: -38.468 flat angles P-C4'-P energy: -16.001 tors. eta vs tors. theta energy: 11.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 123 Temperature: 0.900000 Total energy: -784.524856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.524856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.524856 (E_RNA) where: Base-Base interactions energy: -534.496 where: short stacking energy: -230.092 Base-Backbone interact. energy: -0.342 local terms energy: -249.686845 where: bonds (distance) C4'-P energy: -55.238 bonds (distance) P-C4' energy: -47.734 flat angles C4'-P-C4' energy: -60.447 flat angles P-C4'-P energy: -36.348 tors. eta vs tors. theta energy: -49.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 123 Temperature: 0.964286 Total energy: -755.474417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.474417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.474417 (E_RNA) where: Base-Base interactions energy: -475.267 where: short stacking energy: -254.445 Base-Backbone interact. energy: -0.472 local terms energy: -279.735331 where: bonds (distance) C4'-P energy: -60.044 bonds (distance) P-C4' energy: -54.375 flat angles C4'-P-C4' energy: -58.698 flat angles P-C4'-P energy: -41.292 tors. eta vs tors. theta energy: -65.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 123 Temperature: 1.028571 Total energy: -726.965928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.965928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -726.965928 (E_RNA) where: Base-Base interactions energy: -482.330 where: short stacking energy: -209.564 Base-Backbone interact. energy: 0.204 local terms energy: -244.840013 where: bonds (distance) C4'-P energy: -53.204 bonds (distance) P-C4' energy: -57.722 flat angles C4'-P-C4' energy: -56.106 flat angles P-C4'-P energy: -41.026 tors. eta vs tors. theta energy: -36.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 123 Temperature: 1.092857 Total energy: -597.691440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.691440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.691440 (E_RNA) where: Base-Base interactions energy: -375.695 where: short stacking energy: -194.629 Base-Backbone interact. energy: -0.942 local terms energy: -221.053845 where: bonds (distance) C4'-P energy: -52.957 bonds (distance) P-C4' energy: -49.267 flat angles C4'-P-C4' energy: -46.081 flat angles P-C4'-P energy: -38.355 tors. eta vs tors. theta energy: -34.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 123 Temperature: 1.157143 Total energy: -433.078324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.078324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.078324 (E_RNA) where: Base-Base interactions energy: -219.458 where: short stacking energy: -143.740 Base-Backbone interact. energy: -1.412 local terms energy: -212.208355 where: bonds (distance) C4'-P energy: -55.654 bonds (distance) P-C4' energy: -57.601 flat angles C4'-P-C4' energy: -53.925 flat angles P-C4'-P energy: -26.728 tors. eta vs tors. theta energy: -18.301 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 123 Temperature: 1.221429 Total energy: -358.363053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.363053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.363053 (E_RNA) where: Base-Base interactions energy: -173.993 where: short stacking energy: -121.390 Base-Backbone interact. energy: -0.701 local terms energy: -183.668926 where: bonds (distance) C4'-P energy: -52.537 bonds (distance) P-C4' energy: -42.198 flat angles C4'-P-C4' energy: -55.182 flat angles P-C4'-P energy: -14.410 tors. eta vs tors. theta energy: -19.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 123 Temperature: 1.285714 Total energy: -245.323772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.323772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.323772 (E_RNA) where: Base-Base interactions energy: -85.002 where: short stacking energy: -77.030 Base-Backbone interact. energy: 2.723 local terms energy: -163.045039 where: bonds (distance) C4'-P energy: -47.862 bonds (distance) P-C4' energy: -45.969 flat angles C4'-P-C4' energy: -57.011 flat angles P-C4'-P energy: -14.894 tors. eta vs tors. theta energy: 2.691 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 123 Temperature: 1.350000 Total energy: -227.624560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.624560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.624560 (E_RNA) where: Base-Base interactions energy: -70.876 where: short stacking energy: -57.807 Base-Backbone interact. energy: -0.723 local terms energy: -156.025821 where: bonds (distance) C4'-P energy: -46.158 bonds (distance) P-C4' energy: -43.143 flat angles C4'-P-C4' energy: -36.627 flat angles P-C4'-P energy: -32.589 tors. eta vs tors. theta energy: 2.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 124 Temperature: 0.900000 Total energy: -805.020937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -805.020937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -805.020937 (E_RNA) where: Base-Base interactions energy: -549.615 where: short stacking energy: -245.499 Base-Backbone interact. energy: -1.834 local terms energy: -253.572192 where: bonds (distance) C4'-P energy: -54.133 bonds (distance) P-C4' energy: -51.316 flat angles C4'-P-C4' energy: -56.386 flat angles P-C4'-P energy: -44.138 tors. eta vs tors. theta energy: -47.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 124 Temperature: 0.964286 Total energy: -768.200722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.200722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.200722 (E_RNA) where: Base-Base interactions energy: -479.690 where: short stacking energy: -252.150 Base-Backbone interact. energy: -1.200 local terms energy: -287.310678 where: bonds (distance) C4'-P energy: -59.849 bonds (distance) P-C4' energy: -51.252 flat angles C4'-P-C4' energy: -66.618 flat angles P-C4'-P energy: -47.662 tors. eta vs tors. theta energy: -61.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 124 Temperature: 1.028571 Total energy: -707.992270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.992270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.992270 (E_RNA) where: Base-Base interactions energy: -471.096 where: short stacking energy: -204.385 Base-Backbone interact. energy: -0.222 local terms energy: -236.674005 where: bonds (distance) C4'-P energy: -55.981 bonds (distance) P-C4' energy: -57.829 flat angles C4'-P-C4' energy: -54.410 flat angles P-C4'-P energy: -41.457 tors. eta vs tors. theta energy: -26.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 124 Temperature: 1.092857 Total energy: -603.871366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.871366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.871366 (E_RNA) where: Base-Base interactions energy: -351.087 where: short stacking energy: -182.451 Base-Backbone interact. energy: -0.608 local terms energy: -252.176125 where: bonds (distance) C4'-P energy: -63.038 bonds (distance) P-C4' energy: -58.217 flat angles C4'-P-C4' energy: -54.977 flat angles P-C4'-P energy: -34.240 tors. eta vs tors. theta energy: -41.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 124 Temperature: 1.157143 Total energy: -471.167843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.167843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.167843 (E_RNA) where: Base-Base interactions energy: -267.742 where: short stacking energy: -169.811 Base-Backbone interact. energy: -0.113 local terms energy: -203.312762 where: bonds (distance) C4'-P energy: -48.318 bonds (distance) P-C4' energy: -51.951 flat angles C4'-P-C4' energy: -42.969 flat angles P-C4'-P energy: -22.766 tors. eta vs tors. theta energy: -37.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 124 Temperature: 1.221429 Total energy: -336.522133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.522133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.522133 (E_RNA) where: Base-Base interactions energy: -156.428 where: short stacking energy: -99.253 Base-Backbone interact. energy: 0.760 local terms energy: -180.854258 where: bonds (distance) C4'-P energy: -51.176 bonds (distance) P-C4' energy: -54.060 flat angles C4'-P-C4' energy: -42.155 flat angles P-C4'-P energy: -29.751 tors. eta vs tors. theta energy: -3.712 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 124 Temperature: 1.285714 Total energy: -256.970645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.970645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.970645 (E_RNA) where: Base-Base interactions energy: -87.961 where: short stacking energy: -84.569 Base-Backbone interact. energy: -0.117 local terms energy: -168.892449 where: bonds (distance) C4'-P energy: -49.177 bonds (distance) P-C4' energy: -50.487 flat angles C4'-P-C4' energy: -41.219 flat angles P-C4'-P energy: -21.818 tors. eta vs tors. theta energy: -6.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 124 Temperature: 1.350000 Total energy: -258.417735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.417735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.417735 (E_RNA) where: Base-Base interactions energy: -113.141 where: short stacking energy: -92.241 Base-Backbone interact. energy: -1.342 local terms energy: -143.934671 where: bonds (distance) C4'-P energy: -43.046 bonds (distance) P-C4' energy: -37.805 flat angles C4'-P-C4' energy: -43.442 flat angles P-C4'-P energy: -21.197 tors. eta vs tors. theta energy: 1.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 125 Temperature: 0.900000 Total energy: -789.337125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.337125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.337125 (E_RNA) where: Base-Base interactions energy: -540.562 where: short stacking energy: -245.673 Base-Backbone interact. energy: -1.606 local terms energy: -247.169102 where: bonds (distance) C4'-P energy: -49.710 bonds (distance) P-C4' energy: -55.458 flat angles C4'-P-C4' energy: -61.061 flat angles P-C4'-P energy: -34.762 tors. eta vs tors. theta energy: -46.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 125 Temperature: 0.964286 Total energy: -756.947963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.947963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.947963 (E_RNA) where: Base-Base interactions energy: -493.317 where: short stacking energy: -262.997 Base-Backbone interact. energy: -1.394 local terms energy: -262.237774 where: bonds (distance) C4'-P energy: -53.880 bonds (distance) P-C4' energy: -59.343 flat angles C4'-P-C4' energy: -56.451 flat angles P-C4'-P energy: -31.269 tors. eta vs tors. theta energy: -61.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 125 Temperature: 1.028571 Total energy: -729.428523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.428523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.428523 (E_RNA) where: Base-Base interactions energy: -477.793 where: short stacking energy: -203.994 Base-Backbone interact. energy: -0.078 local terms energy: -251.557857 where: bonds (distance) C4'-P energy: -60.091 bonds (distance) P-C4' energy: -60.163 flat angles C4'-P-C4' energy: -55.274 flat angles P-C4'-P energy: -28.960 tors. eta vs tors. theta energy: -47.071 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 125 Temperature: 1.092857 Total energy: -586.549186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.549186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.549186 (E_RNA) where: Base-Base interactions energy: -359.949 where: short stacking energy: -178.938 Base-Backbone interact. energy: 2.370 local terms energy: -228.970062 where: bonds (distance) C4'-P energy: -57.216 bonds (distance) P-C4' energy: -56.854 flat angles C4'-P-C4' energy: -51.600 flat angles P-C4'-P energy: -22.897 tors. eta vs tors. theta energy: -40.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 125 Temperature: 1.157143 Total energy: -450.103166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.103166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.103166 (E_RNA) where: Base-Base interactions energy: -242.765 where: short stacking energy: -148.361 Base-Backbone interact. energy: 3.781 local terms energy: -211.119836 where: bonds (distance) C4'-P energy: -51.431 bonds (distance) P-C4' energy: -55.777 flat angles C4'-P-C4' energy: -51.681 flat angles P-C4'-P energy: -32.375 tors. eta vs tors. theta energy: -19.856 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 125 Temperature: 1.221429 Total energy: -342.375580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.375580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.375580 (E_RNA) where: Base-Base interactions energy: -160.300 where: short stacking energy: -100.099 Base-Backbone interact. energy: -0.807 local terms energy: -181.269023 where: bonds (distance) C4'-P energy: -49.734 bonds (distance) P-C4' energy: -56.060 flat angles C4'-P-C4' energy: -52.849 flat angles P-C4'-P energy: -25.566 tors. eta vs tors. theta energy: 2.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 125 Temperature: 1.285714 Total energy: -232.244470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.244470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.244470 (E_RNA) where: Base-Base interactions energy: -79.385 where: short stacking energy: -66.531 Base-Backbone interact. energy: 0.235 local terms energy: -153.094027 where: bonds (distance) C4'-P energy: -46.261 bonds (distance) P-C4' energy: -45.592 flat angles C4'-P-C4' energy: -37.503 flat angles P-C4'-P energy: -25.124 tors. eta vs tors. theta energy: 1.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 125 Temperature: 1.350000 Total energy: -255.954768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.954768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.954768 (E_RNA) where: Base-Base interactions energy: -115.735 where: short stacking energy: -96.754 Base-Backbone interact. energy: -1.294 local terms energy: -138.926113 where: bonds (distance) C4'-P energy: -39.237 bonds (distance) P-C4' energy: -38.489 flat angles C4'-P-C4' energy: -40.242 flat angles P-C4'-P energy: -22.430 tors. eta vs tors. theta energy: 1.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 126 Temperature: 0.900000 Total energy: -784.405015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.405015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.405015 (E_RNA) where: Base-Base interactions energy: -514.605 where: short stacking energy: -236.113 Base-Backbone interact. energy: -1.904 local terms energy: -267.896639 where: bonds (distance) C4'-P energy: -64.862 bonds (distance) P-C4' energy: -59.988 flat angles C4'-P-C4' energy: -56.277 flat angles P-C4'-P energy: -32.059 tors. eta vs tors. theta energy: -54.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 126 Temperature: 0.964286 Total energy: -769.550115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.550115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.550115 (E_RNA) where: Base-Base interactions energy: -489.157 where: short stacking energy: -259.208 Base-Backbone interact. energy: -0.404 local terms energy: -279.988969 where: bonds (distance) C4'-P energy: -56.642 bonds (distance) P-C4' energy: -63.099 flat angles C4'-P-C4' energy: -64.462 flat angles P-C4'-P energy: -37.045 tors. eta vs tors. theta energy: -58.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 126 Temperature: 1.028571 Total energy: -712.350932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.350932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.350932 (E_RNA) where: Base-Base interactions energy: -471.053 where: short stacking energy: -217.672 Base-Backbone interact. energy: -2.074 local terms energy: -239.223253 where: bonds (distance) C4'-P energy: -47.664 bonds (distance) P-C4' energy: -58.785 flat angles C4'-P-C4' energy: -48.553 flat angles P-C4'-P energy: -38.071 tors. eta vs tors. theta energy: -46.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 126 Temperature: 1.092857 Total energy: -628.478015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.478015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.478015 (E_RNA) where: Base-Base interactions energy: -373.980 where: short stacking energy: -201.509 Base-Backbone interact. energy: 0.643 local terms energy: -255.141558 where: bonds (distance) C4'-P energy: -56.395 bonds (distance) P-C4' energy: -57.092 flat angles C4'-P-C4' energy: -59.760 flat angles P-C4'-P energy: -39.706 tors. eta vs tors. theta energy: -42.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 126 Temperature: 1.157143 Total energy: -468.339485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.339485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.339485 (E_RNA) where: Base-Base interactions energy: -250.977 where: short stacking energy: -155.275 Base-Backbone interact. energy: -1.196 local terms energy: -216.166502 where: bonds (distance) C4'-P energy: -55.961 bonds (distance) P-C4' energy: -47.746 flat angles C4'-P-C4' energy: -55.992 flat angles P-C4'-P energy: -29.605 tors. eta vs tors. theta energy: -26.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 126 Temperature: 1.221429 Total energy: -347.088353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.088353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.088353 (E_RNA) where: Base-Base interactions energy: -146.654 where: short stacking energy: -100.836 Base-Backbone interact. energy: 2.577 local terms energy: -203.011266 where: bonds (distance) C4'-P energy: -50.665 bonds (distance) P-C4' energy: -63.256 flat angles C4'-P-C4' energy: -40.868 flat angles P-C4'-P energy: -38.694 tors. eta vs tors. theta energy: -9.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 126 Temperature: 1.285714 Total energy: -256.476993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.476993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.476993 (E_RNA) where: Base-Base interactions energy: -96.607 where: short stacking energy: -63.519 Base-Backbone interact. energy: -0.996 local terms energy: -158.874491 where: bonds (distance) C4'-P energy: -52.345 bonds (distance) P-C4' energy: -45.417 flat angles C4'-P-C4' energy: -37.398 flat angles P-C4'-P energy: -32.092 tors. eta vs tors. theta energy: 8.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 126 Temperature: 1.350000 Total energy: -238.688072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.688072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.688072 (E_RNA) where: Base-Base interactions energy: -99.567 where: short stacking energy: -78.443 Base-Backbone interact. energy: 2.259 local terms energy: -141.379531 where: bonds (distance) C4'-P energy: -50.612 bonds (distance) P-C4' energy: -47.615 flat angles C4'-P-C4' energy: -39.322 flat angles P-C4'-P energy: -13.625 tors. eta vs tors. theta energy: 9.795 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 127 Temperature: 0.900000 Total energy: -804.075482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -804.075482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -804.075482 (E_RNA) where: Base-Base interactions energy: -539.607 where: short stacking energy: -242.886 Base-Backbone interact. energy: 0.551 local terms energy: -265.019845 where: bonds (distance) C4'-P energy: -61.881 bonds (distance) P-C4' energy: -58.361 flat angles C4'-P-C4' energy: -61.285 flat angles P-C4'-P energy: -37.129 tors. eta vs tors. theta energy: -46.364 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 127 Temperature: 0.964286 Total energy: -770.639447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.639447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.639447 (E_RNA) where: Base-Base interactions energy: -492.974 where: short stacking energy: -245.712 Base-Backbone interact. energy: -0.905 local terms energy: -276.760245 where: bonds (distance) C4'-P energy: -49.437 bonds (distance) P-C4' energy: -61.749 flat angles C4'-P-C4' energy: -65.732 flat angles P-C4'-P energy: -41.462 tors. eta vs tors. theta energy: -58.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 127 Temperature: 1.028571 Total energy: -689.906299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.906299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.906299 (E_RNA) where: Base-Base interactions energy: -451.016 where: short stacking energy: -202.733 Base-Backbone interact. energy: -0.835 local terms energy: -238.055971 where: bonds (distance) C4'-P energy: -53.619 bonds (distance) P-C4' energy: -56.152 flat angles C4'-P-C4' energy: -51.008 flat angles P-C4'-P energy: -39.088 tors. eta vs tors. theta energy: -38.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 127 Temperature: 1.092857 Total energy: -601.032652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.032652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.032652 (E_RNA) where: Base-Base interactions energy: -366.111 where: short stacking energy: -205.381 Base-Backbone interact. energy: -1.041 local terms energy: -233.880404 where: bonds (distance) C4'-P energy: -44.923 bonds (distance) P-C4' energy: -52.451 flat angles C4'-P-C4' energy: -51.532 flat angles P-C4'-P energy: -37.903 tors. eta vs tors. theta energy: -47.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 127 Temperature: 1.157143 Total energy: -437.551968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.551968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.551968 (E_RNA) where: Base-Base interactions energy: -237.173 where: short stacking energy: -139.896 Base-Backbone interact. energy: -0.985 local terms energy: -199.393190 where: bonds (distance) C4'-P energy: -44.528 bonds (distance) P-C4' energy: -49.920 flat angles C4'-P-C4' energy: -41.133 flat angles P-C4'-P energy: -31.978 tors. eta vs tors. theta energy: -31.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 127 Temperature: 1.221429 Total energy: -373.597047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.597047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.597047 (E_RNA) where: Base-Base interactions energy: -202.990 where: short stacking energy: -103.079 Base-Backbone interact. energy: -0.964 local terms energy: -169.643208 where: bonds (distance) C4'-P energy: -59.011 bonds (distance) P-C4' energy: -49.042 flat angles C4'-P-C4' energy: -42.725 flat angles P-C4'-P energy: -17.698 tors. eta vs tors. theta energy: -1.167 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 127 Temperature: 1.285714 Total energy: -276.598857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.598857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.598857 (E_RNA) where: Base-Base interactions energy: -99.084 where: short stacking energy: -89.000 Base-Backbone interact. energy: -0.869 local terms energy: -176.645851 where: bonds (distance) C4'-P energy: -42.380 bonds (distance) P-C4' energy: -57.910 flat angles C4'-P-C4' energy: -44.095 flat angles P-C4'-P energy: -27.234 tors. eta vs tors. theta energy: -5.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 127 Temperature: 1.350000 Total energy: -254.592107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.592107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.592107 (E_RNA) where: Base-Base interactions energy: -98.018 where: short stacking energy: -92.844 Base-Backbone interact. energy: 1.628 local terms energy: -158.202051 where: bonds (distance) C4'-P energy: -38.624 bonds (distance) P-C4' energy: -57.580 flat angles C4'-P-C4' energy: -28.180 flat angles P-C4'-P energy: -27.978 tors. eta vs tors. theta energy: -5.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 128 Temperature: 0.900000 Total energy: -807.876390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -807.876390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -807.876390 (E_RNA) where: Base-Base interactions energy: -553.306 where: short stacking energy: -253.061 Base-Backbone interact. energy: -0.875 local terms energy: -253.695326 where: bonds (distance) C4'-P energy: -59.861 bonds (distance) P-C4' energy: -48.636 flat angles C4'-P-C4' energy: -59.389 flat angles P-C4'-P energy: -36.469 tors. eta vs tors. theta energy: -49.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 128 Temperature: 0.964286 Total energy: -752.248734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.248734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.248734 (E_RNA) where: Base-Base interactions energy: -468.164 where: short stacking energy: -249.541 Base-Backbone interact. energy: -1.333 local terms energy: -282.751506 where: bonds (distance) C4'-P energy: -63.563 bonds (distance) P-C4' energy: -55.902 flat angles C4'-P-C4' energy: -65.634 flat angles P-C4'-P energy: -35.068 tors. eta vs tors. theta energy: -62.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 128 Temperature: 1.028571 Total energy: -732.599488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.599488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.599488 (E_RNA) where: Base-Base interactions energy: -493.831 where: short stacking energy: -227.842 Base-Backbone interact. energy: -2.048 local terms energy: -236.720842 where: bonds (distance) C4'-P energy: -47.693 bonds (distance) P-C4' energy: -58.386 flat angles C4'-P-C4' energy: -56.436 flat angles P-C4'-P energy: -30.225 tors. eta vs tors. theta energy: -43.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 128 Temperature: 1.092857 Total energy: -619.433066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.433066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.433066 (E_RNA) where: Base-Base interactions energy: -397.665 where: short stacking energy: -208.001 Base-Backbone interact. energy: -2.712 local terms energy: -219.056353 where: bonds (distance) C4'-P energy: -54.765 bonds (distance) P-C4' energy: -44.102 flat angles C4'-P-C4' energy: -53.877 flat angles P-C4'-P energy: -25.475 tors. eta vs tors. theta energy: -40.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 128 Temperature: 1.157143 Total energy: -425.682160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.682160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.682160 (E_RNA) where: Base-Base interactions energy: -223.508 where: short stacking energy: -119.789 Base-Backbone interact. energy: -0.125 local terms energy: -202.049137 where: bonds (distance) C4'-P energy: -32.319 bonds (distance) P-C4' energy: -57.459 flat angles C4'-P-C4' energy: -60.928 flat angles P-C4'-P energy: -30.742 tors. eta vs tors. theta energy: -20.601 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 128 Temperature: 1.221429 Total energy: -344.216723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.216723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.216723 (E_RNA) where: Base-Base interactions energy: -153.744 where: short stacking energy: -84.759 Base-Backbone interact. energy: -0.008 local terms energy: -190.465066 where: bonds (distance) C4'-P energy: -54.849 bonds (distance) P-C4' energy: -55.233 flat angles C4'-P-C4' energy: -45.253 flat angles P-C4'-P energy: -31.968 tors. eta vs tors. theta energy: -3.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 128 Temperature: 1.285714 Total energy: -275.300396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.300396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.300396 (E_RNA) where: Base-Base interactions energy: -114.379 where: short stacking energy: -102.008 Base-Backbone interact. energy: 1.582 local terms energy: -162.503194 where: bonds (distance) C4'-P energy: -44.566 bonds (distance) P-C4' energy: -52.934 flat angles C4'-P-C4' energy: -44.583 flat angles P-C4'-P energy: -15.266 tors. eta vs tors. theta energy: -5.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 128 Temperature: 1.350000 Total energy: -241.757123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.757123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.757123 (E_RNA) where: Base-Base interactions energy: -79.852 where: short stacking energy: -75.475 Base-Backbone interact. energy: 2.329 local terms energy: -164.234198 where: bonds (distance) C4'-P energy: -53.544 bonds (distance) P-C4' energy: -47.812 flat angles C4'-P-C4' energy: -38.939 flat angles P-C4'-P energy: -29.860 tors. eta vs tors. theta energy: 5.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 129 Temperature: 0.900000 Total energy: -803.548174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.548174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -803.548174 (E_RNA) where: Base-Base interactions energy: -542.860 where: short stacking energy: -235.742 Base-Backbone interact. energy: -0.212 local terms energy: -260.476343 where: bonds (distance) C4'-P energy: -51.768 bonds (distance) P-C4' energy: -64.619 flat angles C4'-P-C4' energy: -59.986 flat angles P-C4'-P energy: -32.147 tors. eta vs tors. theta energy: -51.955 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 129 Temperature: 0.964286 Total energy: -781.851235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.851235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -781.851235 (E_RNA) where: Base-Base interactions energy: -509.128 where: short stacking energy: -283.944 Base-Backbone interact. energy: 1.918 local terms energy: -274.641584 where: bonds (distance) C4'-P energy: -48.987 bonds (distance) P-C4' energy: -63.254 flat angles C4'-P-C4' energy: -60.299 flat angles P-C4'-P energy: -32.624 tors. eta vs tors. theta energy: -69.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 129 Temperature: 1.028571 Total energy: -711.899895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.899895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.899895 (E_RNA) where: Base-Base interactions energy: -500.912 where: short stacking energy: -204.601 Base-Backbone interact. energy: -2.613 local terms energy: -208.374312 where: bonds (distance) C4'-P energy: -45.147 bonds (distance) P-C4' energy: -43.781 flat angles C4'-P-C4' energy: -51.087 flat angles P-C4'-P energy: -19.823 tors. eta vs tors. theta energy: -48.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 129 Temperature: 1.092857 Total energy: -618.892883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.892883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.892883 (E_RNA) where: Base-Base interactions energy: -385.623 where: short stacking energy: -220.048 Base-Backbone interact. energy: -1.611 local terms energy: -231.658505 where: bonds (distance) C4'-P energy: -47.286 bonds (distance) P-C4' energy: -56.635 flat angles C4'-P-C4' energy: -54.469 flat angles P-C4'-P energy: -25.434 tors. eta vs tors. theta energy: -47.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 129 Temperature: 1.157143 Total energy: -456.642820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.642820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.642820 (E_RNA) where: Base-Base interactions energy: -252.488 where: short stacking energy: -118.729 Base-Backbone interact. energy: -0.857 local terms energy: -203.297832 where: bonds (distance) C4'-P energy: -50.296 bonds (distance) P-C4' energy: -54.508 flat angles C4'-P-C4' energy: -44.317 flat angles P-C4'-P energy: -38.330 tors. eta vs tors. theta energy: -15.847 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 129 Temperature: 1.221429 Total energy: -327.022053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.022053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.022053 (E_RNA) where: Base-Base interactions energy: -170.505 where: short stacking energy: -98.343 Base-Backbone interact. energy: 7.078 local terms energy: -163.594978 where: bonds (distance) C4'-P energy: -48.978 bonds (distance) P-C4' energy: -49.590 flat angles C4'-P-C4' energy: -44.459 flat angles P-C4'-P energy: -21.627 tors. eta vs tors. theta energy: 1.058 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 129 Temperature: 1.285714 Total energy: -269.913294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.913294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.913294 (E_RNA) where: Base-Base interactions energy: -103.878 where: short stacking energy: -96.074 Base-Backbone interact. energy: -0.141 local terms energy: -165.894452 where: bonds (distance) C4'-P energy: -46.064 bonds (distance) P-C4' energy: -47.884 flat angles C4'-P-C4' energy: -42.781 flat angles P-C4'-P energy: -35.735 tors. eta vs tors. theta energy: 6.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 129 Temperature: 1.350000 Total energy: -236.773218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.773218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.773218 (E_RNA) where: Base-Base interactions energy: -71.416 where: short stacking energy: -63.301 Base-Backbone interact. energy: -2.419 local terms energy: -162.938351 where: bonds (distance) C4'-P energy: -47.221 bonds (distance) P-C4' energy: -51.047 flat angles C4'-P-C4' energy: -46.796 flat angles P-C4'-P energy: -26.135 tors. eta vs tors. theta energy: 8.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 130 Temperature: 0.900000 Total energy: -816.385228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -816.385228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -816.385228 (E_RNA) where: Base-Base interactions energy: -546.347 where: short stacking energy: -244.397 Base-Backbone interact. energy: -1.940 local terms energy: -268.097832 where: bonds (distance) C4'-P energy: -59.339 bonds (distance) P-C4' energy: -64.669 flat angles C4'-P-C4' energy: -58.386 flat angles P-C4'-P energy: -35.872 tors. eta vs tors. theta energy: -49.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 130 Temperature: 0.964286 Total energy: -762.382917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.382917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.382917 (E_RNA) where: Base-Base interactions energy: -487.616 where: short stacking energy: -261.040 Base-Backbone interact. energy: 0.623 local terms energy: -275.389506 where: bonds (distance) C4'-P energy: -54.986 bonds (distance) P-C4' energy: -57.365 flat angles C4'-P-C4' energy: -50.047 flat angles P-C4'-P energy: -39.877 tors. eta vs tors. theta energy: -73.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 130 Temperature: 1.028571 Total energy: -742.369673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.369673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -742.369673 (E_RNA) where: Base-Base interactions energy: -470.483 where: short stacking energy: -200.671 Base-Backbone interact. energy: -1.136 local terms energy: -270.750433 where: bonds (distance) C4'-P energy: -55.295 bonds (distance) P-C4' energy: -65.750 flat angles C4'-P-C4' energy: -60.064 flat angles P-C4'-P energy: -42.678 tors. eta vs tors. theta energy: -46.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 130 Temperature: 1.092857 Total energy: -639.647508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -639.647508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.647508 (E_RNA) where: Base-Base interactions energy: -397.685 where: short stacking energy: -213.249 Base-Backbone interact. energy: -0.506 local terms energy: -241.456253 where: bonds (distance) C4'-P energy: -54.644 bonds (distance) P-C4' energy: -56.656 flat angles C4'-P-C4' energy: -58.776 flat angles P-C4'-P energy: -22.948 tors. eta vs tors. theta energy: -48.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 130 Temperature: 1.157143 Total energy: -496.297999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.297999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.297999 (E_RNA) where: Base-Base interactions energy: -287.826 where: short stacking energy: -159.918 Base-Backbone interact. energy: -0.049 local terms energy: -208.423383 where: bonds (distance) C4'-P energy: -49.579 bonds (distance) P-C4' energy: -50.495 flat angles C4'-P-C4' energy: -47.315 flat angles P-C4'-P energy: -36.288 tors. eta vs tors. theta energy: -24.747 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 130 Temperature: 1.221429 Total energy: -369.045842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.045842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.045842 (E_RNA) where: Base-Base interactions energy: -190.100 where: short stacking energy: -126.511 Base-Backbone interact. energy: -0.094 local terms energy: -178.851836 where: bonds (distance) C4'-P energy: -46.594 bonds (distance) P-C4' energy: -54.195 flat angles C4'-P-C4' energy: -40.310 flat angles P-C4'-P energy: -31.711 tors. eta vs tors. theta energy: -6.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 130 Temperature: 1.285714 Total energy: -275.259288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.259288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.259288 (E_RNA) where: Base-Base interactions energy: -117.417 where: short stacking energy: -79.513 Base-Backbone interact. energy: 0.391 local terms energy: -158.234078 where: bonds (distance) C4'-P energy: -48.630 bonds (distance) P-C4' energy: -51.837 flat angles C4'-P-C4' energy: -39.310 flat angles P-C4'-P energy: -20.359 tors. eta vs tors. theta energy: 1.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 130 Temperature: 1.350000 Total energy: -223.541517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.541517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.541517 (E_RNA) where: Base-Base interactions energy: -95.202 where: short stacking energy: -68.245 Base-Backbone interact. energy: -0.866 local terms energy: -127.473057 where: bonds (distance) C4'-P energy: -39.450 bonds (distance) P-C4' energy: -46.356 flat angles C4'-P-C4' energy: -34.368 flat angles P-C4'-P energy: -20.918 tors. eta vs tors. theta energy: 13.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 131 Temperature: 0.900000 Total energy: -800.931542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.931542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.931542 (E_RNA) where: Base-Base interactions energy: -548.809 where: short stacking energy: -245.065 Base-Backbone interact. energy: -1.196 local terms energy: -250.926653 where: bonds (distance) C4'-P energy: -59.084 bonds (distance) P-C4' energy: -54.752 flat angles C4'-P-C4' energy: -48.401 flat angles P-C4'-P energy: -35.352 tors. eta vs tors. theta energy: -53.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 131 Temperature: 0.964286 Total energy: -777.362334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.362334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.362334 (E_RNA) where: Base-Base interactions energy: -487.103 where: short stacking energy: -264.052 Base-Backbone interact. energy: 2.618 local terms energy: -292.877843 where: bonds (distance) C4'-P energy: -62.388 bonds (distance) P-C4' energy: -60.547 flat angles C4'-P-C4' energy: -60.483 flat angles P-C4'-P energy: -36.581 tors. eta vs tors. theta energy: -72.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 131 Temperature: 1.028571 Total energy: -750.330561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.330561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.330561 (E_RNA) where: Base-Base interactions energy: -500.846 where: short stacking energy: -219.159 Base-Backbone interact. energy: -1.209 local terms energy: -248.275884 where: bonds (distance) C4'-P energy: -56.659 bonds (distance) P-C4' energy: -53.226 flat angles C4'-P-C4' energy: -56.861 flat angles P-C4'-P energy: -36.519 tors. eta vs tors. theta energy: -45.011 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 131 Temperature: 1.092857 Total energy: -653.648078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.648078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.648078 (E_RNA) where: Base-Base interactions energy: -385.697 where: short stacking energy: -234.793 Base-Backbone interact. energy: -0.015 local terms energy: -267.936553 where: bonds (distance) C4'-P energy: -64.228 bonds (distance) P-C4' energy: -52.302 flat angles C4'-P-C4' energy: -59.709 flat angles P-C4'-P energy: -32.428 tors. eta vs tors. theta energy: -59.269 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 131 Temperature: 1.157143 Total energy: -501.638303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.638303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.638303 (E_RNA) where: Base-Base interactions energy: -276.518 where: short stacking energy: -168.211 Base-Backbone interact. energy: -0.695 local terms energy: -224.425835 where: bonds (distance) C4'-P energy: -56.615 bonds (distance) P-C4' energy: -39.526 flat angles C4'-P-C4' energy: -55.397 flat angles P-C4'-P energy: -40.540 tors. eta vs tors. theta energy: -32.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 131 Temperature: 1.221429 Total energy: -359.841278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.841278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.841278 (E_RNA) where: Base-Base interactions energy: -194.244 where: short stacking energy: -123.506 Base-Backbone interact. energy: -0.543 local terms energy: -165.053455 where: bonds (distance) C4'-P energy: -44.041 bonds (distance) P-C4' energy: -48.916 flat angles C4'-P-C4' energy: -41.838 flat angles P-C4'-P energy: -22.801 tors. eta vs tors. theta energy: -7.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 131 Temperature: 1.285714 Total energy: -255.689938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.689938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.689938 (E_RNA) where: Base-Base interactions energy: -96.619 where: short stacking energy: -78.188 Base-Backbone interact. energy: -0.206 local terms energy: -158.864725 where: bonds (distance) C4'-P energy: -48.561 bonds (distance) P-C4' energy: -47.263 flat angles C4'-P-C4' energy: -36.753 flat angles P-C4'-P energy: -29.056 tors. eta vs tors. theta energy: 2.769 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 131 Temperature: 1.350000 Total energy: -226.734062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.734062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.734062 (E_RNA) where: Base-Base interactions energy: -78.697 where: short stacking energy: -68.764 Base-Backbone interact. energy: 0.790 local terms energy: -148.827236 where: bonds (distance) C4'-P energy: -35.949 bonds (distance) P-C4' energy: -53.369 flat angles C4'-P-C4' energy: -30.587 flat angles P-C4'-P energy: -28.475 tors. eta vs tors. theta energy: -0.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 132 Temperature: 0.900000 Total energy: -805.908759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -805.908759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -805.908759 (E_RNA) where: Base-Base interactions energy: -544.827 where: short stacking energy: -242.480 Base-Backbone interact. energy: 0.161 local terms energy: -261.242562 where: bonds (distance) C4'-P energy: -52.765 bonds (distance) P-C4' energy: -59.544 flat angles C4'-P-C4' energy: -50.412 flat angles P-C4'-P energy: -38.328 tors. eta vs tors. theta energy: -60.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 132 Temperature: 0.964286 Total energy: -744.011941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.011941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.011941 (E_RNA) where: Base-Base interactions energy: -470.364 where: short stacking energy: -234.486 Base-Backbone interact. energy: 1.200 local terms energy: -274.847565 where: bonds (distance) C4'-P energy: -59.504 bonds (distance) P-C4' energy: -55.823 flat angles C4'-P-C4' energy: -61.385 flat angles P-C4'-P energy: -38.631 tors. eta vs tors. theta energy: -59.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 132 Temperature: 1.028571 Total energy: -715.411228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.411228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.411228 (E_RNA) where: Base-Base interactions energy: -465.452 where: short stacking energy: -189.626 Base-Backbone interact. energy: -2.480 local terms energy: -247.478769 where: bonds (distance) C4'-P energy: -53.318 bonds (distance) P-C4' energy: -55.344 flat angles C4'-P-C4' energy: -57.557 flat angles P-C4'-P energy: -41.764 tors. eta vs tors. theta energy: -39.497 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 132 Temperature: 1.092857 Total energy: -656.166141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.166141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.166141 (E_RNA) where: Base-Base interactions energy: -394.727 where: short stacking energy: -228.391 Base-Backbone interact. energy: -2.145 local terms energy: -259.294622 where: bonds (distance) C4'-P energy: -49.489 bonds (distance) P-C4' energy: -59.713 flat angles C4'-P-C4' energy: -60.507 flat angles P-C4'-P energy: -30.840 tors. eta vs tors. theta energy: -58.745 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 132 Temperature: 1.157143 Total energy: -521.030017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.030017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.030017 (E_RNA) where: Base-Base interactions energy: -313.784 where: short stacking energy: -179.118 Base-Backbone interact. energy: 1.185 local terms energy: -208.430942 where: bonds (distance) C4'-P energy: -53.787 bonds (distance) P-C4' energy: -43.276 flat angles C4'-P-C4' energy: -44.506 flat angles P-C4'-P energy: -32.048 tors. eta vs tors. theta energy: -34.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 132 Temperature: 1.221429 Total energy: -309.530614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.530614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.530614 (E_RNA) where: Base-Base interactions energy: -146.778 where: short stacking energy: -90.551 Base-Backbone interact. energy: -3.219 local terms energy: -159.533707 where: bonds (distance) C4'-P energy: -47.551 bonds (distance) P-C4' energy: -56.022 flat angles C4'-P-C4' energy: -39.566 flat angles P-C4'-P energy: -20.182 tors. eta vs tors. theta energy: 3.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 132 Temperature: 1.285714 Total energy: -264.142131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.142131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.142131 (E_RNA) where: Base-Base interactions energy: -86.516 where: short stacking energy: -80.659 Base-Backbone interact. energy: -0.907 local terms energy: -176.718898 where: bonds (distance) C4'-P energy: -47.610 bonds (distance) P-C4' energy: -60.160 flat angles C4'-P-C4' energy: -48.030 flat angles P-C4'-P energy: -20.332 tors. eta vs tors. theta energy: -0.588 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 132 Temperature: 1.350000 Total energy: -233.797009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.797009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.797009 (E_RNA) where: Base-Base interactions energy: -83.367 where: short stacking energy: -70.574 Base-Backbone interact. energy: 2.261 local terms energy: -152.691232 where: bonds (distance) C4'-P energy: -38.531 bonds (distance) P-C4' energy: -51.937 flat angles C4'-P-C4' energy: -38.020 flat angles P-C4'-P energy: -26.737 tors. eta vs tors. theta energy: 2.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 133 Temperature: 0.900000 Total energy: -845.232758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.232758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.232758 (E_RNA) where: Base-Base interactions energy: -571.063 where: short stacking energy: -252.982 Base-Backbone interact. energy: 0.369 local terms energy: -274.538344 where: bonds (distance) C4'-P energy: -61.225 bonds (distance) P-C4' energy: -62.611 flat angles C4'-P-C4' energy: -54.053 flat angles P-C4'-P energy: -42.425 tors. eta vs tors. theta energy: -54.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 133 Temperature: 0.964286 Total energy: -751.390493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.390493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.390493 (E_RNA) where: Base-Base interactions energy: -492.309 where: short stacking energy: -223.719 Base-Backbone interact. energy: 0.164 local terms energy: -259.245695 where: bonds (distance) C4'-P energy: -56.113 bonds (distance) P-C4' energy: -58.296 flat angles C4'-P-C4' energy: -58.499 flat angles P-C4'-P energy: -44.543 tors. eta vs tors. theta energy: -41.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 133 Temperature: 1.028571 Total energy: -711.837641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.837641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.837641 (E_RNA) where: Base-Base interactions energy: -463.930 where: short stacking energy: -238.868 Base-Backbone interact. energy: -1.175 local terms energy: -246.732735 where: bonds (distance) C4'-P energy: -55.170 bonds (distance) P-C4' energy: -53.263 flat angles C4'-P-C4' energy: -57.069 flat angles P-C4'-P energy: -30.162 tors. eta vs tors. theta energy: -51.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 133 Temperature: 1.092857 Total energy: -626.376346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.376346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.376346 (E_RNA) where: Base-Base interactions energy: -416.230 where: short stacking energy: -218.545 Base-Backbone interact. energy: 1.757 local terms energy: -211.903874 where: bonds (distance) C4'-P energy: -40.683 bonds (distance) P-C4' energy: -46.801 flat angles C4'-P-C4' energy: -46.927 flat angles P-C4'-P energy: -18.963 tors. eta vs tors. theta energy: -58.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 133 Temperature: 1.157143 Total energy: -472.406213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.406213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.406213 (E_RNA) where: Base-Base interactions energy: -260.759 where: short stacking energy: -152.339 Base-Backbone interact. energy: 0.321 local terms energy: -211.968270 where: bonds (distance) C4'-P energy: -52.031 bonds (distance) P-C4' energy: -52.193 flat angles C4'-P-C4' energy: -51.574 flat angles P-C4'-P energy: -29.938 tors. eta vs tors. theta energy: -26.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 133 Temperature: 1.221429 Total energy: -312.354112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.354112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.354112 (E_RNA) where: Base-Base interactions energy: -140.282 where: short stacking energy: -85.885 Base-Backbone interact. energy: -0.688 local terms energy: -171.384662 where: bonds (distance) C4'-P energy: -54.352 bonds (distance) P-C4' energy: -53.707 flat angles C4'-P-C4' energy: -34.829 flat angles P-C4'-P energy: -29.615 tors. eta vs tors. theta energy: 1.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 133 Temperature: 1.285714 Total energy: -229.144086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.144086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.144086 (E_RNA) where: Base-Base interactions energy: -71.811 where: short stacking energy: -70.723 Base-Backbone interact. energy: 4.722 local terms energy: -162.055394 where: bonds (distance) C4'-P energy: -51.005 bonds (distance) P-C4' energy: -51.925 flat angles C4'-P-C4' energy: -50.100 flat angles P-C4'-P energy: -28.549 tors. eta vs tors. theta energy: 19.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 133 Temperature: 1.350000 Total energy: -255.214982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.214982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.214982 (E_RNA) where: Base-Base interactions energy: -88.039 where: short stacking energy: -82.073 Base-Backbone interact. energy: 3.008 local terms energy: -170.184051 where: bonds (distance) C4'-P energy: -47.931 bonds (distance) P-C4' energy: -48.766 flat angles C4'-P-C4' energy: -44.162 flat angles P-C4'-P energy: -34.069 tors. eta vs tors. theta energy: 4.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 134 Temperature: 0.900000 Total energy: -838.742284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.742284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.742284 (E_RNA) where: Base-Base interactions energy: -571.261 where: short stacking energy: -255.356 Base-Backbone interact. energy: -1.987 local terms energy: -265.494168 where: bonds (distance) C4'-P energy: -56.617 bonds (distance) P-C4' energy: -56.549 flat angles C4'-P-C4' energy: -56.622 flat angles P-C4'-P energy: -40.516 tors. eta vs tors. theta energy: -55.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 134 Temperature: 0.964286 Total energy: -744.292249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.292249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.292249 (E_RNA) where: Base-Base interactions energy: -484.601 where: short stacking energy: -215.642 Base-Backbone interact. energy: -1.567 local terms energy: -258.124604 where: bonds (distance) C4'-P energy: -57.175 bonds (distance) P-C4' energy: -59.046 flat angles C4'-P-C4' energy: -54.220 flat angles P-C4'-P energy: -37.143 tors. eta vs tors. theta energy: -50.540 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 134 Temperature: 1.028571 Total energy: -710.184888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -710.184888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.184888 (E_RNA) where: Base-Base interactions energy: -435.576 where: short stacking energy: -223.761 Base-Backbone interact. energy: -1.476 local terms energy: -273.133426 where: bonds (distance) C4'-P energy: -57.111 bonds (distance) P-C4' energy: -56.556 flat angles C4'-P-C4' energy: -53.910 flat angles P-C4'-P energy: -38.830 tors. eta vs tors. theta energy: -66.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 134 Temperature: 1.092857 Total energy: -636.795469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.795469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.795469 (E_RNA) where: Base-Base interactions energy: -397.462 where: short stacking energy: -200.257 Base-Backbone interact. energy: 0.019 local terms energy: -239.353264 where: bonds (distance) C4'-P energy: -51.468 bonds (distance) P-C4' energy: -57.171 flat angles C4'-P-C4' energy: -48.074 flat angles P-C4'-P energy: -28.781 tors. eta vs tors. theta energy: -53.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 134 Temperature: 1.157143 Total energy: -444.046394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.046394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.046394 (E_RNA) where: Base-Base interactions energy: -234.352 where: short stacking energy: -133.564 Base-Backbone interact. energy: -0.737 local terms energy: -208.957106 where: bonds (distance) C4'-P energy: -66.427 bonds (distance) P-C4' energy: -62.207 flat angles C4'-P-C4' energy: -36.014 flat angles P-C4'-P energy: -32.136 tors. eta vs tors. theta energy: -12.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 134 Temperature: 1.221429 Total energy: -339.466483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.466483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.466483 (E_RNA) where: Base-Base interactions energy: -162.684 where: short stacking energy: -110.620 Base-Backbone interact. energy: -1.612 local terms energy: -175.170865 where: bonds (distance) C4'-P energy: -46.887 bonds (distance) P-C4' energy: -45.705 flat angles C4'-P-C4' energy: -44.192 flat angles P-C4'-P energy: -32.733 tors. eta vs tors. theta energy: -5.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 134 Temperature: 1.285714 Total energy: -262.684054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.684054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.684054 (E_RNA) where: Base-Base interactions energy: -99.796 where: short stacking energy: -87.844 Base-Backbone interact. energy: 2.352 local terms energy: -165.239213 where: bonds (distance) C4'-P energy: -46.538 bonds (distance) P-C4' energy: -55.536 flat angles C4'-P-C4' energy: -38.370 flat angles P-C4'-P energy: -24.479 tors. eta vs tors. theta energy: -0.316 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 134 Temperature: 1.350000 Total energy: -224.612062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.612062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.612062 (E_RNA) where: Base-Base interactions energy: -74.142 where: short stacking energy: -66.824 Base-Backbone interact. energy: -0.999 local terms energy: -149.471801 where: bonds (distance) C4'-P energy: -46.305 bonds (distance) P-C4' energy: -54.231 flat angles C4'-P-C4' energy: -39.238 flat angles P-C4'-P energy: -21.075 tors. eta vs tors. theta energy: 11.378 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 135 Temperature: 0.900000 Total energy: -837.775645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.775645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.775645 (E_RNA) where: Base-Base interactions energy: -563.006 where: short stacking energy: -259.256 Base-Backbone interact. energy: -1.812 local terms energy: -272.957960 where: bonds (distance) C4'-P energy: -56.304 bonds (distance) P-C4' energy: -65.503 flat angles C4'-P-C4' energy: -59.121 flat angles P-C4'-P energy: -37.228 tors. eta vs tors. theta energy: -54.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 135 Temperature: 0.964286 Total energy: -763.548448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.548448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.548448 (E_RNA) where: Base-Base interactions energy: -489.950 where: short stacking energy: -246.737 Base-Backbone interact. energy: 2.107 local terms energy: -275.704815 where: bonds (distance) C4'-P energy: -56.700 bonds (distance) P-C4' energy: -57.835 flat angles C4'-P-C4' energy: -61.943 flat angles P-C4'-P energy: -40.015 tors. eta vs tors. theta energy: -59.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 135 Temperature: 1.028571 Total energy: -716.976882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.976882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.976882 (E_RNA) where: Base-Base interactions energy: -472.634 where: short stacking energy: -206.630 Base-Backbone interact. energy: -1.848 local terms energy: -242.494525 where: bonds (distance) C4'-P energy: -50.461 bonds (distance) P-C4' energy: -51.115 flat angles C4'-P-C4' energy: -54.932 flat angles P-C4'-P energy: -34.991 tors. eta vs tors. theta energy: -50.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 135 Temperature: 1.092857 Total energy: -650.566934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.566934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.566934 (E_RNA) where: Base-Base interactions energy: -396.917 where: short stacking energy: -204.673 Base-Backbone interact. energy: 0.349 local terms energy: -253.998915 where: bonds (distance) C4'-P energy: -56.192 bonds (distance) P-C4' energy: -55.715 flat angles C4'-P-C4' energy: -62.206 flat angles P-C4'-P energy: -31.588 tors. eta vs tors. theta energy: -48.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 135 Temperature: 1.157143 Total energy: -447.559305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.559305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.559305 (E_RNA) where: Base-Base interactions energy: -235.903 where: short stacking energy: -146.323 Base-Backbone interact. energy: -0.892 local terms energy: -210.764475 where: bonds (distance) C4'-P energy: -46.177 bonds (distance) P-C4' energy: -50.529 flat angles C4'-P-C4' energy: -57.379 flat angles P-C4'-P energy: -32.090 tors. eta vs tors. theta energy: -24.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 135 Temperature: 1.221429 Total energy: -248.895471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.895471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.895471 (E_RNA) where: Base-Base interactions energy: -79.839 where: short stacking energy: -65.889 Base-Backbone interact. energy: 1.150 local terms energy: -170.216290 where: bonds (distance) C4'-P energy: -45.197 bonds (distance) P-C4' energy: -52.924 flat angles C4'-P-C4' energy: -45.587 flat angles P-C4'-P energy: -33.700 tors. eta vs tors. theta energy: 7.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.010 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 135 Temperature: 1.285714 Total energy: -291.936332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.936332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.936332 (E_RNA) where: Base-Base interactions energy: -142.379 where: short stacking energy: -92.825 Base-Backbone interact. energy: 0.460 local terms energy: -150.017410 where: bonds (distance) C4'-P energy: -41.156 bonds (distance) P-C4' energy: -47.737 flat angles C4'-P-C4' energy: -40.301 flat angles P-C4'-P energy: -22.655 tors. eta vs tors. theta energy: 1.832 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 135 Temperature: 1.350000 Total energy: -210.531586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.531586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.531586 (E_RNA) where: Base-Base interactions energy: -69.564 where: short stacking energy: -64.926 Base-Backbone interact. energy: 2.261 local terms energy: -143.228453 where: bonds (distance) C4'-P energy: -46.028 bonds (distance) P-C4' energy: -60.434 flat angles C4'-P-C4' energy: -33.011 flat angles P-C4'-P energy: -24.832 tors. eta vs tors. theta energy: 21.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 136 Temperature: 0.900000 Total energy: -846.497008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.497008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -846.497008 (E_RNA) where: Base-Base interactions energy: -569.198 where: short stacking energy: -246.196 Base-Backbone interact. energy: -2.172 local terms energy: -275.126867 where: bonds (distance) C4'-P energy: -60.890 bonds (distance) P-C4' energy: -65.105 flat angles C4'-P-C4' energy: -55.942 flat angles P-C4'-P energy: -41.401 tors. eta vs tors. theta energy: -51.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 136 Temperature: 0.964286 Total energy: -763.765085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.765085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.765085 (E_RNA) where: Base-Base interactions energy: -482.438 where: short stacking energy: -249.930 Base-Backbone interact. energy: -1.166 local terms energy: -280.160397 where: bonds (distance) C4'-P energy: -59.856 bonds (distance) P-C4' energy: -51.748 flat angles C4'-P-C4' energy: -66.173 flat angles P-C4'-P energy: -36.668 tors. eta vs tors. theta energy: -65.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 136 Temperature: 1.028571 Total energy: -725.326536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.326536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.326536 (E_RNA) where: Base-Base interactions energy: -487.980 where: short stacking energy: -215.826 Base-Backbone interact. energy: 0.109 local terms energy: -237.455989 where: bonds (distance) C4'-P energy: -42.311 bonds (distance) P-C4' energy: -51.892 flat angles C4'-P-C4' energy: -56.033 flat angles P-C4'-P energy: -41.682 tors. eta vs tors. theta energy: -45.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 136 Temperature: 1.092857 Total energy: -623.045873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -623.045873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -623.045873 (E_RNA) where: Base-Base interactions energy: -390.034 where: short stacking energy: -208.070 Base-Backbone interact. energy: 0.574 local terms energy: -233.585406 where: bonds (distance) C4'-P energy: -49.447 bonds (distance) P-C4' energy: -56.902 flat angles C4'-P-C4' energy: -44.409 flat angles P-C4'-P energy: -32.786 tors. eta vs tors. theta energy: -50.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 136 Temperature: 1.157143 Total energy: -445.167870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.167870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.167870 (E_RNA) where: Base-Base interactions energy: -240.352 where: short stacking energy: -143.181 Base-Backbone interact. energy: -0.626 local terms energy: -204.190657 where: bonds (distance) C4'-P energy: -56.183 bonds (distance) P-C4' energy: -54.492 flat angles C4'-P-C4' energy: -53.710 flat angles P-C4'-P energy: -19.723 tors. eta vs tors. theta energy: -20.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 136 Temperature: 1.221429 Total energy: -303.840714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.840714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.840714 (E_RNA) where: Base-Base interactions energy: -135.305 where: short stacking energy: -112.563 Base-Backbone interact. energy: -0.622 local terms energy: -167.913417 where: bonds (distance) C4'-P energy: -44.702 bonds (distance) P-C4' energy: -47.509 flat angles C4'-P-C4' energy: -45.520 flat angles P-C4'-P energy: -24.450 tors. eta vs tors. theta energy: -5.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 136 Temperature: 1.285714 Total energy: -283.584847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.584847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.584847 (E_RNA) where: Base-Base interactions energy: -121.104 where: short stacking energy: -67.941 Base-Backbone interact. energy: 2.689 local terms energy: -165.169709 where: bonds (distance) C4'-P energy: -47.019 bonds (distance) P-C4' energy: -56.615 flat angles C4'-P-C4' energy: -44.028 flat angles P-C4'-P energy: -28.600 tors. eta vs tors. theta energy: 11.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 136 Temperature: 1.350000 Total energy: -208.056719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.056719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.056719 (E_RNA) where: Base-Base interactions energy: -71.981 where: short stacking energy: -72.080 Base-Backbone interact. energy: -1.006 local terms energy: -135.069696 where: bonds (distance) C4'-P energy: -57.873 bonds (distance) P-C4' energy: -48.962 flat angles C4'-P-C4' energy: -24.639 flat angles P-C4'-P energy: -20.971 tors. eta vs tors. theta energy: 17.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 137 Temperature: 0.900000 Total energy: -826.588936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.588936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.588936 (E_RNA) where: Base-Base interactions energy: -560.448 where: short stacking energy: -238.711 Base-Backbone interact. energy: -1.160 local terms energy: -264.980961 where: bonds (distance) C4'-P energy: -58.663 bonds (distance) P-C4' energy: -52.148 flat angles C4'-P-C4' energy: -58.849 flat angles P-C4'-P energy: -43.710 tors. eta vs tors. theta energy: -51.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 137 Temperature: 0.964286 Total energy: -766.281977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.281977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.281977 (E_RNA) where: Base-Base interactions energy: -491.023 where: short stacking energy: -268.911 Base-Backbone interact. energy: -1.236 local terms energy: -274.022277 where: bonds (distance) C4'-P energy: -52.215 bonds (distance) P-C4' energy: -59.274 flat angles C4'-P-C4' energy: -64.338 flat angles P-C4'-P energy: -36.428 tors. eta vs tors. theta energy: -61.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 137 Temperature: 1.028571 Total energy: -714.467073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.467073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.467073 (E_RNA) where: Base-Base interactions energy: -471.002 where: short stacking energy: -200.678 Base-Backbone interact. energy: -1.867 local terms energy: -241.597895 where: bonds (distance) C4'-P energy: -52.200 bonds (distance) P-C4' energy: -48.168 flat angles C4'-P-C4' energy: -51.617 flat angles P-C4'-P energy: -40.559 tors. eta vs tors. theta energy: -49.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 137 Temperature: 1.092857 Total energy: -615.482277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.482277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.482277 (E_RNA) where: Base-Base interactions energy: -390.470 where: short stacking energy: -199.427 Base-Backbone interact. energy: -0.876 local terms energy: -224.136694 where: bonds (distance) C4'-P energy: -39.535 bonds (distance) P-C4' energy: -53.047 flat angles C4'-P-C4' energy: -58.482 flat angles P-C4'-P energy: -33.264 tors. eta vs tors. theta energy: -39.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 137 Temperature: 1.157143 Total energy: -459.214262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.214262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.214262 (E_RNA) where: Base-Base interactions energy: -261.213 where: short stacking energy: -144.560 Base-Backbone interact. energy: -0.337 local terms energy: -197.664634 where: bonds (distance) C4'-P energy: -49.709 bonds (distance) P-C4' energy: -51.897 flat angles C4'-P-C4' energy: -46.354 flat angles P-C4'-P energy: -27.490 tors. eta vs tors. theta energy: -22.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 137 Temperature: 1.221429 Total energy: -330.255637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.255637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.255637 (E_RNA) where: Base-Base interactions energy: -136.914 where: short stacking energy: -118.931 Base-Backbone interact. energy: -1.046 local terms energy: -192.448273 where: bonds (distance) C4'-P energy: -49.065 bonds (distance) P-C4' energy: -54.069 flat angles C4'-P-C4' energy: -45.636 flat angles P-C4'-P energy: -30.029 tors. eta vs tors. theta energy: -13.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.154 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 137 Temperature: 1.285714 Total energy: -298.492123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.492123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.492123 (E_RNA) where: Base-Base interactions energy: -140.762 where: short stacking energy: -85.808 Base-Backbone interact. energy: -0.966 local terms energy: -156.764438 where: bonds (distance) C4'-P energy: -48.331 bonds (distance) P-C4' energy: -45.576 flat angles C4'-P-C4' energy: -40.305 flat angles P-C4'-P energy: -24.958 tors. eta vs tors. theta energy: 2.406 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 137 Temperature: 1.350000 Total energy: -211.354455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.354455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.354455 (E_RNA) where: Base-Base interactions energy: -77.896 where: short stacking energy: -67.990 Base-Backbone interact. energy: 0.395 local terms energy: -133.854002 where: bonds (distance) C4'-P energy: -45.084 bonds (distance) P-C4' energy: -47.348 flat angles C4'-P-C4' energy: -41.395 flat angles P-C4'-P energy: -18.231 tors. eta vs tors. theta energy: 18.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 138 Temperature: 0.900000 Total energy: -831.129682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.129682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.129682 (E_RNA) where: Base-Base interactions energy: -563.099 where: short stacking energy: -249.728 Base-Backbone interact. energy: -1.699 local terms energy: -266.332464 where: bonds (distance) C4'-P energy: -61.858 bonds (distance) P-C4' energy: -49.457 flat angles C4'-P-C4' energy: -61.928 flat angles P-C4'-P energy: -39.459 tors. eta vs tors. theta energy: -53.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 138 Temperature: 0.964286 Total energy: -748.775201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.775201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.775201 (E_RNA) where: Base-Base interactions energy: -478.101 where: short stacking energy: -243.768 Base-Backbone interact. energy: -0.447 local terms energy: -270.227482 where: bonds (distance) C4'-P energy: -55.746 bonds (distance) P-C4' energy: -57.060 flat angles C4'-P-C4' energy: -63.156 flat angles P-C4'-P energy: -28.821 tors. eta vs tors. theta energy: -65.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 138 Temperature: 1.028571 Total energy: -711.873818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.873818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.873818 (E_RNA) where: Base-Base interactions energy: -464.683 where: short stacking energy: -196.718 Base-Backbone interact. energy: -3.270 local terms energy: -243.920543 where: bonds (distance) C4'-P energy: -51.176 bonds (distance) P-C4' energy: -53.131 flat angles C4'-P-C4' energy: -63.868 flat angles P-C4'-P energy: -32.443 tors. eta vs tors. theta energy: -43.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 138 Temperature: 1.092857 Total energy: -626.979175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.979175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.979175 (E_RNA) where: Base-Base interactions energy: -395.886 where: short stacking energy: -214.340 Base-Backbone interact. energy: -0.195 local terms energy: -230.898025 where: bonds (distance) C4'-P energy: -42.254 bonds (distance) P-C4' energy: -45.838 flat angles C4'-P-C4' energy: -46.649 flat angles P-C4'-P energy: -46.268 tors. eta vs tors. theta energy: -49.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 138 Temperature: 1.157143 Total energy: -464.352290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.352290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.352290 (E_RNA) where: Base-Base interactions energy: -270.587 where: short stacking energy: -152.490 Base-Backbone interact. energy: -0.635 local terms energy: -193.130731 where: bonds (distance) C4'-P energy: -51.667 bonds (distance) P-C4' energy: -42.755 flat angles C4'-P-C4' energy: -43.944 flat angles P-C4'-P energy: -24.705 tors. eta vs tors. theta energy: -30.060 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 138 Temperature: 1.221429 Total energy: -288.273648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.273648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.273648 (E_RNA) where: Base-Base interactions energy: -113.921 where: short stacking energy: -109.128 Base-Backbone interact. energy: -1.451 local terms energy: -172.902198 where: bonds (distance) C4'-P energy: -47.538 bonds (distance) P-C4' energy: -38.541 flat angles C4'-P-C4' energy: -46.589 flat angles P-C4'-P energy: -27.903 tors. eta vs tors. theta energy: -12.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 138 Temperature: 1.285714 Total energy: -332.149466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.149466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.149466 (E_RNA) where: Base-Base interactions energy: -152.404 where: short stacking energy: -104.525 Base-Backbone interact. energy: 1.801 local terms energy: -181.546463 where: bonds (distance) C4'-P energy: -42.306 bonds (distance) P-C4' energy: -44.425 flat angles C4'-P-C4' energy: -57.710 flat angles P-C4'-P energy: -28.679 tors. eta vs tors. theta energy: -8.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 138 Temperature: 1.350000 Total energy: -211.680516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.680516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.680516 (E_RNA) where: Base-Base interactions energy: -82.972 where: short stacking energy: -62.879 Base-Backbone interact. energy: 0.625 local terms energy: -129.333440 where: bonds (distance) C4'-P energy: -43.977 bonds (distance) P-C4' energy: -42.593 flat angles C4'-P-C4' energy: -35.869 flat angles P-C4'-P energy: -15.866 tors. eta vs tors. theta energy: 8.972 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 139 Temperature: 0.900000 Total energy: -829.477354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.477354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.477354 (E_RNA) where: Base-Base interactions energy: -575.422 where: short stacking energy: -247.474 Base-Backbone interact. energy: -2.125 local terms energy: -251.930499 where: bonds (distance) C4'-P energy: -44.883 bonds (distance) P-C4' energy: -63.247 flat angles C4'-P-C4' energy: -55.725 flat angles P-C4'-P energy: -32.811 tors. eta vs tors. theta energy: -55.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 139 Temperature: 0.964286 Total energy: -794.207331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.207331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.207331 (E_RNA) where: Base-Base interactions energy: -523.883 where: short stacking energy: -288.152 Base-Backbone interact. energy: -1.514 local terms energy: -268.809851 where: bonds (distance) C4'-P energy: -48.613 bonds (distance) P-C4' energy: -56.190 flat angles C4'-P-C4' energy: -52.935 flat angles P-C4'-P energy: -37.999 tors. eta vs tors. theta energy: -73.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 139 Temperature: 1.028571 Total energy: -718.333959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.333959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.333959 (E_RNA) where: Base-Base interactions energy: -460.792 where: short stacking energy: -213.041 Base-Backbone interact. energy: -1.242 local terms energy: -256.300273 where: bonds (distance) C4'-P energy: -55.114 bonds (distance) P-C4' energy: -57.446 flat angles C4'-P-C4' energy: -61.478 flat angles P-C4'-P energy: -34.820 tors. eta vs tors. theta energy: -47.442 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 139 Temperature: 1.092857 Total energy: -637.482619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -637.482619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.482619 (E_RNA) where: Base-Base interactions energy: -403.048 where: short stacking energy: -199.482 Base-Backbone interact. energy: 1.036 local terms energy: -235.470937 where: bonds (distance) C4'-P energy: -56.740 bonds (distance) P-C4' energy: -46.498 flat angles C4'-P-C4' energy: -54.782 flat angles P-C4'-P energy: -33.776 tors. eta vs tors. theta energy: -43.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 139 Temperature: 1.157143 Total energy: -436.542513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.542513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.542513 (E_RNA) where: Base-Base interactions energy: -240.300 where: short stacking energy: -129.225 Base-Backbone interact. energy: 0.678 local terms energy: -196.920779 where: bonds (distance) C4'-P energy: -57.097 bonds (distance) P-C4' energy: -46.565 flat angles C4'-P-C4' energy: -48.870 flat angles P-C4'-P energy: -33.370 tors. eta vs tors. theta energy: -11.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 139 Temperature: 1.221429 Total energy: -352.296436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.296436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.296436 (E_RNA) where: Base-Base interactions energy: -166.017 where: short stacking energy: -131.702 Base-Backbone interact. energy: 2.974 local terms energy: -189.253010 where: bonds (distance) C4'-P energy: -47.987 bonds (distance) P-C4' energy: -54.744 flat angles C4'-P-C4' energy: -48.493 flat angles P-C4'-P energy: -26.105 tors. eta vs tors. theta energy: -11.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 139 Temperature: 1.285714 Total energy: -266.426871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.426871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.426871 (E_RNA) where: Base-Base interactions energy: -92.072 where: short stacking energy: -71.393 Base-Backbone interact. energy: 1.366 local terms energy: -175.720916 where: bonds (distance) C4'-P energy: -53.072 bonds (distance) P-C4' energy: -45.130 flat angles C4'-P-C4' energy: -47.897 flat angles P-C4'-P energy: -28.966 tors. eta vs tors. theta energy: -0.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 139 Temperature: 1.350000 Total energy: -227.406767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.406767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.406767 (E_RNA) where: Base-Base interactions energy: -94.145 where: short stacking energy: -69.634 Base-Backbone interact. energy: 2.930 local terms energy: -136.191469 where: bonds (distance) C4'-P energy: -48.654 bonds (distance) P-C4' energy: -49.887 flat angles C4'-P-C4' energy: -34.870 flat angles P-C4'-P energy: -15.625 tors. eta vs tors. theta energy: 12.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 140 Temperature: 0.900000 Total energy: -854.227367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -854.227367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -854.227367 (E_RNA) where: Base-Base interactions energy: -584.968 where: short stacking energy: -249.296 Base-Backbone interact. energy: -1.059 local terms energy: -268.200303 where: bonds (distance) C4'-P energy: -60.881 bonds (distance) P-C4' energy: -65.749 flat angles C4'-P-C4' energy: -57.453 flat angles P-C4'-P energy: -34.825 tors. eta vs tors. theta energy: -49.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 140 Temperature: 0.964286 Total energy: -779.688668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.688668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.688668 (E_RNA) where: Base-Base interactions energy: -483.904 where: short stacking energy: -257.461 Base-Backbone interact. energy: -0.227 local terms energy: -295.558188 where: bonds (distance) C4'-P energy: -66.185 bonds (distance) P-C4' energy: -56.629 flat angles C4'-P-C4' energy: -62.743 flat angles P-C4'-P energy: -35.983 tors. eta vs tors. theta energy: -74.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 140 Temperature: 1.028571 Total energy: -730.645426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.645426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.645426 (E_RNA) where: Base-Base interactions energy: -469.815 where: short stacking energy: -200.813 Base-Backbone interact. energy: -1.574 local terms energy: -259.256481 where: bonds (distance) C4'-P energy: -62.008 bonds (distance) P-C4' energy: -54.406 flat angles C4'-P-C4' energy: -62.014 flat angles P-C4'-P energy: -32.525 tors. eta vs tors. theta energy: -48.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 140 Temperature: 1.092857 Total energy: -680.453594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.453594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.453594 (E_RNA) where: Base-Base interactions energy: -426.950 where: short stacking energy: -227.867 Base-Backbone interact. energy: 0.527 local terms energy: -254.030614 where: bonds (distance) C4'-P energy: -57.405 bonds (distance) P-C4' energy: -57.250 flat angles C4'-P-C4' energy: -57.500 flat angles P-C4'-P energy: -30.936 tors. eta vs tors. theta energy: -50.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 140 Temperature: 1.157143 Total energy: -460.466377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.466377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.466377 (E_RNA) where: Base-Base interactions energy: -262.564 where: short stacking energy: -144.601 Base-Backbone interact. energy: -0.409 local terms energy: -197.493510 where: bonds (distance) C4'-P energy: -52.140 bonds (distance) P-C4' energy: -52.371 flat angles C4'-P-C4' energy: -48.165 flat angles P-C4'-P energy: -27.110 tors. eta vs tors. theta energy: -17.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 140 Temperature: 1.221429 Total energy: -319.753505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.753505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.753505 (E_RNA) where: Base-Base interactions energy: -132.093 where: short stacking energy: -93.708 Base-Backbone interact. energy: 0.303 local terms energy: -187.963896 where: bonds (distance) C4'-P energy: -46.170 bonds (distance) P-C4' energy: -60.148 flat angles C4'-P-C4' energy: -50.466 flat angles P-C4'-P energy: -24.235 tors. eta vs tors. theta energy: -6.944 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 140 Temperature: 1.285714 Total energy: -285.440525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.440525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.440525 (E_RNA) where: Base-Base interactions energy: -111.010 where: short stacking energy: -103.789 Base-Backbone interact. energy: -1.034 local terms energy: -173.396685 where: bonds (distance) C4'-P energy: -40.810 bonds (distance) P-C4' energy: -53.727 flat angles C4'-P-C4' energy: -45.476 flat angles P-C4'-P energy: -28.420 tors. eta vs tors. theta energy: -4.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 140 Temperature: 1.350000 Total energy: -225.746795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.746795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.746795 (E_RNA) where: Base-Base interactions energy: -98.590 where: short stacking energy: -78.296 Base-Backbone interact. energy: -0.133 local terms energy: -127.024397 where: bonds (distance) C4'-P energy: -44.543 bonds (distance) P-C4' energy: -47.133 flat angles C4'-P-C4' energy: -33.560 flat angles P-C4'-P energy: -17.348 tors. eta vs tors. theta energy: 15.560 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 141 Temperature: 0.900000 Total energy: -846.422036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.422036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -846.422036 (E_RNA) where: Base-Base interactions energy: -584.718 where: short stacking energy: -252.008 Base-Backbone interact. energy: -2.288 local terms energy: -259.416087 where: bonds (distance) C4'-P energy: -56.561 bonds (distance) P-C4' energy: -57.327 flat angles C4'-P-C4' energy: -54.590 flat angles P-C4'-P energy: -37.477 tors. eta vs tors. theta energy: -53.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 141 Temperature: 0.964286 Total energy: -769.701279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.701279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.701279 (E_RNA) where: Base-Base interactions energy: -483.828 where: short stacking energy: -260.180 Base-Backbone interact. energy: -0.302 local terms energy: -285.571079 where: bonds (distance) C4'-P energy: -55.364 bonds (distance) P-C4' energy: -60.610 flat angles C4'-P-C4' energy: -64.550 flat angles P-C4'-P energy: -32.805 tors. eta vs tors. theta energy: -72.242 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 141 Temperature: 1.028571 Total energy: -721.810697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.810697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.810697 (E_RNA) where: Base-Base interactions energy: -474.133 where: short stacking energy: -208.509 Base-Backbone interact. energy: -0.539 local terms energy: -247.137996 where: bonds (distance) C4'-P energy: -54.310 bonds (distance) P-C4' energy: -53.001 flat angles C4'-P-C4' energy: -63.747 flat angles P-C4'-P energy: -39.310 tors. eta vs tors. theta energy: -36.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 141 Temperature: 1.092857 Total energy: -711.496532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.496532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.496532 (E_RNA) where: Base-Base interactions energy: -437.514 where: short stacking energy: -244.474 Base-Backbone interact. energy: -0.455 local terms energy: -273.527919 where: bonds (distance) C4'-P energy: -58.029 bonds (distance) P-C4' energy: -53.946 flat angles C4'-P-C4' energy: -52.317 flat angles P-C4'-P energy: -38.408 tors. eta vs tors. theta energy: -70.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 141 Temperature: 1.157143 Total energy: -440.941513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.941513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.941513 (E_RNA) where: Base-Base interactions energy: -234.729 where: short stacking energy: -131.094 Base-Backbone interact. energy: 0.770 local terms energy: -206.982725 where: bonds (distance) C4'-P energy: -49.049 bonds (distance) P-C4' energy: -47.444 flat angles C4'-P-C4' energy: -47.588 flat angles P-C4'-P energy: -35.030 tors. eta vs tors. theta energy: -27.871 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 141 Temperature: 1.221429 Total energy: -320.959660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.959660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.959660 (E_RNA) where: Base-Base interactions energy: -133.107 where: short stacking energy: -100.389 Base-Backbone interact. energy: -1.296 local terms energy: -186.556637 where: bonds (distance) C4'-P energy: -49.912 bonds (distance) P-C4' energy: -52.637 flat angles C4'-P-C4' energy: -41.413 flat angles P-C4'-P energy: -35.645 tors. eta vs tors. theta energy: -6.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 141 Temperature: 1.285714 Total energy: -285.088394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.088394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.088394 (E_RNA) where: Base-Base interactions energy: -112.025 where: short stacking energy: -92.120 Base-Backbone interact. energy: 2.149 local terms energy: -175.212287 where: bonds (distance) C4'-P energy: -52.836 bonds (distance) P-C4' energy: -55.379 flat angles C4'-P-C4' energy: -31.175 flat angles P-C4'-P energy: -27.810 tors. eta vs tors. theta energy: -8.012 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 141 Temperature: 1.350000 Total energy: -234.828092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.828092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.828092 (E_RNA) where: Base-Base interactions energy: -96.030 where: short stacking energy: -85.806 Base-Backbone interact. energy: -0.319 local terms energy: -138.479223 where: bonds (distance) C4'-P energy: -35.339 bonds (distance) P-C4' energy: -44.820 flat angles C4'-P-C4' energy: -53.326 flat angles P-C4'-P energy: -10.897 tors. eta vs tors. theta energy: 5.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 142 Temperature: 0.900000 Total energy: -784.696550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.696550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.696550 (E_RNA) where: Base-Base interactions energy: -511.128 where: short stacking energy: -268.980 Base-Backbone interact. energy: -0.778 local terms energy: -272.790760 where: bonds (distance) C4'-P energy: -48.275 bonds (distance) P-C4' energy: -55.296 flat angles C4'-P-C4' energy: -56.802 flat angles P-C4'-P energy: -43.835 tors. eta vs tors. theta energy: -68.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 142 Temperature: 0.964286 Total energy: -816.336540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -816.336540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -816.336540 (E_RNA) where: Base-Base interactions energy: -551.065 where: short stacking energy: -235.690 Base-Backbone interact. energy: -1.947 local terms energy: -263.324290 where: bonds (distance) C4'-P energy: -65.339 bonds (distance) P-C4' energy: -54.034 flat angles C4'-P-C4' energy: -59.320 flat angles P-C4'-P energy: -34.833 tors. eta vs tors. theta energy: -49.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 142 Temperature: 1.028571 Total energy: -731.271519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.271519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.271519 (E_RNA) where: Base-Base interactions energy: -493.555 where: short stacking energy: -212.548 Base-Backbone interact. energy: -1.310 local terms energy: -236.406504 where: bonds (distance) C4'-P energy: -46.863 bonds (distance) P-C4' energy: -56.783 flat angles C4'-P-C4' energy: -57.430 flat angles P-C4'-P energy: -34.447 tors. eta vs tors. theta energy: -40.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 142 Temperature: 1.092857 Total energy: -662.690412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.690412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.690412 (E_RNA) where: Base-Base interactions energy: -416.138 where: short stacking energy: -220.388 Base-Backbone interact. energy: -0.255 local terms energy: -246.297550 where: bonds (distance) C4'-P energy: -51.588 bonds (distance) P-C4' energy: -50.954 flat angles C4'-P-C4' energy: -54.145 flat angles P-C4'-P energy: -40.725 tors. eta vs tors. theta energy: -48.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 142 Temperature: 1.157143 Total energy: -410.935194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.935194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.935194 (E_RNA) where: Base-Base interactions energy: -217.688 where: short stacking energy: -139.525 Base-Backbone interact. energy: -0.222 local terms energy: -193.025384 where: bonds (distance) C4'-P energy: -45.712 bonds (distance) P-C4' energy: -41.350 flat angles C4'-P-C4' energy: -59.410 flat angles P-C4'-P energy: -32.080 tors. eta vs tors. theta energy: -14.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 142 Temperature: 1.221429 Total energy: -288.689907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.689907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.689907 (E_RNA) where: Base-Base interactions energy: -128.792 where: short stacking energy: -87.887 Base-Backbone interact. energy: 0.336 local terms energy: -160.233578 where: bonds (distance) C4'-P energy: -38.346 bonds (distance) P-C4' energy: -61.688 flat angles C4'-P-C4' energy: -36.526 flat angles P-C4'-P energy: -24.539 tors. eta vs tors. theta energy: 0.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 142 Temperature: 1.285714 Total energy: -212.053753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.053753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.053753 (E_RNA) where: Base-Base interactions energy: -76.031 where: short stacking energy: -57.910 Base-Backbone interact. energy: 2.344 local terms energy: -138.366980 where: bonds (distance) C4'-P energy: -40.956 bonds (distance) P-C4' energy: -50.819 flat angles C4'-P-C4' energy: -39.918 flat angles P-C4'-P energy: -26.351 tors. eta vs tors. theta energy: 19.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 142 Temperature: 1.350000 Total energy: -225.452358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.452358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.452358 (E_RNA) where: Base-Base interactions energy: -77.370 where: short stacking energy: -58.818 Base-Backbone interact. energy: 0.789 local terms energy: -148.871080 where: bonds (distance) C4'-P energy: -36.544 bonds (distance) P-C4' energy: -43.003 flat angles C4'-P-C4' energy: -46.256 flat angles P-C4'-P energy: -35.517 tors. eta vs tors. theta energy: 12.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 143 Temperature: 0.900000 Total energy: -767.083577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.083577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.083577 (E_RNA) where: Base-Base interactions energy: -466.790 where: short stacking energy: -229.587 Base-Backbone interact. energy: -0.561 local terms energy: -299.733367 where: bonds (distance) C4'-P energy: -58.518 bonds (distance) P-C4' energy: -67.371 flat angles C4'-P-C4' energy: -61.998 flat angles P-C4'-P energy: -45.078 tors. eta vs tors. theta energy: -66.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 143 Temperature: 0.964286 Total energy: -790.695500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -790.695500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.695500 (E_RNA) where: Base-Base interactions energy: -526.586 where: short stacking energy: -240.405 Base-Backbone interact. energy: 0.435 local terms energy: -264.544244 where: bonds (distance) C4'-P energy: -53.154 bonds (distance) P-C4' energy: -60.308 flat angles C4'-P-C4' energy: -52.665 flat angles P-C4'-P energy: -46.663 tors. eta vs tors. theta energy: -51.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 143 Temperature: 1.028571 Total energy: -734.792265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.792265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.792265 (E_RNA) where: Base-Base interactions energy: -470.672 where: short stacking energy: -232.329 Base-Backbone interact. energy: -0.731 local terms energy: -263.390013 where: bonds (distance) C4'-P energy: -51.119 bonds (distance) P-C4' energy: -62.556 flat angles C4'-P-C4' energy: -48.728 flat angles P-C4'-P energy: -43.234 tors. eta vs tors. theta energy: -57.754 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 143 Temperature: 1.092857 Total energy: -663.600274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.600274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.600274 (E_RNA) where: Base-Base interactions energy: -412.507 where: short stacking energy: -206.211 Base-Backbone interact. energy: 0.572 local terms energy: -251.664688 where: bonds (distance) C4'-P energy: -54.296 bonds (distance) P-C4' energy: -55.829 flat angles C4'-P-C4' energy: -48.532 flat angles P-C4'-P energy: -35.364 tors. eta vs tors. theta energy: -57.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 143 Temperature: 1.157143 Total energy: -438.331065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.331065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.331065 (E_RNA) where: Base-Base interactions energy: -229.981 where: short stacking energy: -142.704 Base-Backbone interact. energy: -0.511 local terms energy: -207.838615 where: bonds (distance) C4'-P energy: -55.540 bonds (distance) P-C4' energy: -54.806 flat angles C4'-P-C4' energy: -53.303 flat angles P-C4'-P energy: -25.039 tors. eta vs tors. theta energy: -19.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 143 Temperature: 1.221429 Total energy: -335.637872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.637872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.637872 (E_RNA) where: Base-Base interactions energy: -145.952 where: short stacking energy: -95.878 Base-Backbone interact. energy: 0.396 local terms energy: -190.082295 where: bonds (distance) C4'-P energy: -51.156 bonds (distance) P-C4' energy: -48.338 flat angles C4'-P-C4' energy: -52.110 flat angles P-C4'-P energy: -28.827 tors. eta vs tors. theta energy: -9.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 143 Temperature: 1.285714 Total energy: -239.733176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.733176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.733176 (E_RNA) where: Base-Base interactions energy: -105.818 where: short stacking energy: -72.453 Base-Backbone interact. energy: -1.368 local terms energy: -132.547837 where: bonds (distance) C4'-P energy: -46.664 bonds (distance) P-C4' energy: -46.564 flat angles C4'-P-C4' energy: -39.412 flat angles P-C4'-P energy: -10.273 tors. eta vs tors. theta energy: 10.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 143 Temperature: 1.350000 Total energy: -249.663810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.663810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.663810 (E_RNA) where: Base-Base interactions energy: -93.464 where: short stacking energy: -69.440 Base-Backbone interact. energy: 1.368 local terms energy: -157.567727 where: bonds (distance) C4'-P energy: -41.557 bonds (distance) P-C4' energy: -54.910 flat angles C4'-P-C4' energy: -42.044 flat angles P-C4'-P energy: -25.445 tors. eta vs tors. theta energy: 6.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 144 Temperature: 0.900000 Total energy: -783.654065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.654065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.654065 (E_RNA) where: Base-Base interactions energy: -528.512 where: short stacking energy: -249.461 Base-Backbone interact. energy: 0.122 local terms energy: -255.264861 where: bonds (distance) C4'-P energy: -48.295 bonds (distance) P-C4' energy: -49.754 flat angles C4'-P-C4' energy: -57.513 flat angles P-C4'-P energy: -48.179 tors. eta vs tors. theta energy: -51.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 144 Temperature: 0.964286 Total energy: -745.363023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.363023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.363023 (E_RNA) where: Base-Base interactions energy: -481.968 where: short stacking energy: -242.725 Base-Backbone interact. energy: -0.749 local terms energy: -262.645788 where: bonds (distance) C4'-P energy: -49.892 bonds (distance) P-C4' energy: -53.351 flat angles C4'-P-C4' energy: -61.820 flat angles P-C4'-P energy: -36.434 tors. eta vs tors. theta energy: -61.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 144 Temperature: 1.028571 Total energy: -724.343201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.343201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.343201 (E_RNA) where: Base-Base interactions energy: -456.104 where: short stacking energy: -204.332 Base-Backbone interact. energy: -2.415 local terms energy: -265.824444 where: bonds (distance) C4'-P energy: -52.038 bonds (distance) P-C4' energy: -59.307 flat angles C4'-P-C4' energy: -59.148 flat angles P-C4'-P energy: -46.672 tors. eta vs tors. theta energy: -48.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 144 Temperature: 1.092857 Total energy: -659.488173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.488173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.488173 (E_RNA) where: Base-Base interactions energy: -405.773 where: short stacking energy: -198.267 Base-Backbone interact. energy: -1.507 local terms energy: -252.208318 where: bonds (distance) C4'-P energy: -46.135 bonds (distance) P-C4' energy: -52.946 flat angles C4'-P-C4' energy: -62.597 flat angles P-C4'-P energy: -33.732 tors. eta vs tors. theta energy: -56.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 144 Temperature: 1.157143 Total energy: -433.750589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.750589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.750589 (E_RNA) where: Base-Base interactions energy: -236.343 where: short stacking energy: -144.071 Base-Backbone interact. energy: 1.203 local terms energy: -198.610279 where: bonds (distance) C4'-P energy: -53.262 bonds (distance) P-C4' energy: -46.575 flat angles C4'-P-C4' energy: -50.368 flat angles P-C4'-P energy: -27.549 tors. eta vs tors. theta energy: -20.857 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 144 Temperature: 1.221429 Total energy: -348.869985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.869985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.869985 (E_RNA) where: Base-Base interactions energy: -174.219 where: short stacking energy: -130.947 Base-Backbone interact. energy: -0.353 local terms energy: -174.298353 where: bonds (distance) C4'-P energy: -40.624 bonds (distance) P-C4' energy: -41.166 flat angles C4'-P-C4' energy: -41.336 flat angles P-C4'-P energy: -33.522 tors. eta vs tors. theta energy: -17.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 144 Temperature: 1.285714 Total energy: -251.018538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.018538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.018538 (E_RNA) where: Base-Base interactions energy: -108.522 where: short stacking energy: -82.638 Base-Backbone interact. energy: 3.298 local terms energy: -145.795187 where: bonds (distance) C4'-P energy: -39.042 bonds (distance) P-C4' energy: -53.688 flat angles C4'-P-C4' energy: -48.557 flat angles P-C4'-P energy: -14.803 tors. eta vs tors. theta energy: 10.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 144 Temperature: 1.350000 Total energy: -225.758650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.758650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.758650 (E_RNA) where: Base-Base interactions energy: -67.732 where: short stacking energy: -50.562 Base-Backbone interact. energy: 1.140 local terms energy: -159.166217 where: bonds (distance) C4'-P energy: -54.190 bonds (distance) P-C4' energy: -56.333 flat angles C4'-P-C4' energy: -30.322 flat angles P-C4'-P energy: -33.020 tors. eta vs tors. theta energy: 14.699 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 145 Temperature: 0.900000 Total energy: -786.313809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.313809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.313809 (E_RNA) where: Base-Base interactions energy: -535.202 where: short stacking energy: -242.896 Base-Backbone interact. energy: -2.042 local terms energy: -249.069570 where: bonds (distance) C4'-P energy: -53.347 bonds (distance) P-C4' energy: -49.601 flat angles C4'-P-C4' energy: -54.510 flat angles P-C4'-P energy: -40.528 tors. eta vs tors. theta energy: -51.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 145 Temperature: 0.964286 Total energy: -772.328239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.328239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.328239 (E_RNA) where: Base-Base interactions energy: -508.007 where: short stacking energy: -244.224 Base-Backbone interact. energy: -1.122 local terms energy: -263.198372 where: bonds (distance) C4'-P energy: -51.017 bonds (distance) P-C4' energy: -54.143 flat angles C4'-P-C4' energy: -62.154 flat angles P-C4'-P energy: -42.505 tors. eta vs tors. theta energy: -53.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 145 Temperature: 1.028571 Total energy: -736.672642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.672642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.672642 (E_RNA) where: Base-Base interactions energy: -476.011 where: short stacking energy: -240.674 Base-Backbone interact. energy: -0.940 local terms energy: -259.722028 where: bonds (distance) C4'-P energy: -50.434 bonds (distance) P-C4' energy: -57.960 flat angles C4'-P-C4' energy: -51.358 flat angles P-C4'-P energy: -36.594 tors. eta vs tors. theta energy: -63.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 145 Temperature: 1.092857 Total energy: -657.468416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.468416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.468416 (E_RNA) where: Base-Base interactions energy: -398.208 where: short stacking energy: -215.426 Base-Backbone interact. energy: -0.902 local terms energy: -258.358320 where: bonds (distance) C4'-P energy: -55.653 bonds (distance) P-C4' energy: -51.975 flat angles C4'-P-C4' energy: -55.433 flat angles P-C4'-P energy: -39.006 tors. eta vs tors. theta energy: -56.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 145 Temperature: 1.157143 Total energy: -455.746506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.746506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.746506 (E_RNA) where: Base-Base interactions energy: -246.510 where: short stacking energy: -144.339 Base-Backbone interact. energy: -0.101 local terms energy: -209.135789 where: bonds (distance) C4'-P energy: -48.704 bonds (distance) P-C4' energy: -57.010 flat angles C4'-P-C4' energy: -47.595 flat angles P-C4'-P energy: -30.843 tors. eta vs tors. theta energy: -24.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 145 Temperature: 1.221429 Total energy: -335.871976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.871976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.871976 (E_RNA) where: Base-Base interactions energy: -165.840 where: short stacking energy: -116.148 Base-Backbone interact. energy: -0.168 local terms energy: -169.864422 where: bonds (distance) C4'-P energy: -41.818 bonds (distance) P-C4' energy: -39.002 flat angles C4'-P-C4' energy: -55.128 flat angles P-C4'-P energy: -29.870 tors. eta vs tors. theta energy: -4.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 145 Temperature: 1.285714 Total energy: -301.908407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.908407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.908407 (E_RNA) where: Base-Base interactions energy: -126.698 where: short stacking energy: -81.268 Base-Backbone interact. energy: -1.382 local terms energy: -174.043489 where: bonds (distance) C4'-P energy: -54.124 bonds (distance) P-C4' energy: -51.310 flat angles C4'-P-C4' energy: -42.964 flat angles P-C4'-P energy: -27.327 tors. eta vs tors. theta energy: 1.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.214 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 145 Temperature: 1.350000 Total energy: -237.490982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.490982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.490982 (E_RNA) where: Base-Base interactions energy: -72.902 where: short stacking energy: -53.795 Base-Backbone interact. energy: -0.504 local terms energy: -164.084824 where: bonds (distance) C4'-P energy: -51.388 bonds (distance) P-C4' energy: -53.481 flat angles C4'-P-C4' energy: -43.075 flat angles P-C4'-P energy: -27.184 tors. eta vs tors. theta energy: 11.044 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 146 Temperature: 0.900000 Total energy: -834.765124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.765124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.765124 (E_RNA) where: Base-Base interactions energy: -555.073 where: short stacking energy: -251.305 Base-Backbone interact. energy: -0.866 local terms energy: -278.826132 where: bonds (distance) C4'-P energy: -57.266 bonds (distance) P-C4' energy: -60.572 flat angles C4'-P-C4' energy: -63.761 flat angles P-C4'-P energy: -47.020 tors. eta vs tors. theta energy: -50.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 146 Temperature: 0.964286 Total energy: -787.791116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -787.791116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.791116 (E_RNA) where: Base-Base interactions energy: -521.590 where: short stacking energy: -240.759 Base-Backbone interact. energy: -1.048 local terms energy: -265.153606 where: bonds (distance) C4'-P energy: -45.275 bonds (distance) P-C4' energy: -55.922 flat angles C4'-P-C4' energy: -54.110 flat angles P-C4'-P energy: -47.418 tors. eta vs tors. theta energy: -62.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 146 Temperature: 1.028571 Total energy: -716.186493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.186493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.186493 (E_RNA) where: Base-Base interactions energy: -460.426 where: short stacking energy: -235.231 Base-Backbone interact. energy: -3.301 local terms energy: -252.459442 where: bonds (distance) C4'-P energy: -48.548 bonds (distance) P-C4' energy: -51.449 flat angles C4'-P-C4' energy: -60.089 flat angles P-C4'-P energy: -34.121 tors. eta vs tors. theta energy: -58.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 146 Temperature: 1.092857 Total energy: -661.527067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.527067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.527067 (E_RNA) where: Base-Base interactions energy: -418.861 where: short stacking energy: -213.295 Base-Backbone interact. energy: 5.022 local terms energy: -247.687664 where: bonds (distance) C4'-P energy: -50.587 bonds (distance) P-C4' energy: -57.151 flat angles C4'-P-C4' energy: -54.746 flat angles P-C4'-P energy: -39.732 tors. eta vs tors. theta energy: -45.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 146 Temperature: 1.157143 Total energy: -437.498998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.498998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.498998 (E_RNA) where: Base-Base interactions energy: -201.827 where: short stacking energy: -122.124 Base-Backbone interact. energy: -0.126 local terms energy: -235.546189 where: bonds (distance) C4'-P energy: -55.917 bonds (distance) P-C4' energy: -57.964 flat angles C4'-P-C4' energy: -54.594 flat angles P-C4'-P energy: -41.583 tors. eta vs tors. theta energy: -25.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 146 Temperature: 1.221429 Total energy: -332.192606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.192606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.192606 (E_RNA) where: Base-Base interactions energy: -151.844 where: short stacking energy: -106.097 Base-Backbone interact. energy: -0.925 local terms energy: -179.424099 where: bonds (distance) C4'-P energy: -52.808 bonds (distance) P-C4' energy: -55.335 flat angles C4'-P-C4' energy: -45.303 flat angles P-C4'-P energy: -27.284 tors. eta vs tors. theta energy: 1.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 146 Temperature: 1.285714 Total energy: -266.260280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.260280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.260280 (E_RNA) where: Base-Base interactions energy: -116.633 where: short stacking energy: -69.357 Base-Backbone interact. energy: -1.041 local terms energy: -148.586184 where: bonds (distance) C4'-P energy: -40.983 bonds (distance) P-C4' energy: -50.572 flat angles C4'-P-C4' energy: -41.000 flat angles P-C4'-P energy: -23.747 tors. eta vs tors. theta energy: 7.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 146 Temperature: 1.350000 Total energy: -227.890850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.890850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.890850 (E_RNA) where: Base-Base interactions energy: -75.057 where: short stacking energy: -56.738 Base-Backbone interact. energy: 2.321 local terms energy: -155.154372 where: bonds (distance) C4'-P energy: -38.970 bonds (distance) P-C4' energy: -54.549 flat angles C4'-P-C4' energy: -39.957 flat angles P-C4'-P energy: -31.216 tors. eta vs tors. theta energy: 9.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 147 Temperature: 0.900000 Total energy: -832.431291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.431291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.431291 (E_RNA) where: Base-Base interactions energy: -553.692 where: short stacking energy: -245.179 Base-Backbone interact. energy: -1.093 local terms energy: -277.646738 where: bonds (distance) C4'-P energy: -57.338 bonds (distance) P-C4' energy: -59.625 flat angles C4'-P-C4' energy: -63.551 flat angles P-C4'-P energy: -45.177 tors. eta vs tors. theta energy: -51.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 147 Temperature: 0.964286 Total energy: -755.491560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.491560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.491560 (E_RNA) where: Base-Base interactions energy: -509.470 where: short stacking energy: -232.860 Base-Backbone interact. energy: 1.473 local terms energy: -247.494485 where: bonds (distance) C4'-P energy: -56.830 bonds (distance) P-C4' energy: -58.396 flat angles C4'-P-C4' energy: -47.801 flat angles P-C4'-P energy: -29.552 tors. eta vs tors. theta energy: -54.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 147 Temperature: 1.028571 Total energy: -735.488678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.488678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.488678 (E_RNA) where: Base-Base interactions energy: -478.306 where: short stacking energy: -252.570 Base-Backbone interact. energy: -1.309 local terms energy: -255.874321 where: bonds (distance) C4'-P energy: -53.479 bonds (distance) P-C4' energy: -45.773 flat angles C4'-P-C4' energy: -60.287 flat angles P-C4'-P energy: -27.724 tors. eta vs tors. theta energy: -68.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 147 Temperature: 1.092857 Total energy: -650.191518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.191518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.191518 (E_RNA) where: Base-Base interactions energy: -408.592 where: short stacking energy: -207.084 Base-Backbone interact. energy: -0.434 local terms energy: -241.165880 where: bonds (distance) C4'-P energy: -52.952 bonds (distance) P-C4' energy: -50.764 flat angles C4'-P-C4' energy: -53.644 flat angles P-C4'-P energy: -34.438 tors. eta vs tors. theta energy: -49.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 147 Temperature: 1.157143 Total energy: -435.737560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.737560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.737560 (E_RNA) where: Base-Base interactions energy: -238.134 where: short stacking energy: -139.308 Base-Backbone interact. energy: 0.956 local terms energy: -198.559773 where: bonds (distance) C4'-P energy: -59.254 bonds (distance) P-C4' energy: -55.244 flat angles C4'-P-C4' energy: -52.196 flat angles P-C4'-P energy: -20.891 tors. eta vs tors. theta energy: -10.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 147 Temperature: 1.221429 Total energy: -319.989453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.989453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.989453 (E_RNA) where: Base-Base interactions energy: -147.902 where: short stacking energy: -122.247 Base-Backbone interact. energy: 0.466 local terms energy: -172.553595 where: bonds (distance) C4'-P energy: -46.424 bonds (distance) P-C4' energy: -56.581 flat angles C4'-P-C4' energy: -43.177 flat angles P-C4'-P energy: -14.456 tors. eta vs tors. theta energy: -11.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 147 Temperature: 1.285714 Total energy: -274.743128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.743128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.743128 (E_RNA) where: Base-Base interactions energy: -131.105 where: short stacking energy: -68.965 Base-Backbone interact. energy: -1.756 local terms energy: -141.882908 where: bonds (distance) C4'-P energy: -46.937 bonds (distance) P-C4' energy: -44.803 flat angles C4'-P-C4' energy: -47.001 flat angles P-C4'-P energy: -25.478 tors. eta vs tors. theta energy: 22.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 147 Temperature: 1.350000 Total energy: -248.782827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.782827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.782827 (E_RNA) where: Base-Base interactions energy: -94.234 where: short stacking energy: -70.356 Base-Backbone interact. energy: -1.935 local terms energy: -152.614489 where: bonds (distance) C4'-P energy: -43.011 bonds (distance) P-C4' energy: -48.366 flat angles C4'-P-C4' energy: -38.796 flat angles P-C4'-P energy: -27.840 tors. eta vs tors. theta energy: 5.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 148 Temperature: 0.900000 Total energy: -838.772129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.772129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.772129 (E_RNA) where: Base-Base interactions energy: -575.070 where: short stacking energy: -256.048 Base-Backbone interact. energy: -0.269 local terms energy: -263.432624 where: bonds (distance) C4'-P energy: -60.107 bonds (distance) P-C4' energy: -52.171 flat angles C4'-P-C4' energy: -62.161 flat angles P-C4'-P energy: -39.385 tors. eta vs tors. theta energy: -49.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 148 Temperature: 0.964286 Total energy: -788.643212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -788.643212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.643212 (E_RNA) where: Base-Base interactions energy: -525.016 where: short stacking energy: -234.458 Base-Backbone interact. energy: -3.486 local terms energy: -260.140795 where: bonds (distance) C4'-P energy: -47.242 bonds (distance) P-C4' energy: -57.499 flat angles C4'-P-C4' energy: -57.074 flat angles P-C4'-P energy: -42.472 tors. eta vs tors. theta energy: -55.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 148 Temperature: 1.028571 Total energy: -739.945630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -739.945630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.945630 (E_RNA) where: Base-Base interactions energy: -461.981 where: short stacking energy: -250.553 Base-Backbone interact. energy: -0.955 local terms energy: -277.009447 where: bonds (distance) C4'-P energy: -53.989 bonds (distance) P-C4' energy: -60.407 flat angles C4'-P-C4' energy: -54.826 flat angles P-C4'-P energy: -35.597 tors. eta vs tors. theta energy: -72.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 148 Temperature: 1.092857 Total energy: -645.320930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.320930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.320930 (E_RNA) where: Base-Base interactions energy: -416.486 where: short stacking energy: -204.879 Base-Backbone interact. energy: -0.789 local terms energy: -228.045355 where: bonds (distance) C4'-P energy: -55.565 bonds (distance) P-C4' energy: -53.363 flat angles C4'-P-C4' energy: -48.636 flat angles P-C4'-P energy: -22.092 tors. eta vs tors. theta energy: -48.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 148 Temperature: 1.157143 Total energy: -447.738452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.738452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.738452 (E_RNA) where: Base-Base interactions energy: -250.207 where: short stacking energy: -126.608 Base-Backbone interact. energy: -0.167 local terms energy: -197.364487 where: bonds (distance) C4'-P energy: -51.861 bonds (distance) P-C4' energy: -60.463 flat angles C4'-P-C4' energy: -40.729 flat angles P-C4'-P energy: -24.088 tors. eta vs tors. theta energy: -20.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 148 Temperature: 1.221429 Total energy: -313.515243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.515243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.515243 (E_RNA) where: Base-Base interactions energy: -131.967 where: short stacking energy: -116.786 Base-Backbone interact. energy: -0.426 local terms energy: -181.122097 where: bonds (distance) C4'-P energy: -55.564 bonds (distance) P-C4' energy: -43.758 flat angles C4'-P-C4' energy: -53.692 flat angles P-C4'-P energy: -25.401 tors. eta vs tors. theta energy: -2.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 148 Temperature: 1.285714 Total energy: -267.217208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.217208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.217208 (E_RNA) where: Base-Base interactions energy: -123.041 where: short stacking energy: -95.388 Base-Backbone interact. energy: -0.105 local terms energy: -144.071453 where: bonds (distance) C4'-P energy: -40.414 bonds (distance) P-C4' energy: -51.217 flat angles C4'-P-C4' energy: -36.662 flat angles P-C4'-P energy: -24.619 tors. eta vs tors. theta energy: 8.840 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 148 Temperature: 1.350000 Total energy: -260.826576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.826576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.826576 (E_RNA) where: Base-Base interactions energy: -118.419 where: short stacking energy: -76.132 Base-Backbone interact. energy: 4.056 local terms energy: -146.463860 where: bonds (distance) C4'-P energy: -37.188 bonds (distance) P-C4' energy: -57.632 flat angles C4'-P-C4' energy: -36.891 flat angles P-C4'-P energy: -31.196 tors. eta vs tors. theta energy: 16.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 149 Temperature: 0.900000 Total energy: -805.481789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -805.481789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -805.481789 (E_RNA) where: Base-Base interactions energy: -545.152 where: short stacking energy: -240.440 Base-Backbone interact. energy: -0.009 local terms energy: -260.321267 where: bonds (distance) C4'-P energy: -63.309 bonds (distance) P-C4' energy: -60.922 flat angles C4'-P-C4' energy: -54.003 flat angles P-C4'-P energy: -37.724 tors. eta vs tors. theta energy: -44.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 149 Temperature: 0.964286 Total energy: -784.894181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.894181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.894181 (E_RNA) where: Base-Base interactions energy: -525.626 where: short stacking energy: -236.985 Base-Backbone interact. energy: -2.040 local terms energy: -257.227908 where: bonds (distance) C4'-P energy: -57.904 bonds (distance) P-C4' energy: -56.612 flat angles C4'-P-C4' energy: -51.497 flat angles P-C4'-P energy: -32.750 tors. eta vs tors. theta energy: -58.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 149 Temperature: 1.028571 Total energy: -732.717915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.717915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.717915 (E_RNA) where: Base-Base interactions energy: -467.512 where: short stacking energy: -247.190 Base-Backbone interact. energy: -1.753 local terms energy: -263.452575 where: bonds (distance) C4'-P energy: -52.528 bonds (distance) P-C4' energy: -58.628 flat angles C4'-P-C4' energy: -55.276 flat angles P-C4'-P energy: -32.654 tors. eta vs tors. theta energy: -64.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 149 Temperature: 1.092857 Total energy: -648.274632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.274632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.274632 (E_RNA) where: Base-Base interactions energy: -425.965 where: short stacking energy: -213.268 Base-Backbone interact. energy: 0.159 local terms energy: -222.469034 where: bonds (distance) C4'-P energy: -47.021 bonds (distance) P-C4' energy: -51.283 flat angles C4'-P-C4' energy: -48.844 flat angles P-C4'-P energy: -30.093 tors. eta vs tors. theta energy: -45.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 149 Temperature: 1.157143 Total energy: -440.728445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.728445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.728445 (E_RNA) where: Base-Base interactions energy: -246.412 where: short stacking energy: -143.950 Base-Backbone interact. energy: -0.245 local terms energy: -194.071355 where: bonds (distance) C4'-P energy: -44.434 bonds (distance) P-C4' energy: -46.581 flat angles C4'-P-C4' energy: -46.268 flat angles P-C4'-P energy: -32.541 tors. eta vs tors. theta energy: -24.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 149 Temperature: 1.221429 Total energy: -314.424425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.424425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.424425 (E_RNA) where: Base-Base interactions energy: -133.214 where: short stacking energy: -110.504 Base-Backbone interact. energy: -1.501 local terms energy: -179.709348 where: bonds (distance) C4'-P energy: -39.154 bonds (distance) P-C4' energy: -55.405 flat angles C4'-P-C4' energy: -48.193 flat angles P-C4'-P energy: -33.016 tors. eta vs tors. theta energy: -3.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 149 Temperature: 1.285714 Total energy: -277.229137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.229137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.229137 (E_RNA) where: Base-Base interactions energy: -128.679 where: short stacking energy: -70.000 Base-Backbone interact. energy: -1.021 local terms energy: -147.529515 where: bonds (distance) C4'-P energy: -30.086 bonds (distance) P-C4' energy: -52.180 flat angles C4'-P-C4' energy: -37.330 flat angles P-C4'-P energy: -29.770 tors. eta vs tors. theta energy: 1.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 149 Temperature: 1.350000 Total energy: -289.986291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.986291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.986291 (E_RNA) where: Base-Base interactions energy: -153.144 where: short stacking energy: -99.438 Base-Backbone interact. energy: 0.504 local terms energy: -137.346063 where: bonds (distance) C4'-P energy: -33.124 bonds (distance) P-C4' energy: -48.705 flat angles C4'-P-C4' energy: -33.500 flat angles P-C4'-P energy: -17.684 tors. eta vs tors. theta energy: -4.333 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 150 Temperature: 0.900000 Total energy: -829.806897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.806897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.806897 (E_RNA) where: Base-Base interactions energy: -571.579 where: short stacking energy: -253.194 Base-Backbone interact. energy: -1.381 local terms energy: -256.846749 where: bonds (distance) C4'-P energy: -46.770 bonds (distance) P-C4' energy: -56.324 flat angles C4'-P-C4' energy: -53.596 flat angles P-C4'-P energy: -43.070 tors. eta vs tors. theta energy: -57.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 150 Temperature: 0.964286 Total energy: -765.836586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.836586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.836586 (E_RNA) where: Base-Base interactions energy: -505.253 where: short stacking energy: -221.688 Base-Backbone interact. energy: -1.703 local terms energy: -258.880461 where: bonds (distance) C4'-P energy: -59.014 bonds (distance) P-C4' energy: -60.902 flat angles C4'-P-C4' energy: -53.305 flat angles P-C4'-P energy: -39.214 tors. eta vs tors. theta energy: -46.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 150 Temperature: 1.028571 Total energy: -744.637410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.637410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.637410 (E_RNA) where: Base-Base interactions energy: -479.842 where: short stacking energy: -243.985 Base-Backbone interact. energy: -0.975 local terms energy: -263.819926 where: bonds (distance) C4'-P energy: -51.493 bonds (distance) P-C4' energy: -50.346 flat angles C4'-P-C4' energy: -61.855 flat angles P-C4'-P energy: -27.258 tors. eta vs tors. theta energy: -72.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 150 Temperature: 1.092857 Total energy: -648.547048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.547048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.547048 (E_RNA) where: Base-Base interactions energy: -411.092 where: short stacking energy: -192.954 Base-Backbone interact. energy: -2.051 local terms energy: -235.403869 where: bonds (distance) C4'-P energy: -60.494 bonds (distance) P-C4' energy: -47.240 flat angles C4'-P-C4' energy: -54.799 flat angles P-C4'-P energy: -37.505 tors. eta vs tors. theta energy: -35.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 150 Temperature: 1.157143 Total energy: -435.463573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.463573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.463573 (E_RNA) where: Base-Base interactions energy: -241.609 where: short stacking energy: -145.587 Base-Backbone interact. energy: -0.164 local terms energy: -193.690971 where: bonds (distance) C4'-P energy: -56.596 bonds (distance) P-C4' energy: -53.627 flat angles C4'-P-C4' energy: -35.810 flat angles P-C4'-P energy: -30.028 tors. eta vs tors. theta energy: -17.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 150 Temperature: 1.221429 Total energy: -325.681940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.681940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.681940 (E_RNA) where: Base-Base interactions energy: -155.168 where: short stacking energy: -121.592 Base-Backbone interact. energy: 1.761 local terms energy: -172.274770 where: bonds (distance) C4'-P energy: -40.412 bonds (distance) P-C4' energy: -55.296 flat angles C4'-P-C4' energy: -35.302 flat angles P-C4'-P energy: -39.597 tors. eta vs tors. theta energy: -1.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 150 Temperature: 1.285714 Total energy: -314.740797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.740797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.740797 (E_RNA) where: Base-Base interactions energy: -171.914 where: short stacking energy: -95.287 Base-Backbone interact. energy: 0.095 local terms energy: -142.921307 where: bonds (distance) C4'-P energy: -37.180 bonds (distance) P-C4' energy: -50.265 flat angles C4'-P-C4' energy: -46.741 flat angles P-C4'-P energy: -16.307 tors. eta vs tors. theta energy: 7.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 150 Temperature: 1.350000 Total energy: -274.894843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.894843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.894843 (E_RNA) where: Base-Base interactions energy: -134.870 where: short stacking energy: -96.123 Base-Backbone interact. energy: -0.484 local terms energy: -139.540438 where: bonds (distance) C4'-P energy: -35.633 bonds (distance) P-C4' energy: -48.337 flat angles C4'-P-C4' energy: -37.777 flat angles P-C4'-P energy: -16.302 tors. eta vs tors. theta energy: -1.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 151 Temperature: 0.900000 Total energy: -846.774513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.774513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -846.774513 (E_RNA) where: Base-Base interactions energy: -571.116 where: short stacking energy: -245.965 Base-Backbone interact. energy: -0.970 local terms energy: -274.688050 where: bonds (distance) C4'-P energy: -57.882 bonds (distance) P-C4' energy: -58.760 flat angles C4'-P-C4' energy: -58.724 flat angles P-C4'-P energy: -38.807 tors. eta vs tors. theta energy: -60.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 151 Temperature: 0.964286 Total energy: -788.600841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -788.600841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.600841 (E_RNA) where: Base-Base interactions energy: -494.780 where: short stacking energy: -259.529 Base-Backbone interact. energy: -0.773 local terms energy: -293.047544 where: bonds (distance) C4'-P energy: -57.403 bonds (distance) P-C4' energy: -60.892 flat angles C4'-P-C4' energy: -67.743 flat angles P-C4'-P energy: -37.664 tors. eta vs tors. theta energy: -69.345 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 151 Temperature: 1.028571 Total energy: -729.755162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.755162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.755162 (E_RNA) where: Base-Base interactions energy: -488.160 where: short stacking energy: -213.947 Base-Backbone interact. energy: -2.093 local terms energy: -239.501600 where: bonds (distance) C4'-P energy: -52.585 bonds (distance) P-C4' energy: -62.641 flat angles C4'-P-C4' energy: -47.630 flat angles P-C4'-P energy: -34.347 tors. eta vs tors. theta energy: -42.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 151 Temperature: 1.092857 Total energy: -685.582984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.582984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.582984 (E_RNA) where: Base-Base interactions energy: -445.918 where: short stacking energy: -220.970 Base-Backbone interact. energy: 1.394 local terms energy: -241.059665 where: bonds (distance) C4'-P energy: -42.853 bonds (distance) P-C4' energy: -55.968 flat angles C4'-P-C4' energy: -59.853 flat angles P-C4'-P energy: -40.678 tors. eta vs tors. theta energy: -41.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 151 Temperature: 1.157143 Total energy: -431.252186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.252186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.252186 (E_RNA) where: Base-Base interactions energy: -235.352 where: short stacking energy: -140.392 Base-Backbone interact. energy: -0.954 local terms energy: -194.946120 where: bonds (distance) C4'-P energy: -58.222 bonds (distance) P-C4' energy: -45.361 flat angles C4'-P-C4' energy: -45.476 flat angles P-C4'-P energy: -22.010 tors. eta vs tors. theta energy: -23.877 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 151 Temperature: 1.221429 Total energy: -319.499679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.499679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.499679 (E_RNA) where: Base-Base interactions energy: -134.043 where: short stacking energy: -94.778 Base-Backbone interact. energy: 2.232 local terms energy: -187.688949 where: bonds (distance) C4'-P energy: -39.732 bonds (distance) P-C4' energy: -56.385 flat angles C4'-P-C4' energy: -46.662 flat angles P-C4'-P energy: -27.352 tors. eta vs tors. theta energy: -17.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 151 Temperature: 1.285714 Total energy: -256.372316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.372316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.372316 (E_RNA) where: Base-Base interactions energy: -95.691 where: short stacking energy: -81.495 Base-Backbone interact. energy: 0.025 local terms energy: -160.706893 where: bonds (distance) C4'-P energy: -53.691 bonds (distance) P-C4' energy: -43.087 flat angles C4'-P-C4' energy: -44.485 flat angles P-C4'-P energy: -28.568 tors. eta vs tors. theta energy: 9.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 151 Temperature: 1.350000 Total energy: -269.977601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.977601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.977601 (E_RNA) where: Base-Base interactions energy: -119.600 where: short stacking energy: -74.442 Base-Backbone interact. energy: -2.443 local terms energy: -147.934394 where: bonds (distance) C4'-P energy: -51.510 bonds (distance) P-C4' energy: -46.133 flat angles C4'-P-C4' energy: -33.007 flat angles P-C4'-P energy: -23.622 tors. eta vs tors. theta energy: 6.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 152 Temperature: 0.900000 Total energy: -856.893318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.893318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -856.893318 (E_RNA) where: Base-Base interactions energy: -602.295 where: short stacking energy: -270.095 Base-Backbone interact. energy: -2.029 local terms energy: -252.568503 where: bonds (distance) C4'-P energy: -40.860 bonds (distance) P-C4' energy: -53.446 flat angles C4'-P-C4' energy: -50.118 flat angles P-C4'-P energy: -40.421 tors. eta vs tors. theta energy: -67.724 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 152 Temperature: 0.964286 Total energy: -806.308435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.308435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -806.308435 (E_RNA) where: Base-Base interactions energy: -529.651 where: short stacking energy: -292.007 Base-Backbone interact. energy: 0.954 local terms energy: -277.611621 where: bonds (distance) C4'-P energy: -51.829 bonds (distance) P-C4' energy: -58.612 flat angles C4'-P-C4' energy: -57.869 flat angles P-C4'-P energy: -34.364 tors. eta vs tors. theta energy: -74.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 152 Temperature: 1.028571 Total energy: -725.978178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.978178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.978178 (E_RNA) where: Base-Base interactions energy: -477.205 where: short stacking energy: -217.442 Base-Backbone interact. energy: -0.273 local terms energy: -248.500738 where: bonds (distance) C4'-P energy: -56.183 bonds (distance) P-C4' energy: -53.883 flat angles C4'-P-C4' energy: -49.559 flat angles P-C4'-P energy: -40.679 tors. eta vs tors. theta energy: -48.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 152 Temperature: 1.092857 Total energy: -667.640294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.640294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.640294 (E_RNA) where: Base-Base interactions energy: -439.905 where: short stacking energy: -214.862 Base-Backbone interact. energy: -1.858 local terms energy: -225.877156 where: bonds (distance) C4'-P energy: -42.651 bonds (distance) P-C4' energy: -56.134 flat angles C4'-P-C4' energy: -44.753 flat angles P-C4'-P energy: -35.919 tors. eta vs tors. theta energy: -46.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 152 Temperature: 1.157143 Total energy: -425.012468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.012468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.012468 (E_RNA) where: Base-Base interactions energy: -225.385 where: short stacking energy: -130.995 Base-Backbone interact. energy: -0.540 local terms energy: -199.087435 where: bonds (distance) C4'-P energy: -49.823 bonds (distance) P-C4' energy: -60.428 flat angles C4'-P-C4' energy: -47.388 flat angles P-C4'-P energy: -27.942 tors. eta vs tors. theta energy: -13.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 152 Temperature: 1.221429 Total energy: -288.852925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.852925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.852925 (E_RNA) where: Base-Base interactions energy: -97.503 where: short stacking energy: -85.036 Base-Backbone interact. energy: -0.638 local terms energy: -190.712421 where: bonds (distance) C4'-P energy: -48.757 bonds (distance) P-C4' energy: -59.888 flat angles C4'-P-C4' energy: -42.274 flat angles P-C4'-P energy: -35.963 tors. eta vs tors. theta energy: -3.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 152 Temperature: 1.285714 Total energy: -320.671418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.671418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.671418 (E_RNA) where: Base-Base interactions energy: -168.853 where: short stacking energy: -114.972 Base-Backbone interact. energy: -0.328 local terms energy: -151.489721 where: bonds (distance) C4'-P energy: -34.999 bonds (distance) P-C4' energy: -38.893 flat angles C4'-P-C4' energy: -41.606 flat angles P-C4'-P energy: -28.005 tors. eta vs tors. theta energy: -7.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 152 Temperature: 1.350000 Total energy: -228.328131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.328131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.328131 (E_RNA) where: Base-Base interactions energy: -77.887 where: short stacking energy: -77.455 Base-Backbone interact. energy: 5.840 local terms energy: -156.280864 where: bonds (distance) C4'-P energy: -44.264 bonds (distance) P-C4' energy: -48.287 flat angles C4'-P-C4' energy: -47.029 flat angles P-C4'-P energy: -14.023 tors. eta vs tors. theta energy: -2.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 153 Temperature: 0.900000 Total energy: -845.961432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.961432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.961432 (E_RNA) where: Base-Base interactions energy: -577.734 where: short stacking energy: -266.624 Base-Backbone interact. energy: -0.997 local terms energy: -267.230853 where: bonds (distance) C4'-P energy: -58.059 bonds (distance) P-C4' energy: -56.587 flat angles C4'-P-C4' energy: -51.248 flat angles P-C4'-P energy: -41.340 tors. eta vs tors. theta energy: -59.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 153 Temperature: 0.964286 Total energy: -775.078613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.078613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.078613 (E_RNA) where: Base-Base interactions energy: -482.917 where: short stacking energy: -260.843 Base-Backbone interact. energy: -1.218 local terms energy: -290.944111 where: bonds (distance) C4'-P energy: -56.781 bonds (distance) P-C4' energy: -58.505 flat angles C4'-P-C4' energy: -62.237 flat angles P-C4'-P energy: -38.574 tors. eta vs tors. theta energy: -74.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 153 Temperature: 1.028571 Total energy: -734.398348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.398348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.398348 (E_RNA) where: Base-Base interactions energy: -473.002 where: short stacking energy: -217.239 Base-Backbone interact. energy: -0.210 local terms energy: -261.187055 where: bonds (distance) C4'-P energy: -50.461 bonds (distance) P-C4' energy: -54.575 flat angles C4'-P-C4' energy: -56.110 flat angles P-C4'-P energy: -44.572 tors. eta vs tors. theta energy: -55.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 153 Temperature: 1.092857 Total energy: -666.007330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.007330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.007330 (E_RNA) where: Base-Base interactions energy: -421.411 where: short stacking energy: -210.033 Base-Backbone interact. energy: -0.143 local terms energy: -244.453105 where: bonds (distance) C4'-P energy: -53.902 bonds (distance) P-C4' energy: -52.355 flat angles C4'-P-C4' energy: -54.573 flat angles P-C4'-P energy: -36.380 tors. eta vs tors. theta energy: -47.242 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 153 Temperature: 1.157143 Total energy: -421.287639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.287639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.287639 (E_RNA) where: Base-Base interactions energy: -230.296 where: short stacking energy: -138.452 Base-Backbone interact. energy: -1.526 local terms energy: -189.465067 where: bonds (distance) C4'-P energy: -50.621 bonds (distance) P-C4' energy: -56.040 flat angles C4'-P-C4' energy: -40.557 flat angles P-C4'-P energy: -28.376 tors. eta vs tors. theta energy: -13.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 153 Temperature: 1.221429 Total energy: -359.180265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.180265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.180265 (E_RNA) where: Base-Base interactions energy: -169.750 where: short stacking energy: -115.260 Base-Backbone interact. energy: -1.285 local terms energy: -188.144831 where: bonds (distance) C4'-P energy: -58.328 bonds (distance) P-C4' energy: -55.625 flat angles C4'-P-C4' energy: -48.783 flat angles P-C4'-P energy: -23.467 tors. eta vs tors. theta energy: -1.942 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 153 Temperature: 1.285714 Total energy: -217.023577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.023577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.023577 (E_RNA) where: Base-Base interactions energy: -73.804 where: short stacking energy: -55.834 Base-Backbone interact. energy: 0.513 local terms energy: -143.733088 where: bonds (distance) C4'-P energy: -43.383 bonds (distance) P-C4' energy: -58.864 flat angles C4'-P-C4' energy: -40.269 flat angles P-C4'-P energy: -16.832 tors. eta vs tors. theta energy: 15.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 153 Temperature: 1.350000 Total energy: -229.254748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.254748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.254748 (E_RNA) where: Base-Base interactions energy: -79.716 where: short stacking energy: -61.926 Base-Backbone interact. energy: 1.327 local terms energy: -150.865328 where: bonds (distance) C4'-P energy: -51.228 bonds (distance) P-C4' energy: -40.874 flat angles C4'-P-C4' energy: -49.487 flat angles P-C4'-P energy: -17.269 tors. eta vs tors. theta energy: 7.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 154 Temperature: 0.900000 Total energy: -823.310183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -823.310183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.310183 (E_RNA) where: Base-Base interactions energy: -562.034 where: short stacking energy: -240.035 Base-Backbone interact. energy: -1.935 local terms energy: -259.341235 where: bonds (distance) C4'-P energy: -55.421 bonds (distance) P-C4' energy: -63.173 flat angles C4'-P-C4' energy: -48.673 flat angles P-C4'-P energy: -40.294 tors. eta vs tors. theta energy: -51.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 154 Temperature: 0.964286 Total energy: -764.288846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -764.288846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -764.288846 (E_RNA) where: Base-Base interactions energy: -482.902 where: short stacking energy: -250.359 Base-Backbone interact. energy: 0.884 local terms energy: -282.270321 where: bonds (distance) C4'-P energy: -57.381 bonds (distance) P-C4' energy: -62.914 flat angles C4'-P-C4' energy: -61.115 flat angles P-C4'-P energy: -36.212 tors. eta vs tors. theta energy: -64.649 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 154 Temperature: 1.028571 Total energy: -756.376479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.376479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.376479 (E_RNA) where: Base-Base interactions energy: -491.330 where: short stacking energy: -231.416 Base-Backbone interact. energy: -2.627 local terms energy: -262.419203 where: bonds (distance) C4'-P energy: -52.362 bonds (distance) P-C4' energy: -63.203 flat angles C4'-P-C4' energy: -53.400 flat angles P-C4'-P energy: -38.813 tors. eta vs tors. theta energy: -54.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 154 Temperature: 1.092857 Total energy: -635.497278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.497278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.497278 (E_RNA) where: Base-Base interactions energy: -402.253 where: short stacking energy: -183.630 Base-Backbone interact. energy: -0.905 local terms energy: -232.339130 where: bonds (distance) C4'-P energy: -53.115 bonds (distance) P-C4' energy: -50.920 flat angles C4'-P-C4' energy: -47.662 flat angles P-C4'-P energy: -42.104 tors. eta vs tors. theta energy: -38.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 154 Temperature: 1.157143 Total energy: -397.692346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.692346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.692346 (E_RNA) where: Base-Base interactions energy: -199.377 where: short stacking energy: -140.786 Base-Backbone interact. energy: 1.381 local terms energy: -199.696334 where: bonds (distance) C4'-P energy: -48.010 bonds (distance) P-C4' energy: -59.595 flat angles C4'-P-C4' energy: -44.735 flat angles P-C4'-P energy: -30.504 tors. eta vs tors. theta energy: -16.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 154 Temperature: 1.221429 Total energy: -375.040373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.040373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.040373 (E_RNA) where: Base-Base interactions energy: -172.190 where: short stacking energy: -118.571 Base-Backbone interact. energy: 1.416 local terms energy: -204.266164 where: bonds (distance) C4'-P energy: -50.831 bonds (distance) P-C4' energy: -57.052 flat angles C4'-P-C4' energy: -53.112 flat angles P-C4'-P energy: -32.738 tors. eta vs tors. theta energy: -10.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 154 Temperature: 1.285714 Total energy: -266.809116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.809116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.809116 (E_RNA) where: Base-Base interactions energy: -102.494 where: short stacking energy: -84.813 Base-Backbone interact. energy: -0.426 local terms energy: -163.889646 where: bonds (distance) C4'-P energy: -56.064 bonds (distance) P-C4' energy: -44.692 flat angles C4'-P-C4' energy: -37.622 flat angles P-C4'-P energy: -25.414 tors. eta vs tors. theta energy: -0.097 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 154 Temperature: 1.350000 Total energy: -224.218674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.218674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.218674 (E_RNA) where: Base-Base interactions energy: -75.888 where: short stacking energy: -64.869 Base-Backbone interact. energy: 1.586 local terms energy: -149.917272 where: bonds (distance) C4'-P energy: -34.924 bonds (distance) P-C4' energy: -57.742 flat angles C4'-P-C4' energy: -37.839 flat angles P-C4'-P energy: -25.134 tors. eta vs tors. theta energy: 5.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 155 Temperature: 0.900000 Total energy: -851.229885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -851.229885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -851.229885 (E_RNA) where: Base-Base interactions energy: -571.381 where: short stacking energy: -240.488 Base-Backbone interact. energy: -3.226 local terms energy: -276.622414 where: bonds (distance) C4'-P energy: -65.468 bonds (distance) P-C4' energy: -62.343 flat angles C4'-P-C4' energy: -55.783 flat angles P-C4'-P energy: -41.789 tors. eta vs tors. theta energy: -51.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 155 Temperature: 0.964286 Total energy: -792.684163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -792.684163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -792.684163 (E_RNA) where: Base-Base interactions energy: -518.632 where: short stacking energy: -231.329 Base-Backbone interact. energy: -1.785 local terms energy: -272.266989 where: bonds (distance) C4'-P energy: -58.581 bonds (distance) P-C4' energy: -58.227 flat angles C4'-P-C4' energy: -63.820 flat angles P-C4'-P energy: -40.471 tors. eta vs tors. theta energy: -51.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 155 Temperature: 1.028571 Total energy: -742.741182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.741182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -742.741182 (E_RNA) where: Base-Base interactions energy: -471.219 where: short stacking energy: -252.630 Base-Backbone interact. energy: -1.012 local terms energy: -270.510329 where: bonds (distance) C4'-P energy: -52.220 bonds (distance) P-C4' energy: -62.545 flat angles C4'-P-C4' energy: -59.565 flat angles P-C4'-P energy: -33.363 tors. eta vs tors. theta energy: -62.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 155 Temperature: 1.092857 Total energy: -676.420148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.420148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.420148 (E_RNA) where: Base-Base interactions energy: -426.214 where: short stacking energy: -219.175 Base-Backbone interact. energy: -1.639 local terms energy: -248.566820 where: bonds (distance) C4'-P energy: -53.043 bonds (distance) P-C4' energy: -59.877 flat angles C4'-P-C4' energy: -47.270 flat angles P-C4'-P energy: -41.662 tors. eta vs tors. theta energy: -46.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 155 Temperature: 1.157143 Total energy: -396.813245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.813245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.813245 (E_RNA) where: Base-Base interactions energy: -206.801 where: short stacking energy: -131.515 Base-Backbone interact. energy: -1.190 local terms energy: -188.822658 where: bonds (distance) C4'-P energy: -56.424 bonds (distance) P-C4' energy: -42.125 flat angles C4'-P-C4' energy: -44.863 flat angles P-C4'-P energy: -27.586 tors. eta vs tors. theta energy: -17.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 155 Temperature: 1.221429 Total energy: -350.388481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.388481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.388481 (E_RNA) where: Base-Base interactions energy: -142.044 where: short stacking energy: -87.065 Base-Backbone interact. energy: -0.765 local terms energy: -207.579957 where: bonds (distance) C4'-P energy: -47.692 bonds (distance) P-C4' energy: -61.701 flat angles C4'-P-C4' energy: -49.453 flat angles P-C4'-P energy: -42.412 tors. eta vs tors. theta energy: -6.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 155 Temperature: 1.285714 Total energy: -277.191763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.191763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.191763 (E_RNA) where: Base-Base interactions energy: -112.542 where: short stacking energy: -107.600 Base-Backbone interact. energy: 0.052 local terms energy: -164.702350 where: bonds (distance) C4'-P energy: -32.073 bonds (distance) P-C4' energy: -57.170 flat angles C4'-P-C4' energy: -41.217 flat angles P-C4'-P energy: -29.160 tors. eta vs tors. theta energy: -5.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 155 Temperature: 1.350000 Total energy: -226.743900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.743900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.743900 (E_RNA) where: Base-Base interactions energy: -89.340 where: short stacking energy: -78.979 Base-Backbone interact. energy: 0.151 local terms energy: -137.555201 where: bonds (distance) C4'-P energy: -46.088 bonds (distance) P-C4' energy: -50.093 flat angles C4'-P-C4' energy: -42.507 flat angles P-C4'-P energy: -17.457 tors. eta vs tors. theta energy: 18.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 156 Temperature: 0.900000 Total energy: -826.013548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.013548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.013548 (E_RNA) where: Base-Base interactions energy: -566.845 where: short stacking energy: -241.892 Base-Backbone interact. energy: -3.300 local terms energy: -255.868252 where: bonds (distance) C4'-P energy: -54.583 bonds (distance) P-C4' energy: -56.755 flat angles C4'-P-C4' energy: -54.532 flat angles P-C4'-P energy: -38.706 tors. eta vs tors. theta energy: -51.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 156 Temperature: 0.964286 Total energy: -769.232489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.232489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.232489 (E_RNA) where: Base-Base interactions energy: -521.076 where: short stacking energy: -225.214 Base-Backbone interact. energy: -1.963 local terms energy: -246.192907 where: bonds (distance) C4'-P energy: -50.910 bonds (distance) P-C4' energy: -50.058 flat angles C4'-P-C4' energy: -53.369 flat angles P-C4'-P energy: -40.375 tors. eta vs tors. theta energy: -51.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 156 Temperature: 1.028571 Total energy: -754.568401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -754.568401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.568401 (E_RNA) where: Base-Base interactions energy: -489.428 where: short stacking energy: -264.575 Base-Backbone interact. energy: -0.465 local terms energy: -264.675401 where: bonds (distance) C4'-P energy: -46.199 bonds (distance) P-C4' energy: -57.655 flat angles C4'-P-C4' energy: -57.652 flat angles P-C4'-P energy: -35.835 tors. eta vs tors. theta energy: -67.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 156 Temperature: 1.092857 Total energy: -684.070120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.070120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.070120 (E_RNA) where: Base-Base interactions energy: -435.981 where: short stacking energy: -202.129 Base-Backbone interact. energy: 1.778 local terms energy: -249.866614 where: bonds (distance) C4'-P energy: -54.633 bonds (distance) P-C4' energy: -57.940 flat angles C4'-P-C4' energy: -57.220 flat angles P-C4'-P energy: -29.590 tors. eta vs tors. theta energy: -50.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 156 Temperature: 1.157143 Total energy: -368.359275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.359275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.359275 (E_RNA) where: Base-Base interactions energy: -192.434 where: short stacking energy: -97.809 Base-Backbone interact. energy: 0.635 local terms energy: -176.560654 where: bonds (distance) C4'-P energy: -41.797 bonds (distance) P-C4' energy: -56.529 flat angles C4'-P-C4' energy: -35.091 flat angles P-C4'-P energy: -36.870 tors. eta vs tors. theta energy: -6.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 156 Temperature: 1.221429 Total energy: -365.241442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.241442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.241442 (E_RNA) where: Base-Base interactions energy: -164.330 where: short stacking energy: -123.648 Base-Backbone interact. energy: -0.545 local terms energy: -200.366143 where: bonds (distance) C4'-P energy: -56.562 bonds (distance) P-C4' energy: -57.013 flat angles C4'-P-C4' energy: -44.468 flat angles P-C4'-P energy: -28.196 tors. eta vs tors. theta energy: -14.128 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 156 Temperature: 1.285714 Total energy: -272.433044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.433044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.433044 (E_RNA) where: Base-Base interactions energy: -87.045 where: short stacking energy: -85.002 Base-Backbone interact. energy: -0.494 local terms energy: -184.894245 where: bonds (distance) C4'-P energy: -46.762 bonds (distance) P-C4' energy: -59.347 flat angles C4'-P-C4' energy: -50.952 flat angles P-C4'-P energy: -24.606 tors. eta vs tors. theta energy: -3.227 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 156 Temperature: 1.350000 Total energy: -232.083954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.083954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.083954 (E_RNA) where: Base-Base interactions energy: -84.764 where: short stacking energy: -84.764 Base-Backbone interact. energy: 1.143 local terms energy: -148.462895 where: bonds (distance) C4'-P energy: -49.263 bonds (distance) P-C4' energy: -52.031 flat angles C4'-P-C4' energy: -37.760 flat angles P-C4'-P energy: -14.858 tors. eta vs tors. theta energy: 5.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 157 Temperature: 0.900000 Total energy: -813.835626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.835626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.835626 (E_RNA) where: Base-Base interactions energy: -558.459 where: short stacking energy: -238.824 Base-Backbone interact. energy: -1.205 local terms energy: -254.171536 where: bonds (distance) C4'-P energy: -59.322 bonds (distance) P-C4' energy: -59.882 flat angles C4'-P-C4' energy: -50.008 flat angles P-C4'-P energy: -29.645 tors. eta vs tors. theta energy: -55.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 157 Temperature: 0.964286 Total energy: -782.813871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.813871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.813871 (E_RNA) where: Base-Base interactions energy: -528.922 where: short stacking energy: -259.293 Base-Backbone interact. energy: -1.052 local terms energy: -252.840763 where: bonds (distance) C4'-P energy: -43.273 bonds (distance) P-C4' energy: -54.923 flat angles C4'-P-C4' energy: -57.739 flat angles P-C4'-P energy: -37.840 tors. eta vs tors. theta energy: -59.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 157 Temperature: 1.028571 Total energy: -701.002076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.002076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.002076 (E_RNA) where: Base-Base interactions energy: -433.905 where: short stacking energy: -205.243 Base-Backbone interact. energy: 2.276 local terms energy: -269.373217 where: bonds (distance) C4'-P energy: -54.998 bonds (distance) P-C4' energy: -61.909 flat angles C4'-P-C4' energy: -56.340 flat angles P-C4'-P energy: -41.343 tors. eta vs tors. theta energy: -54.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 157 Temperature: 1.092857 Total energy: -677.518649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.518649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.518649 (E_RNA) where: Base-Base interactions energy: -436.202 where: short stacking energy: -228.848 Base-Backbone interact. energy: -0.712 local terms energy: -240.605388 where: bonds (distance) C4'-P energy: -49.488 bonds (distance) P-C4' energy: -49.753 flat angles C4'-P-C4' energy: -58.677 flat angles P-C4'-P energy: -29.756 tors. eta vs tors. theta energy: -52.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 157 Temperature: 1.157143 Total energy: -397.460925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.460925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.460925 (E_RNA) where: Base-Base interactions energy: -217.990 where: short stacking energy: -120.355 Base-Backbone interact. energy: -0.877 local terms energy: -178.593969 where: bonds (distance) C4'-P energy: -41.898 bonds (distance) P-C4' energy: -54.304 flat angles C4'-P-C4' energy: -51.744 flat angles P-C4'-P energy: -28.116 tors. eta vs tors. theta energy: -2.532 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 157 Temperature: 1.221429 Total energy: -336.078730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.078730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.078730 (E_RNA) where: Base-Base interactions energy: -140.363 where: short stacking energy: -92.284 Base-Backbone interact. energy: 1.767 local terms energy: -197.482964 where: bonds (distance) C4'-P energy: -58.209 bonds (distance) P-C4' energy: -55.897 flat angles C4'-P-C4' energy: -45.465 flat angles P-C4'-P energy: -29.251 tors. eta vs tors. theta energy: -8.661 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 157 Temperature: 1.285714 Total energy: -268.718897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.718897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.718897 (E_RNA) where: Base-Base interactions energy: -101.365 where: short stacking energy: -92.341 Base-Backbone interact. energy: 2.805 local terms energy: -170.159078 where: bonds (distance) C4'-P energy: -47.426 bonds (distance) P-C4' energy: -61.851 flat angles C4'-P-C4' energy: -49.358 flat angles P-C4'-P energy: -14.987 tors. eta vs tors. theta energy: 3.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 157 Temperature: 1.350000 Total energy: -214.651715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.651715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.651715 (E_RNA) where: Base-Base interactions energy: -70.350 where: short stacking energy: -64.995 Base-Backbone interact. energy: -1.141 local terms energy: -143.159820 where: bonds (distance) C4'-P energy: -46.066 bonds (distance) P-C4' energy: -44.314 flat angles C4'-P-C4' energy: -41.737 flat angles P-C4'-P energy: -28.034 tors. eta vs tors. theta energy: 16.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 158 Temperature: 0.900000 Total energy: -837.903832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.903832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.903832 (E_RNA) where: Base-Base interactions energy: -591.282 where: short stacking energy: -261.290 Base-Backbone interact. energy: -2.306 local terms energy: -244.316231 where: bonds (distance) C4'-P energy: -52.807 bonds (distance) P-C4' energy: -56.479 flat angles C4'-P-C4' energy: -45.051 flat angles P-C4'-P energy: -39.271 tors. eta vs tors. theta energy: -50.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 158 Temperature: 0.964286 Total energy: -762.606400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.606400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.606400 (E_RNA) where: Base-Base interactions energy: -511.799 where: short stacking energy: -229.176 Base-Backbone interact. energy: 3.046 local terms energy: -253.853211 where: bonds (distance) C4'-P energy: -59.130 bonds (distance) P-C4' energy: -50.503 flat angles C4'-P-C4' energy: -53.090 flat angles P-C4'-P energy: -38.018 tors. eta vs tors. theta energy: -53.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 158 Temperature: 1.028571 Total energy: -666.444355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.444355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.444355 (E_RNA) where: Base-Base interactions energy: -432.273 where: short stacking energy: -204.719 Base-Backbone interact. energy: 0.199 local terms energy: -234.370819 where: bonds (distance) C4'-P energy: -51.467 bonds (distance) P-C4' energy: -51.518 flat angles C4'-P-C4' energy: -51.413 flat angles P-C4'-P energy: -39.079 tors. eta vs tors. theta energy: -40.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 158 Temperature: 1.092857 Total energy: -657.717553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.717553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.717553 (E_RNA) where: Base-Base interactions energy: -414.737 where: short stacking energy: -201.984 Base-Backbone interact. energy: -1.023 local terms energy: -241.957025 where: bonds (distance) C4'-P energy: -50.393 bonds (distance) P-C4' energy: -57.353 flat angles C4'-P-C4' energy: -50.320 flat angles P-C4'-P energy: -33.910 tors. eta vs tors. theta energy: -49.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 158 Temperature: 1.157143 Total energy: -420.506415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.506415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.506415 (E_RNA) where: Base-Base interactions energy: -238.733 where: short stacking energy: -135.106 Base-Backbone interact. energy: -0.942 local terms energy: -180.830835 where: bonds (distance) C4'-P energy: -49.102 bonds (distance) P-C4' energy: -44.375 flat angles C4'-P-C4' energy: -40.667 flat angles P-C4'-P energy: -30.158 tors. eta vs tors. theta energy: -16.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 158 Temperature: 1.221429 Total energy: -345.234458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.234458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.234458 (E_RNA) where: Base-Base interactions energy: -160.027 where: short stacking energy: -104.119 Base-Backbone interact. energy: 0.878 local terms energy: -186.085431 where: bonds (distance) C4'-P energy: -49.385 bonds (distance) P-C4' energy: -51.866 flat angles C4'-P-C4' energy: -47.142 flat angles P-C4'-P energy: -25.633 tors. eta vs tors. theta energy: -12.060 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 158 Temperature: 1.285714 Total energy: -259.815784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.815784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.815784 (E_RNA) where: Base-Base interactions energy: -86.271 where: short stacking energy: -77.771 Base-Backbone interact. energy: 1.522 local terms energy: -175.067106 where: bonds (distance) C4'-P energy: -47.056 bonds (distance) P-C4' energy: -58.676 flat angles C4'-P-C4' energy: -40.422 flat angles P-C4'-P energy: -26.669 tors. eta vs tors. theta energy: -2.243 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 158 Temperature: 1.350000 Total energy: -217.596741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.596741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.596741 (E_RNA) where: Base-Base interactions energy: -68.047 where: short stacking energy: -60.503 Base-Backbone interact. energy: -1.030 local terms energy: -148.519735 where: bonds (distance) C4'-P energy: -47.285 bonds (distance) P-C4' energy: -51.212 flat angles C4'-P-C4' energy: -40.723 flat angles P-C4'-P energy: -25.614 tors. eta vs tors. theta energy: 16.314 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 159 Temperature: 0.900000 Total energy: -874.216803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -874.216803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.216803 (E_RNA) where: Base-Base interactions energy: -598.053 where: short stacking energy: -250.610 Base-Backbone interact. energy: -1.216 local terms energy: -274.947964 where: bonds (distance) C4'-P energy: -60.748 bonds (distance) P-C4' energy: -57.620 flat angles C4'-P-C4' energy: -57.826 flat angles P-C4'-P energy: -43.801 tors. eta vs tors. theta energy: -54.952 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 159 Temperature: 0.964286 Total energy: -783.156099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.156099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.156099 (E_RNA) where: Base-Base interactions energy: -526.459 where: short stacking energy: -230.702 Base-Backbone interact. energy: -0.533 local terms energy: -256.164080 where: bonds (distance) C4'-P energy: -49.745 bonds (distance) P-C4' energy: -60.538 flat angles C4'-P-C4' energy: -51.329 flat angles P-C4'-P energy: -40.127 tors. eta vs tors. theta energy: -54.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 159 Temperature: 1.028571 Total energy: -659.973121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.973121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.973121 (E_RNA) where: Base-Base interactions energy: -415.423 where: short stacking energy: -203.464 Base-Backbone interact. energy: -0.672 local terms energy: -243.877569 where: bonds (distance) C4'-P energy: -53.697 bonds (distance) P-C4' energy: -57.733 flat angles C4'-P-C4' energy: -66.685 flat angles P-C4'-P energy: -30.125 tors. eta vs tors. theta energy: -35.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 159 Temperature: 1.092857 Total energy: -677.307157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.307157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.307157 (E_RNA) where: Base-Base interactions energy: -431.449 where: short stacking energy: -227.468 Base-Backbone interact. energy: 2.305 local terms energy: -248.163183 where: bonds (distance) C4'-P energy: -38.545 bonds (distance) P-C4' energy: -51.996 flat angles C4'-P-C4' energy: -63.156 flat angles P-C4'-P energy: -34.543 tors. eta vs tors. theta energy: -59.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 159 Temperature: 1.157143 Total energy: -462.391522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.391522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.391522 (E_RNA) where: Base-Base interactions energy: -271.329 where: short stacking energy: -123.778 Base-Backbone interact. energy: 0.630 local terms energy: -191.692075 where: bonds (distance) C4'-P energy: -51.029 bonds (distance) P-C4' energy: -48.426 flat angles C4'-P-C4' energy: -50.735 flat angles P-C4'-P energy: -20.320 tors. eta vs tors. theta energy: -21.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 159 Temperature: 1.221429 Total energy: -284.407008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.407008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.407008 (E_RNA) where: Base-Base interactions energy: -103.971 where: short stacking energy: -88.432 Base-Backbone interact. energy: -0.180 local terms energy: -180.255972 where: bonds (distance) C4'-P energy: -50.531 bonds (distance) P-C4' energy: -55.065 flat angles C4'-P-C4' energy: -55.510 flat angles P-C4'-P energy: -24.264 tors. eta vs tors. theta energy: 5.115 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 159 Temperature: 1.285714 Total energy: -322.504076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.504076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.504076 (E_RNA) where: Base-Base interactions energy: -166.853 where: short stacking energy: -113.425 Base-Backbone interact. energy: -1.324 local terms energy: -154.327153 where: bonds (distance) C4'-P energy: -38.915 bonds (distance) P-C4' energy: -38.161 flat angles C4'-P-C4' energy: -44.996 flat angles P-C4'-P energy: -19.974 tors. eta vs tors. theta energy: -12.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 159 Temperature: 1.350000 Total energy: -240.935678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.935678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.935678 (E_RNA) where: Base-Base interactions energy: -85.274 where: short stacking energy: -81.589 Base-Backbone interact. energy: -0.701 local terms energy: -154.960450 where: bonds (distance) C4'-P energy: -40.369 bonds (distance) P-C4' energy: -40.614 flat angles C4'-P-C4' energy: -43.130 flat angles P-C4'-P energy: -29.881 tors. eta vs tors. theta energy: -0.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 160 Temperature: 0.900000 Total energy: -891.623989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -891.623989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -891.623989 (E_RNA) where: Base-Base interactions energy: -618.875 where: short stacking energy: -272.192 Base-Backbone interact. energy: -0.773 local terms energy: -271.976021 where: bonds (distance) C4'-P energy: -57.426 bonds (distance) P-C4' energy: -58.578 flat angles C4'-P-C4' energy: -61.294 flat angles P-C4'-P energy: -39.281 tors. eta vs tors. theta energy: -55.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 160 Temperature: 0.964286 Total energy: -795.370087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.370087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -795.370087 (E_RNA) where: Base-Base interactions energy: -542.910 where: short stacking energy: -239.137 Base-Backbone interact. energy: 1.297 local terms energy: -253.757151 where: bonds (distance) C4'-P energy: -43.996 bonds (distance) P-C4' energy: -59.228 flat angles C4'-P-C4' energy: -55.748 flat angles P-C4'-P energy: -37.641 tors. eta vs tors. theta energy: -57.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 160 Temperature: 1.028571 Total energy: -709.602207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.602207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.602207 (E_RNA) where: Base-Base interactions energy: -451.588 where: short stacking energy: -247.979 Base-Backbone interact. energy: -1.672 local terms energy: -256.341653 where: bonds (distance) C4'-P energy: -40.554 bonds (distance) P-C4' energy: -60.688 flat angles C4'-P-C4' energy: -55.013 flat angles P-C4'-P energy: -37.183 tors. eta vs tors. theta energy: -62.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 160 Temperature: 1.092857 Total energy: -649.826008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.826008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.826008 (E_RNA) where: Base-Base interactions energy: -417.119 where: short stacking energy: -203.207 Base-Backbone interact. energy: -0.006 local terms energy: -232.700479 where: bonds (distance) C4'-P energy: -55.965 bonds (distance) P-C4' energy: -50.937 flat angles C4'-P-C4' energy: -57.239 flat angles P-C4'-P energy: -36.013 tors. eta vs tors. theta energy: -32.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 160 Temperature: 1.157143 Total energy: -451.126793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.126793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.126793 (E_RNA) where: Base-Base interactions energy: -274.231 where: short stacking energy: -151.593 Base-Backbone interact. energy: -0.741 local terms energy: -176.154945 where: bonds (distance) C4'-P energy: -47.073 bonds (distance) P-C4' energy: -46.574 flat angles C4'-P-C4' energy: -43.333 flat angles P-C4'-P energy: -11.572 tors. eta vs tors. theta energy: -27.603 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 160 Temperature: 1.221429 Total energy: -298.110469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.110469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.110469 (E_RNA) where: Base-Base interactions energy: -121.563 where: short stacking energy: -114.853 Base-Backbone interact. energy: 0.565 local terms energy: -178.754551 where: bonds (distance) C4'-P energy: -54.198 bonds (distance) P-C4' energy: -50.826 flat angles C4'-P-C4' energy: -40.923 flat angles P-C4'-P energy: -26.209 tors. eta vs tors. theta energy: -6.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.642 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 160 Temperature: 1.285714 Total energy: -335.289047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.289047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.289047 (E_RNA) where: Base-Base interactions energy: -162.005 where: short stacking energy: -83.617 Base-Backbone interact. energy: 1.617 local terms energy: -174.900581 where: bonds (distance) C4'-P energy: -56.481 bonds (distance) P-C4' energy: -55.920 flat angles C4'-P-C4' energy: -33.486 flat angles P-C4'-P energy: -28.599 tors. eta vs tors. theta energy: -0.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 160 Temperature: 1.350000 Total energy: -244.806356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.806356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.806356 (E_RNA) where: Base-Base interactions energy: -87.195 where: short stacking energy: -85.877 Base-Backbone interact. energy: 0.887 local terms energy: -158.498511 where: bonds (distance) C4'-P energy: -40.690 bonds (distance) P-C4' energy: -48.189 flat angles C4'-P-C4' energy: -45.386 flat angles P-C4'-P energy: -26.536 tors. eta vs tors. theta energy: 2.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 161 Temperature: 0.900000 Total energy: -871.979223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.979223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.979223 (E_RNA) where: Base-Base interactions energy: -602.591 where: short stacking energy: -256.540 Base-Backbone interact. energy: -0.537 local terms energy: -268.851262 where: bonds (distance) C4'-P energy: -49.728 bonds (distance) P-C4' energy: -62.159 flat angles C4'-P-C4' energy: -59.331 flat angles P-C4'-P energy: -41.017 tors. eta vs tors. theta energy: -56.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 161 Temperature: 0.964286 Total energy: -793.262081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -793.262081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.262081 (E_RNA) where: Base-Base interactions energy: -527.102 where: short stacking energy: -234.187 Base-Backbone interact. energy: -0.024 local terms energy: -266.135202 where: bonds (distance) C4'-P energy: -59.949 bonds (distance) P-C4' energy: -61.204 flat angles C4'-P-C4' energy: -60.090 flat angles P-C4'-P energy: -40.111 tors. eta vs tors. theta energy: -44.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 161 Temperature: 1.028571 Total energy: -721.003306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.003306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.003306 (E_RNA) where: Base-Base interactions energy: -452.420 where: short stacking energy: -240.493 Base-Backbone interact. energy: -2.919 local terms energy: -265.664152 where: bonds (distance) C4'-P energy: -56.800 bonds (distance) P-C4' energy: -56.448 flat angles C4'-P-C4' energy: -58.530 flat angles P-C4'-P energy: -35.917 tors. eta vs tors. theta energy: -57.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 161 Temperature: 1.092857 Total energy: -635.572847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.572847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.572847 (E_RNA) where: Base-Base interactions energy: -409.908 where: short stacking energy: -209.098 Base-Backbone interact. energy: -0.783 local terms energy: -224.881700 where: bonds (distance) C4'-P energy: -50.739 bonds (distance) P-C4' energy: -38.519 flat angles C4'-P-C4' energy: -58.581 flat angles P-C4'-P energy: -28.539 tors. eta vs tors. theta energy: -48.503 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 161 Temperature: 1.157143 Total energy: -430.354899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.354899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.354899 (E_RNA) where: Base-Base interactions energy: -253.819 where: short stacking energy: -120.617 Base-Backbone interact. energy: 1.151 local terms energy: -177.686795 where: bonds (distance) C4'-P energy: -44.271 bonds (distance) P-C4' energy: -48.472 flat angles C4'-P-C4' energy: -46.689 flat angles P-C4'-P energy: -25.306 tors. eta vs tors. theta energy: -12.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 161 Temperature: 1.221429 Total energy: -368.828604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.828604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.828604 (E_RNA) where: Base-Base interactions energy: -193.234 where: short stacking energy: -129.737 Base-Backbone interact. energy: -0.762 local terms energy: -174.833092 where: bonds (distance) C4'-P energy: -39.626 bonds (distance) P-C4' energy: -43.290 flat angles C4'-P-C4' energy: -45.195 flat angles P-C4'-P energy: -21.366 tors. eta vs tors. theta energy: -25.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 161 Temperature: 1.285714 Total energy: -323.009719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.009719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.009719 (E_RNA) where: Base-Base interactions energy: -134.055 where: short stacking energy: -98.228 Base-Backbone interact. energy: -0.247 local terms energy: -188.707710 where: bonds (distance) C4'-P energy: -56.772 bonds (distance) P-C4' energy: -59.030 flat angles C4'-P-C4' energy: -36.558 flat angles P-C4'-P energy: -33.771 tors. eta vs tors. theta energy: -2.576 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 161 Temperature: 1.350000 Total energy: -225.701900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.701900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.701900 (E_RNA) where: Base-Base interactions energy: -74.820 where: short stacking energy: -71.124 Base-Backbone interact. energy: 0.432 local terms energy: -151.314028 where: bonds (distance) C4'-P energy: -52.933 bonds (distance) P-C4' energy: -44.932 flat angles C4'-P-C4' energy: -38.555 flat angles P-C4'-P energy: -22.345 tors. eta vs tors. theta energy: 7.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 162 Temperature: 0.900000 Total energy: -877.528061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.528061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -877.528061 (E_RNA) where: Base-Base interactions energy: -604.326 where: short stacking energy: -262.766 Base-Backbone interact. energy: -1.639 local terms energy: -271.562486 where: bonds (distance) C4'-P energy: -61.129 bonds (distance) P-C4' energy: -56.908 flat angles C4'-P-C4' energy: -60.590 flat angles P-C4'-P energy: -35.376 tors. eta vs tors. theta energy: -57.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 162 Temperature: 0.964286 Total energy: -795.361221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.361221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -795.361221 (E_RNA) where: Base-Base interactions energy: -541.544 where: short stacking energy: -230.303 Base-Backbone interact. energy: -1.247 local terms energy: -252.569601 where: bonds (distance) C4'-P energy: -57.158 bonds (distance) P-C4' energy: -53.623 flat angles C4'-P-C4' energy: -57.115 flat angles P-C4'-P energy: -34.135 tors. eta vs tors. theta energy: -50.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 162 Temperature: 1.028571 Total energy: -700.438316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.438316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.438316 (E_RNA) where: Base-Base interactions energy: -435.254 where: short stacking energy: -212.213 Base-Backbone interact. energy: -0.651 local terms energy: -264.533061 where: bonds (distance) C4'-P energy: -55.111 bonds (distance) P-C4' energy: -51.844 flat angles C4'-P-C4' energy: -63.152 flat angles P-C4'-P energy: -46.211 tors. eta vs tors. theta energy: -48.215 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 162 Temperature: 1.092857 Total energy: -668.938796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.938796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.938796 (E_RNA) where: Base-Base interactions energy: -419.371 where: short stacking energy: -203.582 Base-Backbone interact. energy: -0.785 local terms energy: -248.782926 where: bonds (distance) C4'-P energy: -59.057 bonds (distance) P-C4' energy: -59.023 flat angles C4'-P-C4' energy: -49.372 flat angles P-C4'-P energy: -38.792 tors. eta vs tors. theta energy: -42.540 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 162 Temperature: 1.157143 Total energy: -443.155573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.155573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.155573 (E_RNA) where: Base-Base interactions energy: -249.417 where: short stacking energy: -143.386 Base-Backbone interact. energy: 1.867 local terms energy: -195.605508 where: bonds (distance) C4'-P energy: -37.510 bonds (distance) P-C4' energy: -43.281 flat angles C4'-P-C4' energy: -55.784 flat angles P-C4'-P energy: -35.102 tors. eta vs tors. theta energy: -23.928 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 162 Temperature: 1.221429 Total energy: -382.566363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.566363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.566363 (E_RNA) where: Base-Base interactions energy: -178.605 where: short stacking energy: -132.675 Base-Backbone interact. energy: 0.337 local terms energy: -204.298602 where: bonds (distance) C4'-P energy: -50.983 bonds (distance) P-C4' energy: -57.147 flat angles C4'-P-C4' energy: -51.797 flat angles P-C4'-P energy: -27.660 tors. eta vs tors. theta energy: -16.712 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 162 Temperature: 1.285714 Total energy: -226.626792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.626792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.626792 (E_RNA) where: Base-Base interactions energy: -74.590 where: short stacking energy: -70.427 Base-Backbone interact. energy: 1.302 local terms energy: -153.339469 where: bonds (distance) C4'-P energy: -42.308 bonds (distance) P-C4' energy: -51.117 flat angles C4'-P-C4' energy: -42.284 flat angles P-C4'-P energy: -27.633 tors. eta vs tors. theta energy: 10.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 162 Temperature: 1.350000 Total energy: -251.925469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.925469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.925469 (E_RNA) where: Base-Base interactions energy: -100.679 where: short stacking energy: -91.085 Base-Backbone interact. energy: -1.029 local terms energy: -150.218383 where: bonds (distance) C4'-P energy: -42.325 bonds (distance) P-C4' energy: -50.982 flat angles C4'-P-C4' energy: -36.407 flat angles P-C4'-P energy: -22.366 tors. eta vs tors. theta energy: 1.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 163 Temperature: 0.900000 Total energy: -895.370897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -895.370897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -895.370897 (E_RNA) where: Base-Base interactions energy: -610.645 where: short stacking energy: -270.378 Base-Backbone interact. energy: -0.756 local terms energy: -283.970375 where: bonds (distance) C4'-P energy: -60.045 bonds (distance) P-C4' energy: -64.688 flat angles C4'-P-C4' energy: -62.362 flat angles P-C4'-P energy: -39.939 tors. eta vs tors. theta energy: -56.937 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 163 Temperature: 0.964286 Total energy: -800.017702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.017702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.017702 (E_RNA) where: Base-Base interactions energy: -515.068 where: short stacking energy: -231.267 Base-Backbone interact. energy: -2.001 local terms energy: -282.948357 where: bonds (distance) C4'-P energy: -64.350 bonds (distance) P-C4' energy: -61.311 flat angles C4'-P-C4' energy: -60.728 flat angles P-C4'-P energy: -40.686 tors. eta vs tors. theta energy: -55.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 163 Temperature: 1.028571 Total energy: -710.989106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -710.989106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.989106 (E_RNA) where: Base-Base interactions energy: -447.723 where: short stacking energy: -219.135 Base-Backbone interact. energy: -0.848 local terms energy: -262.418807 where: bonds (distance) C4'-P energy: -54.166 bonds (distance) P-C4' energy: -63.118 flat angles C4'-P-C4' energy: -64.153 flat angles P-C4'-P energy: -25.283 tors. eta vs tors. theta energy: -55.700 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 163 Temperature: 1.092857 Total energy: -643.080932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.080932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.080932 (E_RNA) where: Base-Base interactions energy: -398.230 where: short stacking energy: -197.663 Base-Backbone interact. energy: 0.016 local terms energy: -244.867049 where: bonds (distance) C4'-P energy: -52.950 bonds (distance) P-C4' energy: -54.719 flat angles C4'-P-C4' energy: -63.679 flat angles P-C4'-P energy: -34.304 tors. eta vs tors. theta energy: -39.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 163 Temperature: 1.157143 Total energy: -425.764728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.764728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.764728 (E_RNA) where: Base-Base interactions energy: -224.080 where: short stacking energy: -117.979 Base-Backbone interact. energy: -0.910 local terms energy: -200.774829 where: bonds (distance) C4'-P energy: -62.361 bonds (distance) P-C4' energy: -52.109 flat angles C4'-P-C4' energy: -39.627 flat angles P-C4'-P energy: -36.451 tors. eta vs tors. theta energy: -10.227 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 163 Temperature: 1.221429 Total energy: -366.169387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.169387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.169387 (E_RNA) where: Base-Base interactions energy: -183.417 where: short stacking energy: -138.392 Base-Backbone interact. energy: 0.677 local terms energy: -183.429008 where: bonds (distance) C4'-P energy: -47.821 bonds (distance) P-C4' energy: -40.095 flat angles C4'-P-C4' energy: -42.406 flat angles P-C4'-P energy: -21.987 tors. eta vs tors. theta energy: -31.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 163 Temperature: 1.285714 Total energy: -277.174856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.174856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.174856 (E_RNA) where: Base-Base interactions energy: -97.392 where: short stacking energy: -80.458 Base-Backbone interact. energy: -0.110 local terms energy: -179.672890 where: bonds (distance) C4'-P energy: -41.570 bonds (distance) P-C4' energy: -49.078 flat angles C4'-P-C4' energy: -55.881 flat angles P-C4'-P energy: -29.110 tors. eta vs tors. theta energy: -4.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 163 Temperature: 1.350000 Total energy: -250.234841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.234841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.234841 (E_RNA) where: Base-Base interactions energy: -89.061 where: short stacking energy: -68.082 Base-Backbone interact. energy: -2.633 local terms energy: -158.540290 where: bonds (distance) C4'-P energy: -41.789 bonds (distance) P-C4' energy: -53.210 flat angles C4'-P-C4' energy: -39.984 flat angles P-C4'-P energy: -33.349 tors. eta vs tors. theta energy: 9.791 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 164 Temperature: 0.900000 Total energy: -868.694146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -868.694146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -868.694146 (E_RNA) where: Base-Base interactions energy: -597.778 where: short stacking energy: -269.972 Base-Backbone interact. energy: -3.023 local terms energy: -267.893364 where: bonds (distance) C4'-P energy: -50.994 bonds (distance) P-C4' energy: -60.123 flat angles C4'-P-C4' energy: -61.037 flat angles P-C4'-P energy: -38.033 tors. eta vs tors. theta energy: -57.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 164 Temperature: 0.964286 Total energy: -787.853713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -787.853713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.853713 (E_RNA) where: Base-Base interactions energy: -522.007 where: short stacking energy: -227.279 Base-Backbone interact. energy: -1.583 local terms energy: -264.264537 where: bonds (distance) C4'-P energy: -53.832 bonds (distance) P-C4' energy: -58.193 flat angles C4'-P-C4' energy: -57.690 flat angles P-C4'-P energy: -40.611 tors. eta vs tors. theta energy: -53.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 164 Temperature: 1.028571 Total energy: -714.339346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.339346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.339346 (E_RNA) where: Base-Base interactions energy: -454.089 where: short stacking energy: -226.398 Base-Backbone interact. energy: 0.208 local terms energy: -260.458894 where: bonds (distance) C4'-P energy: -52.838 bonds (distance) P-C4' energy: -56.191 flat angles C4'-P-C4' energy: -61.476 flat angles P-C4'-P energy: -36.288 tors. eta vs tors. theta energy: -53.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 164 Temperature: 1.092857 Total energy: -658.424699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.424699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.424699 (E_RNA) where: Base-Base interactions energy: -430.498 where: short stacking energy: -199.722 Base-Backbone interact. energy: -0.207 local terms energy: -227.719959 where: bonds (distance) C4'-P energy: -51.307 bonds (distance) P-C4' energy: -46.800 flat angles C4'-P-C4' energy: -50.672 flat angles P-C4'-P energy: -37.468 tors. eta vs tors. theta energy: -41.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 164 Temperature: 1.157143 Total energy: -450.180623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.180623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.180623 (E_RNA) where: Base-Base interactions energy: -232.162 where: short stacking energy: -139.617 Base-Backbone interact. energy: -0.986 local terms energy: -217.032310 where: bonds (distance) C4'-P energy: -52.657 bonds (distance) P-C4' energy: -55.285 flat angles C4'-P-C4' energy: -49.978 flat angles P-C4'-P energy: -37.191 tors. eta vs tors. theta energy: -21.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 164 Temperature: 1.221429 Total energy: -335.203100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.203100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.203100 (E_RNA) where: Base-Base interactions energy: -159.246 where: short stacking energy: -101.139 Base-Backbone interact. energy: 0.948 local terms energy: -176.904557 where: bonds (distance) C4'-P energy: -55.681 bonds (distance) P-C4' energy: -43.760 flat angles C4'-P-C4' energy: -46.439 flat angles P-C4'-P energy: -28.828 tors. eta vs tors. theta energy: -2.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 164 Temperature: 1.285714 Total energy: -300.578574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.578574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.578574 (E_RNA) where: Base-Base interactions energy: -129.485 where: short stacking energy: -100.196 Base-Backbone interact. energy: -1.159 local terms energy: -169.933957 where: bonds (distance) C4'-P energy: -44.460 bonds (distance) P-C4' energy: -46.454 flat angles C4'-P-C4' energy: -53.697 flat angles P-C4'-P energy: -25.122 tors. eta vs tors. theta energy: -0.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 164 Temperature: 1.350000 Total energy: -227.797354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.797354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.797354 (E_RNA) where: Base-Base interactions energy: -65.945 where: short stacking energy: -65.500 Base-Backbone interact. energy: -0.161 local terms energy: -161.691166 where: bonds (distance) C4'-P energy: -45.226 bonds (distance) P-C4' energy: -61.032 flat angles C4'-P-C4' energy: -44.402 flat angles P-C4'-P energy: -23.261 tors. eta vs tors. theta energy: 12.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 165 Temperature: 0.900000 Total energy: -848.671360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.671360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -848.671360 (E_RNA) where: Base-Base interactions energy: -590.742 where: short stacking energy: -245.585 Base-Backbone interact. energy: -0.844 local terms energy: -257.085150 where: bonds (distance) C4'-P energy: -55.667 bonds (distance) P-C4' energy: -54.126 flat angles C4'-P-C4' energy: -51.965 flat angles P-C4'-P energy: -41.116 tors. eta vs tors. theta energy: -54.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 165 Temperature: 0.964286 Total energy: -742.962238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.962238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -742.962238 (E_RNA) where: Base-Base interactions energy: -477.701 where: short stacking energy: -236.706 Base-Backbone interact. energy: -1.334 local terms energy: -263.926669 where: bonds (distance) C4'-P energy: -49.630 bonds (distance) P-C4' energy: -58.951 flat angles C4'-P-C4' energy: -56.851 flat angles P-C4'-P energy: -40.030 tors. eta vs tors. theta energy: -58.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 165 Temperature: 1.028571 Total energy: -774.904027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -774.904027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.904027 (E_RNA) where: Base-Base interactions energy: -524.966 where: short stacking energy: -249.996 Base-Backbone interact. energy: -1.749 local terms energy: -248.188706 where: bonds (distance) C4'-P energy: -46.127 bonds (distance) P-C4' energy: -52.011 flat angles C4'-P-C4' energy: -54.467 flat angles P-C4'-P energy: -38.666 tors. eta vs tors. theta energy: -56.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 165 Temperature: 1.092857 Total energy: -629.136412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.136412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.136412 (E_RNA) where: Base-Base interactions energy: -408.544 where: short stacking energy: -204.746 Base-Backbone interact. energy: 0.887 local terms energy: -221.479801 where: bonds (distance) C4'-P energy: -37.150 bonds (distance) P-C4' energy: -60.262 flat angles C4'-P-C4' energy: -52.398 flat angles P-C4'-P energy: -33.351 tors. eta vs tors. theta energy: -38.320 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 165 Temperature: 1.157143 Total energy: -475.446668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.446668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.446668 (E_RNA) where: Base-Base interactions energy: -284.216 where: short stacking energy: -145.582 Base-Backbone interact. energy: -2.138 local terms energy: -189.092397 where: bonds (distance) C4'-P energy: -53.040 bonds (distance) P-C4' energy: -45.205 flat angles C4'-P-C4' energy: -45.293 flat angles P-C4'-P energy: -25.974 tors. eta vs tors. theta energy: -19.580 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 165 Temperature: 1.221429 Total energy: -365.463374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.463374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.463374 (E_RNA) where: Base-Base interactions energy: -192.256 where: short stacking energy: -142.502 Base-Backbone interact. energy: 3.175 local terms energy: -176.381940 where: bonds (distance) C4'-P energy: -43.114 bonds (distance) P-C4' energy: -49.482 flat angles C4'-P-C4' energy: -34.068 flat angles P-C4'-P energy: -28.806 tors. eta vs tors. theta energy: -20.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 165 Temperature: 1.285714 Total energy: -281.202664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.202664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.202664 (E_RNA) where: Base-Base interactions energy: -91.912 where: short stacking energy: -84.729 Base-Backbone interact. energy: -1.583 local terms energy: -187.708340 where: bonds (distance) C4'-P energy: -53.875 bonds (distance) P-C4' energy: -58.895 flat angles C4'-P-C4' energy: -49.047 flat angles P-C4'-P energy: -22.422 tors. eta vs tors. theta energy: -3.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 165 Temperature: 1.350000 Total energy: -256.378614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.378614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.378614 (E_RNA) where: Base-Base interactions energy: -104.010 where: short stacking energy: -79.155 Base-Backbone interact. energy: 5.817 local terms energy: -158.185656 where: bonds (distance) C4'-P energy: -46.217 bonds (distance) P-C4' energy: -41.296 flat angles C4'-P-C4' energy: -42.942 flat angles P-C4'-P energy: -33.169 tors. eta vs tors. theta energy: 5.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 166 Temperature: 0.900000 Total energy: -867.845864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -867.845864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.845864 (E_RNA) where: Base-Base interactions energy: -591.773 where: short stacking energy: -254.092 Base-Backbone interact. energy: 0.334 local terms energy: -276.405998 where: bonds (distance) C4'-P energy: -59.181 bonds (distance) P-C4' energy: -59.704 flat angles C4'-P-C4' energy: -62.111 flat angles P-C4'-P energy: -37.673 tors. eta vs tors. theta energy: -57.737 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 166 Temperature: 0.964286 Total energy: -750.889576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.889576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.889576 (E_RNA) where: Base-Base interactions energy: -485.798 where: short stacking energy: -250.286 Base-Backbone interact. energy: -2.094 local terms energy: -262.997613 where: bonds (distance) C4'-P energy: -52.423 bonds (distance) P-C4' energy: -50.345 flat angles C4'-P-C4' energy: -57.116 flat angles P-C4'-P energy: -40.759 tors. eta vs tors. theta energy: -62.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 166 Temperature: 1.028571 Total energy: -785.229285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.229285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.229285 (E_RNA) where: Base-Base interactions energy: -531.133 where: short stacking energy: -235.976 Base-Backbone interact. energy: 2.357 local terms energy: -256.452813 where: bonds (distance) C4'-P energy: -43.913 bonds (distance) P-C4' energy: -55.817 flat angles C4'-P-C4' energy: -58.786 flat angles P-C4'-P energy: -44.541 tors. eta vs tors. theta energy: -53.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 166 Temperature: 1.092857 Total energy: -629.872457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.872457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.872457 (E_RNA) where: Base-Base interactions energy: -406.551 where: short stacking energy: -202.102 Base-Backbone interact. energy: -0.111 local terms energy: -223.210814 where: bonds (distance) C4'-P energy: -44.944 bonds (distance) P-C4' energy: -49.685 flat angles C4'-P-C4' energy: -48.643 flat angles P-C4'-P energy: -37.580 tors. eta vs tors. theta energy: -42.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 166 Temperature: 1.157143 Total energy: -464.535252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.535252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.535252 (E_RNA) where: Base-Base interactions energy: -279.084 where: short stacking energy: -144.766 Base-Backbone interact. energy: -0.702 local terms energy: -184.749600 where: bonds (distance) C4'-P energy: -47.654 bonds (distance) P-C4' energy: -48.938 flat angles C4'-P-C4' energy: -31.951 flat angles P-C4'-P energy: -37.743 tors. eta vs tors. theta energy: -18.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 166 Temperature: 1.221429 Total energy: -370.993610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.993610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.993610 (E_RNA) where: Base-Base interactions energy: -181.537 where: short stacking energy: -125.350 Base-Backbone interact. energy: 1.359 local terms energy: -190.816223 where: bonds (distance) C4'-P energy: -46.525 bonds (distance) P-C4' energy: -51.076 flat angles C4'-P-C4' energy: -46.054 flat angles P-C4'-P energy: -33.050 tors. eta vs tors. theta energy: -14.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 166 Temperature: 1.285714 Total energy: -254.493352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.493352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.493352 (E_RNA) where: Base-Base interactions energy: -105.170 where: short stacking energy: -89.568 Base-Backbone interact. energy: -0.931 local terms energy: -148.392071 where: bonds (distance) C4'-P energy: -40.799 bonds (distance) P-C4' energy: -51.338 flat angles C4'-P-C4' energy: -28.608 flat angles P-C4'-P energy: -23.444 tors. eta vs tors. theta energy: -4.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 166 Temperature: 1.350000 Total energy: -243.055729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.055729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.055729 (E_RNA) where: Base-Base interactions energy: -88.966 where: short stacking energy: -58.942 Base-Backbone interact. energy: 2.058 local terms energy: -156.147042 where: bonds (distance) C4'-P energy: -40.055 bonds (distance) P-C4' energy: -51.229 flat angles C4'-P-C4' energy: -42.073 flat angles P-C4'-P energy: -27.665 tors. eta vs tors. theta energy: 4.874 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 167 Temperature: 0.900000 Total energy: -881.460985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -881.460985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.460985 (E_RNA) where: Base-Base interactions energy: -625.119 where: short stacking energy: -246.963 Base-Backbone interact. energy: -1.573 local terms energy: -254.768919 where: bonds (distance) C4'-P energy: -59.907 bonds (distance) P-C4' energy: -65.189 flat angles C4'-P-C4' energy: -46.364 flat angles P-C4'-P energy: -35.611 tors. eta vs tors. theta energy: -47.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 167 Temperature: 0.964286 Total energy: -817.907270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -817.907270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -817.907270 (E_RNA) where: Base-Base interactions energy: -546.291 where: short stacking energy: -239.971 Base-Backbone interact. energy: -1.271 local terms energy: -270.344940 where: bonds (distance) C4'-P energy: -52.623 bonds (distance) P-C4' energy: -61.520 flat angles C4'-P-C4' energy: -59.186 flat angles P-C4'-P energy: -39.413 tors. eta vs tors. theta energy: -57.603 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 167 Temperature: 1.028571 Total energy: -709.532180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.532180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.532180 (E_RNA) where: Base-Base interactions energy: -464.196 where: short stacking energy: -238.368 Base-Backbone interact. energy: -1.427 local terms energy: -243.908860 where: bonds (distance) C4'-P energy: -40.577 bonds (distance) P-C4' energy: -51.851 flat angles C4'-P-C4' energy: -52.021 flat angles P-C4'-P energy: -40.071 tors. eta vs tors. theta energy: -59.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 167 Temperature: 1.092857 Total energy: -645.093010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.093010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.093010 (E_RNA) where: Base-Base interactions energy: -402.091 where: short stacking energy: -199.934 Base-Backbone interact. energy: -0.482 local terms energy: -242.520196 where: bonds (distance) C4'-P energy: -41.992 bonds (distance) P-C4' energy: -61.923 flat angles C4'-P-C4' energy: -62.261 flat angles P-C4'-P energy: -36.185 tors. eta vs tors. theta energy: -40.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 167 Temperature: 1.157143 Total energy: -441.201528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.201528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.201528 (E_RNA) where: Base-Base interactions energy: -263.071 where: short stacking energy: -142.529 Base-Backbone interact. energy: -0.561 local terms energy: -177.569302 where: bonds (distance) C4'-P energy: -55.014 bonds (distance) P-C4' energy: -41.285 flat angles C4'-P-C4' energy: -45.157 flat angles P-C4'-P energy: -25.475 tors. eta vs tors. theta energy: -10.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 167 Temperature: 1.221429 Total energy: -404.343133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.343133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.343133 (E_RNA) where: Base-Base interactions energy: -201.275 where: short stacking energy: -136.493 Base-Backbone interact. energy: 0.162 local terms energy: -203.230988 where: bonds (distance) C4'-P energy: -49.164 bonds (distance) P-C4' energy: -51.424 flat angles C4'-P-C4' energy: -39.641 flat angles P-C4'-P energy: -37.344 tors. eta vs tors. theta energy: -25.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 167 Temperature: 1.285714 Total energy: -253.539853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.539853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.539853 (E_RNA) where: Base-Base interactions energy: -95.003 where: short stacking energy: -74.211 Base-Backbone interact. energy: 0.691 local terms energy: -159.228344 where: bonds (distance) C4'-P energy: -52.288 bonds (distance) P-C4' energy: -50.334 flat angles C4'-P-C4' energy: -39.125 flat angles P-C4'-P energy: -27.586 tors. eta vs tors. theta energy: 10.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 167 Temperature: 1.350000 Total energy: -258.617426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.617426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.617426 (E_RNA) where: Base-Base interactions energy: -85.072 where: short stacking energy: -74.303 Base-Backbone interact. energy: 3.113 local terms energy: -176.657610 where: bonds (distance) C4'-P energy: -62.149 bonds (distance) P-C4' energy: -50.030 flat angles C4'-P-C4' energy: -40.844 flat angles P-C4'-P energy: -30.292 tors. eta vs tors. theta energy: 6.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 168 Temperature: 0.900000 Total energy: -886.100452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -886.100452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.100452 (E_RNA) where: Base-Base interactions energy: -624.950 where: short stacking energy: -253.369 Base-Backbone interact. energy: -1.736 local terms energy: -259.414307 where: bonds (distance) C4'-P energy: -44.310 bonds (distance) P-C4' energy: -60.413 flat angles C4'-P-C4' energy: -56.761 flat angles P-C4'-P energy: -46.819 tors. eta vs tors. theta energy: -51.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 168 Temperature: 0.964286 Total energy: -820.128144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.128144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.128144 (E_RNA) where: Base-Base interactions energy: -553.388 where: short stacking energy: -248.281 Base-Backbone interact. energy: -1.713 local terms energy: -265.027230 where: bonds (distance) C4'-P energy: -53.024 bonds (distance) P-C4' energy: -60.024 flat angles C4'-P-C4' energy: -58.185 flat angles P-C4'-P energy: -32.916 tors. eta vs tors. theta energy: -60.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 168 Temperature: 1.028571 Total energy: -705.425972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.425972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.425972 (E_RNA) where: Base-Base interactions energy: -466.906 where: short stacking energy: -223.213 Base-Backbone interact. energy: -2.041 local terms energy: -236.479017 where: bonds (distance) C4'-P energy: -45.408 bonds (distance) P-C4' energy: -52.515 flat angles C4'-P-C4' energy: -51.810 flat angles P-C4'-P energy: -37.503 tors. eta vs tors. theta energy: -49.243 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 168 Temperature: 1.092857 Total energy: -639.950591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -639.950591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.950591 (E_RNA) where: Base-Base interactions energy: -425.887 where: short stacking energy: -198.727 Base-Backbone interact. energy: 7.248 local terms energy: -221.311667 where: bonds (distance) C4'-P energy: -35.767 bonds (distance) P-C4' energy: -58.417 flat angles C4'-P-C4' energy: -58.586 flat angles P-C4'-P energy: -32.125 tors. eta vs tors. theta energy: -36.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 168 Temperature: 1.157143 Total energy: -452.763079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.763079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.763079 (E_RNA) where: Base-Base interactions energy: -255.678 where: short stacking energy: -136.453 Base-Backbone interact. energy: 0.172 local terms energy: -197.257360 where: bonds (distance) C4'-P energy: -47.958 bonds (distance) P-C4' energy: -59.048 flat angles C4'-P-C4' energy: -48.013 flat angles P-C4'-P energy: -31.063 tors. eta vs tors. theta energy: -11.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 168 Temperature: 1.221429 Total energy: -361.863336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.863336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.863336 (E_RNA) where: Base-Base interactions energy: -188.341 where: short stacking energy: -113.016 Base-Backbone interact. energy: 0.531 local terms energy: -174.053729 where: bonds (distance) C4'-P energy: -40.436 bonds (distance) P-C4' energy: -50.436 flat angles C4'-P-C4' energy: -52.138 flat angles P-C4'-P energy: -23.001 tors. eta vs tors. theta energy: -8.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 168 Temperature: 1.285714 Total energy: -267.421934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.421934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.421934 (E_RNA) where: Base-Base interactions energy: -102.652 where: short stacking energy: -78.678 Base-Backbone interact. energy: -0.805 local terms energy: -163.964791 where: bonds (distance) C4'-P energy: -48.817 bonds (distance) P-C4' energy: -62.064 flat angles C4'-P-C4' energy: -38.536 flat angles P-C4'-P energy: -20.121 tors. eta vs tors. theta energy: 5.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 168 Temperature: 1.350000 Total energy: -229.731264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.731264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.731264 (E_RNA) where: Base-Base interactions energy: -95.501 where: short stacking energy: -74.362 Base-Backbone interact. energy: -1.899 local terms energy: -132.331011 where: bonds (distance) C4'-P energy: -27.674 bonds (distance) P-C4' energy: -46.679 flat angles C4'-P-C4' energy: -37.022 flat angles P-C4'-P energy: -31.025 tors. eta vs tors. theta energy: 10.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 169 Temperature: 0.900000 Total energy: -881.907304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -881.907304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.907304 (E_RNA) where: Base-Base interactions energy: -624.979 where: short stacking energy: -263.005 Base-Backbone interact. energy: -1.465 local terms energy: -255.463006 where: bonds (distance) C4'-P energy: -57.753 bonds (distance) P-C4' energy: -52.325 flat angles C4'-P-C4' energy: -54.712 flat angles P-C4'-P energy: -37.178 tors. eta vs tors. theta energy: -53.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 169 Temperature: 0.964286 Total energy: -814.466998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.466998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.466998 (E_RNA) where: Base-Base interactions energy: -551.566 where: short stacking energy: -234.843 Base-Backbone interact. energy: -2.569 local terms energy: -260.331707 where: bonds (distance) C4'-P energy: -50.457 bonds (distance) P-C4' energy: -55.518 flat angles C4'-P-C4' energy: -60.517 flat angles P-C4'-P energy: -40.174 tors. eta vs tors. theta energy: -53.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 169 Temperature: 1.028571 Total energy: -733.699952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -733.699952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -733.699952 (E_RNA) where: Base-Base interactions energy: -471.518 where: short stacking energy: -240.588 Base-Backbone interact. energy: 0.284 local terms energy: -262.465866 where: bonds (distance) C4'-P energy: -55.229 bonds (distance) P-C4' energy: -58.551 flat angles C4'-P-C4' energy: -57.862 flat angles P-C4'-P energy: -37.830 tors. eta vs tors. theta energy: -52.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 169 Temperature: 1.092857 Total energy: -644.617677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.617677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.617677 (E_RNA) where: Base-Base interactions energy: -432.430 where: short stacking energy: -199.186 Base-Backbone interact. energy: -0.888 local terms energy: -211.299340 where: bonds (distance) C4'-P energy: -50.892 bonds (distance) P-C4' energy: -48.045 flat angles C4'-P-C4' energy: -58.307 flat angles P-C4'-P energy: -21.421 tors. eta vs tors. theta energy: -32.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 169 Temperature: 1.157143 Total energy: -427.967178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.967178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.967178 (E_RNA) where: Base-Base interactions energy: -248.505 where: short stacking energy: -147.152 Base-Backbone interact. energy: 0.704 local terms energy: -180.166352 where: bonds (distance) C4'-P energy: -49.528 bonds (distance) P-C4' energy: -45.076 flat angles C4'-P-C4' energy: -42.390 flat angles P-C4'-P energy: -29.967 tors. eta vs tors. theta energy: -13.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 169 Temperature: 1.221429 Total energy: -386.057535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.057535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.057535 (E_RNA) where: Base-Base interactions energy: -205.091 where: short stacking energy: -134.849 Base-Backbone interact. energy: 0.216 local terms energy: -181.183069 where: bonds (distance) C4'-P energy: -37.151 bonds (distance) P-C4' energy: -46.158 flat angles C4'-P-C4' energy: -50.448 flat angles P-C4'-P energy: -29.038 tors. eta vs tors. theta energy: -18.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 169 Temperature: 1.285714 Total energy: -246.972537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.972537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.972537 (E_RNA) where: Base-Base interactions energy: -80.600 where: short stacking energy: -68.314 Base-Backbone interact. energy: 5.998 local terms energy: -172.370938 where: bonds (distance) C4'-P energy: -53.541 bonds (distance) P-C4' energy: -59.541 flat angles C4'-P-C4' energy: -38.666 flat angles P-C4'-P energy: -26.735 tors. eta vs tors. theta energy: 6.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 169 Temperature: 1.350000 Total energy: -232.673568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.673568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.673568 (E_RNA) where: Base-Base interactions energy: -81.065 where: short stacking energy: -68.826 Base-Backbone interact. energy: 2.584 local terms energy: -154.192613 where: bonds (distance) C4'-P energy: -44.119 bonds (distance) P-C4' energy: -54.624 flat angles C4'-P-C4' energy: -34.238 flat angles P-C4'-P energy: -26.352 tors. eta vs tors. theta energy: 5.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 170 Temperature: 0.900000 Total energy: -890.665371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -890.665371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -890.665371 (E_RNA) where: Base-Base interactions energy: -630.797 where: short stacking energy: -265.774 Base-Backbone interact. energy: -2.309 local terms energy: -257.559815 where: bonds (distance) C4'-P energy: -52.940 bonds (distance) P-C4' energy: -50.584 flat angles C4'-P-C4' energy: -59.974 flat angles P-C4'-P energy: -38.789 tors. eta vs tors. theta energy: -55.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 170 Temperature: 0.964286 Total energy: -816.909857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -816.909857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -816.909857 (E_RNA) where: Base-Base interactions energy: -547.497 where: short stacking energy: -227.239 Base-Backbone interact. energy: -2.955 local terms energy: -266.458480 where: bonds (distance) C4'-P energy: -56.798 bonds (distance) P-C4' energy: -63.883 flat angles C4'-P-C4' energy: -53.570 flat angles P-C4'-P energy: -43.107 tors. eta vs tors. theta energy: -49.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 170 Temperature: 1.028571 Total energy: -721.325919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.325919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.325919 (E_RNA) where: Base-Base interactions energy: -469.678 where: short stacking energy: -228.016 Base-Backbone interact. energy: -0.378 local terms energy: -251.269920 where: bonds (distance) C4'-P energy: -47.434 bonds (distance) P-C4' energy: -57.166 flat angles C4'-P-C4' energy: -58.705 flat angles P-C4'-P energy: -28.764 tors. eta vs tors. theta energy: -59.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 170 Temperature: 1.092857 Total energy: -638.554230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.554230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.554230 (E_RNA) where: Base-Base interactions energy: -410.296 where: short stacking energy: -199.750 Base-Backbone interact. energy: 0.409 local terms energy: -228.667277 where: bonds (distance) C4'-P energy: -49.920 bonds (distance) P-C4' energy: -47.091 flat angles C4'-P-C4' energy: -53.644 flat angles P-C4'-P energy: -38.955 tors. eta vs tors. theta energy: -39.058 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 170 Temperature: 1.157143 Total energy: -421.093874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.093874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.093874 (E_RNA) where: Base-Base interactions energy: -238.986 where: short stacking energy: -138.637 Base-Backbone interact. energy: -0.847 local terms energy: -181.260864 where: bonds (distance) C4'-P energy: -51.317 bonds (distance) P-C4' energy: -45.399 flat angles C4'-P-C4' energy: -58.386 flat angles P-C4'-P energy: -19.034 tors. eta vs tors. theta energy: -7.125 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 170 Temperature: 1.221429 Total energy: -417.976317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.976317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.976317 (E_RNA) where: Base-Base interactions energy: -235.710 where: short stacking energy: -131.659 Base-Backbone interact. energy: 0.114 local terms energy: -182.379776 where: bonds (distance) C4'-P energy: -49.381 bonds (distance) P-C4' energy: -49.867 flat angles C4'-P-C4' energy: -46.537 flat angles P-C4'-P energy: -22.366 tors. eta vs tors. theta energy: -14.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 170 Temperature: 1.285714 Total energy: -277.608528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.608528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.608528 (E_RNA) where: Base-Base interactions energy: -101.050 where: short stacking energy: -76.099 Base-Backbone interact. energy: -0.090 local terms energy: -176.468484 where: bonds (distance) C4'-P energy: -45.148 bonds (distance) P-C4' energy: -60.943 flat angles C4'-P-C4' energy: -37.531 flat angles P-C4'-P energy: -34.880 tors. eta vs tors. theta energy: 2.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 170 Temperature: 1.350000 Total energy: -240.716927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.716927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.716927 (E_RNA) where: Base-Base interactions energy: -90.491 where: short stacking energy: -84.413 Base-Backbone interact. energy: -0.844 local terms energy: -149.382677 where: bonds (distance) C4'-P energy: -44.955 bonds (distance) P-C4' energy: -51.483 flat angles C4'-P-C4' energy: -37.828 flat angles P-C4'-P energy: -19.910 tors. eta vs tors. theta energy: 4.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 171 Temperature: 0.900000 Total energy: -889.009481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.009481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.009481 (E_RNA) where: Base-Base interactions energy: -619.576 where: short stacking energy: -272.449 Base-Backbone interact. energy: -1.441 local terms energy: -267.992599 where: bonds (distance) C4'-P energy: -59.570 bonds (distance) P-C4' energy: -53.941 flat angles C4'-P-C4' energy: -50.929 flat angles P-C4'-P energy: -44.971 tors. eta vs tors. theta energy: -58.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 171 Temperature: 0.964286 Total energy: -850.754318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.754318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -850.754318 (E_RNA) where: Base-Base interactions energy: -563.942 where: short stacking energy: -239.499 Base-Backbone interact. energy: -0.420 local terms energy: -286.392015 where: bonds (distance) C4'-P energy: -64.029 bonds (distance) P-C4' energy: -63.436 flat angles C4'-P-C4' energy: -55.541 flat angles P-C4'-P energy: -41.692 tors. eta vs tors. theta energy: -61.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 171 Temperature: 1.028571 Total energy: -724.318866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.318866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.318866 (E_RNA) where: Base-Base interactions energy: -463.413 where: short stacking energy: -232.353 Base-Backbone interact. energy: 0.550 local terms energy: -261.455505 where: bonds (distance) C4'-P energy: -61.809 bonds (distance) P-C4' energy: -53.272 flat angles C4'-P-C4' energy: -57.227 flat angles P-C4'-P energy: -31.075 tors. eta vs tors. theta energy: -58.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 171 Temperature: 1.092857 Total energy: -677.474802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.474802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.474802 (E_RNA) where: Base-Base interactions energy: -435.862 where: short stacking energy: -207.510 Base-Backbone interact. energy: -0.499 local terms energy: -241.113841 where: bonds (distance) C4'-P energy: -51.837 bonds (distance) P-C4' energy: -50.631 flat angles C4'-P-C4' energy: -59.640 flat angles P-C4'-P energy: -28.947 tors. eta vs tors. theta energy: -50.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 171 Temperature: 1.157143 Total energy: -459.036106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.036106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.036106 (E_RNA) where: Base-Base interactions energy: -269.462 where: short stacking energy: -150.418 Base-Backbone interact. energy: -0.469 local terms energy: -189.105239 where: bonds (distance) C4'-P energy: -49.094 bonds (distance) P-C4' energy: -55.318 flat angles C4'-P-C4' energy: -60.360 flat angles P-C4'-P energy: -19.308 tors. eta vs tors. theta energy: -5.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 171 Temperature: 1.221429 Total energy: -437.045442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.045442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.045442 (E_RNA) where: Base-Base interactions energy: -230.431 where: short stacking energy: -131.480 Base-Backbone interact. energy: 0.548 local terms energy: -207.162305 where: bonds (distance) C4'-P energy: -57.411 bonds (distance) P-C4' energy: -47.416 flat angles C4'-P-C4' energy: -44.897 flat angles P-C4'-P energy: -40.644 tors. eta vs tors. theta energy: -16.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 171 Temperature: 1.285714 Total energy: -273.817465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.817465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.817465 (E_RNA) where: Base-Base interactions energy: -127.662 where: short stacking energy: -100.292 Base-Backbone interact. energy: -0.836 local terms energy: -145.319649 where: bonds (distance) C4'-P energy: -36.335 bonds (distance) P-C4' energy: -59.225 flat angles C4'-P-C4' energy: -38.477 flat angles P-C4'-P energy: -17.396 tors. eta vs tors. theta energy: 6.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 171 Temperature: 1.350000 Total energy: -269.087529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.087529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.087529 (E_RNA) where: Base-Base interactions energy: -94.423 where: short stacking energy: -82.049 Base-Backbone interact. energy: 4.964 local terms energy: -179.628135 where: bonds (distance) C4'-P energy: -53.654 bonds (distance) P-C4' energy: -47.310 flat angles C4'-P-C4' energy: -49.320 flat angles P-C4'-P energy: -33.463 tors. eta vs tors. theta energy: 4.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 172 Temperature: 0.900000 Total energy: -871.984079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.984079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.984079 (E_RNA) where: Base-Base interactions energy: -586.590 where: short stacking energy: -251.793 Base-Backbone interact. energy: -2.184 local terms energy: -283.210969 where: bonds (distance) C4'-P energy: -57.326 bonds (distance) P-C4' energy: -60.555 flat angles C4'-P-C4' energy: -63.301 flat angles P-C4'-P energy: -38.856 tors. eta vs tors. theta energy: -63.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 172 Temperature: 0.964286 Total energy: -858.938370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.938370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -858.938370 (E_RNA) where: Base-Base interactions energy: -595.633 where: short stacking energy: -253.872 Base-Backbone interact. energy: -0.674 local terms energy: -262.631697 where: bonds (distance) C4'-P energy: -56.979 bonds (distance) P-C4' energy: -62.200 flat angles C4'-P-C4' energy: -44.497 flat angles P-C4'-P energy: -45.507 tors. eta vs tors. theta energy: -53.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 172 Temperature: 1.028571 Total energy: -703.271489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.271489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.271489 (E_RNA) where: Base-Base interactions energy: -454.256 where: short stacking energy: -207.234 Base-Backbone interact. energy: -3.328 local terms energy: -245.688087 where: bonds (distance) C4'-P energy: -54.376 bonds (distance) P-C4' energy: -51.575 flat angles C4'-P-C4' energy: -51.179 flat angles P-C4'-P energy: -38.087 tors. eta vs tors. theta energy: -50.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 172 Temperature: 1.092857 Total energy: -683.528744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.528744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.528744 (E_RNA) where: Base-Base interactions energy: -438.206 where: short stacking energy: -216.875 Base-Backbone interact. energy: -0.815 local terms energy: -244.507874 where: bonds (distance) C4'-P energy: -52.303 bonds (distance) P-C4' energy: -52.330 flat angles C4'-P-C4' energy: -59.447 flat angles P-C4'-P energy: -29.350 tors. eta vs tors. theta energy: -51.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 172 Temperature: 1.157143 Total energy: -454.670474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.670474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.670474 (E_RNA) where: Base-Base interactions energy: -271.616 where: short stacking energy: -139.403 Base-Backbone interact. energy: 3.224 local terms energy: -186.278302 where: bonds (distance) C4'-P energy: -40.656 bonds (distance) P-C4' energy: -49.340 flat angles C4'-P-C4' energy: -42.972 flat angles P-C4'-P energy: -35.087 tors. eta vs tors. theta energy: -18.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 172 Temperature: 1.221429 Total energy: -423.821543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.821543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.821543 (E_RNA) where: Base-Base interactions energy: -232.900 where: short stacking energy: -127.820 Base-Backbone interact. energy: -0.161 local terms energy: -190.760301 where: bonds (distance) C4'-P energy: -42.905 bonds (distance) P-C4' energy: -45.113 flat angles C4'-P-C4' energy: -49.297 flat angles P-C4'-P energy: -36.503 tors. eta vs tors. theta energy: -16.944 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 172 Temperature: 1.285714 Total energy: -240.091201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.091201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.091201 (E_RNA) where: Base-Base interactions energy: -80.288 where: short stacking energy: -73.948 Base-Backbone interact. energy: 0.279 local terms energy: -160.081834 where: bonds (distance) C4'-P energy: -51.554 bonds (distance) P-C4' energy: -55.474 flat angles C4'-P-C4' energy: -39.383 flat angles P-C4'-P energy: -24.800 tors. eta vs tors. theta energy: 11.129 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 172 Temperature: 1.350000 Total energy: -241.269884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.269884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.269884 (E_RNA) where: Base-Base interactions energy: -84.804 where: short stacking energy: -84.804 Base-Backbone interact. energy: 1.786 local terms energy: -158.251593 where: bonds (distance) C4'-P energy: -40.566 bonds (distance) P-C4' energy: -49.631 flat angles C4'-P-C4' energy: -44.627 flat angles P-C4'-P energy: -29.038 tors. eta vs tors. theta energy: 5.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 173 Temperature: 0.900000 Total energy: -844.164530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -844.164530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -844.164530 (E_RNA) where: Base-Base interactions energy: -571.096 where: short stacking energy: -239.522 Base-Backbone interact. energy: -1.107 local terms energy: -271.960852 where: bonds (distance) C4'-P energy: -55.936 bonds (distance) P-C4' energy: -58.913 flat angles C4'-P-C4' energy: -61.730 flat angles P-C4'-P energy: -42.246 tors. eta vs tors. theta energy: -53.136 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 173 Temperature: 0.964286 Total energy: -848.219889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.219889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -848.219889 (E_RNA) where: Base-Base interactions energy: -585.571 where: short stacking energy: -244.472 Base-Backbone interact. energy: 3.664 local terms energy: -266.312956 where: bonds (distance) C4'-P energy: -50.084 bonds (distance) P-C4' energy: -62.314 flat angles C4'-P-C4' energy: -59.154 flat angles P-C4'-P energy: -38.695 tors. eta vs tors. theta energy: -56.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 173 Temperature: 1.028571 Total energy: -697.289394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.289394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.289394 (E_RNA) where: Base-Base interactions energy: -453.061 where: short stacking energy: -224.993 Base-Backbone interact. energy: -1.889 local terms energy: -242.339306 where: bonds (distance) C4'-P energy: -42.205 bonds (distance) P-C4' energy: -59.433 flat angles C4'-P-C4' energy: -49.733 flat angles P-C4'-P energy: -34.839 tors. eta vs tors. theta energy: -56.129 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 173 Temperature: 1.092857 Total energy: -710.798845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -710.798845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.798845 (E_RNA) where: Base-Base interactions energy: -444.153 where: short stacking energy: -212.518 Base-Backbone interact. energy: -0.768 local terms energy: -265.877637 where: bonds (distance) C4'-P energy: -57.530 bonds (distance) P-C4' energy: -61.409 flat angles C4'-P-C4' energy: -57.327 flat angles P-C4'-P energy: -37.390 tors. eta vs tors. theta energy: -52.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 173 Temperature: 1.157143 Total energy: -444.718308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.718308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.718308 (E_RNA) where: Base-Base interactions energy: -257.633 where: short stacking energy: -129.899 Base-Backbone interact. energy: 0.397 local terms energy: -187.482103 where: bonds (distance) C4'-P energy: -55.461 bonds (distance) P-C4' energy: -53.243 flat angles C4'-P-C4' energy: -44.771 flat angles P-C4'-P energy: -30.503 tors. eta vs tors. theta energy: -3.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 173 Temperature: 1.221429 Total energy: -426.316722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.316722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.316722 (E_RNA) where: Base-Base interactions energy: -242.054 where: short stacking energy: -134.738 Base-Backbone interact. energy: -1.567 local terms energy: -182.695840 where: bonds (distance) C4'-P energy: -44.995 bonds (distance) P-C4' energy: -52.949 flat angles C4'-P-C4' energy: -36.720 flat angles P-C4'-P energy: -29.952 tors. eta vs tors. theta energy: -18.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 173 Temperature: 1.285714 Total energy: -270.431776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.431776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.431776 (E_RNA) where: Base-Base interactions energy: -87.122 where: short stacking energy: -83.719 Base-Backbone interact. energy: 1.320 local terms energy: -184.629814 where: bonds (distance) C4'-P energy: -41.011 bonds (distance) P-C4' energy: -62.707 flat angles C4'-P-C4' energy: -47.174 flat angles P-C4'-P energy: -36.197 tors. eta vs tors. theta energy: 2.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 173 Temperature: 1.350000 Total energy: -219.891913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.891913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.891913 (E_RNA) where: Base-Base interactions energy: -87.807 where: short stacking energy: -76.694 Base-Backbone interact. energy: 3.122 local terms energy: -135.207161 where: bonds (distance) C4'-P energy: -45.729 bonds (distance) P-C4' energy: -50.254 flat angles C4'-P-C4' energy: -35.973 flat angles P-C4'-P energy: -9.975 tors. eta vs tors. theta energy: 6.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 174 Temperature: 0.900000 Total energy: -872.262696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.262696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.262696 (E_RNA) where: Base-Base interactions energy: -596.338 where: short stacking energy: -260.687 Base-Backbone interact. energy: -2.104 local terms energy: -273.820121 where: bonds (distance) C4'-P energy: -52.868 bonds (distance) P-C4' energy: -57.319 flat angles C4'-P-C4' energy: -52.634 flat angles P-C4'-P energy: -44.108 tors. eta vs tors. theta energy: -66.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 174 Temperature: 0.964286 Total energy: -832.949053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.949053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.949053 (E_RNA) where: Base-Base interactions energy: -587.027 where: short stacking energy: -244.968 Base-Backbone interact. energy: -1.439 local terms energy: -244.482495 where: bonds (distance) C4'-P energy: -47.085 bonds (distance) P-C4' energy: -47.740 flat angles C4'-P-C4' energy: -58.416 flat angles P-C4'-P energy: -46.007 tors. eta vs tors. theta energy: -45.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 174 Temperature: 1.028571 Total energy: -715.782474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.782474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.782474 (E_RNA) where: Base-Base interactions energy: -464.477 where: short stacking energy: -223.118 Base-Backbone interact. energy: -1.741 local terms energy: -249.564919 where: bonds (distance) C4'-P energy: -51.248 bonds (distance) P-C4' energy: -52.348 flat angles C4'-P-C4' energy: -58.819 flat angles P-C4'-P energy: -34.671 tors. eta vs tors. theta energy: -52.480 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 174 Temperature: 1.092857 Total energy: -664.333224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.333224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.333224 (E_RNA) where: Base-Base interactions energy: -433.950 where: short stacking energy: -217.534 Base-Backbone interact. energy: -0.883 local terms energy: -229.500116 where: bonds (distance) C4'-P energy: -47.887 bonds (distance) P-C4' energy: -54.773 flat angles C4'-P-C4' energy: -55.516 flat angles P-C4'-P energy: -27.648 tors. eta vs tors. theta energy: -43.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 174 Temperature: 1.157143 Total energy: -442.755348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.755348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.755348 (E_RNA) where: Base-Base interactions energy: -253.167 where: short stacking energy: -141.779 Base-Backbone interact. energy: 2.543 local terms energy: -192.131599 where: bonds (distance) C4'-P energy: -49.206 bonds (distance) P-C4' energy: -47.890 flat angles C4'-P-C4' energy: -42.125 flat angles P-C4'-P energy: -33.842 tors. eta vs tors. theta energy: -19.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 174 Temperature: 1.221429 Total energy: -402.056825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.056825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.056825 (E_RNA) where: Base-Base interactions energy: -226.404 where: short stacking energy: -133.275 Base-Backbone interact. energy: -1.472 local terms energy: -174.181179 where: bonds (distance) C4'-P energy: -35.905 bonds (distance) P-C4' energy: -54.722 flat angles C4'-P-C4' energy: -51.615 flat angles P-C4'-P energy: -20.887 tors. eta vs tors. theta energy: -11.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 174 Temperature: 1.285714 Total energy: -258.461933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.461933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.461933 (E_RNA) where: Base-Base interactions energy: -82.561 where: short stacking energy: -77.643 Base-Backbone interact. energy: -0.921 local terms energy: -174.980662 where: bonds (distance) C4'-P energy: -49.294 bonds (distance) P-C4' energy: -54.483 flat angles C4'-P-C4' energy: -39.821 flat angles P-C4'-P energy: -30.909 tors. eta vs tors. theta energy: -0.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 174 Temperature: 1.350000 Total energy: -227.822204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.822204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.822204 (E_RNA) where: Base-Base interactions energy: -70.174 where: short stacking energy: -57.455 Base-Backbone interact. energy: 0.465 local terms energy: -158.112288 where: bonds (distance) C4'-P energy: -45.416 bonds (distance) P-C4' energy: -48.408 flat angles C4'-P-C4' energy: -48.175 flat angles P-C4'-P energy: -24.079 tors. eta vs tors. theta energy: 7.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 175 Temperature: 0.900000 Total energy: -864.319903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -864.319903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -864.319903 (E_RNA) where: Base-Base interactions energy: -595.731 where: short stacking energy: -238.862 Base-Backbone interact. energy: -1.326 local terms energy: -267.263107 where: bonds (distance) C4'-P energy: -64.335 bonds (distance) P-C4' energy: -54.858 flat angles C4'-P-C4' energy: -56.437 flat angles P-C4'-P energy: -36.261 tors. eta vs tors. theta energy: -55.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 175 Temperature: 0.964286 Total energy: -823.929041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -823.929041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.929041 (E_RNA) where: Base-Base interactions energy: -572.249 where: short stacking energy: -242.922 Base-Backbone interact. energy: -1.311 local terms energy: -250.369162 where: bonds (distance) C4'-P energy: -54.910 bonds (distance) P-C4' energy: -52.006 flat angles C4'-P-C4' energy: -58.812 flat angles P-C4'-P energy: -38.030 tors. eta vs tors. theta energy: -46.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 175 Temperature: 1.028571 Total energy: -699.261747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.261747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.261747 (E_RNA) where: Base-Base interactions energy: -454.391 where: short stacking energy: -213.537 Base-Backbone interact. energy: 0.147 local terms energy: -245.018085 where: bonds (distance) C4'-P energy: -51.249 bonds (distance) P-C4' energy: -57.237 flat angles C4'-P-C4' energy: -58.200 flat angles P-C4'-P energy: -32.386 tors. eta vs tors. theta energy: -45.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 175 Temperature: 1.092857 Total energy: -686.453143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.453143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.453143 (E_RNA) where: Base-Base interactions energy: -453.237 where: short stacking energy: -224.902 Base-Backbone interact. energy: 2.845 local terms energy: -236.061207 where: bonds (distance) C4'-P energy: -44.182 bonds (distance) P-C4' energy: -54.273 flat angles C4'-P-C4' energy: -60.288 flat angles P-C4'-P energy: -27.921 tors. eta vs tors. theta energy: -49.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 175 Temperature: 1.157143 Total energy: -443.526766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.526766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.526766 (E_RNA) where: Base-Base interactions energy: -237.015 where: short stacking energy: -139.489 Base-Backbone interact. energy: -1.171 local terms energy: -205.340339 where: bonds (distance) C4'-P energy: -54.474 bonds (distance) P-C4' energy: -53.262 flat angles C4'-P-C4' energy: -54.595 flat angles P-C4'-P energy: -25.287 tors. eta vs tors. theta energy: -17.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 175 Temperature: 1.221429 Total energy: -423.921313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.921313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.921313 (E_RNA) where: Base-Base interactions energy: -243.437 where: short stacking energy: -127.013 Base-Backbone interact. energy: 1.054 local terms energy: -181.538884 where: bonds (distance) C4'-P energy: -48.544 bonds (distance) P-C4' energy: -57.305 flat angles C4'-P-C4' energy: -46.790 flat angles P-C4'-P energy: -23.251 tors. eta vs tors. theta energy: -5.649 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 175 Temperature: 1.285714 Total energy: -266.970534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.970534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.970534 (E_RNA) where: Base-Base interactions energy: -103.337 where: short stacking energy: -81.558 Base-Backbone interact. energy: -0.589 local terms energy: -163.044381 where: bonds (distance) C4'-P energy: -52.247 bonds (distance) P-C4' energy: -60.371 flat angles C4'-P-C4' energy: -44.292 flat angles P-C4'-P energy: -16.785 tors. eta vs tors. theta energy: 10.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 175 Temperature: 1.350000 Total energy: -209.095441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.095441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.095441 (E_RNA) where: Base-Base interactions energy: -62.270 where: short stacking energy: -51.894 Base-Backbone interact. energy: 0.725 local terms energy: -147.549969 where: bonds (distance) C4'-P energy: -44.109 bonds (distance) P-C4' energy: -52.145 flat angles C4'-P-C4' energy: -44.519 flat angles P-C4'-P energy: -28.170 tors. eta vs tors. theta energy: 21.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 176 Temperature: 0.900000 Total energy: -872.441531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.441531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.441531 (E_RNA) where: Base-Base interactions energy: -594.698 where: short stacking energy: -248.122 Base-Backbone interact. energy: -2.810 local terms energy: -274.933866 where: bonds (distance) C4'-P energy: -58.237 bonds (distance) P-C4' energy: -65.098 flat angles C4'-P-C4' energy: -53.967 flat angles P-C4'-P energy: -38.052 tors. eta vs tors. theta energy: -59.580 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 176 Temperature: 0.964286 Total energy: -819.806469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.806469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.806469 (E_RNA) where: Base-Base interactions energy: -583.919 where: short stacking energy: -261.659 Base-Backbone interact. energy: -0.968 local terms energy: -234.919352 where: bonds (distance) C4'-P energy: -50.721 bonds (distance) P-C4' energy: -57.583 flat angles C4'-P-C4' energy: -46.805 flat angles P-C4'-P energy: -33.921 tors. eta vs tors. theta energy: -45.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 176 Temperature: 1.028571 Total energy: -690.716106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.716106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.716106 (E_RNA) where: Base-Base interactions energy: -453.675 where: short stacking energy: -222.411 Base-Backbone interact. energy: -0.866 local terms energy: -236.175454 where: bonds (distance) C4'-P energy: -52.295 bonds (distance) P-C4' energy: -45.176 flat angles C4'-P-C4' energy: -56.643 flat angles P-C4'-P energy: -31.901 tors. eta vs tors. theta energy: -50.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 176 Temperature: 1.092857 Total energy: -674.016793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.016793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.016793 (E_RNA) where: Base-Base interactions energy: -442.991 where: short stacking energy: -211.327 Base-Backbone interact. energy: -1.013 local terms energy: -230.013117 where: bonds (distance) C4'-P energy: -41.365 bonds (distance) P-C4' energy: -55.168 flat angles C4'-P-C4' energy: -48.601 flat angles P-C4'-P energy: -31.861 tors. eta vs tors. theta energy: -53.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 176 Temperature: 1.157143 Total energy: -399.839611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.839611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.839611 (E_RNA) where: Base-Base interactions energy: -213.678 where: short stacking energy: -104.425 Base-Backbone interact. energy: -0.729 local terms energy: -185.432731 where: bonds (distance) C4'-P energy: -54.813 bonds (distance) P-C4' energy: -55.292 flat angles C4'-P-C4' energy: -45.378 flat angles P-C4'-P energy: -25.502 tors. eta vs tors. theta energy: -4.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 176 Temperature: 1.221429 Total energy: -432.190093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.190093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.190093 (E_RNA) where: Base-Base interactions energy: -257.261 where: short stacking energy: -153.911 Base-Backbone interact. energy: -2.697 local terms energy: -172.231817 where: bonds (distance) C4'-P energy: -40.009 bonds (distance) P-C4' energy: -37.392 flat angles C4'-P-C4' energy: -40.651 flat angles P-C4'-P energy: -30.107 tors. eta vs tors. theta energy: -24.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 176 Temperature: 1.285714 Total energy: -254.389747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.389747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.389747 (E_RNA) where: Base-Base interactions energy: -93.765 where: short stacking energy: -69.922 Base-Backbone interact. energy: -0.308 local terms energy: -162.223710 where: bonds (distance) C4'-P energy: -43.246 bonds (distance) P-C4' energy: -49.207 flat angles C4'-P-C4' energy: -47.713 flat angles P-C4'-P energy: -28.918 tors. eta vs tors. theta energy: 6.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.906 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 176 Temperature: 1.350000 Total energy: -234.060694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.060694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.060694 (E_RNA) where: Base-Base interactions energy: -81.798 where: short stacking energy: -77.702 Base-Backbone interact. energy: 1.781 local terms energy: -154.043982 where: bonds (distance) C4'-P energy: -42.394 bonds (distance) P-C4' energy: -42.761 flat angles C4'-P-C4' energy: -37.547 flat angles P-C4'-P energy: -31.300 tors. eta vs tors. theta energy: -0.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 177 Temperature: 0.900000 Total energy: -879.161736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.161736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.161736 (E_RNA) where: Base-Base interactions energy: -598.381 where: short stacking energy: -264.834 Base-Backbone interact. energy: -1.460 local terms energy: -279.320525 where: bonds (distance) C4'-P energy: -59.579 bonds (distance) P-C4' energy: -61.225 flat angles C4'-P-C4' energy: -60.277 flat angles P-C4'-P energy: -39.366 tors. eta vs tors. theta energy: -58.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 177 Temperature: 0.964286 Total energy: -828.476751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -828.476751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -828.476751 (E_RNA) where: Base-Base interactions energy: -584.575 where: short stacking energy: -248.483 Base-Backbone interact. energy: 1.091 local terms energy: -244.992789 where: bonds (distance) C4'-P energy: -54.420 bonds (distance) P-C4' energy: -58.463 flat angles C4'-P-C4' energy: -54.323 flat angles P-C4'-P energy: -33.797 tors. eta vs tors. theta energy: -43.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 177 Temperature: 1.028571 Total energy: -721.823345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.823345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.823345 (E_RNA) where: Base-Base interactions energy: -472.381 where: short stacking energy: -238.552 Base-Backbone interact. energy: 0.989 local terms energy: -250.432074 where: bonds (distance) C4'-P energy: -51.703 bonds (distance) P-C4' energy: -53.305 flat angles C4'-P-C4' energy: -58.271 flat angles P-C4'-P energy: -32.720 tors. eta vs tors. theta energy: -54.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 177 Temperature: 1.092857 Total energy: -703.566901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.566901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.566901 (E_RNA) where: Base-Base interactions energy: -458.381 where: short stacking energy: -230.534 Base-Backbone interact. energy: -1.230 local terms energy: -243.956314 where: bonds (distance) C4'-P energy: -52.245 bonds (distance) P-C4' energy: -55.268 flat angles C4'-P-C4' energy: -49.832 flat angles P-C4'-P energy: -30.356 tors. eta vs tors. theta energy: -56.255 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 177 Temperature: 1.157143 Total energy: -419.156616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.156616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.156616 (E_RNA) where: Base-Base interactions energy: -218.369 where: short stacking energy: -124.165 Base-Backbone interact. energy: 0.240 local terms energy: -201.028094 where: bonds (distance) C4'-P energy: -56.469 bonds (distance) P-C4' energy: -63.405 flat angles C4'-P-C4' energy: -45.831 flat angles P-C4'-P energy: -32.575 tors. eta vs tors. theta energy: -2.747 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 177 Temperature: 1.221429 Total energy: -462.351155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.351155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.351155 (E_RNA) where: Base-Base interactions energy: -262.435 where: short stacking energy: -161.664 Base-Backbone interact. energy: 5.392 local terms energy: -205.308238 where: bonds (distance) C4'-P energy: -43.830 bonds (distance) P-C4' energy: -49.170 flat angles C4'-P-C4' energy: -56.203 flat angles P-C4'-P energy: -32.683 tors. eta vs tors. theta energy: -23.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 177 Temperature: 1.285714 Total energy: -266.845775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.845775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.845775 (E_RNA) where: Base-Base interactions energy: -115.206 where: short stacking energy: -78.281 Base-Backbone interact. energy: -0.566 local terms energy: -151.073693 where: bonds (distance) C4'-P energy: -45.378 bonds (distance) P-C4' energy: -57.837 flat angles C4'-P-C4' energy: -22.195 flat angles P-C4'-P energy: -30.110 tors. eta vs tors. theta energy: 4.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 177 Temperature: 1.350000 Total energy: -217.776576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.776576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.776576 (E_RNA) where: Base-Base interactions energy: -79.027 where: short stacking energy: -67.821 Base-Backbone interact. energy: -1.969 local terms energy: -136.780221 where: bonds (distance) C4'-P energy: -42.386 bonds (distance) P-C4' energy: -56.166 flat angles C4'-P-C4' energy: -36.598 flat angles P-C4'-P energy: -9.907 tors. eta vs tors. theta energy: 8.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 178 Temperature: 0.900000 Total energy: -875.814456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.814456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -875.814456 (E_RNA) where: Base-Base interactions energy: -595.994 where: short stacking energy: -241.237 Base-Backbone interact. energy: -2.086 local terms energy: -277.734962 where: bonds (distance) C4'-P energy: -57.396 bonds (distance) P-C4' energy: -59.720 flat angles C4'-P-C4' energy: -52.119 flat angles P-C4'-P energy: -46.261 tors. eta vs tors. theta energy: -62.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 178 Temperature: 0.964286 Total energy: -841.273154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.273154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.273154 (E_RNA) where: Base-Base interactions energy: -593.693 where: short stacking energy: -243.517 Base-Backbone interact. energy: -1.338 local terms energy: -246.242354 where: bonds (distance) C4'-P energy: -43.338 bonds (distance) P-C4' energy: -57.038 flat angles C4'-P-C4' energy: -55.916 flat angles P-C4'-P energy: -39.569 tors. eta vs tors. theta energy: -50.380 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 178 Temperature: 1.028571 Total energy: -723.497248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -723.497248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.497248 (E_RNA) where: Base-Base interactions energy: -458.739 where: short stacking energy: -224.491 Base-Backbone interact. energy: -0.549 local terms energy: -264.209205 where: bonds (distance) C4'-P energy: -54.460 bonds (distance) P-C4' energy: -56.761 flat angles C4'-P-C4' energy: -56.532 flat angles P-C4'-P energy: -38.624 tors. eta vs tors. theta energy: -57.832 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 178 Temperature: 1.092857 Total energy: -693.213357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.213357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.213357 (E_RNA) where: Base-Base interactions energy: -456.250 where: short stacking energy: -227.020 Base-Backbone interact. energy: -0.776 local terms energy: -236.187260 where: bonds (distance) C4'-P energy: -49.712 bonds (distance) P-C4' energy: -48.251 flat angles C4'-P-C4' energy: -49.286 flat angles P-C4'-P energy: -39.285 tors. eta vs tors. theta energy: -49.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 178 Temperature: 1.157143 Total energy: -417.741700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.741700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.741700 (E_RNA) where: Base-Base interactions energy: -232.328 where: short stacking energy: -140.598 Base-Backbone interact. energy: -0.514 local terms energy: -184.900101 where: bonds (distance) C4'-P energy: -47.000 bonds (distance) P-C4' energy: -51.132 flat angles C4'-P-C4' energy: -44.855 flat angles P-C4'-P energy: -15.346 tors. eta vs tors. theta energy: -26.567 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 178 Temperature: 1.221429 Total energy: -388.225411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.225411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.225411 (E_RNA) where: Base-Base interactions energy: -210.962 where: short stacking energy: -102.680 Base-Backbone interact. energy: -1.488 local terms energy: -175.775198 where: bonds (distance) C4'-P energy: -56.063 bonds (distance) P-C4' energy: -47.594 flat angles C4'-P-C4' energy: -46.787 flat angles P-C4'-P energy: -26.267 tors. eta vs tors. theta energy: 0.936 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 178 Temperature: 1.285714 Total energy: -259.193986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.193986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.193986 (E_RNA) where: Base-Base interactions energy: -89.222 where: short stacking energy: -73.262 Base-Backbone interact. energy: -0.348 local terms energy: -169.624528 where: bonds (distance) C4'-P energy: -53.231 bonds (distance) P-C4' energy: -48.385 flat angles C4'-P-C4' energy: -39.670 flat angles P-C4'-P energy: -28.020 tors. eta vs tors. theta energy: -0.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 178 Temperature: 1.350000 Total energy: -228.434085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.434085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.434085 (E_RNA) where: Base-Base interactions energy: -79.243 where: short stacking energy: -77.669 Base-Backbone interact. energy: 1.540 local terms energy: -150.731902 where: bonds (distance) C4'-P energy: -57.607 bonds (distance) P-C4' energy: -37.936 flat angles C4'-P-C4' energy: -33.186 flat angles P-C4'-P energy: -26.056 tors. eta vs tors. theta energy: 4.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 179 Temperature: 0.900000 Total energy: -884.565737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.565737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -884.565737 (E_RNA) where: Base-Base interactions energy: -613.288 where: short stacking energy: -260.961 Base-Backbone interact. energy: -1.575 local terms energy: -269.703452 where: bonds (distance) C4'-P energy: -49.684 bonds (distance) P-C4' energy: -64.472 flat angles C4'-P-C4' energy: -51.136 flat angles P-C4'-P energy: -42.117 tors. eta vs tors. theta energy: -62.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 179 Temperature: 0.964286 Total energy: -875.921634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.921634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -875.921634 (E_RNA) where: Base-Base interactions energy: -614.157 where: short stacking energy: -263.678 Base-Backbone interact. energy: 0.051 local terms energy: -261.815983 where: bonds (distance) C4'-P energy: -63.296 bonds (distance) P-C4' energy: -52.304 flat angles C4'-P-C4' energy: -52.236 flat angles P-C4'-P energy: -39.882 tors. eta vs tors. theta energy: -54.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 179 Temperature: 1.028571 Total energy: -739.232175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -739.232175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.232175 (E_RNA) where: Base-Base interactions energy: -476.049 where: short stacking energy: -226.153 Base-Backbone interact. energy: -0.632 local terms energy: -262.551772 where: bonds (distance) C4'-P energy: -54.748 bonds (distance) P-C4' energy: -51.534 flat angles C4'-P-C4' energy: -61.513 flat angles P-C4'-P energy: -42.389 tors. eta vs tors. theta energy: -52.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 179 Temperature: 1.092857 Total energy: -675.014661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.014661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.014661 (E_RNA) where: Base-Base interactions energy: -434.601 where: short stacking energy: -221.836 Base-Backbone interact. energy: 0.354 local terms energy: -240.767788 where: bonds (distance) C4'-P energy: -51.215 bonds (distance) P-C4' energy: -59.161 flat angles C4'-P-C4' energy: -54.105 flat angles P-C4'-P energy: -30.032 tors. eta vs tors. theta energy: -46.255 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 179 Temperature: 1.157143 Total energy: -455.593351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.593351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.593351 (E_RNA) where: Base-Base interactions energy: -255.376 where: short stacking energy: -123.100 Base-Backbone interact. energy: -0.297 local terms energy: -199.920730 where: bonds (distance) C4'-P energy: -57.289 bonds (distance) P-C4' energy: -58.834 flat angles C4'-P-C4' energy: -33.747 flat angles P-C4'-P energy: -32.806 tors. eta vs tors. theta energy: -17.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 179 Temperature: 1.221429 Total energy: -380.422571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.422571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.422571 (E_RNA) where: Base-Base interactions energy: -188.602 where: short stacking energy: -103.269 Base-Backbone interact. energy: -0.953 local terms energy: -190.867910 where: bonds (distance) C4'-P energy: -53.732 bonds (distance) P-C4' energy: -57.161 flat angles C4'-P-C4' energy: -49.526 flat angles P-C4'-P energy: -31.049 tors. eta vs tors. theta energy: 0.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 179 Temperature: 1.285714 Total energy: -273.933670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.933670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.933670 (E_RNA) where: Base-Base interactions energy: -127.619 where: short stacking energy: -72.565 Base-Backbone interact. energy: -0.874 local terms energy: -145.440864 where: bonds (distance) C4'-P energy: -45.679 bonds (distance) P-C4' energy: -44.329 flat angles C4'-P-C4' energy: -41.241 flat angles P-C4'-P energy: -22.610 tors. eta vs tors. theta energy: 8.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 179 Temperature: 1.350000 Total energy: -231.499909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.499909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.499909 (E_RNA) where: Base-Base interactions energy: -89.881 where: short stacking energy: -77.943 Base-Backbone interact. energy: 7.238 local terms energy: -148.856230 where: bonds (distance) C4'-P energy: -42.495 bonds (distance) P-C4' energy: -44.330 flat angles C4'-P-C4' energy: -40.032 flat angles P-C4'-P energy: -33.537 tors. eta vs tors. theta energy: 11.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 180 Temperature: 0.900000 Total energy: -880.981991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.981991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -880.981991 (E_RNA) where: Base-Base interactions energy: -611.906 where: short stacking energy: -269.502 Base-Backbone interact. energy: -3.313 local terms energy: -265.763230 where: bonds (distance) C4'-P energy: -53.539 bonds (distance) P-C4' energy: -62.359 flat angles C4'-P-C4' energy: -52.071 flat angles P-C4'-P energy: -36.966 tors. eta vs tors. theta energy: -60.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 180 Temperature: 0.964286 Total energy: -863.397952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -863.397952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -863.397952 (E_RNA) where: Base-Base interactions energy: -607.505 where: short stacking energy: -259.990 Base-Backbone interact. energy: -2.355 local terms energy: -253.537813 where: bonds (distance) C4'-P energy: -55.090 bonds (distance) P-C4' energy: -55.810 flat angles C4'-P-C4' energy: -56.100 flat angles P-C4'-P energy: -37.778 tors. eta vs tors. theta energy: -48.761 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 180 Temperature: 1.028571 Total energy: -752.941678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.941678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.941678 (E_RNA) where: Base-Base interactions energy: -498.814 where: short stacking energy: -245.788 Base-Backbone interact. energy: 0.411 local terms energy: -254.538666 where: bonds (distance) C4'-P energy: -53.035 bonds (distance) P-C4' energy: -53.969 flat angles C4'-P-C4' energy: -54.650 flat angles P-C4'-P energy: -36.860 tors. eta vs tors. theta energy: -56.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 180 Temperature: 1.092857 Total energy: -660.847033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.847033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -660.847033 (E_RNA) where: Base-Base interactions energy: -415.699 where: short stacking energy: -208.765 Base-Backbone interact. energy: -0.900 local terms energy: -244.248062 where: bonds (distance) C4'-P energy: -41.298 bonds (distance) P-C4' energy: -59.275 flat angles C4'-P-C4' energy: -53.440 flat angles P-C4'-P energy: -42.065 tors. eta vs tors. theta energy: -48.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 180 Temperature: 1.157143 Total energy: -468.354788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.354788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.354788 (E_RNA) where: Base-Base interactions energy: -283.726 where: short stacking energy: -144.012 Base-Backbone interact. energy: 0.884 local terms energy: -185.512359 where: bonds (distance) C4'-P energy: -48.656 bonds (distance) P-C4' energy: -57.324 flat angles C4'-P-C4' energy: -40.286 flat angles P-C4'-P energy: -19.708 tors. eta vs tors. theta energy: -19.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 180 Temperature: 1.221429 Total energy: -366.614806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.614806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.614806 (E_RNA) where: Base-Base interactions energy: -189.159 where: short stacking energy: -112.306 Base-Backbone interact. energy: 1.089 local terms energy: -178.545173 where: bonds (distance) C4'-P energy: -44.483 bonds (distance) P-C4' energy: -54.897 flat angles C4'-P-C4' energy: -51.045 flat angles P-C4'-P energy: -30.591 tors. eta vs tors. theta energy: 2.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 180 Temperature: 1.285714 Total energy: -283.924431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.924431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.924431 (E_RNA) where: Base-Base interactions energy: -123.173 where: short stacking energy: -74.459 Base-Backbone interact. energy: -0.429 local terms energy: -160.323030 where: bonds (distance) C4'-P energy: -51.294 bonds (distance) P-C4' energy: -46.896 flat angles C4'-P-C4' energy: -43.183 flat angles P-C4'-P energy: -28.694 tors. eta vs tors. theta energy: 9.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 180 Temperature: 1.350000 Total energy: -226.536339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.536339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.536339 (E_RNA) where: Base-Base interactions energy: -70.412 where: short stacking energy: -66.541 Base-Backbone interact. energy: -0.045 local terms energy: -156.079773 where: bonds (distance) C4'-P energy: -42.439 bonds (distance) P-C4' energy: -54.325 flat angles C4'-P-C4' energy: -47.297 flat angles P-C4'-P energy: -21.028 tors. eta vs tors. theta energy: 9.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 181 Temperature: 0.900000 Total energy: -882.544975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -882.544975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.544975 (E_RNA) where: Base-Base interactions energy: -609.152 where: short stacking energy: -260.759 Base-Backbone interact. energy: -1.327 local terms energy: -272.066456 where: bonds (distance) C4'-P energy: -54.682 bonds (distance) P-C4' energy: -61.229 flat angles C4'-P-C4' energy: -59.934 flat angles P-C4'-P energy: -36.228 tors. eta vs tors. theta energy: -59.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 181 Temperature: 0.964286 Total energy: -836.464518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.464518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.464518 (E_RNA) where: Base-Base interactions energy: -594.760 where: short stacking energy: -247.319 Base-Backbone interact. energy: 1.423 local terms energy: -243.127427 where: bonds (distance) C4'-P energy: -48.848 bonds (distance) P-C4' energy: -48.534 flat angles C4'-P-C4' energy: -56.532 flat angles P-C4'-P energy: -41.128 tors. eta vs tors. theta energy: -48.085 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 181 Temperature: 1.028571 Total energy: -728.109855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.109855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.109855 (E_RNA) where: Base-Base interactions energy: -489.614 where: short stacking energy: -223.512 Base-Backbone interact. energy: -0.863 local terms energy: -237.632924 where: bonds (distance) C4'-P energy: -49.462 bonds (distance) P-C4' energy: -54.534 flat angles C4'-P-C4' energy: -49.494 flat angles P-C4'-P energy: -30.819 tors. eta vs tors. theta energy: -53.324 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 181 Temperature: 1.092857 Total energy: -686.415434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.415434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.415434 (E_RNA) where: Base-Base interactions energy: -447.158 where: short stacking energy: -237.101 Base-Backbone interact. energy: 1.359 local terms energy: -240.616115 where: bonds (distance) C4'-P energy: -51.078 bonds (distance) P-C4' energy: -45.828 flat angles C4'-P-C4' energy: -59.191 flat angles P-C4'-P energy: -31.933 tors. eta vs tors. theta energy: -52.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 181 Temperature: 1.157143 Total energy: -511.950200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.950200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.950200 (E_RNA) where: Base-Base interactions energy: -297.999 where: short stacking energy: -163.925 Base-Backbone interact. energy: -0.882 local terms energy: -213.068962 where: bonds (distance) C4'-P energy: -47.779 bonds (distance) P-C4' energy: -62.582 flat angles C4'-P-C4' energy: -44.961 flat angles P-C4'-P energy: -22.819 tors. eta vs tors. theta energy: -34.928 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 181 Temperature: 1.221429 Total energy: -364.310698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.310698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.310698 (E_RNA) where: Base-Base interactions energy: -207.185 where: short stacking energy: -109.783 Base-Backbone interact. energy: 1.101 local terms energy: -158.226888 where: bonds (distance) C4'-P energy: -37.143 bonds (distance) P-C4' energy: -49.190 flat angles C4'-P-C4' energy: -39.217 flat angles P-C4'-P energy: -36.544 tors. eta vs tors. theta energy: 3.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 181 Temperature: 1.285714 Total energy: -237.630700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.630700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.630700 (E_RNA) where: Base-Base interactions energy: -95.415 where: short stacking energy: -73.019 Base-Backbone interact. energy: 1.796 local terms energy: -144.012150 where: bonds (distance) C4'-P energy: -40.381 bonds (distance) P-C4' energy: -54.175 flat angles C4'-P-C4' energy: -38.939 flat angles P-C4'-P energy: -30.168 tors. eta vs tors. theta energy: 19.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 181 Temperature: 1.350000 Total energy: -224.341894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.341894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.341894 (E_RNA) where: Base-Base interactions energy: -78.071 where: short stacking energy: -73.650 Base-Backbone interact. energy: -1.206 local terms energy: -145.065812 where: bonds (distance) C4'-P energy: -50.731 bonds (distance) P-C4' energy: -51.924 flat angles C4'-P-C4' energy: -28.717 flat angles P-C4'-P energy: -25.659 tors. eta vs tors. theta energy: 11.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 182 Temperature: 0.900000 Total energy: -869.209330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.209330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -869.209330 (E_RNA) where: Base-Base interactions energy: -595.044 where: short stacking energy: -256.717 Base-Backbone interact. energy: -1.083 local terms energy: -273.082486 where: bonds (distance) C4'-P energy: -49.652 bonds (distance) P-C4' energy: -60.528 flat angles C4'-P-C4' energy: -57.898 flat angles P-C4'-P energy: -46.452 tors. eta vs tors. theta energy: -58.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 182 Temperature: 0.964286 Total energy: -827.052711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.052711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -827.052711 (E_RNA) where: Base-Base interactions energy: -579.186 where: short stacking energy: -237.641 Base-Backbone interact. energy: -1.904 local terms energy: -245.962985 where: bonds (distance) C4'-P energy: -44.815 bonds (distance) P-C4' energy: -59.751 flat angles C4'-P-C4' energy: -49.489 flat angles P-C4'-P energy: -45.409 tors. eta vs tors. theta energy: -46.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 182 Temperature: 1.028571 Total energy: -709.790641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.790641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.790641 (E_RNA) where: Base-Base interactions energy: -464.913 where: short stacking energy: -245.060 Base-Backbone interact. energy: 0.134 local terms energy: -245.012323 where: bonds (distance) C4'-P energy: -45.611 bonds (distance) P-C4' energy: -51.007 flat angles C4'-P-C4' energy: -49.770 flat angles P-C4'-P energy: -32.734 tors. eta vs tors. theta energy: -65.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 182 Temperature: 1.092857 Total energy: -701.457594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.457594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.457594 (E_RNA) where: Base-Base interactions energy: -462.733 where: short stacking energy: -211.322 Base-Backbone interact. energy: -0.317 local terms energy: -238.407985 where: bonds (distance) C4'-P energy: -58.510 bonds (distance) P-C4' energy: -53.089 flat angles C4'-P-C4' energy: -46.259 flat angles P-C4'-P energy: -31.773 tors. eta vs tors. theta energy: -48.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 182 Temperature: 1.157143 Total energy: -519.181799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.181799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.181799 (E_RNA) where: Base-Base interactions energy: -313.595 where: short stacking energy: -160.468 Base-Backbone interact. energy: -1.014 local terms energy: -204.572650 where: bonds (distance) C4'-P energy: -50.069 bonds (distance) P-C4' energy: -55.956 flat angles C4'-P-C4' energy: -46.141 flat angles P-C4'-P energy: -26.084 tors. eta vs tors. theta energy: -26.324 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 182 Temperature: 1.221429 Total energy: -366.700192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.700192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.700192 (E_RNA) where: Base-Base interactions energy: -202.268 where: short stacking energy: -105.624 Base-Backbone interact. energy: -1.378 local terms energy: -163.053467 where: bonds (distance) C4'-P energy: -47.395 bonds (distance) P-C4' energy: -47.047 flat angles C4'-P-C4' energy: -43.823 flat angles P-C4'-P energy: -26.638 tors. eta vs tors. theta energy: 1.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 182 Temperature: 1.285714 Total energy: -243.688525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.688525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.688525 (E_RNA) where: Base-Base interactions energy: -70.345 where: short stacking energy: -63.326 Base-Backbone interact. energy: 0.420 local terms energy: -173.764262 where: bonds (distance) C4'-P energy: -50.968 bonds (distance) P-C4' energy: -55.499 flat angles C4'-P-C4' energy: -45.761 flat angles P-C4'-P energy: -26.066 tors. eta vs tors. theta energy: 4.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 182 Temperature: 1.350000 Total energy: -240.745784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.745784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.745784 (E_RNA) where: Base-Base interactions energy: -90.410 where: short stacking energy: -81.458 Base-Backbone interact. energy: -1.184 local terms energy: -149.151490 where: bonds (distance) C4'-P energy: -50.170 bonds (distance) P-C4' energy: -48.403 flat angles C4'-P-C4' energy: -35.210 flat angles P-C4'-P energy: -14.406 tors. eta vs tors. theta energy: -0.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 183 Temperature: 0.900000 Total energy: -860.348024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.348024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.348024 (E_RNA) where: Base-Base interactions energy: -586.626 where: short stacking energy: -234.852 Base-Backbone interact. energy: -0.372 local terms energy: -273.350081 where: bonds (distance) C4'-P energy: -53.391 bonds (distance) P-C4' energy: -61.206 flat angles C4'-P-C4' energy: -58.514 flat angles P-C4'-P energy: -43.793 tors. eta vs tors. theta energy: -56.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 183 Temperature: 0.964286 Total energy: -817.963816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -817.963816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -817.963816 (E_RNA) where: Base-Base interactions energy: -567.192 where: short stacking energy: -221.538 Base-Backbone interact. energy: -1.687 local terms energy: -249.085308 where: bonds (distance) C4'-P energy: -56.233 bonds (distance) P-C4' energy: -53.227 flat angles C4'-P-C4' energy: -47.844 flat angles P-C4'-P energy: -43.187 tors. eta vs tors. theta energy: -48.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 183 Temperature: 1.028571 Total energy: -721.553343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.553343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.553343 (E_RNA) where: Base-Base interactions energy: -452.195 where: short stacking energy: -243.658 Base-Backbone interact. energy: 1.056 local terms energy: -270.414726 where: bonds (distance) C4'-P energy: -49.601 bonds (distance) P-C4' energy: -58.241 flat angles C4'-P-C4' energy: -61.532 flat angles P-C4'-P energy: -37.670 tors. eta vs tors. theta energy: -63.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 183 Temperature: 1.092857 Total energy: -724.699474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.699474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.699474 (E_RNA) where: Base-Base interactions energy: -470.348 where: short stacking energy: -225.331 Base-Backbone interact. energy: 0.161 local terms energy: -254.511902 where: bonds (distance) C4'-P energy: -59.063 bonds (distance) P-C4' energy: -52.433 flat angles C4'-P-C4' energy: -56.453 flat angles P-C4'-P energy: -39.265 tors. eta vs tors. theta energy: -47.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 183 Temperature: 1.157143 Total energy: -544.898878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.898878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.898878 (E_RNA) where: Base-Base interactions energy: -345.082 where: short stacking energy: -182.572 Base-Backbone interact. energy: -1.096 local terms energy: -198.720777 where: bonds (distance) C4'-P energy: -46.023 bonds (distance) P-C4' energy: -52.287 flat angles C4'-P-C4' energy: -39.356 flat angles P-C4'-P energy: -38.367 tors. eta vs tors. theta energy: -22.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 183 Temperature: 1.221429 Total energy: -355.052931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.052931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.052931 (E_RNA) where: Base-Base interactions energy: -168.339 where: short stacking energy: -100.170 Base-Backbone interact. energy: 1.344 local terms energy: -188.057699 where: bonds (distance) C4'-P energy: -53.379 bonds (distance) P-C4' energy: -49.124 flat angles C4'-P-C4' energy: -45.739 flat angles P-C4'-P energy: -31.586 tors. eta vs tors. theta energy: -8.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 183 Temperature: 1.285714 Total energy: -257.788028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.788028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.788028 (E_RNA) where: Base-Base interactions energy: -100.526 where: short stacking energy: -87.782 Base-Backbone interact. energy: -1.514 local terms energy: -155.747830 where: bonds (distance) C4'-P energy: -40.756 bonds (distance) P-C4' energy: -51.343 flat angles C4'-P-C4' energy: -41.894 flat angles P-C4'-P energy: -27.253 tors. eta vs tors. theta energy: 5.499 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 183 Temperature: 1.350000 Total energy: -229.282368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.282368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.282368 (E_RNA) where: Base-Base interactions energy: -77.912 where: short stacking energy: -53.304 Base-Backbone interact. energy: -1.725 local terms energy: -149.645315 where: bonds (distance) C4'-P energy: -50.516 bonds (distance) P-C4' energy: -43.698 flat angles C4'-P-C4' energy: -48.734 flat angles P-C4'-P energy: -20.847 tors. eta vs tors. theta energy: 14.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 184 Temperature: 0.900000 Total energy: -856.971739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.971739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -856.971739 (E_RNA) where: Base-Base interactions energy: -603.856 where: short stacking energy: -243.124 Base-Backbone interact. energy: -0.950 local terms energy: -252.165494 where: bonds (distance) C4'-P energy: -58.831 bonds (distance) P-C4' energy: -55.207 flat angles C4'-P-C4' energy: -54.382 flat angles P-C4'-P energy: -39.967 tors. eta vs tors. theta energy: -43.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 184 Temperature: 0.964286 Total energy: -828.270796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -828.270796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -828.270796 (E_RNA) where: Base-Base interactions energy: -585.278 where: short stacking energy: -248.802 Base-Backbone interact. energy: -0.395 local terms energy: -242.598771 where: bonds (distance) C4'-P energy: -45.480 bonds (distance) P-C4' energy: -55.657 flat angles C4'-P-C4' energy: -63.169 flat angles P-C4'-P energy: -26.658 tors. eta vs tors. theta energy: -51.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 184 Temperature: 1.028571 Total energy: -722.926662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.926662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.926662 (E_RNA) where: Base-Base interactions energy: -476.005 where: short stacking energy: -232.194 Base-Backbone interact. energy: -1.279 local terms energy: -245.642609 where: bonds (distance) C4'-P energy: -46.002 bonds (distance) P-C4' energy: -55.910 flat angles C4'-P-C4' energy: -58.063 flat angles P-C4'-P energy: -38.332 tors. eta vs tors. theta energy: -47.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 184 Temperature: 1.092857 Total energy: -676.269674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.269674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.269674 (E_RNA) where: Base-Base interactions energy: -422.662 where: short stacking energy: -224.133 Base-Backbone interact. energy: -1.008 local terms energy: -252.599520 where: bonds (distance) C4'-P energy: -50.499 bonds (distance) P-C4' energy: -55.794 flat angles C4'-P-C4' energy: -54.458 flat angles P-C4'-P energy: -45.797 tors. eta vs tors. theta energy: -46.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 184 Temperature: 1.157143 Total energy: -558.264541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.264541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.264541 (E_RNA) where: Base-Base interactions energy: -321.489 where: short stacking energy: -168.902 Base-Backbone interact. energy: -0.448 local terms energy: -236.326790 where: bonds (distance) C4'-P energy: -50.369 bonds (distance) P-C4' energy: -54.209 flat angles C4'-P-C4' energy: -56.859 flat angles P-C4'-P energy: -34.739 tors. eta vs tors. theta energy: -40.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 184 Temperature: 1.221429 Total energy: -346.877662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.877662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.877662 (E_RNA) where: Base-Base interactions energy: -158.992 where: short stacking energy: -84.528 Base-Backbone interact. energy: -0.243 local terms energy: -187.643370 where: bonds (distance) C4'-P energy: -50.530 bonds (distance) P-C4' energy: -58.259 flat angles C4'-P-C4' energy: -47.287 flat angles P-C4'-P energy: -33.577 tors. eta vs tors. theta energy: 2.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 184 Temperature: 1.285714 Total energy: -247.482031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.482031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.482031 (E_RNA) where: Base-Base interactions energy: -101.309 where: short stacking energy: -82.459 Base-Backbone interact. energy: -1.674 local terms energy: -145.288630 where: bonds (distance) C4'-P energy: -41.530 bonds (distance) P-C4' energy: -46.125 flat angles C4'-P-C4' energy: -38.713 flat angles P-C4'-P energy: -17.320 tors. eta vs tors. theta energy: -1.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.790 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 184 Temperature: 1.350000 Total energy: -225.094925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.094925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.094925 (E_RNA) where: Base-Base interactions energy: -92.251 where: short stacking energy: -75.545 Base-Backbone interact. energy: 2.898 local terms energy: -135.742584 where: bonds (distance) C4'-P energy: -54.847 bonds (distance) P-C4' energy: -45.104 flat angles C4'-P-C4' energy: -21.841 flat angles P-C4'-P energy: -23.407 tors. eta vs tors. theta energy: 9.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 185 Temperature: 0.900000 Total energy: -859.661724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -859.661724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.661724 (E_RNA) where: Base-Base interactions energy: -594.097 where: short stacking energy: -243.250 Base-Backbone interact. energy: -0.625 local terms energy: -264.939073 where: bonds (distance) C4'-P energy: -56.936 bonds (distance) P-C4' energy: -61.443 flat angles C4'-P-C4' energy: -57.964 flat angles P-C4'-P energy: -41.785 tors. eta vs tors. theta energy: -46.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 185 Temperature: 0.964286 Total energy: -803.855062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.855062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -803.855062 (E_RNA) where: Base-Base interactions energy: -574.539 where: short stacking energy: -228.452 Base-Backbone interact. energy: -0.779 local terms energy: -228.537560 where: bonds (distance) C4'-P energy: -52.556 bonds (distance) P-C4' energy: -47.847 flat angles C4'-P-C4' energy: -52.425 flat angles P-C4'-P energy: -31.937 tors. eta vs tors. theta energy: -43.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 185 Temperature: 1.028571 Total energy: -738.315758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.315758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.315758 (E_RNA) where: Base-Base interactions energy: -487.037 where: short stacking energy: -241.654 Base-Backbone interact. energy: 0.894 local terms energy: -252.172553 where: bonds (distance) C4'-P energy: -52.635 bonds (distance) P-C4' energy: -58.722 flat angles C4'-P-C4' energy: -52.011 flat angles P-C4'-P energy: -32.002 tors. eta vs tors. theta energy: -56.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 185 Temperature: 1.092857 Total energy: -653.287244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.287244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.287244 (E_RNA) where: Base-Base interactions energy: -418.503 where: short stacking energy: -197.995 Base-Backbone interact. energy: -0.267 local terms energy: -234.516603 where: bonds (distance) C4'-P energy: -51.617 bonds (distance) P-C4' energy: -59.229 flat angles C4'-P-C4' energy: -55.515 flat angles P-C4'-P energy: -26.861 tors. eta vs tors. theta energy: -41.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 185 Temperature: 1.157143 Total energy: -551.955310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.955310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.955310 (E_RNA) where: Base-Base interactions energy: -326.657 where: short stacking energy: -176.051 Base-Backbone interact. energy: -1.781 local terms energy: -223.517402 where: bonds (distance) C4'-P energy: -49.434 bonds (distance) P-C4' energy: -47.735 flat angles C4'-P-C4' energy: -53.159 flat angles P-C4'-P energy: -33.527 tors. eta vs tors. theta energy: -39.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 185 Temperature: 1.221429 Total energy: -376.049018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.049018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.049018 (E_RNA) where: Base-Base interactions energy: -200.449 where: short stacking energy: -115.985 Base-Backbone interact. energy: 5.475 local terms energy: -181.074838 where: bonds (distance) C4'-P energy: -55.023 bonds (distance) P-C4' energy: -48.046 flat angles C4'-P-C4' energy: -40.839 flat angles P-C4'-P energy: -32.130 tors. eta vs tors. theta energy: -5.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 185 Temperature: 1.285714 Total energy: -233.113111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.113111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.113111 (E_RNA) where: Base-Base interactions energy: -88.793 where: short stacking energy: -69.297 Base-Backbone interact. energy: -0.393 local terms energy: -143.926932 where: bonds (distance) C4'-P energy: -48.040 bonds (distance) P-C4' energy: -47.164 flat angles C4'-P-C4' energy: -30.962 flat angles P-C4'-P energy: -23.335 tors. eta vs tors. theta energy: 5.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 185 Temperature: 1.350000 Total energy: -232.802989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.802989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.802989 (E_RNA) where: Base-Base interactions energy: -69.944 where: short stacking energy: -62.355 Base-Backbone interact. energy: 2.372 local terms energy: -165.231239 where: bonds (distance) C4'-P energy: -46.233 bonds (distance) P-C4' energy: -61.149 flat angles C4'-P-C4' energy: -37.721 flat angles P-C4'-P energy: -22.864 tors. eta vs tors. theta energy: 2.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 186 Temperature: 0.900000 Total energy: -859.603863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -859.603863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.603863 (E_RNA) where: Base-Base interactions energy: -605.764 where: short stacking energy: -238.930 Base-Backbone interact. energy: -2.024 local terms energy: -251.816329 where: bonds (distance) C4'-P energy: -61.234 bonds (distance) P-C4' energy: -48.917 flat angles C4'-P-C4' energy: -57.662 flat angles P-C4'-P energy: -41.718 tors. eta vs tors. theta energy: -42.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 186 Temperature: 0.964286 Total energy: -818.945324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.945324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -818.945324 (E_RNA) where: Base-Base interactions energy: -552.414 where: short stacking energy: -230.451 Base-Backbone interact. energy: 0.131 local terms energy: -266.662682 where: bonds (distance) C4'-P energy: -54.537 bonds (distance) P-C4' energy: -52.416 flat angles C4'-P-C4' energy: -62.922 flat angles P-C4'-P energy: -43.751 tors. eta vs tors. theta energy: -53.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 186 Temperature: 1.028571 Total energy: -764.535675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -764.535675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -764.535675 (E_RNA) where: Base-Base interactions energy: -493.135 where: short stacking energy: -243.661 Base-Backbone interact. energy: -0.063 local terms energy: -271.337867 where: bonds (distance) C4'-P energy: -60.206 bonds (distance) P-C4' energy: -56.486 flat angles C4'-P-C4' energy: -57.547 flat angles P-C4'-P energy: -37.331 tors. eta vs tors. theta energy: -59.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 186 Temperature: 1.092857 Total energy: -697.255215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.255215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.255215 (E_RNA) where: Base-Base interactions energy: -437.486 where: short stacking energy: -205.491 Base-Backbone interact. energy: -1.969 local terms energy: -257.800750 where: bonds (distance) C4'-P energy: -58.205 bonds (distance) P-C4' energy: -56.582 flat angles C4'-P-C4' energy: -52.054 flat angles P-C4'-P energy: -41.501 tors. eta vs tors. theta energy: -49.459 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 186 Temperature: 1.157143 Total energy: -564.700109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.700109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.700109 (E_RNA) where: Base-Base interactions energy: -376.522 where: short stacking energy: -149.788 Base-Backbone interact. energy: 1.986 local terms energy: -190.164266 where: bonds (distance) C4'-P energy: -37.321 bonds (distance) P-C4' energy: -55.069 flat angles C4'-P-C4' energy: -41.047 flat angles P-C4'-P energy: -35.401 tors. eta vs tors. theta energy: -21.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 186 Temperature: 1.221429 Total energy: -357.741180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.741180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.741180 (E_RNA) where: Base-Base interactions energy: -174.109 where: short stacking energy: -102.836 Base-Backbone interact. energy: -0.513 local terms energy: -183.119320 where: bonds (distance) C4'-P energy: -59.403 bonds (distance) P-C4' energy: -51.201 flat angles C4'-P-C4' energy: -49.399 flat angles P-C4'-P energy: -22.004 tors. eta vs tors. theta energy: -1.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 186 Temperature: 1.285714 Total energy: -274.322288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.322288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.322288 (E_RNA) where: Base-Base interactions energy: -112.524 where: short stacking energy: -81.979 Base-Backbone interact. energy: 2.717 local terms energy: -164.514593 where: bonds (distance) C4'-P energy: -52.559 bonds (distance) P-C4' energy: -39.805 flat angles C4'-P-C4' energy: -52.595 flat angles P-C4'-P energy: -30.796 tors. eta vs tors. theta energy: 11.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 186 Temperature: 1.350000 Total energy: -223.229452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.229452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.229452 (E_RNA) where: Base-Base interactions energy: -85.242 where: short stacking energy: -74.356 Base-Backbone interact. energy: -2.284 local terms energy: -135.703489 where: bonds (distance) C4'-P energy: -45.383 bonds (distance) P-C4' energy: -52.929 flat angles C4'-P-C4' energy: -24.046 flat angles P-C4'-P energy: -26.164 tors. eta vs tors. theta energy: 12.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 187 Temperature: 0.900000 Total energy: -860.824193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.824193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.824193 (E_RNA) where: Base-Base interactions energy: -601.757 where: short stacking energy: -241.930 Base-Backbone interact. energy: -2.264 local terms energy: -256.802885 where: bonds (distance) C4'-P energy: -59.592 bonds (distance) P-C4' energy: -53.485 flat angles C4'-P-C4' energy: -54.679 flat angles P-C4'-P energy: -45.850 tors. eta vs tors. theta energy: -43.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 187 Temperature: 0.964286 Total energy: -799.894095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.894095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.894095 (E_RNA) where: Base-Base interactions energy: -559.409 where: short stacking energy: -230.000 Base-Backbone interact. energy: -2.189 local terms energy: -238.295687 where: bonds (distance) C4'-P energy: -45.765 bonds (distance) P-C4' energy: -53.697 flat angles C4'-P-C4' energy: -62.452 flat angles P-C4'-P energy: -28.109 tors. eta vs tors. theta energy: -48.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 187 Temperature: 1.028571 Total energy: -711.444475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.444475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.444475 (E_RNA) where: Base-Base interactions energy: -470.358 where: short stacking energy: -231.020 Base-Backbone interact. energy: -1.703 local terms energy: -239.382510 where: bonds (distance) C4'-P energy: -53.288 bonds (distance) P-C4' energy: -53.687 flat angles C4'-P-C4' energy: -48.714 flat angles P-C4'-P energy: -36.692 tors. eta vs tors. theta energy: -47.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 187 Temperature: 1.092857 Total energy: -692.839453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.839453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.839453 (E_RNA) where: Base-Base interactions energy: -443.393 where: short stacking energy: -226.923 Base-Backbone interact. energy: -1.535 local terms energy: -247.910730 where: bonds (distance) C4'-P energy: -42.856 bonds (distance) P-C4' energy: -58.699 flat angles C4'-P-C4' energy: -58.010 flat angles P-C4'-P energy: -29.651 tors. eta vs tors. theta energy: -58.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 187 Temperature: 1.157143 Total energy: -533.549071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.549071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.549071 (E_RNA) where: Base-Base interactions energy: -343.811 where: short stacking energy: -156.091 Base-Backbone interact. energy: -1.035 local terms energy: -188.702232 where: bonds (distance) C4'-P energy: -40.549 bonds (distance) P-C4' energy: -45.860 flat angles C4'-P-C4' energy: -51.494 flat angles P-C4'-P energy: -30.555 tors. eta vs tors. theta energy: -20.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 187 Temperature: 1.221429 Total energy: -379.158984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.158984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.158984 (E_RNA) where: Base-Base interactions energy: -199.291 where: short stacking energy: -86.758 Base-Backbone interact. energy: 0.571 local terms energy: -180.439210 where: bonds (distance) C4'-P energy: -60.739 bonds (distance) P-C4' energy: -57.759 flat angles C4'-P-C4' energy: -48.711 flat angles P-C4'-P energy: -21.947 tors. eta vs tors. theta energy: 8.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 187 Temperature: 1.285714 Total energy: -252.932231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.932231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.932231 (E_RNA) where: Base-Base interactions energy: -106.051 where: short stacking energy: -84.127 Base-Backbone interact. energy: -1.203 local terms energy: -145.678198 where: bonds (distance) C4'-P energy: -55.859 bonds (distance) P-C4' energy: -54.008 flat angles C4'-P-C4' energy: -27.616 flat angles P-C4'-P energy: -17.538 tors. eta vs tors. theta energy: 9.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 187 Temperature: 1.350000 Total energy: -232.179075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.179075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.179075 (E_RNA) where: Base-Base interactions energy: -94.182 where: short stacking energy: -67.297 Base-Backbone interact. energy: 2.836 local terms energy: -140.833083 where: bonds (distance) C4'-P energy: -40.894 bonds (distance) P-C4' energy: -45.372 flat angles C4'-P-C4' energy: -39.557 flat angles P-C4'-P energy: -20.122 tors. eta vs tors. theta energy: 5.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 188 Temperature: 0.900000 Total energy: -866.735537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.735537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.735537 (E_RNA) where: Base-Base interactions energy: -617.206 where: short stacking energy: -270.367 Base-Backbone interact. energy: -1.629 local terms energy: -247.900543 where: bonds (distance) C4'-P energy: -48.706 bonds (distance) P-C4' energy: -53.416 flat angles C4'-P-C4' energy: -54.624 flat angles P-C4'-P energy: -46.762 tors. eta vs tors. theta energy: -44.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 188 Temperature: 0.964286 Total energy: -818.255688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.255688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -818.255688 (E_RNA) where: Base-Base interactions energy: -544.602 where: short stacking energy: -241.324 Base-Backbone interact. energy: -2.410 local terms energy: -271.243327 where: bonds (distance) C4'-P energy: -60.114 bonds (distance) P-C4' energy: -54.154 flat angles C4'-P-C4' energy: -59.432 flat angles P-C4'-P energy: -39.020 tors. eta vs tors. theta energy: -58.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 188 Temperature: 1.028571 Total energy: -736.308467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.308467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.308467 (E_RNA) where: Base-Base interactions energy: -494.835 where: short stacking energy: -239.278 Base-Backbone interact. energy: -1.070 local terms energy: -240.403331 where: bonds (distance) C4'-P energy: -54.223 bonds (distance) P-C4' energy: -50.031 flat angles C4'-P-C4' energy: -49.534 flat angles P-C4'-P energy: -38.444 tors. eta vs tors. theta energy: -48.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 188 Temperature: 1.092857 Total energy: -642.677887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.677887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.677887 (E_RNA) where: Base-Base interactions energy: -400.651 where: short stacking energy: -212.041 Base-Backbone interact. energy: 0.164 local terms energy: -242.190533 where: bonds (distance) C4'-P energy: -54.050 bonds (distance) P-C4' energy: -44.907 flat angles C4'-P-C4' energy: -61.920 flat angles P-C4'-P energy: -30.748 tors. eta vs tors. theta energy: -50.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 188 Temperature: 1.157143 Total energy: -588.598874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.598874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.598874 (E_RNA) where: Base-Base interactions energy: -383.230 where: short stacking energy: -171.820 Base-Backbone interact. energy: 0.014 local terms energy: -205.383037 where: bonds (distance) C4'-P energy: -56.064 bonds (distance) P-C4' energy: -49.485 flat angles C4'-P-C4' energy: -50.321 flat angles P-C4'-P energy: -19.698 tors. eta vs tors. theta energy: -29.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 188 Temperature: 1.221429 Total energy: -376.310934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.310934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.310934 (E_RNA) where: Base-Base interactions energy: -182.940 where: short stacking energy: -89.409 Base-Backbone interact. energy: 3.078 local terms energy: -196.448989 where: bonds (distance) C4'-P energy: -48.753 bonds (distance) P-C4' energy: -56.731 flat angles C4'-P-C4' energy: -54.983 flat angles P-C4'-P energy: -29.930 tors. eta vs tors. theta energy: -6.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 188 Temperature: 1.285714 Total energy: -249.614993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.614993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.614993 (E_RNA) where: Base-Base interactions energy: -89.637 where: short stacking energy: -84.589 Base-Backbone interact. energy: -0.216 local terms energy: -159.761558 where: bonds (distance) C4'-P energy: -56.932 bonds (distance) P-C4' energy: -38.304 flat angles C4'-P-C4' energy: -44.105 flat angles P-C4'-P energy: -25.640 tors. eta vs tors. theta energy: 5.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 188 Temperature: 1.350000 Total energy: -228.356839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.356839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.356839 (E_RNA) where: Base-Base interactions energy: -98.312 where: short stacking energy: -59.478 Base-Backbone interact. energy: 0.959 local terms energy: -132.119127 where: bonds (distance) C4'-P energy: -44.191 bonds (distance) P-C4' energy: -49.891 flat angles C4'-P-C4' energy: -27.061 flat angles P-C4'-P energy: -33.671 tors. eta vs tors. theta energy: 22.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.115 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 189 Temperature: 0.900000 Total energy: -877.358745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.358745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -877.358745 (E_RNA) where: Base-Base interactions energy: -613.144 where: short stacking energy: -260.479 Base-Backbone interact. energy: -0.715 local terms energy: -263.499440 where: bonds (distance) C4'-P energy: -58.379 bonds (distance) P-C4' energy: -56.876 flat angles C4'-P-C4' energy: -58.487 flat angles P-C4'-P energy: -42.286 tors. eta vs tors. theta energy: -47.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 189 Temperature: 0.964286 Total energy: -812.352788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.352788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.352788 (E_RNA) where: Base-Base interactions energy: -548.425 where: short stacking energy: -236.916 Base-Backbone interact. energy: -1.830 local terms energy: -262.097204 where: bonds (distance) C4'-P energy: -62.915 bonds (distance) P-C4' energy: -49.313 flat angles C4'-P-C4' energy: -58.258 flat angles P-C4'-P energy: -37.593 tors. eta vs tors. theta energy: -54.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 189 Temperature: 1.028571 Total energy: -736.429260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.429260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.429260 (E_RNA) where: Base-Base interactions energy: -496.432 where: short stacking energy: -231.160 Base-Backbone interact. energy: 1.117 local terms energy: -241.113500 where: bonds (distance) C4'-P energy: -49.779 bonds (distance) P-C4' energy: -55.484 flat angles C4'-P-C4' energy: -53.857 flat angles P-C4'-P energy: -37.279 tors. eta vs tors. theta energy: -44.714 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 189 Temperature: 1.092857 Total energy: -622.886900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.886900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.886900 (E_RNA) where: Base-Base interactions energy: -397.462 where: short stacking energy: -198.338 Base-Backbone interact. energy: 4.763 local terms energy: -230.187978 where: bonds (distance) C4'-P energy: -55.440 bonds (distance) P-C4' energy: -58.197 flat angles C4'-P-C4' energy: -54.385 flat angles P-C4'-P energy: -31.918 tors. eta vs tors. theta energy: -30.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 189 Temperature: 1.157143 Total energy: -621.350202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.350202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.350202 (E_RNA) where: Base-Base interactions energy: -405.302 where: short stacking energy: -196.146 Base-Backbone interact. energy: -0.681 local terms energy: -215.367256 where: bonds (distance) C4'-P energy: -47.557 bonds (distance) P-C4' energy: -44.840 flat angles C4'-P-C4' energy: -53.459 flat angles P-C4'-P energy: -27.387 tors. eta vs tors. theta energy: -42.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 189 Temperature: 1.221429 Total energy: -408.957966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.957966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.957966 (E_RNA) where: Base-Base interactions energy: -237.583 where: short stacking energy: -136.455 Base-Backbone interact. energy: 0.192 local terms energy: -171.567278 where: bonds (distance) C4'-P energy: -51.788 bonds (distance) P-C4' energy: -32.932 flat angles C4'-P-C4' energy: -39.976 flat angles P-C4'-P energy: -29.111 tors. eta vs tors. theta energy: -17.761 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 189 Temperature: 1.285714 Total energy: -251.013898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.013898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.013898 (E_RNA) where: Base-Base interactions energy: -93.752 where: short stacking energy: -90.507 Base-Backbone interact. energy: 0.898 local terms energy: -158.160733 where: bonds (distance) C4'-P energy: -39.467 bonds (distance) P-C4' energy: -46.120 flat angles C4'-P-C4' energy: -48.678 flat angles P-C4'-P energy: -28.871 tors. eta vs tors. theta energy: 4.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 189 Temperature: 1.350000 Total energy: -198.676893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.676893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.676893 (E_RNA) where: Base-Base interactions energy: -71.493 where: short stacking energy: -47.330 Base-Backbone interact. energy: -1.011 local terms energy: -126.172447 where: bonds (distance) C4'-P energy: -35.155 bonds (distance) P-C4' energy: -55.466 flat angles C4'-P-C4' energy: -31.074 flat angles P-C4'-P energy: -21.517 tors. eta vs tors. theta energy: 17.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 190 Temperature: 0.900000 Total energy: -883.346682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -883.346682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -883.346682 (E_RNA) where: Base-Base interactions energy: -627.026 where: short stacking energy: -271.401 Base-Backbone interact. energy: -0.587 local terms energy: -255.734193 where: bonds (distance) C4'-P energy: -47.335 bonds (distance) P-C4' energy: -60.601 flat angles C4'-P-C4' energy: -56.930 flat angles P-C4'-P energy: -43.666 tors. eta vs tors. theta energy: -47.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 190 Temperature: 0.964286 Total energy: -819.239819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.239819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.239819 (E_RNA) where: Base-Base interactions energy: -535.679 where: short stacking energy: -239.610 Base-Backbone interact. energy: -1.690 local terms energy: -281.870477 where: bonds (distance) C4'-P energy: -62.204 bonds (distance) P-C4' energy: -58.237 flat angles C4'-P-C4' energy: -55.618 flat angles P-C4'-P energy: -46.226 tors. eta vs tors. theta energy: -59.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 190 Temperature: 1.028571 Total energy: -761.857014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.857014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.857014 (E_RNA) where: Base-Base interactions energy: -500.538 where: short stacking energy: -243.860 Base-Backbone interact. energy: -0.641 local terms energy: -260.678498 where: bonds (distance) C4'-P energy: -59.680 bonds (distance) P-C4' energy: -63.127 flat angles C4'-P-C4' energy: -57.947 flat angles P-C4'-P energy: -31.574 tors. eta vs tors. theta energy: -48.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 190 Temperature: 1.092857 Total energy: -592.176855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.176855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.176855 (E_RNA) where: Base-Base interactions energy: -362.546 where: short stacking energy: -169.377 Base-Backbone interact. energy: -1.510 local terms energy: -228.120564 where: bonds (distance) C4'-P energy: -45.737 bonds (distance) P-C4' energy: -59.727 flat angles C4'-P-C4' energy: -56.402 flat angles P-C4'-P energy: -38.055 tors. eta vs tors. theta energy: -28.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 190 Temperature: 1.157143 Total energy: -608.646070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.646070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.646070 (E_RNA) where: Base-Base interactions energy: -388.697 where: short stacking energy: -210.942 Base-Backbone interact. energy: -1.193 local terms energy: -218.756030 where: bonds (distance) C4'-P energy: -33.403 bonds (distance) P-C4' energy: -54.497 flat angles C4'-P-C4' energy: -50.192 flat angles P-C4'-P energy: -37.614 tors. eta vs tors. theta energy: -43.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 190 Temperature: 1.221429 Total energy: -417.598026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.598026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.598026 (E_RNA) where: Base-Base interactions energy: -226.077 where: short stacking energy: -130.032 Base-Backbone interact. energy: -0.166 local terms energy: -191.355274 where: bonds (distance) C4'-P energy: -43.730 bonds (distance) P-C4' energy: -50.878 flat angles C4'-P-C4' energy: -52.041 flat angles P-C4'-P energy: -29.157 tors. eta vs tors. theta energy: -15.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 190 Temperature: 1.285714 Total energy: -292.551750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.551750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.551750 (E_RNA) where: Base-Base interactions energy: -132.621 where: short stacking energy: -97.614 Base-Backbone interact. energy: -1.581 local terms energy: -158.349771 where: bonds (distance) C4'-P energy: -53.332 bonds (distance) P-C4' energy: -47.723 flat angles C4'-P-C4' energy: -46.430 flat angles P-C4'-P energy: -10.943 tors. eta vs tors. theta energy: 0.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 190 Temperature: 1.350000 Total energy: -253.921084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.921084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.921084 (E_RNA) where: Base-Base interactions energy: -87.658 where: short stacking energy: -86.895 Base-Backbone interact. energy: -0.762 local terms energy: -165.500880 where: bonds (distance) C4'-P energy: -42.429 bonds (distance) P-C4' energy: -47.795 flat angles C4'-P-C4' energy: -42.895 flat angles P-C4'-P energy: -39.502 tors. eta vs tors. theta energy: 7.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 191 Temperature: 0.900000 Total energy: -889.756294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.756294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.756294 (E_RNA) where: Base-Base interactions energy: -612.673 where: short stacking energy: -268.708 Base-Backbone interact. energy: -0.930 local terms energy: -276.152614 where: bonds (distance) C4'-P energy: -51.426 bonds (distance) P-C4' energy: -57.738 flat angles C4'-P-C4' energy: -57.528 flat angles P-C4'-P energy: -52.778 tors. eta vs tors. theta energy: -56.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 191 Temperature: 0.964286 Total energy: -809.030382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -809.030382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.030382 (E_RNA) where: Base-Base interactions energy: -540.696 where: short stacking energy: -237.972 Base-Backbone interact. energy: -3.085 local terms energy: -265.249748 where: bonds (distance) C4'-P energy: -52.173 bonds (distance) P-C4' energy: -56.641 flat angles C4'-P-C4' energy: -59.099 flat angles P-C4'-P energy: -35.776 tors. eta vs tors. theta energy: -61.561 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 191 Temperature: 1.028571 Total energy: -752.512686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.512686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.512686 (E_RNA) where: Base-Base interactions energy: -492.640 where: short stacking energy: -233.416 Base-Backbone interact. energy: -0.447 local terms energy: -259.425849 where: bonds (distance) C4'-P energy: -57.120 bonds (distance) P-C4' energy: -51.478 flat angles C4'-P-C4' energy: -65.346 flat angles P-C4'-P energy: -30.969 tors. eta vs tors. theta energy: -54.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 191 Temperature: 1.092857 Total energy: -650.361388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.361388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.361388 (E_RNA) where: Base-Base interactions energy: -413.224 where: short stacking energy: -199.250 Base-Backbone interact. energy: 4.013 local terms energy: -241.150466 where: bonds (distance) C4'-P energy: -50.849 bonds (distance) P-C4' energy: -54.919 flat angles C4'-P-C4' energy: -63.698 flat angles P-C4'-P energy: -31.321 tors. eta vs tors. theta energy: -40.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 191 Temperature: 1.157143 Total energy: -560.319255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.319255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.319255 (E_RNA) where: Base-Base interactions energy: -342.264 where: short stacking energy: -154.841 Base-Backbone interact. energy: -1.259 local terms energy: -216.795547 where: bonds (distance) C4'-P energy: -49.090 bonds (distance) P-C4' energy: -56.970 flat angles C4'-P-C4' energy: -56.416 flat angles P-C4'-P energy: -33.487 tors. eta vs tors. theta energy: -20.832 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 191 Temperature: 1.221429 Total energy: -442.519608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.519608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.519608 (E_RNA) where: Base-Base interactions energy: -261.084 where: short stacking energy: -140.217 Base-Backbone interact. energy: -1.037 local terms energy: -180.398235 where: bonds (distance) C4'-P energy: -52.007 bonds (distance) P-C4' energy: -45.588 flat angles C4'-P-C4' energy: -38.805 flat angles P-C4'-P energy: -29.984 tors. eta vs tors. theta energy: -14.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 191 Temperature: 1.285714 Total energy: -246.759618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.759618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.759618 (E_RNA) where: Base-Base interactions energy: -88.670 where: short stacking energy: -64.224 Base-Backbone interact. energy: -0.766 local terms energy: -157.323613 where: bonds (distance) C4'-P energy: -53.369 bonds (distance) P-C4' energy: -51.069 flat angles C4'-P-C4' energy: -39.082 flat angles P-C4'-P energy: -27.734 tors. eta vs tors. theta energy: 13.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 191 Temperature: 1.350000 Total energy: -236.247126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.247126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.247126 (E_RNA) where: Base-Base interactions energy: -81.689 where: short stacking energy: -69.144 Base-Backbone interact. energy: -0.772 local terms energy: -153.785789 where: bonds (distance) C4'-P energy: -46.337 bonds (distance) P-C4' energy: -48.124 flat angles C4'-P-C4' energy: -43.307 flat angles P-C4'-P energy: -26.890 tors. eta vs tors. theta energy: 10.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 192 Temperature: 0.900000 Total energy: -915.033593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -915.033593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -915.033593 (E_RNA) where: Base-Base interactions energy: -642.154 where: short stacking energy: -277.582 Base-Backbone interact. energy: -3.339 local terms energy: -269.540669 where: bonds (distance) C4'-P energy: -57.394 bonds (distance) P-C4' energy: -57.827 flat angles C4'-P-C4' energy: -60.151 flat angles P-C4'-P energy: -38.081 tors. eta vs tors. theta energy: -56.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 192 Temperature: 0.964286 Total energy: -793.960321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -793.960321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.960321 (E_RNA) where: Base-Base interactions energy: -538.938 where: short stacking energy: -248.970 Base-Backbone interact. energy: 3.284 local terms energy: -258.306097 where: bonds (distance) C4'-P energy: -52.987 bonds (distance) P-C4' energy: -44.623 flat angles C4'-P-C4' energy: -67.446 flat angles P-C4'-P energy: -32.630 tors. eta vs tors. theta energy: -60.620 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 192 Temperature: 1.028571 Total energy: -756.412860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.412860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.412860 (E_RNA) where: Base-Base interactions energy: -487.274 where: short stacking energy: -245.493 Base-Backbone interact. energy: -0.885 local terms energy: -268.253509 where: bonds (distance) C4'-P energy: -54.301 bonds (distance) P-C4' energy: -63.808 flat angles C4'-P-C4' energy: -58.105 flat angles P-C4'-P energy: -39.120 tors. eta vs tors. theta energy: -52.919 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 192 Temperature: 1.092857 Total energy: -631.346696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -631.346696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -631.346696 (E_RNA) where: Base-Base interactions energy: -400.776 where: short stacking energy: -206.090 Base-Backbone interact. energy: -0.807 local terms energy: -229.763073 where: bonds (distance) C4'-P energy: -44.574 bonds (distance) P-C4' energy: -55.478 flat angles C4'-P-C4' energy: -54.793 flat angles P-C4'-P energy: -33.192 tors. eta vs tors. theta energy: -41.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 192 Temperature: 1.157143 Total energy: -581.115011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -581.115011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.115011 (E_RNA) where: Base-Base interactions energy: -371.459 where: short stacking energy: -175.219 Base-Backbone interact. energy: -0.733 local terms energy: -208.922936 where: bonds (distance) C4'-P energy: -40.321 bonds (distance) P-C4' energy: -48.024 flat angles C4'-P-C4' energy: -57.180 flat angles P-C4'-P energy: -38.634 tors. eta vs tors. theta energy: -24.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 192 Temperature: 1.221429 Total energy: -421.458231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.458231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.458231 (E_RNA) where: Base-Base interactions energy: -219.381 where: short stacking energy: -110.542 Base-Backbone interact. energy: -1.695 local terms energy: -200.382812 where: bonds (distance) C4'-P energy: -50.928 bonds (distance) P-C4' energy: -62.700 flat angles C4'-P-C4' energy: -47.247 flat angles P-C4'-P energy: -36.917 tors. eta vs tors. theta energy: -2.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 192 Temperature: 1.285714 Total energy: -244.588633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.588633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.588633 (E_RNA) where: Base-Base interactions energy: -92.796 where: short stacking energy: -65.223 Base-Backbone interact. energy: -2.008 local terms energy: -149.784132 where: bonds (distance) C4'-P energy: -45.711 bonds (distance) P-C4' energy: -46.558 flat angles C4'-P-C4' energy: -36.837 flat angles P-C4'-P energy: -28.607 tors. eta vs tors. theta energy: 7.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 192 Temperature: 1.350000 Total energy: -257.405778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.405778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.405778 (E_RNA) where: Base-Base interactions energy: -88.388 where: short stacking energy: -76.139 Base-Backbone interact. energy: -0.570 local terms energy: -168.447474 where: bonds (distance) C4'-P energy: -43.976 bonds (distance) P-C4' energy: -49.563 flat angles C4'-P-C4' energy: -46.193 flat angles P-C4'-P energy: -29.086 tors. eta vs tors. theta energy: 0.370 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 193 Temperature: 0.900000 Total energy: -848.186623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.186623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -848.186623 (E_RNA) where: Base-Base interactions energy: -599.988 where: short stacking energy: -242.806 Base-Backbone interact. energy: -2.122 local terms energy: -246.077133 where: bonds (distance) C4'-P energy: -54.433 bonds (distance) P-C4' energy: -48.703 flat angles C4'-P-C4' energy: -50.797 flat angles P-C4'-P energy: -39.894 tors. eta vs tors. theta energy: -52.250 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 193 Temperature: 0.964286 Total energy: -847.364522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -847.364522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -847.364522 (E_RNA) where: Base-Base interactions energy: -568.979 where: short stacking energy: -260.718 Base-Backbone interact. energy: -1.013 local terms energy: -277.372011 where: bonds (distance) C4'-P energy: -55.356 bonds (distance) P-C4' energy: -57.461 flat angles C4'-P-C4' energy: -66.094 flat angles P-C4'-P energy: -36.922 tors. eta vs tors. theta energy: -61.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 193 Temperature: 1.028571 Total energy: -754.637413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -754.637413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.637413 (E_RNA) where: Base-Base interactions energy: -502.553 where: short stacking energy: -245.662 Base-Backbone interact. energy: 6.779 local terms energy: -258.863936 where: bonds (distance) C4'-P energy: -49.311 bonds (distance) P-C4' energy: -59.203 flat angles C4'-P-C4' energy: -59.332 flat angles P-C4'-P energy: -36.349 tors. eta vs tors. theta energy: -54.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 193 Temperature: 1.092857 Total energy: -626.271526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.271526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.271526 (E_RNA) where: Base-Base interactions energy: -391.698 where: short stacking energy: -212.238 Base-Backbone interact. energy: 1.882 local terms energy: -236.454950 where: bonds (distance) C4'-P energy: -61.415 bonds (distance) P-C4' energy: -43.606 flat angles C4'-P-C4' energy: -61.655 flat angles P-C4'-P energy: -20.189 tors. eta vs tors. theta energy: -49.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 193 Temperature: 1.157143 Total energy: -564.272948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.272948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.272948 (E_RNA) where: Base-Base interactions energy: -359.657 where: short stacking energy: -175.128 Base-Backbone interact. energy: -0.132 local terms energy: -204.483786 where: bonds (distance) C4'-P energy: -41.859 bonds (distance) P-C4' energy: -56.773 flat angles C4'-P-C4' energy: -42.649 flat angles P-C4'-P energy: -27.258 tors. eta vs tors. theta energy: -35.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 193 Temperature: 1.221429 Total energy: -437.113713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.113713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.113713 (E_RNA) where: Base-Base interactions energy: -256.085 where: short stacking energy: -120.034 Base-Backbone interact. energy: -1.366 local terms energy: -179.661957 where: bonds (distance) C4'-P energy: -47.673 bonds (distance) P-C4' energy: -50.778 flat angles C4'-P-C4' energy: -39.324 flat angles P-C4'-P energy: -25.597 tors. eta vs tors. theta energy: -16.290 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 193 Temperature: 1.285714 Total energy: -285.607246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.607246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.607246 (E_RNA) where: Base-Base interactions energy: -124.467 where: short stacking energy: -89.959 Base-Backbone interact. energy: -2.328 local terms energy: -158.812899 where: bonds (distance) C4'-P energy: -48.532 bonds (distance) P-C4' energy: -42.489 flat angles C4'-P-C4' energy: -47.020 flat angles P-C4'-P energy: -26.904 tors. eta vs tors. theta energy: 6.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 193 Temperature: 1.350000 Total energy: -246.605307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.605307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.605307 (E_RNA) where: Base-Base interactions energy: -95.792 where: short stacking energy: -70.633 Base-Backbone interact. energy: -0.263 local terms energy: -150.550509 where: bonds (distance) C4'-P energy: -53.669 bonds (distance) P-C4' energy: -45.662 flat angles C4'-P-C4' energy: -34.071 flat angles P-C4'-P energy: -25.999 tors. eta vs tors. theta energy: 8.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 194 Temperature: 0.900000 Total energy: -839.619839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -839.619839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -839.619839 (E_RNA) where: Base-Base interactions energy: -595.659 where: short stacking energy: -245.151 Base-Backbone interact. energy: 0.136 local terms energy: -244.096415 where: bonds (distance) C4'-P energy: -46.296 bonds (distance) P-C4' energy: -56.928 flat angles C4'-P-C4' energy: -59.543 flat angles P-C4'-P energy: -37.699 tors. eta vs tors. theta energy: -43.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 194 Temperature: 0.964286 Total energy: -849.569968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.569968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.569968 (E_RNA) where: Base-Base interactions energy: -569.970 where: short stacking energy: -264.734 Base-Backbone interact. energy: -2.016 local terms energy: -277.583784 where: bonds (distance) C4'-P energy: -51.770 bonds (distance) P-C4' energy: -59.510 flat angles C4'-P-C4' energy: -63.537 flat angles P-C4'-P energy: -41.570 tors. eta vs tors. theta energy: -61.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 194 Temperature: 1.028571 Total energy: -741.947819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -741.947819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.947819 (E_RNA) where: Base-Base interactions energy: -484.020 where: short stacking energy: -232.594 Base-Backbone interact. energy: 0.492 local terms energy: -258.419035 where: bonds (distance) C4'-P energy: -50.879 bonds (distance) P-C4' energy: -61.846 flat angles C4'-P-C4' energy: -56.845 flat angles P-C4'-P energy: -31.729 tors. eta vs tors. theta energy: -57.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 194 Temperature: 1.092857 Total energy: -605.014101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.014101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.014101 (E_RNA) where: Base-Base interactions energy: -387.043 where: short stacking energy: -186.702 Base-Backbone interact. energy: 1.088 local terms energy: -219.059450 where: bonds (distance) C4'-P energy: -46.917 bonds (distance) P-C4' energy: -48.557 flat angles C4'-P-C4' energy: -53.011 flat angles P-C4'-P energy: -35.244 tors. eta vs tors. theta energy: -35.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 194 Temperature: 1.157143 Total energy: -554.339773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.339773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.339773 (E_RNA) where: Base-Base interactions energy: -346.763 where: short stacking energy: -166.367 Base-Backbone interact. energy: -0.818 local terms energy: -206.758769 where: bonds (distance) C4'-P energy: -50.322 bonds (distance) P-C4' energy: -50.059 flat angles C4'-P-C4' energy: -50.466 flat angles P-C4'-P energy: -36.277 tors. eta vs tors. theta energy: -19.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 194 Temperature: 1.221429 Total energy: -445.299042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.299042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.299042 (E_RNA) where: Base-Base interactions energy: -261.905 where: short stacking energy: -132.970 Base-Backbone interact. energy: 1.849 local terms energy: -185.243587 where: bonds (distance) C4'-P energy: -41.180 bonds (distance) P-C4' energy: -58.282 flat angles C4'-P-C4' energy: -54.050 flat angles P-C4'-P energy: -30.369 tors. eta vs tors. theta energy: -1.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 194 Temperature: 1.285714 Total energy: -221.014628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.014628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.014628 (E_RNA) where: Base-Base interactions energy: -73.634 where: short stacking energy: -68.476 Base-Backbone interact. energy: -1.401 local terms energy: -145.979757 where: bonds (distance) C4'-P energy: -42.809 bonds (distance) P-C4' energy: -57.886 flat angles C4'-P-C4' energy: -39.144 flat angles P-C4'-P energy: -8.322 tors. eta vs tors. theta energy: 2.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 194 Temperature: 1.350000 Total energy: -231.666594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.666594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.666594 (E_RNA) where: Base-Base interactions energy: -79.722 where: short stacking energy: -71.267 Base-Backbone interact. energy: -0.425 local terms energy: -151.519303 where: bonds (distance) C4'-P energy: -47.687 bonds (distance) P-C4' energy: -49.404 flat angles C4'-P-C4' energy: -44.030 flat angles P-C4'-P energy: -25.718 tors. eta vs tors. theta energy: 15.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 195 Temperature: 0.900000 Total energy: -846.631840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.631840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -846.631840 (E_RNA) where: Base-Base interactions energy: -585.808 where: short stacking energy: -237.957 Base-Backbone interact. energy: 0.263 local terms energy: -261.086941 where: bonds (distance) C4'-P energy: -53.208 bonds (distance) P-C4' energy: -59.870 flat angles C4'-P-C4' energy: -55.919 flat angles P-C4'-P energy: -40.427 tors. eta vs tors. theta energy: -51.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 195 Temperature: 0.964286 Total energy: -840.807693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.807693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -840.807693 (E_RNA) where: Base-Base interactions energy: -557.249 where: short stacking energy: -251.451 Base-Backbone interact. energy: 0.155 local terms energy: -283.713824 where: bonds (distance) C4'-P energy: -61.051 bonds (distance) P-C4' energy: -54.912 flat angles C4'-P-C4' energy: -66.674 flat angles P-C4'-P energy: -42.897 tors. eta vs tors. theta energy: -58.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 195 Temperature: 1.028571 Total energy: -740.484830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.484830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.484830 (E_RNA) where: Base-Base interactions energy: -479.835 where: short stacking energy: -227.448 Base-Backbone interact. energy: 0.477 local terms energy: -261.126716 where: bonds (distance) C4'-P energy: -56.328 bonds (distance) P-C4' energy: -66.078 flat angles C4'-P-C4' energy: -61.916 flat angles P-C4'-P energy: -29.261 tors. eta vs tors. theta energy: -47.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 195 Temperature: 1.092857 Total energy: -634.724099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -634.724099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -634.724099 (E_RNA) where: Base-Base interactions energy: -411.801 where: short stacking energy: -200.494 Base-Backbone interact. energy: 0.272 local terms energy: -223.195795 where: bonds (distance) C4'-P energy: -40.998 bonds (distance) P-C4' energy: -49.261 flat angles C4'-P-C4' energy: -59.537 flat angles P-C4'-P energy: -37.878 tors. eta vs tors. theta energy: -35.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 195 Temperature: 1.157143 Total energy: -580.609919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.609919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.609919 (E_RNA) where: Base-Base interactions energy: -366.849 where: short stacking energy: -176.703 Base-Backbone interact. energy: -0.821 local terms energy: -212.939279 where: bonds (distance) C4'-P energy: -47.661 bonds (distance) P-C4' energy: -54.109 flat angles C4'-P-C4' energy: -47.080 flat angles P-C4'-P energy: -35.764 tors. eta vs tors. theta energy: -28.326 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 195 Temperature: 1.221429 Total energy: -461.367266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.367266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.367266 (E_RNA) where: Base-Base interactions energy: -268.853 where: short stacking energy: -134.808 Base-Backbone interact. energy: -0.176 local terms energy: -192.338284 where: bonds (distance) C4'-P energy: -44.934 bonds (distance) P-C4' energy: -57.480 flat angles C4'-P-C4' energy: -43.545 flat angles P-C4'-P energy: -35.777 tors. eta vs tors. theta energy: -10.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 195 Temperature: 1.285714 Total energy: -269.416858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.416858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.416858 (E_RNA) where: Base-Base interactions energy: -97.622 where: short stacking energy: -86.591 Base-Backbone interact. energy: 0.788 local terms energy: -172.648604 where: bonds (distance) C4'-P energy: -39.704 bonds (distance) P-C4' energy: -44.091 flat angles C4'-P-C4' energy: -45.826 flat angles P-C4'-P energy: -37.842 tors. eta vs tors. theta energy: -5.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.066 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 195 Temperature: 1.350000 Total energy: -233.806816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.806816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.806816 (E_RNA) where: Base-Base interactions energy: -89.357 where: short stacking energy: -69.127 Base-Backbone interact. energy: -0.831 local terms energy: -143.618622 where: bonds (distance) C4'-P energy: -43.295 bonds (distance) P-C4' energy: -27.322 flat angles C4'-P-C4' energy: -52.407 flat angles P-C4'-P energy: -16.872 tors. eta vs tors. theta energy: -3.724 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 196 Temperature: 0.900000 Total energy: -845.970644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.970644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.970644 (E_RNA) where: Base-Base interactions energy: -578.790 where: short stacking energy: -249.470 Base-Backbone interact. energy: 1.582 local terms energy: -268.762852 where: bonds (distance) C4'-P energy: -54.989 bonds (distance) P-C4' energy: -59.295 flat angles C4'-P-C4' energy: -64.289 flat angles P-C4'-P energy: -34.730 tors. eta vs tors. theta energy: -55.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 196 Temperature: 0.964286 Total energy: -818.586095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.586095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -818.586095 (E_RNA) where: Base-Base interactions energy: -546.048 where: short stacking energy: -233.425 Base-Backbone interact. energy: -1.869 local terms energy: -270.668779 where: bonds (distance) C4'-P energy: -62.466 bonds (distance) P-C4' energy: -48.414 flat angles C4'-P-C4' energy: -54.770 flat angles P-C4'-P energy: -49.504 tors. eta vs tors. theta energy: -55.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 196 Temperature: 1.028571 Total energy: -754.602203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -754.602203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.602203 (E_RNA) where: Base-Base interactions energy: -499.972 where: short stacking energy: -255.298 Base-Backbone interact. energy: -1.138 local terms energy: -253.492346 where: bonds (distance) C4'-P energy: -53.025 bonds (distance) P-C4' energy: -54.711 flat angles C4'-P-C4' energy: -61.032 flat angles P-C4'-P energy: -32.392 tors. eta vs tors. theta energy: -52.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 196 Temperature: 1.092857 Total energy: -640.102328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.102328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.102328 (E_RNA) where: Base-Base interactions energy: -397.959 where: short stacking energy: -207.295 Base-Backbone interact. energy: 0.164 local terms energy: -242.307141 where: bonds (distance) C4'-P energy: -59.731 bonds (distance) P-C4' energy: -58.675 flat angles C4'-P-C4' energy: -50.352 flat angles P-C4'-P energy: -26.700 tors. eta vs tors. theta energy: -46.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 196 Temperature: 1.157143 Total energy: -606.688899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.688899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.688899 (E_RNA) where: Base-Base interactions energy: -380.608 where: short stacking energy: -174.481 Base-Backbone interact. energy: -1.392 local terms energy: -224.688079 where: bonds (distance) C4'-P energy: -50.408 bonds (distance) P-C4' energy: -62.432 flat angles C4'-P-C4' energy: -56.241 flat angles P-C4'-P energy: -23.810 tors. eta vs tors. theta energy: -31.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 196 Temperature: 1.221429 Total energy: -448.756747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.756747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.756747 (E_RNA) where: Base-Base interactions energy: -259.128 where: short stacking energy: -127.359 Base-Backbone interact. energy: -2.875 local terms energy: -186.754159 where: bonds (distance) C4'-P energy: -48.501 bonds (distance) P-C4' energy: -43.585 flat angles C4'-P-C4' energy: -50.419 flat angles P-C4'-P energy: -37.251 tors. eta vs tors. theta energy: -6.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 196 Temperature: 1.285714 Total energy: -259.709089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.709089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.709089 (E_RNA) where: Base-Base interactions energy: -99.911 where: short stacking energy: -83.601 Base-Backbone interact. energy: 4.140 local terms energy: -163.937549 where: bonds (distance) C4'-P energy: -50.192 bonds (distance) P-C4' energy: -43.865 flat angles C4'-P-C4' energy: -47.799 flat angles P-C4'-P energy: -23.056 tors. eta vs tors. theta energy: 0.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 196 Temperature: 1.350000 Total energy: -241.688707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.688707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.688707 (E_RNA) where: Base-Base interactions energy: -99.121 where: short stacking energy: -77.052 Base-Backbone interact. energy: -2.035 local terms energy: -140.533465 where: bonds (distance) C4'-P energy: -34.127 bonds (distance) P-C4' energy: -42.223 flat angles C4'-P-C4' energy: -38.936 flat angles P-C4'-P energy: -25.108 tors. eta vs tors. theta energy: -0.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 197 Temperature: 0.900000 Total energy: -833.756167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.756167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.756167 (E_RNA) where: Base-Base interactions energy: -577.111 where: short stacking energy: -238.387 Base-Backbone interact. energy: -1.515 local terms energy: -255.130526 where: bonds (distance) C4'-P energy: -49.784 bonds (distance) P-C4' energy: -60.639 flat angles C4'-P-C4' energy: -49.070 flat angles P-C4'-P energy: -45.420 tors. eta vs tors. theta energy: -50.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 197 Temperature: 0.964286 Total energy: -830.859516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -830.859516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -830.859516 (E_RNA) where: Base-Base interactions energy: -562.124 where: short stacking energy: -254.457 Base-Backbone interact. energy: -1.199 local terms energy: -267.536940 where: bonds (distance) C4'-P energy: -50.944 bonds (distance) P-C4' energy: -56.642 flat angles C4'-P-C4' energy: -54.580 flat angles P-C4'-P energy: -42.687 tors. eta vs tors. theta energy: -62.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 197 Temperature: 1.028571 Total energy: -753.736697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.736697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.736697 (E_RNA) where: Base-Base interactions energy: -497.909 where: short stacking energy: -254.974 Base-Backbone interact. energy: 1.697 local terms energy: -257.524970 where: bonds (distance) C4'-P energy: -59.809 bonds (distance) P-C4' energy: -50.697 flat angles C4'-P-C4' energy: -57.677 flat angles P-C4'-P energy: -35.860 tors. eta vs tors. theta energy: -53.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 197 Temperature: 1.092857 Total energy: -618.173955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.173955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.173955 (E_RNA) where: Base-Base interactions energy: -393.745 where: short stacking energy: -190.256 Base-Backbone interact. energy: -0.926 local terms energy: -223.503114 where: bonds (distance) C4'-P energy: -56.642 bonds (distance) P-C4' energy: -48.850 flat angles C4'-P-C4' energy: -55.491 flat angles P-C4'-P energy: -34.510 tors. eta vs tors. theta energy: -28.011 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 197 Temperature: 1.157143 Total energy: -599.034906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.034906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.034906 (E_RNA) where: Base-Base interactions energy: -413.575 where: short stacking energy: -191.013 Base-Backbone interact. energy: -1.026 local terms energy: -184.434118 where: bonds (distance) C4'-P energy: -40.011 bonds (distance) P-C4' energy: -44.974 flat angles C4'-P-C4' energy: -41.945 flat angles P-C4'-P energy: -31.495 tors. eta vs tors. theta energy: -26.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 197 Temperature: 1.221429 Total energy: -454.584772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.584772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.584772 (E_RNA) where: Base-Base interactions energy: -278.487 where: short stacking energy: -124.288 Base-Backbone interact. energy: -1.032 local terms energy: -175.065218 where: bonds (distance) C4'-P energy: -37.965 bonds (distance) P-C4' energy: -46.796 flat angles C4'-P-C4' energy: -38.375 flat angles P-C4'-P energy: -32.749 tors. eta vs tors. theta energy: -19.180 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 197 Temperature: 1.285714 Total energy: -243.367101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.367101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.367101 (E_RNA) where: Base-Base interactions energy: -71.971 where: short stacking energy: -64.293 Base-Backbone interact. energy: -0.849 local terms energy: -170.546527 where: bonds (distance) C4'-P energy: -47.264 bonds (distance) P-C4' energy: -51.984 flat angles C4'-P-C4' energy: -42.252 flat angles P-C4'-P energy: -31.376 tors. eta vs tors. theta energy: 2.330 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 197 Temperature: 1.350000 Total energy: -228.393373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.393373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.393373 (E_RNA) where: Base-Base interactions energy: -86.672 where: short stacking energy: -73.577 Base-Backbone interact. energy: -1.183 local terms energy: -140.538468 where: bonds (distance) C4'-P energy: -35.425 bonds (distance) P-C4' energy: -44.360 flat angles C4'-P-C4' energy: -43.113 flat angles P-C4'-P energy: -23.453 tors. eta vs tors. theta energy: 5.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 198 Temperature: 0.900000 Total energy: -873.777830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -873.777830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -873.777830 (E_RNA) where: Base-Base interactions energy: -604.051 where: short stacking energy: -265.126 Base-Backbone interact. energy: 0.187 local terms energy: -269.913727 where: bonds (distance) C4'-P energy: -54.543 bonds (distance) P-C4' energy: -60.487 flat angles C4'-P-C4' energy: -59.582 flat angles P-C4'-P energy: -40.330 tors. eta vs tors. theta energy: -54.972 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 198 Temperature: 0.964286 Total energy: -799.603162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.603162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.603162 (E_RNA) where: Base-Base interactions energy: -545.276 where: short stacking energy: -220.652 Base-Backbone interact. energy: -2.158 local terms energy: -252.168975 where: bonds (distance) C4'-P energy: -51.887 bonds (distance) P-C4' energy: -57.648 flat angles C4'-P-C4' energy: -57.983 flat angles P-C4'-P energy: -35.581 tors. eta vs tors. theta energy: -49.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 198 Temperature: 1.028571 Total energy: -723.191490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -723.191490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.191490 (E_RNA) where: Base-Base interactions energy: -473.797 where: short stacking energy: -233.077 Base-Backbone interact. energy: 1.473 local terms energy: -250.867781 where: bonds (distance) C4'-P energy: -48.856 bonds (distance) P-C4' energy: -55.065 flat angles C4'-P-C4' energy: -61.405 flat angles P-C4'-P energy: -32.876 tors. eta vs tors. theta energy: -52.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 198 Temperature: 1.092857 Total energy: -661.226744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.226744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.226744 (E_RNA) where: Base-Base interactions energy: -421.521 where: short stacking energy: -190.286 Base-Backbone interact. energy: -0.811 local terms energy: -238.894808 where: bonds (distance) C4'-P energy: -50.199 bonds (distance) P-C4' energy: -57.618 flat angles C4'-P-C4' energy: -53.390 flat angles P-C4'-P energy: -40.937 tors. eta vs tors. theta energy: -36.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 198 Temperature: 1.157143 Total energy: -615.959468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.959468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.959468 (E_RNA) where: Base-Base interactions energy: -389.705 where: short stacking energy: -180.380 Base-Backbone interact. energy: -0.220 local terms energy: -226.034637 where: bonds (distance) C4'-P energy: -47.788 bonds (distance) P-C4' energy: -57.317 flat angles C4'-P-C4' energy: -56.983 flat angles P-C4'-P energy: -24.964 tors. eta vs tors. theta energy: -38.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 198 Temperature: 1.221429 Total energy: -504.580572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.580572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.580572 (E_RNA) where: Base-Base interactions energy: -295.985 where: short stacking energy: -154.681 Base-Backbone interact. energy: 2.504 local terms energy: -211.100073 where: bonds (distance) C4'-P energy: -55.451 bonds (distance) P-C4' energy: -53.036 flat angles C4'-P-C4' energy: -49.576 flat angles P-C4'-P energy: -26.483 tors. eta vs tors. theta energy: -26.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 198 Temperature: 1.285714 Total energy: -252.217748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.217748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.217748 (E_RNA) where: Base-Base interactions energy: -80.740 where: short stacking energy: -60.179 Base-Backbone interact. energy: 0.530 local terms energy: -172.007850 where: bonds (distance) C4'-P energy: -46.839 bonds (distance) P-C4' energy: -50.676 flat angles C4'-P-C4' energy: -46.516 flat angles P-C4'-P energy: -33.503 tors. eta vs tors. theta energy: 5.526 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 198 Temperature: 1.350000 Total energy: -222.030678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.030678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.030678 (E_RNA) where: Base-Base interactions energy: -79.785 where: short stacking energy: -62.026 Base-Backbone interact. energy: -0.703 local terms energy: -141.542650 where: bonds (distance) C4'-P energy: -48.653 bonds (distance) P-C4' energy: -47.384 flat angles C4'-P-C4' energy: -38.128 flat angles P-C4'-P energy: -17.559 tors. eta vs tors. theta energy: 10.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 199 Temperature: 0.900000 Total energy: -875.404539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.404539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -875.404539 (E_RNA) where: Base-Base interactions energy: -617.669 where: short stacking energy: -269.974 Base-Backbone interact. energy: 2.207 local terms energy: -259.942687 where: bonds (distance) C4'-P energy: -50.934 bonds (distance) P-C4' energy: -55.571 flat angles C4'-P-C4' energy: -54.107 flat angles P-C4'-P energy: -44.656 tors. eta vs tors. theta energy: -54.674 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 199 Temperature: 0.964286 Total energy: -833.539882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.539882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.539882 (E_RNA) where: Base-Base interactions energy: -589.123 where: short stacking energy: -248.772 Base-Backbone interact. energy: -0.881 local terms energy: -243.535288 where: bonds (distance) C4'-P energy: -48.872 bonds (distance) P-C4' energy: -58.365 flat angles C4'-P-C4' energy: -50.197 flat angles P-C4'-P energy: -36.139 tors. eta vs tors. theta energy: -49.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 199 Temperature: 1.028571 Total energy: -716.176705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.176705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.176705 (E_RNA) where: Base-Base interactions energy: -470.259 where: short stacking energy: -236.221 Base-Backbone interact. energy: -0.772 local terms energy: -245.145573 where: bonds (distance) C4'-P energy: -51.451 bonds (distance) P-C4' energy: -48.815 flat angles C4'-P-C4' energy: -48.421 flat angles P-C4'-P energy: -40.428 tors. eta vs tors. theta energy: -56.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 199 Temperature: 1.092857 Total energy: -629.979640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.979640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.979640 (E_RNA) where: Base-Base interactions energy: -408.207 where: short stacking energy: -190.024 Base-Backbone interact. energy: -2.251 local terms energy: -219.521277 where: bonds (distance) C4'-P energy: -52.464 bonds (distance) P-C4' energy: -55.961 flat angles C4'-P-C4' energy: -48.350 flat angles P-C4'-P energy: -29.638 tors. eta vs tors. theta energy: -33.109 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 199 Temperature: 1.157143 Total energy: -614.578354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.578354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.578354 (E_RNA) where: Base-Base interactions energy: -384.910 where: short stacking energy: -184.695 Base-Backbone interact. energy: -0.680 local terms energy: -228.987695 where: bonds (distance) C4'-P energy: -44.899 bonds (distance) P-C4' energy: -49.452 flat angles C4'-P-C4' energy: -52.084 flat angles P-C4'-P energy: -36.565 tors. eta vs tors. theta energy: -45.988 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 199 Temperature: 1.221429 Total energy: -463.832794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.832794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.832794 (E_RNA) where: Base-Base interactions energy: -277.052 where: short stacking energy: -146.643 Base-Backbone interact. energy: 0.840 local terms energy: -187.620595 where: bonds (distance) C4'-P energy: -38.269 bonds (distance) P-C4' energy: -57.820 flat angles C4'-P-C4' energy: -42.769 flat angles P-C4'-P energy: -26.814 tors. eta vs tors. theta energy: -21.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 199 Temperature: 1.285714 Total energy: -269.501314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.501314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.501314 (E_RNA) where: Base-Base interactions energy: -104.712 where: short stacking energy: -94.970 Base-Backbone interact. energy: 1.837 local terms energy: -166.625745 where: bonds (distance) C4'-P energy: -40.691 bonds (distance) P-C4' energy: -56.892 flat angles C4'-P-C4' energy: -37.977 flat angles P-C4'-P energy: -26.281 tors. eta vs tors. theta energy: -4.784 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 199 Temperature: 1.350000 Total energy: -229.987725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.987725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.987725 (E_RNA) where: Base-Base interactions energy: -91.163 where: short stacking energy: -72.303 Base-Backbone interact. energy: 0.362 local terms energy: -140.833663 where: bonds (distance) C4'-P energy: -39.773 bonds (distance) P-C4' energy: -50.536 flat angles C4'-P-C4' energy: -55.673 flat angles P-C4'-P energy: -21.002 tors. eta vs tors. theta energy: 26.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.648 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 200 Temperature: 0.900000 Total energy: -889.978232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.978232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.978232 (E_RNA) where: Base-Base interactions energy: -610.408 where: short stacking energy: -257.496 Base-Backbone interact. energy: -2.540 local terms energy: -277.030601 where: bonds (distance) C4'-P energy: -50.173 bonds (distance) P-C4' energy: -63.483 flat angles C4'-P-C4' energy: -57.992 flat angles P-C4'-P energy: -48.109 tors. eta vs tors. theta energy: -57.273 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 200 Temperature: 0.964286 Total energy: -836.343570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.343570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.343570 (E_RNA) where: Base-Base interactions energy: -550.552 where: short stacking energy: -232.063 Base-Backbone interact. energy: -1.912 local terms energy: -283.879562 where: bonds (distance) C4'-P energy: -64.340 bonds (distance) P-C4' energy: -58.582 flat angles C4'-P-C4' energy: -60.373 flat angles P-C4'-P energy: -45.168 tors. eta vs tors. theta energy: -55.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 200 Temperature: 1.028571 Total energy: -722.184705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.184705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.184705 (E_RNA) where: Base-Base interactions energy: -472.140 where: short stacking energy: -230.001 Base-Backbone interact. energy: -1.654 local terms energy: -248.390622 where: bonds (distance) C4'-P energy: -52.710 bonds (distance) P-C4' energy: -55.117 flat angles C4'-P-C4' energy: -50.292 flat angles P-C4'-P energy: -37.481 tors. eta vs tors. theta energy: -52.790 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 200 Temperature: 1.092857 Total energy: -638.585663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.585663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.585663 (E_RNA) where: Base-Base interactions energy: -400.688 where: short stacking energy: -190.211 Base-Backbone interact. energy: -1.422 local terms energy: -236.476520 where: bonds (distance) C4'-P energy: -50.945 bonds (distance) P-C4' energy: -56.810 flat angles C4'-P-C4' energy: -50.256 flat angles P-C4'-P energy: -44.166 tors. eta vs tors. theta energy: -34.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 200 Temperature: 1.157143 Total energy: -618.930738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.930738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.930738 (E_RNA) where: Base-Base interactions energy: -380.357 where: short stacking energy: -193.912 Base-Backbone interact. energy: 2.676 local terms energy: -241.249910 where: bonds (distance) C4'-P energy: -44.661 bonds (distance) P-C4' energy: -56.564 flat angles C4'-P-C4' energy: -59.576 flat angles P-C4'-P energy: -32.019 tors. eta vs tors. theta energy: -48.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 200 Temperature: 1.221429 Total energy: -454.741267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.741267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.741267 (E_RNA) where: Base-Base interactions energy: -247.516 where: short stacking energy: -141.025 Base-Backbone interact. energy: -0.411 local terms energy: -206.814347 where: bonds (distance) C4'-P energy: -50.318 bonds (distance) P-C4' energy: -64.797 flat angles C4'-P-C4' energy: -48.432 flat angles P-C4'-P energy: -29.968 tors. eta vs tors. theta energy: -13.299 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 200 Temperature: 1.285714 Total energy: -278.090655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.090655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.090655 (E_RNA) where: Base-Base interactions energy: -86.777 where: short stacking energy: -79.572 Base-Backbone interact. energy: -1.911 local terms energy: -189.402829 where: bonds (distance) C4'-P energy: -55.388 bonds (distance) P-C4' energy: -55.226 flat angles C4'-P-C4' energy: -46.682 flat angles P-C4'-P energy: -31.104 tors. eta vs tors. theta energy: -1.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 200 Temperature: 1.350000 Total energy: -230.438405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.438405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.438405 (E_RNA) where: Base-Base interactions energy: -82.824 where: short stacking energy: -60.518 Base-Backbone interact. energy: -0.024 local terms energy: -147.590774 where: bonds (distance) C4'-P energy: -38.399 bonds (distance) P-C4' energy: -58.875 flat angles C4'-P-C4' energy: -47.719 flat angles P-C4'-P energy: -24.586 tors. eta vs tors. theta energy: 21.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 201 Temperature: 0.900000 Total energy: -904.866444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.866444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -904.866444 (E_RNA) where: Base-Base interactions energy: -636.768 where: short stacking energy: -261.057 Base-Backbone interact. energy: -3.015 local terms energy: -265.083127 where: bonds (distance) C4'-P energy: -55.879 bonds (distance) P-C4' energy: -59.544 flat angles C4'-P-C4' energy: -54.627 flat angles P-C4'-P energy: -39.728 tors. eta vs tors. theta energy: -55.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 201 Temperature: 0.964286 Total energy: -841.218949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.218949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.218949 (E_RNA) where: Base-Base interactions energy: -569.010 where: short stacking energy: -229.893 Base-Backbone interact. energy: -1.424 local terms energy: -270.784889 where: bonds (distance) C4'-P energy: -55.282 bonds (distance) P-C4' energy: -63.217 flat angles C4'-P-C4' energy: -59.695 flat angles P-C4'-P energy: -42.857 tors. eta vs tors. theta energy: -49.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 201 Temperature: 1.028571 Total energy: -703.826117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.826117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.826117 (E_RNA) where: Base-Base interactions energy: -446.271 where: short stacking energy: -218.983 Base-Backbone interact. energy: 1.703 local terms energy: -259.257610 where: bonds (distance) C4'-P energy: -54.131 bonds (distance) P-C4' energy: -61.145 flat angles C4'-P-C4' energy: -58.111 flat angles P-C4'-P energy: -33.537 tors. eta vs tors. theta energy: -52.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 201 Temperature: 1.092857 Total energy: -629.565572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.565572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.565572 (E_RNA) where: Base-Base interactions energy: -417.838 where: short stacking energy: -192.997 Base-Backbone interact. energy: -0.972 local terms energy: -210.755283 where: bonds (distance) C4'-P energy: -39.619 bonds (distance) P-C4' energy: -52.896 flat angles C4'-P-C4' energy: -49.610 flat angles P-C4'-P energy: -35.887 tors. eta vs tors. theta energy: -32.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 201 Temperature: 1.157143 Total energy: -631.121420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -631.121420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -631.121420 (E_RNA) where: Base-Base interactions energy: -405.607 where: short stacking energy: -199.102 Base-Backbone interact. energy: 1.718 local terms energy: -227.232367 where: bonds (distance) C4'-P energy: -44.176 bonds (distance) P-C4' energy: -54.901 flat angles C4'-P-C4' energy: -51.585 flat angles P-C4'-P energy: -36.365 tors. eta vs tors. theta energy: -40.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 201 Temperature: 1.221429 Total energy: -420.001036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.001036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.001036 (E_RNA) where: Base-Base interactions energy: -229.147 where: short stacking energy: -115.488 Base-Backbone interact. energy: -1.141 local terms energy: -189.713160 where: bonds (distance) C4'-P energy: -54.026 bonds (distance) P-C4' energy: -48.550 flat angles C4'-P-C4' energy: -40.396 flat angles P-C4'-P energy: -32.503 tors. eta vs tors. theta energy: -14.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 201 Temperature: 1.285714 Total energy: -243.025607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.025607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.025607 (E_RNA) where: Base-Base interactions energy: -79.768 where: short stacking energy: -67.927 Base-Backbone interact. energy: -0.880 local terms energy: -162.377534 where: bonds (distance) C4'-P energy: -44.790 bonds (distance) P-C4' energy: -52.335 flat angles C4'-P-C4' energy: -58.149 flat angles P-C4'-P energy: -23.447 tors. eta vs tors. theta energy: 16.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 201 Temperature: 1.350000 Total energy: -231.352225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.352225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.352225 (E_RNA) where: Base-Base interactions energy: -81.498 where: short stacking energy: -59.006 Base-Backbone interact. energy: 0.181 local terms energy: -150.034505 where: bonds (distance) C4'-P energy: -43.638 bonds (distance) P-C4' energy: -42.608 flat angles C4'-P-C4' energy: -50.652 flat angles P-C4'-P energy: -24.024 tors. eta vs tors. theta energy: 10.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 202 Temperature: 0.900000 Total energy: -904.448499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.448499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -904.448499 (E_RNA) where: Base-Base interactions energy: -645.310 where: short stacking energy: -272.976 Base-Backbone interact. energy: -2.518 local terms energy: -256.620318 where: bonds (distance) C4'-P energy: -48.703 bonds (distance) P-C4' energy: -52.271 flat angles C4'-P-C4' energy: -56.222 flat angles P-C4'-P energy: -43.246 tors. eta vs tors. theta energy: -56.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 202 Temperature: 0.964286 Total energy: -819.301713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.301713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.301713 (E_RNA) where: Base-Base interactions energy: -570.432 where: short stacking energy: -243.549 Base-Backbone interact. energy: -0.044 local terms energy: -248.825689 where: bonds (distance) C4'-P energy: -53.165 bonds (distance) P-C4' energy: -52.134 flat angles C4'-P-C4' energy: -52.383 flat angles P-C4'-P energy: -41.417 tors. eta vs tors. theta energy: -49.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 202 Temperature: 1.028571 Total energy: -724.779247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.779247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.779247 (E_RNA) where: Base-Base interactions energy: -473.706 where: short stacking energy: -240.079 Base-Backbone interact. energy: -2.001 local terms energy: -249.072420 where: bonds (distance) C4'-P energy: -47.949 bonds (distance) P-C4' energy: -51.845 flat angles C4'-P-C4' energy: -54.473 flat angles P-C4'-P energy: -37.991 tors. eta vs tors. theta energy: -56.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 202 Temperature: 1.092857 Total energy: -648.732085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.732085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.732085 (E_RNA) where: Base-Base interactions energy: -405.920 where: short stacking energy: -189.677 Base-Backbone interact. energy: 2.187 local terms energy: -244.999859 where: bonds (distance) C4'-P energy: -52.878 bonds (distance) P-C4' energy: -61.662 flat angles C4'-P-C4' energy: -59.134 flat angles P-C4'-P energy: -34.158 tors. eta vs tors. theta energy: -37.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 202 Temperature: 1.157143 Total energy: -630.744694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.744694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.744694 (E_RNA) where: Base-Base interactions energy: -417.958 where: short stacking energy: -198.854 Base-Backbone interact. energy: -0.929 local terms energy: -211.857307 where: bonds (distance) C4'-P energy: -43.272 bonds (distance) P-C4' energy: -45.079 flat angles C4'-P-C4' energy: -49.156 flat angles P-C4'-P energy: -28.792 tors. eta vs tors. theta energy: -45.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 202 Temperature: 1.221429 Total energy: -410.174489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.174489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.174489 (E_RNA) where: Base-Base interactions energy: -214.629 where: short stacking energy: -120.741 Base-Backbone interact. energy: -1.432 local terms energy: -194.114211 where: bonds (distance) C4'-P energy: -54.538 bonds (distance) P-C4' energy: -60.915 flat angles C4'-P-C4' energy: -46.254 flat angles P-C4'-P energy: -30.559 tors. eta vs tors. theta energy: -1.848 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 202 Temperature: 1.285714 Total energy: -268.578913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.578913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.578913 (E_RNA) where: Base-Base interactions energy: -118.794 where: short stacking energy: -80.131 Base-Backbone interact. energy: -0.618 local terms energy: -149.166634 where: bonds (distance) C4'-P energy: -50.736 bonds (distance) P-C4' energy: -47.668 flat angles C4'-P-C4' energy: -35.011 flat angles P-C4'-P energy: -25.314 tors. eta vs tors. theta energy: 9.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 202 Temperature: 1.350000 Total energy: -231.180261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.180261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.180261 (E_RNA) where: Base-Base interactions energy: -92.551 where: short stacking energy: -69.947 Base-Backbone interact. energy: -1.309 local terms energy: -137.320646 where: bonds (distance) C4'-P energy: -46.397 bonds (distance) P-C4' energy: -29.993 flat angles C4'-P-C4' energy: -49.515 flat angles P-C4'-P energy: -28.096 tors. eta vs tors. theta energy: 16.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 203 Temperature: 0.900000 Total energy: -879.607616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.607616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.607616 (E_RNA) where: Base-Base interactions energy: -618.003 where: short stacking energy: -269.127 Base-Backbone interact. energy: -0.813 local terms energy: -260.792095 where: bonds (distance) C4'-P energy: -53.817 bonds (distance) P-C4' energy: -50.335 flat angles C4'-P-C4' energy: -58.340 flat angles P-C4'-P energy: -45.632 tors. eta vs tors. theta energy: -52.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 203 Temperature: 0.964286 Total energy: -832.449500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.449500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.449500 (E_RNA) where: Base-Base interactions energy: -559.647 where: short stacking energy: -252.320 Base-Backbone interact. energy: -2.064 local terms energy: -270.738439 where: bonds (distance) C4'-P energy: -54.889 bonds (distance) P-C4' energy: -58.014 flat angles C4'-P-C4' energy: -59.834 flat angles P-C4'-P energy: -40.300 tors. eta vs tors. theta energy: -57.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 203 Temperature: 1.028571 Total energy: -735.768257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.768257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.768257 (E_RNA) where: Base-Base interactions energy: -481.954 where: short stacking energy: -245.476 Base-Backbone interact. energy: -0.790 local terms energy: -253.024322 where: bonds (distance) C4'-P energy: -54.711 bonds (distance) P-C4' energy: -53.279 flat angles C4'-P-C4' energy: -53.925 flat angles P-C4'-P energy: -31.842 tors. eta vs tors. theta energy: -59.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 203 Temperature: 1.092857 Total energy: -626.768944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.768944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.768944 (E_RNA) where: Base-Base interactions energy: -402.089 where: short stacking energy: -189.321 Base-Backbone interact. energy: -0.997 local terms energy: -223.682863 where: bonds (distance) C4'-P energy: -44.339 bonds (distance) P-C4' energy: -46.395 flat angles C4'-P-C4' energy: -56.004 flat angles P-C4'-P energy: -34.099 tors. eta vs tors. theta energy: -42.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 203 Temperature: 1.157143 Total energy: -617.801732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -617.801732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.801732 (E_RNA) where: Base-Base interactions energy: -403.169 where: short stacking energy: -192.375 Base-Backbone interact. energy: -0.549 local terms energy: -214.084052 where: bonds (distance) C4'-P energy: -48.693 bonds (distance) P-C4' energy: -48.172 flat angles C4'-P-C4' energy: -44.517 flat angles P-C4'-P energy: -37.106 tors. eta vs tors. theta energy: -35.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 203 Temperature: 1.221429 Total energy: -435.543646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.543646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.543646 (E_RNA) where: Base-Base interactions energy: -231.774 where: short stacking energy: -117.239 Base-Backbone interact. energy: -0.453 local terms energy: -203.317180 where: bonds (distance) C4'-P energy: -50.777 bonds (distance) P-C4' energy: -62.449 flat angles C4'-P-C4' energy: -44.628 flat angles P-C4'-P energy: -33.154 tors. eta vs tors. theta energy: -12.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 203 Temperature: 1.285714 Total energy: -283.335413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.335413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.335413 (E_RNA) where: Base-Base interactions energy: -122.989 where: short stacking energy: -75.037 Base-Backbone interact. energy: 2.404 local terms energy: -162.749633 where: bonds (distance) C4'-P energy: -57.973 bonds (distance) P-C4' energy: -58.477 flat angles C4'-P-C4' energy: -31.629 flat angles P-C4'-P energy: -17.907 tors. eta vs tors. theta energy: 3.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 203 Temperature: 1.350000 Total energy: -208.232242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.232242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.232242 (E_RNA) where: Base-Base interactions energy: -69.360 where: short stacking energy: -57.906 Base-Backbone interact. energy: -0.054 local terms energy: -138.818056 where: bonds (distance) C4'-P energy: -38.139 bonds (distance) P-C4' energy: -44.239 flat angles C4'-P-C4' energy: -46.016 flat angles P-C4'-P energy: -22.694 tors. eta vs tors. theta energy: 12.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 204 Temperature: 0.900000 Total energy: -894.072557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.072557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -894.072557 (E_RNA) where: Base-Base interactions energy: -629.265 where: short stacking energy: -256.375 Base-Backbone interact. energy: -0.760 local terms energy: -264.046956 where: bonds (distance) C4'-P energy: -56.089 bonds (distance) P-C4' energy: -60.034 flat angles C4'-P-C4' energy: -57.772 flat angles P-C4'-P energy: -36.562 tors. eta vs tors. theta energy: -53.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 204 Temperature: 0.964286 Total energy: -836.088792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.088792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.088792 (E_RNA) where: Base-Base interactions energy: -571.457 where: short stacking energy: -254.045 Base-Backbone interact. energy: -2.175 local terms energy: -262.456261 where: bonds (distance) C4'-P energy: -42.541 bonds (distance) P-C4' energy: -65.347 flat angles C4'-P-C4' energy: -64.583 flat angles P-C4'-P energy: -38.297 tors. eta vs tors. theta energy: -51.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 204 Temperature: 1.028571 Total energy: -751.082857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.082857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.082857 (E_RNA) where: Base-Base interactions energy: -480.589 where: short stacking energy: -242.789 Base-Backbone interact. energy: -0.333 local terms energy: -270.160885 where: bonds (distance) C4'-P energy: -53.325 bonds (distance) P-C4' energy: -62.076 flat angles C4'-P-C4' energy: -56.925 flat angles P-C4'-P energy: -35.333 tors. eta vs tors. theta energy: -62.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 204 Temperature: 1.092857 Total energy: -670.766608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -670.766608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.766608 (E_RNA) where: Base-Base interactions energy: -432.410 where: short stacking energy: -212.217 Base-Backbone interact. energy: -0.785 local terms energy: -237.571118 where: bonds (distance) C4'-P energy: -56.856 bonds (distance) P-C4' energy: -54.017 flat angles C4'-P-C4' energy: -59.613 flat angles P-C4'-P energy: -32.792 tors. eta vs tors. theta energy: -34.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 204 Temperature: 1.157143 Total energy: -616.462685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -616.462685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.462685 (E_RNA) where: Base-Base interactions energy: -388.915 where: short stacking energy: -191.849 Base-Backbone interact. energy: 1.703 local terms energy: -229.250457 where: bonds (distance) C4'-P energy: -50.896 bonds (distance) P-C4' energy: -53.433 flat angles C4'-P-C4' energy: -48.025 flat angles P-C4'-P energy: -34.307 tors. eta vs tors. theta energy: -42.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 204 Temperature: 1.221429 Total energy: -470.678581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.678581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.678581 (E_RNA) where: Base-Base interactions energy: -275.662 where: short stacking energy: -150.879 Base-Backbone interact. energy: -0.285 local terms energy: -194.731908 where: bonds (distance) C4'-P energy: -54.410 bonds (distance) P-C4' energy: -49.259 flat angles C4'-P-C4' energy: -43.528 flat angles P-C4'-P energy: -23.839 tors. eta vs tors. theta energy: -23.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 204 Temperature: 1.285714 Total energy: -292.794005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.794005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.794005 (E_RNA) where: Base-Base interactions energy: -134.743 where: short stacking energy: -99.553 Base-Backbone interact. energy: -0.141 local terms energy: -157.910514 where: bonds (distance) C4'-P energy: -38.629 bonds (distance) P-C4' energy: -53.824 flat angles C4'-P-C4' energy: -36.985 flat angles P-C4'-P energy: -28.737 tors. eta vs tors. theta energy: 0.265 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 204 Temperature: 1.350000 Total energy: -258.541860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.541860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.541860 (E_RNA) where: Base-Base interactions energy: -107.208 where: short stacking energy: -69.939 Base-Backbone interact. energy: -0.268 local terms energy: -151.065530 where: bonds (distance) C4'-P energy: -51.233 bonds (distance) P-C4' energy: -51.777 flat angles C4'-P-C4' energy: -33.211 flat angles P-C4'-P energy: -19.941 tors. eta vs tors. theta energy: 5.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 205 Temperature: 0.900000 Total energy: -896.820745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.820745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -896.820745 (E_RNA) where: Base-Base interactions energy: -631.866 where: short stacking energy: -262.752 Base-Backbone interact. energy: -1.595 local terms energy: -263.360036 where: bonds (distance) C4'-P energy: -54.343 bonds (distance) P-C4' energy: -50.661 flat angles C4'-P-C4' energy: -61.282 flat angles P-C4'-P energy: -41.810 tors. eta vs tors. theta energy: -55.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 205 Temperature: 0.964286 Total energy: -842.294446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -842.294446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -842.294446 (E_RNA) where: Base-Base interactions energy: -585.538 where: short stacking energy: -242.568 Base-Backbone interact. energy: -2.095 local terms energy: -254.661616 where: bonds (distance) C4'-P energy: -51.512 bonds (distance) P-C4' energy: -58.229 flat angles C4'-P-C4' energy: -53.926 flat angles P-C4'-P energy: -37.491 tors. eta vs tors. theta energy: -53.503 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 205 Temperature: 1.028571 Total energy: -737.285084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.285084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.285084 (E_RNA) where: Base-Base interactions energy: -469.438 where: short stacking energy: -246.031 Base-Backbone interact. energy: -2.005 local terms energy: -265.842297 where: bonds (distance) C4'-P energy: -62.328 bonds (distance) P-C4' energy: -54.879 flat angles C4'-P-C4' energy: -58.717 flat angles P-C4'-P energy: -29.755 tors. eta vs tors. theta energy: -60.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 205 Temperature: 1.092857 Total energy: -673.354066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.354066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.354066 (E_RNA) where: Base-Base interactions energy: -428.061 where: short stacking energy: -203.230 Base-Backbone interact. energy: -1.584 local terms energy: -243.708349 where: bonds (distance) C4'-P energy: -57.091 bonds (distance) P-C4' energy: -54.523 flat angles C4'-P-C4' energy: -52.117 flat angles P-C4'-P energy: -31.905 tors. eta vs tors. theta energy: -48.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 205 Temperature: 1.157143 Total energy: -639.911137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -639.911137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.911137 (E_RNA) where: Base-Base interactions energy: -426.450 where: short stacking energy: -204.973 Base-Backbone interact. energy: -1.160 local terms energy: -212.301712 where: bonds (distance) C4'-P energy: -49.043 bonds (distance) P-C4' energy: -33.075 flat angles C4'-P-C4' energy: -47.870 flat angles P-C4'-P energy: -39.743 tors. eta vs tors. theta energy: -42.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 205 Temperature: 1.221429 Total energy: -467.945837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.945837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.945837 (E_RNA) where: Base-Base interactions energy: -276.253 where: short stacking energy: -158.824 Base-Backbone interact. energy: -0.523 local terms energy: -191.169970 where: bonds (distance) C4'-P energy: -47.999 bonds (distance) P-C4' energy: -55.881 flat angles C4'-P-C4' energy: -38.263 flat angles P-C4'-P energy: -28.541 tors. eta vs tors. theta energy: -20.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 205 Temperature: 1.285714 Total energy: -249.479370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.479370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.479370 (E_RNA) where: Base-Base interactions energy: -85.935 where: short stacking energy: -76.175 Base-Backbone interact. energy: -1.449 local terms energy: -162.095878 where: bonds (distance) C4'-P energy: -50.600 bonds (distance) P-C4' energy: -53.169 flat angles C4'-P-C4' energy: -53.058 flat angles P-C4'-P energy: -18.913 tors. eta vs tors. theta energy: 13.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 205 Temperature: 1.350000 Total energy: -249.440723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.440723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.440723 (E_RNA) where: Base-Base interactions energy: -88.566 where: short stacking energy: -79.551 Base-Backbone interact. energy: -0.436 local terms energy: -160.439596 where: bonds (distance) C4'-P energy: -41.702 bonds (distance) P-C4' energy: -54.856 flat angles C4'-P-C4' energy: -33.544 flat angles P-C4'-P energy: -28.300 tors. eta vs tors. theta energy: -2.038 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 206 Temperature: 0.900000 Total energy: -872.727308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.727308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.727308 (E_RNA) where: Base-Base interactions energy: -599.940 where: short stacking energy: -249.979 Base-Backbone interact. energy: 0.068 local terms energy: -272.855429 where: bonds (distance) C4'-P energy: -64.846 bonds (distance) P-C4' energy: -57.006 flat angles C4'-P-C4' energy: -59.271 flat angles P-C4'-P energy: -37.270 tors. eta vs tors. theta energy: -54.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 206 Temperature: 0.964286 Total energy: -866.655526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.655526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.655526 (E_RNA) where: Base-Base interactions energy: -602.542 where: short stacking energy: -237.867 Base-Backbone interact. energy: -2.090 local terms energy: -262.023904 where: bonds (distance) C4'-P energy: -52.653 bonds (distance) P-C4' energy: -60.184 flat angles C4'-P-C4' energy: -57.254 flat angles P-C4'-P energy: -40.486 tors. eta vs tors. theta energy: -51.447 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 206 Temperature: 1.028571 Total energy: -728.378708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.378708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.378708 (E_RNA) where: Base-Base interactions energy: -475.154 where: short stacking energy: -246.451 Base-Backbone interact. energy: -1.048 local terms energy: -252.176681 where: bonds (distance) C4'-P energy: -52.892 bonds (distance) P-C4' energy: -53.586 flat angles C4'-P-C4' energy: -55.244 flat angles P-C4'-P energy: -28.037 tors. eta vs tors. theta energy: -62.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 206 Temperature: 1.092857 Total energy: -668.039477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.039477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.039477 (E_RNA) where: Base-Base interactions energy: -447.868 where: short stacking energy: -229.596 Base-Backbone interact. energy: 0.208 local terms energy: -220.378638 where: bonds (distance) C4'-P energy: -40.216 bonds (distance) P-C4' energy: -44.101 flat angles C4'-P-C4' energy: -55.992 flat angles P-C4'-P energy: -26.046 tors. eta vs tors. theta energy: -54.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 206 Temperature: 1.157143 Total energy: -642.878453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.878453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.878453 (E_RNA) where: Base-Base interactions energy: -391.086 where: short stacking energy: -208.793 Base-Backbone interact. energy: -1.431 local terms energy: -250.361088 where: bonds (distance) C4'-P energy: -55.572 bonds (distance) P-C4' energy: -56.641 flat angles C4'-P-C4' energy: -56.651 flat angles P-C4'-P energy: -41.786 tors. eta vs tors. theta energy: -39.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 206 Temperature: 1.221429 Total energy: -480.543033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.543033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.543033 (E_RNA) where: Base-Base interactions energy: -299.550 where: short stacking energy: -160.604 Base-Backbone interact. energy: 0.725 local terms energy: -181.717882 where: bonds (distance) C4'-P energy: -42.797 bonds (distance) P-C4' energy: -44.882 flat angles C4'-P-C4' energy: -33.141 flat angles P-C4'-P energy: -33.610 tors. eta vs tors. theta energy: -27.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 206 Temperature: 1.285714 Total energy: -257.222511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.222511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.222511 (E_RNA) where: Base-Base interactions energy: -117.762 where: short stacking energy: -99.391 Base-Backbone interact. energy: 0.051 local terms energy: -139.511240 where: bonds (distance) C4'-P energy: -35.889 bonds (distance) P-C4' energy: -51.693 flat angles C4'-P-C4' energy: -29.697 flat angles P-C4'-P energy: -16.808 tors. eta vs tors. theta energy: -5.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 206 Temperature: 1.350000 Total energy: -251.226135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.226135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.226135 (E_RNA) where: Base-Base interactions energy: -91.840 where: short stacking energy: -88.633 Base-Backbone interact. energy: -1.531 local terms energy: -157.855320 where: bonds (distance) C4'-P energy: -40.984 bonds (distance) P-C4' energy: -53.305 flat angles C4'-P-C4' energy: -36.638 flat angles P-C4'-P energy: -33.819 tors. eta vs tors. theta energy: 6.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 207 Temperature: 0.900000 Total energy: -895.554817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -895.554817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -895.554817 (E_RNA) where: Base-Base interactions energy: -618.437 where: short stacking energy: -247.475 Base-Backbone interact. energy: -1.331 local terms energy: -275.787368 where: bonds (distance) C4'-P energy: -58.121 bonds (distance) P-C4' energy: -54.831 flat angles C4'-P-C4' energy: -62.031 flat angles P-C4'-P energy: -45.280 tors. eta vs tors. theta energy: -55.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 207 Temperature: 0.964286 Total energy: -852.979880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -852.979880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -852.979880 (E_RNA) where: Base-Base interactions energy: -594.849 where: short stacking energy: -241.541 Base-Backbone interact. energy: -0.949 local terms energy: -257.181753 where: bonds (distance) C4'-P energy: -56.337 bonds (distance) P-C4' energy: -60.785 flat angles C4'-P-C4' energy: -57.791 flat angles P-C4'-P energy: -30.213 tors. eta vs tors. theta energy: -52.056 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 207 Temperature: 1.028571 Total energy: -720.855611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.855611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.855611 (E_RNA) where: Base-Base interactions energy: -462.822 where: short stacking energy: -243.251 Base-Backbone interact. energy: 1.267 local terms energy: -259.300286 where: bonds (distance) C4'-P energy: -49.654 bonds (distance) P-C4' energy: -59.671 flat angles C4'-P-C4' energy: -57.069 flat angles P-C4'-P energy: -35.993 tors. eta vs tors. theta energy: -56.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 207 Temperature: 1.092857 Total energy: -645.884293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.884293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.884293 (E_RNA) where: Base-Base interactions energy: -410.956 where: short stacking energy: -207.707 Base-Backbone interact. energy: -0.709 local terms energy: -234.219194 where: bonds (distance) C4'-P energy: -47.721 bonds (distance) P-C4' energy: -57.747 flat angles C4'-P-C4' energy: -47.700 flat angles P-C4'-P energy: -41.226 tors. eta vs tors. theta energy: -39.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 207 Temperature: 1.157143 Total energy: -634.372308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -634.372308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -634.372308 (E_RNA) where: Base-Base interactions energy: -411.636 where: short stacking energy: -210.618 Base-Backbone interact. energy: -1.549 local terms energy: -221.187818 where: bonds (distance) C4'-P energy: -43.968 bonds (distance) P-C4' energy: -50.946 flat angles C4'-P-C4' energy: -54.674 flat angles P-C4'-P energy: -37.346 tors. eta vs tors. theta energy: -34.253 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 207 Temperature: 1.221429 Total energy: -450.382194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.382194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.382194 (E_RNA) where: Base-Base interactions energy: -266.383 where: short stacking energy: -141.281 Base-Backbone interact. energy: -0.939 local terms energy: -183.060901 where: bonds (distance) C4'-P energy: -48.231 bonds (distance) P-C4' energy: -45.316 flat angles C4'-P-C4' energy: -45.690 flat angles P-C4'-P energy: -25.382 tors. eta vs tors. theta energy: -18.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 207 Temperature: 1.285714 Total energy: -256.858865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.858865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.858865 (E_RNA) where: Base-Base interactions energy: -105.718 where: short stacking energy: -78.941 Base-Backbone interact. energy: 1.764 local terms energy: -152.905086 where: bonds (distance) C4'-P energy: -37.442 bonds (distance) P-C4' energy: -51.081 flat angles C4'-P-C4' energy: -44.650 flat angles P-C4'-P energy: -27.005 tors. eta vs tors. theta energy: 7.273 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 207 Temperature: 1.350000 Total energy: -233.829348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.829348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.829348 (E_RNA) where: Base-Base interactions energy: -78.315 where: short stacking energy: -53.706 Base-Backbone interact. energy: -0.390 local terms energy: -155.123919 where: bonds (distance) C4'-P energy: -57.699 bonds (distance) P-C4' energy: -53.621 flat angles C4'-P-C4' energy: -33.393 flat angles P-C4'-P energy: -23.045 tors. eta vs tors. theta energy: 12.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 208 Temperature: 0.900000 Total energy: -860.690270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.690270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.690270 (E_RNA) where: Base-Base interactions energy: -596.957 where: short stacking energy: -238.228 Base-Backbone interact. energy: -3.092 local terms energy: -260.641617 where: bonds (distance) C4'-P energy: -65.935 bonds (distance) P-C4' energy: -56.412 flat angles C4'-P-C4' energy: -47.610 flat angles P-C4'-P energy: -40.887 tors. eta vs tors. theta energy: -49.797 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 208 Temperature: 0.964286 Total energy: -853.353544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.353544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.353544 (E_RNA) where: Base-Base interactions energy: -598.224 where: short stacking energy: -244.192 Base-Backbone interact. energy: -0.678 local terms energy: -254.451117 where: bonds (distance) C4'-P energy: -51.576 bonds (distance) P-C4' energy: -62.121 flat angles C4'-P-C4' energy: -58.250 flat angles P-C4'-P energy: -30.979 tors. eta vs tors. theta energy: -51.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 208 Temperature: 1.028571 Total energy: -711.922975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.922975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.922975 (E_RNA) where: Base-Base interactions energy: -445.022 where: short stacking energy: -238.701 Base-Backbone interact. energy: -0.117 local terms energy: -266.784260 where: bonds (distance) C4'-P energy: -50.015 bonds (distance) P-C4' energy: -58.020 flat angles C4'-P-C4' energy: -62.989 flat angles P-C4'-P energy: -35.193 tors. eta vs tors. theta energy: -60.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 208 Temperature: 1.092857 Total energy: -633.232410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.232410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.232410 (E_RNA) where: Base-Base interactions energy: -401.435 where: short stacking energy: -188.049 Base-Backbone interact. energy: 1.423 local terms energy: -233.220236 where: bonds (distance) C4'-P energy: -48.044 bonds (distance) P-C4' energy: -58.414 flat angles C4'-P-C4' energy: -48.779 flat angles P-C4'-P energy: -41.047 tors. eta vs tors. theta energy: -36.937 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 208 Temperature: 1.157143 Total energy: -665.614531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.614531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.614531 (E_RNA) where: Base-Base interactions energy: -428.626 where: short stacking energy: -229.654 Base-Backbone interact. energy: -0.725 local terms energy: -236.263384 where: bonds (distance) C4'-P energy: -45.954 bonds (distance) P-C4' energy: -56.517 flat angles C4'-P-C4' energy: -61.844 flat angles P-C4'-P energy: -23.234 tors. eta vs tors. theta energy: -48.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 208 Temperature: 1.221429 Total energy: -488.567621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.567621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.567621 (E_RNA) where: Base-Base interactions energy: -296.336 where: short stacking energy: -156.053 Base-Backbone interact. energy: -1.492 local terms energy: -190.739960 where: bonds (distance) C4'-P energy: -52.053 bonds (distance) P-C4' energy: -46.803 flat angles C4'-P-C4' energy: -52.303 flat angles P-C4'-P energy: -28.426 tors. eta vs tors. theta energy: -11.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 208 Temperature: 1.285714 Total energy: -254.971968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.971968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.971968 (E_RNA) where: Base-Base interactions energy: -79.803 where: short stacking energy: -70.702 Base-Backbone interact. energy: -0.618 local terms energy: -174.551032 where: bonds (distance) C4'-P energy: -47.084 bonds (distance) P-C4' energy: -53.053 flat angles C4'-P-C4' energy: -55.266 flat angles P-C4'-P energy: -22.634 tors. eta vs tors. theta energy: 3.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 208 Temperature: 1.350000 Total energy: -242.824210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.824210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.824210 (E_RNA) where: Base-Base interactions energy: -103.956 where: short stacking energy: -77.459 Base-Backbone interact. energy: -1.771 local terms energy: -137.097517 where: bonds (distance) C4'-P energy: -48.207 bonds (distance) P-C4' energy: -45.369 flat angles C4'-P-C4' energy: -35.974 flat angles P-C4'-P energy: -25.314 tors. eta vs tors. theta energy: 17.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 209 Temperature: 0.900000 Total energy: -879.937917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.937917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.937917 (E_RNA) where: Base-Base interactions energy: -604.431 where: short stacking energy: -241.817 Base-Backbone interact. energy: -0.939 local terms energy: -274.567769 where: bonds (distance) C4'-P energy: -54.659 bonds (distance) P-C4' energy: -58.993 flat angles C4'-P-C4' energy: -61.310 flat angles P-C4'-P energy: -40.252 tors. eta vs tors. theta energy: -59.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 209 Temperature: 0.964286 Total energy: -874.908584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -874.908584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.908584 (E_RNA) where: Base-Base interactions energy: -619.900 where: short stacking energy: -254.743 Base-Backbone interact. energy: 0.308 local terms energy: -255.316615 where: bonds (distance) C4'-P energy: -59.260 bonds (distance) P-C4' energy: -61.010 flat angles C4'-P-C4' energy: -55.198 flat angles P-C4'-P energy: -29.241 tors. eta vs tors. theta energy: -50.607 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 209 Temperature: 1.028571 Total energy: -732.820581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.820581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.820581 (E_RNA) where: Base-Base interactions energy: -487.035 where: short stacking energy: -249.929 Base-Backbone interact. energy: -0.662 local terms energy: -245.123670 where: bonds (distance) C4'-P energy: -48.984 bonds (distance) P-C4' energy: -46.630 flat angles C4'-P-C4' energy: -55.863 flat angles P-C4'-P energy: -27.181 tors. eta vs tors. theta energy: -66.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 209 Temperature: 1.092857 Total energy: -683.345403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.345403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.345403 (E_RNA) where: Base-Base interactions energy: -428.571 where: short stacking energy: -202.453 Base-Backbone interact. energy: -1.431 local terms energy: -253.343788 where: bonds (distance) C4'-P energy: -44.601 bonds (distance) P-C4' energy: -59.934 flat angles C4'-P-C4' energy: -55.537 flat angles P-C4'-P energy: -42.966 tors. eta vs tors. theta energy: -50.307 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 209 Temperature: 1.157143 Total energy: -638.724922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.724922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.724922 (E_RNA) where: Base-Base interactions energy: -414.497 where: short stacking energy: -196.097 Base-Backbone interact. energy: 1.290 local terms energy: -225.518166 where: bonds (distance) C4'-P energy: -49.509 bonds (distance) P-C4' energy: -50.930 flat angles C4'-P-C4' energy: -49.856 flat angles P-C4'-P energy: -34.886 tors. eta vs tors. theta energy: -40.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 209 Temperature: 1.221429 Total energy: -465.283364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.283364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.283364 (E_RNA) where: Base-Base interactions energy: -275.136 where: short stacking energy: -146.876 Base-Backbone interact. energy: 1.370 local terms energy: -191.516911 where: bonds (distance) C4'-P energy: -49.698 bonds (distance) P-C4' energy: -41.802 flat angles C4'-P-C4' energy: -52.867 flat angles P-C4'-P energy: -27.486 tors. eta vs tors. theta energy: -19.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 209 Temperature: 1.285714 Total energy: -264.537727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.537727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.537727 (E_RNA) where: Base-Base interactions energy: -100.497 where: short stacking energy: -93.289 Base-Backbone interact. energy: 0.563 local terms energy: -164.603930 where: bonds (distance) C4'-P energy: -49.256 bonds (distance) P-C4' energy: -44.311 flat angles C4'-P-C4' energy: -43.015 flat angles P-C4'-P energy: -32.093 tors. eta vs tors. theta energy: 4.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 209 Temperature: 1.350000 Total energy: -212.195237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.195237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.195237 (E_RNA) where: Base-Base interactions energy: -75.697 where: short stacking energy: -67.915 Base-Backbone interact. energy: -1.184 local terms energy: -135.313752 where: bonds (distance) C4'-P energy: -33.051 bonds (distance) P-C4' energy: -38.186 flat angles C4'-P-C4' energy: -51.615 flat angles P-C4'-P energy: -24.209 tors. eta vs tors. theta energy: 11.746 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 210 Temperature: 0.900000 Total energy: -900.087251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -900.087251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.087251 (E_RNA) where: Base-Base interactions energy: -633.174 where: short stacking energy: -253.291 Base-Backbone interact. energy: -1.822 local terms energy: -265.090877 where: bonds (distance) C4'-P energy: -53.235 bonds (distance) P-C4' energy: -56.570 flat angles C4'-P-C4' energy: -63.436 flat angles P-C4'-P energy: -37.006 tors. eta vs tors. theta energy: -54.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 210 Temperature: 0.964286 Total energy: -856.964604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.964604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -856.964604 (E_RNA) where: Base-Base interactions energy: -589.456 where: short stacking energy: -237.327 Base-Backbone interact. energy: -2.378 local terms energy: -265.130413 where: bonds (distance) C4'-P energy: -53.278 bonds (distance) P-C4' energy: -44.781 flat angles C4'-P-C4' energy: -64.522 flat angles P-C4'-P energy: -42.797 tors. eta vs tors. theta energy: -59.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 210 Temperature: 1.028571 Total energy: -713.571592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.571592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.571592 (E_RNA) where: Base-Base interactions energy: -465.855 where: short stacking energy: -228.454 Base-Backbone interact. energy: -2.395 local terms energy: -245.321264 where: bonds (distance) C4'-P energy: -50.788 bonds (distance) P-C4' energy: -54.153 flat angles C4'-P-C4' energy: -50.637 flat angles P-C4'-P energy: -29.753 tors. eta vs tors. theta energy: -59.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 210 Temperature: 1.092857 Total energy: -685.175818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.175818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.175818 (E_RNA) where: Base-Base interactions energy: -448.577 where: short stacking energy: -236.500 Base-Backbone interact. energy: -0.774 local terms energy: -235.824529 where: bonds (distance) C4'-P energy: -48.772 bonds (distance) P-C4' energy: -44.531 flat angles C4'-P-C4' energy: -61.873 flat angles P-C4'-P energy: -29.234 tors. eta vs tors. theta energy: -51.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 210 Temperature: 1.157143 Total energy: -640.028344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.028344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.028344 (E_RNA) where: Base-Base interactions energy: -415.204 where: short stacking energy: -206.035 Base-Backbone interact. energy: -0.558 local terms energy: -224.266648 where: bonds (distance) C4'-P energy: -45.638 bonds (distance) P-C4' energy: -47.725 flat angles C4'-P-C4' energy: -55.288 flat angles P-C4'-P energy: -30.240 tors. eta vs tors. theta energy: -45.374 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 210 Temperature: 1.221429 Total energy: -478.913325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.913325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.913325 (E_RNA) where: Base-Base interactions energy: -302.037 where: short stacking energy: -158.256 Base-Backbone interact. energy: 0.774 local terms energy: -177.650852 where: bonds (distance) C4'-P energy: -41.486 bonds (distance) P-C4' energy: -50.175 flat angles C4'-P-C4' energy: -39.730 flat angles P-C4'-P energy: -24.370 tors. eta vs tors. theta energy: -21.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 210 Temperature: 1.285714 Total energy: -249.105047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.105047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.105047 (E_RNA) where: Base-Base interactions energy: -101.866 where: short stacking energy: -71.408 Base-Backbone interact. energy: -0.485 local terms energy: -146.754010 where: bonds (distance) C4'-P energy: -50.032 bonds (distance) P-C4' energy: -48.745 flat angles C4'-P-C4' energy: -39.135 flat angles P-C4'-P energy: -14.623 tors. eta vs tors. theta energy: 5.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 210 Temperature: 1.350000 Total energy: -202.693643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.693643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.693643 (E_RNA) where: Base-Base interactions energy: -64.628 where: short stacking energy: -60.317 Base-Backbone interact. energy: -0.672 local terms energy: -137.393497 where: bonds (distance) C4'-P energy: -34.022 bonds (distance) P-C4' energy: -47.310 flat angles C4'-P-C4' energy: -44.031 flat angles P-C4'-P energy: -27.317 tors. eta vs tors. theta energy: 15.288 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 211 Temperature: 0.900000 Total energy: -921.092074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.092074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -921.092074 (E_RNA) where: Base-Base interactions energy: -628.624 where: short stacking energy: -257.739 Base-Backbone interact. energy: 1.191 local terms energy: -293.659044 where: bonds (distance) C4'-P energy: -64.594 bonds (distance) P-C4' energy: -59.475 flat angles C4'-P-C4' energy: -62.462 flat angles P-C4'-P energy: -47.134 tors. eta vs tors. theta energy: -59.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 211 Temperature: 0.964286 Total energy: -838.248693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.248693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.248693 (E_RNA) where: Base-Base interactions energy: -567.619 where: short stacking energy: -217.124 Base-Backbone interact. energy: -4.921 local terms energy: -265.708611 where: bonds (distance) C4'-P energy: -59.296 bonds (distance) P-C4' energy: -61.789 flat angles C4'-P-C4' energy: -49.075 flat angles P-C4'-P energy: -39.509 tors. eta vs tors. theta energy: -56.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 211 Temperature: 1.028571 Total energy: -703.222527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.222527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.222527 (E_RNA) where: Base-Base interactions energy: -448.466 where: short stacking energy: -212.355 Base-Backbone interact. energy: -2.162 local terms energy: -252.593816 where: bonds (distance) C4'-P energy: -53.269 bonds (distance) P-C4' energy: -52.117 flat angles C4'-P-C4' energy: -61.880 flat angles P-C4'-P energy: -38.717 tors. eta vs tors. theta energy: -46.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 211 Temperature: 1.092857 Total energy: -689.816784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.816784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.816784 (E_RNA) where: Base-Base interactions energy: -461.912 where: short stacking energy: -235.161 Base-Backbone interact. energy: 0.334 local terms energy: -228.238581 where: bonds (distance) C4'-P energy: -46.195 bonds (distance) P-C4' energy: -59.282 flat angles C4'-P-C4' energy: -48.193 flat angles P-C4'-P energy: -29.519 tors. eta vs tors. theta energy: -45.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 211 Temperature: 1.157143 Total energy: -666.601105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.601105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.601105 (E_RNA) where: Base-Base interactions energy: -437.750 where: short stacking energy: -209.534 Base-Backbone interact. energy: -2.266 local terms energy: -226.585250 where: bonds (distance) C4'-P energy: -52.415 bonds (distance) P-C4' energy: -49.197 flat angles C4'-P-C4' energy: -44.278 flat angles P-C4'-P energy: -29.349 tors. eta vs tors. theta energy: -51.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 211 Temperature: 1.221429 Total energy: -508.375502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.375502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.375502 (E_RNA) where: Base-Base interactions energy: -316.012 where: short stacking energy: -155.802 Base-Backbone interact. energy: -1.434 local terms energy: -190.929808 where: bonds (distance) C4'-P energy: -48.585 bonds (distance) P-C4' energy: -52.281 flat angles C4'-P-C4' energy: -43.476 flat angles P-C4'-P energy: -27.917 tors. eta vs tors. theta energy: -18.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 211 Temperature: 1.285714 Total energy: -239.250891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.250891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.250891 (E_RNA) where: Base-Base interactions energy: -82.185 where: short stacking energy: -67.639 Base-Backbone interact. energy: 0.922 local terms energy: -157.988408 where: bonds (distance) C4'-P energy: -40.309 bonds (distance) P-C4' energy: -52.045 flat angles C4'-P-C4' energy: -44.140 flat angles P-C4'-P energy: -30.582 tors. eta vs tors. theta energy: 9.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 211 Temperature: 1.350000 Total energy: -219.253580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.253580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.253580 (E_RNA) where: Base-Base interactions energy: -83.202 where: short stacking energy: -76.493 Base-Backbone interact. energy: -0.665 local terms energy: -135.386488 where: bonds (distance) C4'-P energy: -39.926 bonds (distance) P-C4' energy: -36.086 flat angles C4'-P-C4' energy: -34.513 flat angles P-C4'-P energy: -26.973 tors. eta vs tors. theta energy: 2.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 212 Temperature: 0.900000 Total energy: -926.346037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -926.346037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.346037 (E_RNA) where: Base-Base interactions energy: -659.533 where: short stacking energy: -257.892 Base-Backbone interact. energy: -0.198 local terms energy: -266.614503 where: bonds (distance) C4'-P energy: -58.279 bonds (distance) P-C4' energy: -54.037 flat angles C4'-P-C4' energy: -56.505 flat angles P-C4'-P energy: -37.792 tors. eta vs tors. theta energy: -60.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 212 Temperature: 0.964286 Total energy: -825.140690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -825.140690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -825.140690 (E_RNA) where: Base-Base interactions energy: -565.970 where: short stacking energy: -241.081 Base-Backbone interact. energy: -0.108 local terms energy: -259.062814 where: bonds (distance) C4'-P energy: -60.219 bonds (distance) P-C4' energy: -59.104 flat angles C4'-P-C4' energy: -55.663 flat angles P-C4'-P energy: -31.410 tors. eta vs tors. theta energy: -52.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 212 Temperature: 1.028571 Total energy: -700.539514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.539514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.539514 (E_RNA) where: Base-Base interactions energy: -469.382 where: short stacking energy: -219.018 Base-Backbone interact. energy: -2.132 local terms energy: -229.025721 where: bonds (distance) C4'-P energy: -55.676 bonds (distance) P-C4' energy: -44.143 flat angles C4'-P-C4' energy: -56.414 flat angles P-C4'-P energy: -26.440 tors. eta vs tors. theta energy: -46.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 212 Temperature: 1.092857 Total energy: -667.460003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.460003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.460003 (E_RNA) where: Base-Base interactions energy: -443.534 where: short stacking energy: -197.394 Base-Backbone interact. energy: 0.371 local terms energy: -224.296721 where: bonds (distance) C4'-P energy: -49.552 bonds (distance) P-C4' energy: -56.614 flat angles C4'-P-C4' energy: -49.898 flat angles P-C4'-P energy: -32.520 tors. eta vs tors. theta energy: -35.712 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 212 Temperature: 1.157143 Total energy: -652.978934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -652.978934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.978934 (E_RNA) where: Base-Base interactions energy: -407.716 where: short stacking energy: -205.286 Base-Backbone interact. energy: -0.220 local terms energy: -245.042785 where: bonds (distance) C4'-P energy: -48.383 bonds (distance) P-C4' energy: -63.782 flat angles C4'-P-C4' energy: -56.704 flat angles P-C4'-P energy: -29.550 tors. eta vs tors. theta energy: -46.624 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 212 Temperature: 1.221429 Total energy: -517.223231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.223231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.223231 (E_RNA) where: Base-Base interactions energy: -316.336 where: short stacking energy: -151.010 Base-Backbone interact. energy: -1.299 local terms energy: -199.587771 where: bonds (distance) C4'-P energy: -43.006 bonds (distance) P-C4' energy: -50.568 flat angles C4'-P-C4' energy: -58.044 flat angles P-C4'-P energy: -22.541 tors. eta vs tors. theta energy: -25.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 212 Temperature: 1.285714 Total energy: -256.603240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.603240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.603240 (E_RNA) where: Base-Base interactions energy: -89.156 where: short stacking energy: -78.711 Base-Backbone interact. energy: 0.910 local terms energy: -168.356662 where: bonds (distance) C4'-P energy: -54.053 bonds (distance) P-C4' energy: -43.572 flat angles C4'-P-C4' energy: -46.131 flat angles P-C4'-P energy: -32.531 tors. eta vs tors. theta energy: 7.931 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 212 Temperature: 1.350000 Total energy: -241.193572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.193572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.193572 (E_RNA) where: Base-Base interactions energy: -93.192 where: short stacking energy: -86.534 Base-Backbone interact. energy: -1.070 local terms energy: -146.932032 where: bonds (distance) C4'-P energy: -35.704 bonds (distance) P-C4' energy: -56.074 flat angles C4'-P-C4' energy: -32.716 flat angles P-C4'-P energy: -28.702 tors. eta vs tors. theta energy: 6.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 213 Temperature: 0.900000 Total energy: -919.127009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -919.127009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.127009 (E_RNA) where: Base-Base interactions energy: -649.569 where: short stacking energy: -275.887 Base-Backbone interact. energy: -1.521 local terms energy: -268.036978 where: bonds (distance) C4'-P energy: -54.416 bonds (distance) P-C4' energy: -47.294 flat angles C4'-P-C4' energy: -56.961 flat angles P-C4'-P energy: -44.051 tors. eta vs tors. theta energy: -65.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 213 Temperature: 0.964286 Total energy: -853.984457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.984457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.984457 (E_RNA) where: Base-Base interactions energy: -572.310 where: short stacking energy: -227.645 Base-Backbone interact. energy: 1.178 local terms energy: -282.852770 where: bonds (distance) C4'-P energy: -62.197 bonds (distance) P-C4' energy: -57.543 flat angles C4'-P-C4' energy: -65.473 flat angles P-C4'-P energy: -39.458 tors. eta vs tors. theta energy: -58.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 213 Temperature: 1.028571 Total energy: -746.074014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.074014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.074014 (E_RNA) where: Base-Base interactions energy: -485.811 where: short stacking energy: -227.931 Base-Backbone interact. energy: -1.630 local terms energy: -258.632382 where: bonds (distance) C4'-P energy: -46.353 bonds (distance) P-C4' energy: -57.041 flat angles C4'-P-C4' energy: -62.635 flat angles P-C4'-P energy: -35.171 tors. eta vs tors. theta energy: -57.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 213 Temperature: 1.092857 Total energy: -663.753194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.753194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.753194 (E_RNA) where: Base-Base interactions energy: -423.531 where: short stacking energy: -187.162 Base-Backbone interact. energy: -1.708 local terms energy: -238.514355 where: bonds (distance) C4'-P energy: -57.644 bonds (distance) P-C4' energy: -52.891 flat angles C4'-P-C4' energy: -52.763 flat angles P-C4'-P energy: -37.295 tors. eta vs tors. theta energy: -37.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 213 Temperature: 1.157143 Total energy: -663.465511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.465511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.465511 (E_RNA) where: Base-Base interactions energy: -430.118 where: short stacking energy: -203.586 Base-Backbone interact. energy: -1.604 local terms energy: -231.743393 where: bonds (distance) C4'-P energy: -43.466 bonds (distance) P-C4' energy: -55.033 flat angles C4'-P-C4' energy: -55.850 flat angles P-C4'-P energy: -34.875 tors. eta vs tors. theta energy: -42.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 213 Temperature: 1.221429 Total energy: -485.090345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.090345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.090345 (E_RNA) where: Base-Base interactions energy: -307.627 where: short stacking energy: -150.764 Base-Backbone interact. energy: 2.359 local terms energy: -179.822834 where: bonds (distance) C4'-P energy: -35.507 bonds (distance) P-C4' energy: -53.230 flat angles C4'-P-C4' energy: -35.782 flat angles P-C4'-P energy: -27.414 tors. eta vs tors. theta energy: -27.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 213 Temperature: 1.285714 Total energy: -293.605102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.605102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.605102 (E_RNA) where: Base-Base interactions energy: -142.687 where: short stacking energy: -95.040 Base-Backbone interact. energy: -0.075 local terms energy: -154.734968 where: bonds (distance) C4'-P energy: -46.956 bonds (distance) P-C4' energy: -38.979 flat angles C4'-P-C4' energy: -53.159 flat angles P-C4'-P energy: -15.550 tors. eta vs tors. theta energy: -0.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 3.892 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 213 Temperature: 1.350000 Total energy: -244.652378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.652378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.652378 (E_RNA) where: Base-Base interactions energy: -78.068 where: short stacking energy: -64.584 Base-Backbone interact. energy: -0.769 local terms energy: -165.815403 where: bonds (distance) C4'-P energy: -52.480 bonds (distance) P-C4' energy: -56.993 flat angles C4'-P-C4' energy: -35.456 flat angles P-C4'-P energy: -30.225 tors. eta vs tors. theta energy: 9.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 214 Temperature: 0.900000 Total energy: -908.531992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -908.531992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -908.531992 (E_RNA) where: Base-Base interactions energy: -626.682 where: short stacking energy: -256.816 Base-Backbone interact. energy: -2.045 local terms energy: -279.805215 where: bonds (distance) C4'-P energy: -55.123 bonds (distance) P-C4' energy: -57.998 flat angles C4'-P-C4' energy: -64.652 flat angles P-C4'-P energy: -43.099 tors. eta vs tors. theta energy: -58.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 214 Temperature: 0.964286 Total energy: -915.686942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -915.686942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -915.686942 (E_RNA) where: Base-Base interactions energy: -654.404 where: short stacking energy: -271.766 Base-Backbone interact. energy: -1.959 local terms energy: -259.323859 where: bonds (distance) C4'-P energy: -42.099 bonds (distance) P-C4' energy: -57.770 flat angles C4'-P-C4' energy: -59.388 flat angles P-C4'-P energy: -39.589 tors. eta vs tors. theta energy: -60.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 214 Temperature: 1.028571 Total energy: -733.430936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -733.430936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -733.430936 (E_RNA) where: Base-Base interactions energy: -473.466 where: short stacking energy: -224.954 Base-Backbone interact. energy: -0.790 local terms energy: -259.175066 where: bonds (distance) C4'-P energy: -58.225 bonds (distance) P-C4' energy: -57.410 flat angles C4'-P-C4' energy: -55.650 flat angles P-C4'-P energy: -34.784 tors. eta vs tors. theta energy: -53.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 214 Temperature: 1.092857 Total energy: -622.225699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.225699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.225699 (E_RNA) where: Base-Base interactions energy: -405.150 where: short stacking energy: -177.110 Base-Backbone interact. energy: -1.571 local terms energy: -215.504183 where: bonds (distance) C4'-P energy: -50.838 bonds (distance) P-C4' energy: -61.139 flat angles C4'-P-C4' energy: -45.926 flat angles P-C4'-P energy: -26.260 tors. eta vs tors. theta energy: -31.341 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 214 Temperature: 1.157143 Total energy: -643.686047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.686047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.686047 (E_RNA) where: Base-Base interactions energy: -425.148 where: short stacking energy: -194.361 Base-Backbone interact. energy: 0.028 local terms energy: -218.566127 where: bonds (distance) C4'-P energy: -47.130 bonds (distance) P-C4' energy: -53.401 flat angles C4'-P-C4' energy: -44.512 flat angles P-C4'-P energy: -27.141 tors. eta vs tors. theta energy: -46.383 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 214 Temperature: 1.221429 Total energy: -483.818871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.818871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.818871 (E_RNA) where: Base-Base interactions energy: -282.642 where: short stacking energy: -148.031 Base-Backbone interact. energy: -0.294 local terms energy: -200.882376 where: bonds (distance) C4'-P energy: -51.425 bonds (distance) P-C4' energy: -61.969 flat angles C4'-P-C4' energy: -42.015 flat angles P-C4'-P energy: -28.292 tors. eta vs tors. theta energy: -17.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 214 Temperature: 1.285714 Total energy: -296.521084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.521084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.521084 (E_RNA) where: Base-Base interactions energy: -142.724 where: short stacking energy: -103.437 Base-Backbone interact. energy: 2.151 local terms energy: -155.948687 where: bonds (distance) C4'-P energy: -49.440 bonds (distance) P-C4' energy: -43.659 flat angles C4'-P-C4' energy: -35.455 flat angles P-C4'-P energy: -31.864 tors. eta vs tors. theta energy: 4.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 214 Temperature: 1.350000 Total energy: -271.342220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.342220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.342220 (E_RNA) where: Base-Base interactions energy: -103.157 where: short stacking energy: -87.645 Base-Backbone interact. energy: 0.908 local terms energy: -169.093718 where: bonds (distance) C4'-P energy: -50.330 bonds (distance) P-C4' energy: -43.037 flat angles C4'-P-C4' energy: -34.015 flat angles P-C4'-P energy: -37.323 tors. eta vs tors. theta energy: -4.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 215 Temperature: 0.900000 Total energy: -866.861050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.861050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.861050 (E_RNA) where: Base-Base interactions energy: -590.026 where: short stacking energy: -239.594 Base-Backbone interact. energy: -2.151 local terms energy: -274.683848 where: bonds (distance) C4'-P energy: -63.677 bonds (distance) P-C4' energy: -58.588 flat angles C4'-P-C4' energy: -52.199 flat angles P-C4'-P energy: -40.370 tors. eta vs tors. theta energy: -59.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 215 Temperature: 0.964286 Total energy: -884.880555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.880555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -884.880555 (E_RNA) where: Base-Base interactions energy: -633.633 where: short stacking energy: -258.418 Base-Backbone interact. energy: 0.598 local terms energy: -251.844999 where: bonds (distance) C4'-P energy: -51.694 bonds (distance) P-C4' energy: -50.867 flat angles C4'-P-C4' energy: -57.753 flat angles P-C4'-P energy: -32.458 tors. eta vs tors. theta energy: -59.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 215 Temperature: 1.028571 Total energy: -707.562861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.562861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.562861 (E_RNA) where: Base-Base interactions energy: -450.335 where: short stacking energy: -202.374 Base-Backbone interact. energy: -1.020 local terms energy: -256.207799 where: bonds (distance) C4'-P energy: -54.804 bonds (distance) P-C4' energy: -54.171 flat angles C4'-P-C4' energy: -62.808 flat angles P-C4'-P energy: -38.314 tors. eta vs tors. theta energy: -46.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 215 Temperature: 1.092857 Total energy: -675.193329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.193329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.193329 (E_RNA) where: Base-Base interactions energy: -434.595 where: short stacking energy: -197.241 Base-Backbone interact. energy: -1.772 local terms energy: -238.826069 where: bonds (distance) C4'-P energy: -61.465 bonds (distance) P-C4' energy: -51.425 flat angles C4'-P-C4' energy: -45.435 flat angles P-C4'-P energy: -31.244 tors. eta vs tors. theta energy: -49.257 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 215 Temperature: 1.157143 Total energy: -591.548268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.548268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.548268 (E_RNA) where: Base-Base interactions energy: -354.511 where: short stacking energy: -171.600 Base-Backbone interact. energy: -0.551 local terms energy: -236.486338 where: bonds (distance) C4'-P energy: -52.620 bonds (distance) P-C4' energy: -59.082 flat angles C4'-P-C4' energy: -54.416 flat angles P-C4'-P energy: -38.810 tors. eta vs tors. theta energy: -31.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 215 Temperature: 1.221429 Total energy: -506.646450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.646450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.646450 (E_RNA) where: Base-Base interactions energy: -320.514 where: short stacking energy: -152.066 Base-Backbone interact. energy: 1.293 local terms energy: -187.425763 where: bonds (distance) C4'-P energy: -44.880 bonds (distance) P-C4' energy: -48.300 flat angles C4'-P-C4' energy: -47.147 flat angles P-C4'-P energy: -28.575 tors. eta vs tors. theta energy: -18.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 215 Temperature: 1.285714 Total energy: -285.933875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.933875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.933875 (E_RNA) where: Base-Base interactions energy: -122.066 where: short stacking energy: -81.195 Base-Backbone interact. energy: -1.348 local terms energy: -162.519545 where: bonds (distance) C4'-P energy: -50.599 bonds (distance) P-C4' energy: -52.492 flat angles C4'-P-C4' energy: -34.554 flat angles P-C4'-P energy: -26.185 tors. eta vs tors. theta energy: 1.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 215 Temperature: 1.350000 Total energy: -271.942460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.942460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.942460 (E_RNA) where: Base-Base interactions energy: -108.559 where: short stacking energy: -76.842 Base-Backbone interact. energy: 1.793 local terms energy: -165.175672 where: bonds (distance) C4'-P energy: -38.091 bonds (distance) P-C4' energy: -47.009 flat angles C4'-P-C4' energy: -45.585 flat angles P-C4'-P energy: -37.369 tors. eta vs tors. theta energy: 2.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 216 Temperature: 0.900000 Total energy: -883.859455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -883.859455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -883.859455 (E_RNA) where: Base-Base interactions energy: -611.756 where: short stacking energy: -259.254 Base-Backbone interact. energy: -2.292 local terms energy: -269.811136 where: bonds (distance) C4'-P energy: -62.617 bonds (distance) P-C4' energy: -61.823 flat angles C4'-P-C4' energy: -55.040 flat angles P-C4'-P energy: -30.489 tors. eta vs tors. theta energy: -59.843 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 216 Temperature: 0.964286 Total energy: -872.028031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.028031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.028031 (E_RNA) where: Base-Base interactions energy: -616.488 where: short stacking energy: -252.506 Base-Backbone interact. energy: -2.331 local terms energy: -253.208694 where: bonds (distance) C4'-P energy: -55.877 bonds (distance) P-C4' energy: -47.735 flat angles C4'-P-C4' energy: -52.469 flat angles P-C4'-P energy: -40.607 tors. eta vs tors. theta energy: -56.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 216 Temperature: 1.028571 Total energy: -702.222971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.222971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.222971 (E_RNA) where: Base-Base interactions energy: -444.763 where: short stacking energy: -213.386 Base-Backbone interact. energy: -0.076 local terms energy: -257.383495 where: bonds (distance) C4'-P energy: -49.215 bonds (distance) P-C4' energy: -64.732 flat angles C4'-P-C4' energy: -51.878 flat angles P-C4'-P energy: -50.147 tors. eta vs tors. theta energy: -41.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 216 Temperature: 1.092857 Total energy: -652.591392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -652.591392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.591392 (E_RNA) where: Base-Base interactions energy: -414.034 where: short stacking energy: -210.739 Base-Backbone interact. energy: -1.081 local terms energy: -237.476744 where: bonds (distance) C4'-P energy: -52.608 bonds (distance) P-C4' energy: -53.339 flat angles C4'-P-C4' energy: -53.870 flat angles P-C4'-P energy: -37.349 tors. eta vs tors. theta energy: -40.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 216 Temperature: 1.157143 Total energy: -611.117099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.117099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.117099 (E_RNA) where: Base-Base interactions energy: -390.478 where: short stacking energy: -199.052 Base-Backbone interact. energy: -2.024 local terms energy: -218.614461 where: bonds (distance) C4'-P energy: -51.854 bonds (distance) P-C4' energy: -52.569 flat angles C4'-P-C4' energy: -53.816 flat angles P-C4'-P energy: -25.427 tors. eta vs tors. theta energy: -34.950 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 216 Temperature: 1.221429 Total energy: -473.586303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.586303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.586303 (E_RNA) where: Base-Base interactions energy: -283.927 where: short stacking energy: -129.772 Base-Backbone interact. energy: -3.165 local terms energy: -186.494536 where: bonds (distance) C4'-P energy: -50.606 bonds (distance) P-C4' energy: -39.630 flat angles C4'-P-C4' energy: -48.072 flat angles P-C4'-P energy: -28.178 tors. eta vs tors. theta energy: -20.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 216 Temperature: 1.285714 Total energy: -300.817949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.817949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.817949 (E_RNA) where: Base-Base interactions energy: -138.633 where: short stacking energy: -99.743 Base-Backbone interact. energy: 4.187 local terms energy: -166.371752 where: bonds (distance) C4'-P energy: -41.587 bonds (distance) P-C4' energy: -50.770 flat angles C4'-P-C4' energy: -40.575 flat angles P-C4'-P energy: -24.857 tors. eta vs tors. theta energy: -8.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 216 Temperature: 1.350000 Total energy: -232.540505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.540505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.540505 (E_RNA) where: Base-Base interactions energy: -90.795 where: short stacking energy: -67.287 Base-Backbone interact. energy: -0.093 local terms energy: -141.652422 where: bonds (distance) C4'-P energy: -51.169 bonds (distance) P-C4' energy: -40.679 flat angles C4'-P-C4' energy: -43.434 flat angles P-C4'-P energy: -11.815 tors. eta vs tors. theta energy: 5.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 217 Temperature: 0.900000 Total energy: -881.233916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -881.233916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.233916 (E_RNA) where: Base-Base interactions energy: -602.846 where: short stacking energy: -254.139 Base-Backbone interact. energy: -1.269 local terms energy: -277.118858 where: bonds (distance) C4'-P energy: -50.614 bonds (distance) P-C4' energy: -63.300 flat angles C4'-P-C4' energy: -60.695 flat angles P-C4'-P energy: -42.688 tors. eta vs tors. theta energy: -59.822 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 217 Temperature: 0.964286 Total energy: -865.854843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -865.854843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -865.854843 (E_RNA) where: Base-Base interactions energy: -606.622 where: short stacking energy: -250.630 Base-Backbone interact. energy: -2.018 local terms energy: -257.215585 where: bonds (distance) C4'-P energy: -59.239 bonds (distance) P-C4' energy: -56.875 flat angles C4'-P-C4' energy: -43.712 flat angles P-C4'-P energy: -36.157 tors. eta vs tors. theta energy: -61.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 217 Temperature: 1.028571 Total energy: -693.126822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.126822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.126822 (E_RNA) where: Base-Base interactions energy: -444.455 where: short stacking energy: -218.598 Base-Backbone interact. energy: -3.186 local terms energy: -245.486003 where: bonds (distance) C4'-P energy: -44.517 bonds (distance) P-C4' energy: -58.067 flat angles C4'-P-C4' energy: -54.671 flat angles P-C4'-P energy: -41.675 tors. eta vs tors. theta energy: -46.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 217 Temperature: 1.092857 Total energy: -659.243997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.243997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.243997 (E_RNA) where: Base-Base interactions energy: -422.085 where: short stacking energy: -203.472 Base-Backbone interact. energy: 0.520 local terms energy: -237.678730 where: bonds (distance) C4'-P energy: -60.298 bonds (distance) P-C4' energy: -46.981 flat angles C4'-P-C4' energy: -49.093 flat angles P-C4'-P energy: -32.339 tors. eta vs tors. theta energy: -48.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 217 Temperature: 1.157143 Total energy: -605.849940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.849940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.849940 (E_RNA) where: Base-Base interactions energy: -391.562 where: short stacking energy: -183.278 Base-Backbone interact. energy: 0.445 local terms energy: -214.732797 where: bonds (distance) C4'-P energy: -48.336 bonds (distance) P-C4' energy: -48.439 flat angles C4'-P-C4' energy: -47.725 flat angles P-C4'-P energy: -36.072 tors. eta vs tors. theta energy: -34.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 217 Temperature: 1.221429 Total energy: -473.431598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.431598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.431598 (E_RNA) where: Base-Base interactions energy: -290.682 where: short stacking energy: -140.532 Base-Backbone interact. energy: -1.702 local terms energy: -181.047502 where: bonds (distance) C4'-P energy: -45.306 bonds (distance) P-C4' energy: -49.745 flat angles C4'-P-C4' energy: -51.030 flat angles P-C4'-P energy: -18.217 tors. eta vs tors. theta energy: -16.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 217 Temperature: 1.285714 Total energy: -264.196637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.196637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.196637 (E_RNA) where: Base-Base interactions energy: -122.190 where: short stacking energy: -76.231 Base-Backbone interact. energy: 5.416 local terms energy: -147.422709 where: bonds (distance) C4'-P energy: -43.667 bonds (distance) P-C4' energy: -58.994 flat angles C4'-P-C4' energy: -37.380 flat angles P-C4'-P energy: -20.784 tors. eta vs tors. theta energy: 13.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 217 Temperature: 1.350000 Total energy: -247.690344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.690344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.690344 (E_RNA) where: Base-Base interactions energy: -101.737 where: short stacking energy: -73.163 Base-Backbone interact. energy: 0.354 local terms energy: -146.307665 where: bonds (distance) C4'-P energy: -48.322 bonds (distance) P-C4' energy: -55.468 flat angles C4'-P-C4' energy: -30.904 flat angles P-C4'-P energy: -14.978 tors. eta vs tors. theta energy: 3.364 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 218 Temperature: 0.900000 Total energy: -886.384471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -886.384471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.384471 (E_RNA) where: Base-Base interactions energy: -628.149 where: short stacking energy: -252.178 Base-Backbone interact. energy: -0.564 local terms energy: -257.671461 where: bonds (distance) C4'-P energy: -57.329 bonds (distance) P-C4' energy: -47.322 flat angles C4'-P-C4' energy: -54.927 flat angles P-C4'-P energy: -41.278 tors. eta vs tors. theta energy: -56.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 218 Temperature: 0.964286 Total energy: -868.102467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -868.102467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -868.102467 (E_RNA) where: Base-Base interactions energy: -600.986 where: short stacking energy: -255.127 Base-Backbone interact. energy: 2.009 local terms energy: -269.124999 where: bonds (distance) C4'-P energy: -49.265 bonds (distance) P-C4' energy: -58.545 flat angles C4'-P-C4' energy: -62.724 flat angles P-C4'-P energy: -34.623 tors. eta vs tors. theta energy: -63.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 218 Temperature: 1.028571 Total energy: -698.771987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.771987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.771987 (E_RNA) where: Base-Base interactions energy: -458.928 where: short stacking energy: -222.483 Base-Backbone interact. energy: -1.211 local terms energy: -238.632851 where: bonds (distance) C4'-P energy: -41.571 bonds (distance) P-C4' energy: -61.075 flat angles C4'-P-C4' energy: -64.795 flat angles P-C4'-P energy: -30.291 tors. eta vs tors. theta energy: -40.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 218 Temperature: 1.092857 Total energy: -661.236808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.236808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.236808 (E_RNA) where: Base-Base interactions energy: -422.712 where: short stacking energy: -184.324 Base-Backbone interact. energy: 2.149 local terms energy: -240.673160 where: bonds (distance) C4'-P energy: -54.815 bonds (distance) P-C4' energy: -52.519 flat angles C4'-P-C4' energy: -53.360 flat angles P-C4'-P energy: -35.562 tors. eta vs tors. theta energy: -44.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 218 Temperature: 1.157143 Total energy: -613.428348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.428348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.428348 (E_RNA) where: Base-Base interactions energy: -391.048 where: short stacking energy: -184.220 Base-Backbone interact. energy: 2.924 local terms energy: -225.304163 where: bonds (distance) C4'-P energy: -61.020 bonds (distance) P-C4' energy: -51.763 flat angles C4'-P-C4' energy: -50.492 flat angles P-C4'-P energy: -32.627 tors. eta vs tors. theta energy: -29.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 218 Temperature: 1.221429 Total energy: -473.060373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.060373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.060373 (E_RNA) where: Base-Base interactions energy: -298.678 where: short stacking energy: -156.109 Base-Backbone interact. energy: -0.061 local terms energy: -174.322136 where: bonds (distance) C4'-P energy: -29.808 bonds (distance) P-C4' energy: -53.151 flat angles C4'-P-C4' energy: -37.559 flat angles P-C4'-P energy: -31.687 tors. eta vs tors. theta energy: -22.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 218 Temperature: 1.285714 Total energy: -261.663573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.663573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.663573 (E_RNA) where: Base-Base interactions energy: -85.329 where: short stacking energy: -70.106 Base-Backbone interact. energy: 5.899 local terms energy: -182.233467 where: bonds (distance) C4'-P energy: -50.476 bonds (distance) P-C4' energy: -61.760 flat angles C4'-P-C4' energy: -41.740 flat angles P-C4'-P energy: -26.884 tors. eta vs tors. theta energy: -1.374 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 218 Temperature: 1.350000 Total energy: -301.427740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.427740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.427740 (E_RNA) where: Base-Base interactions energy: -146.742 where: short stacking energy: -91.456 Base-Backbone interact. energy: -1.833 local terms energy: -152.852836 where: bonds (distance) C4'-P energy: -50.117 bonds (distance) P-C4' energy: -49.422 flat angles C4'-P-C4' energy: -33.978 flat angles P-C4'-P energy: -20.663 tors. eta vs tors. theta energy: 1.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 219 Temperature: 0.900000 Total energy: -914.890675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -914.890675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -914.890675 (E_RNA) where: Base-Base interactions energy: -628.781 where: short stacking energy: -244.163 Base-Backbone interact. energy: -1.099 local terms energy: -285.010659 where: bonds (distance) C4'-P energy: -57.342 bonds (distance) P-C4' energy: -64.470 flat angles C4'-P-C4' energy: -58.137 flat angles P-C4'-P energy: -41.914 tors. eta vs tors. theta energy: -63.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 219 Temperature: 0.964286 Total energy: -867.898519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -867.898519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.898519 (E_RNA) where: Base-Base interactions energy: -601.469 where: short stacking energy: -253.345 Base-Backbone interact. energy: 0.233 local terms energy: -266.662569 where: bonds (distance) C4'-P energy: -56.297 bonds (distance) P-C4' energy: -54.705 flat angles C4'-P-C4' energy: -57.838 flat angles P-C4'-P energy: -42.412 tors. eta vs tors. theta energy: -55.410 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 219 Temperature: 1.028571 Total energy: -707.422803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.422803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.422803 (E_RNA) where: Base-Base interactions energy: -451.043 where: short stacking energy: -220.805 Base-Backbone interact. energy: 0.888 local terms energy: -257.267434 where: bonds (distance) C4'-P energy: -49.290 bonds (distance) P-C4' energy: -56.962 flat angles C4'-P-C4' energy: -59.135 flat angles P-C4'-P energy: -41.433 tors. eta vs tors. theta energy: -50.447 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 219 Temperature: 1.092857 Total energy: -666.060173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.060173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.060173 (E_RNA) where: Base-Base interactions energy: -414.816 where: short stacking energy: -195.642 Base-Backbone interact. energy: -0.860 local terms energy: -250.384518 where: bonds (distance) C4'-P energy: -56.611 bonds (distance) P-C4' energy: -59.252 flat angles C4'-P-C4' energy: -52.717 flat angles P-C4'-P energy: -42.651 tors. eta vs tors. theta energy: -39.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 219 Temperature: 1.157143 Total energy: -591.768568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.768568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.768568 (E_RNA) where: Base-Base interactions energy: -392.526 where: short stacking energy: -172.861 Base-Backbone interact. energy: -0.764 local terms energy: -198.478907 where: bonds (distance) C4'-P energy: -52.789 bonds (distance) P-C4' energy: -52.055 flat angles C4'-P-C4' energy: -45.174 flat angles P-C4'-P energy: -20.454 tors. eta vs tors. theta energy: -28.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 219 Temperature: 1.221429 Total energy: -493.220382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.220382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.220382 (E_RNA) where: Base-Base interactions energy: -301.002 where: short stacking energy: -133.540 Base-Backbone interact. energy: -1.943 local terms energy: -190.275096 where: bonds (distance) C4'-P energy: -56.893 bonds (distance) P-C4' energy: -47.375 flat angles C4'-P-C4' energy: -50.630 flat angles P-C4'-P energy: -25.635 tors. eta vs tors. theta energy: -9.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 219 Temperature: 1.285714 Total energy: -247.065917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.065917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.065917 (E_RNA) where: Base-Base interactions energy: -81.022 where: short stacking energy: -68.671 Base-Backbone interact. energy: -0.585 local terms energy: -165.459020 where: bonds (distance) C4'-P energy: -32.087 bonds (distance) P-C4' energy: -55.588 flat angles C4'-P-C4' energy: -39.250 flat angles P-C4'-P energy: -38.590 tors. eta vs tors. theta energy: 0.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 219 Temperature: 1.350000 Total energy: -281.295572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.295572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.295572 (E_RNA) where: Base-Base interactions energy: -124.266 where: short stacking energy: -98.805 Base-Backbone interact. energy: 3.258 local terms energy: -160.287114 where: bonds (distance) C4'-P energy: -52.318 bonds (distance) P-C4' energy: -44.069 flat angles C4'-P-C4' energy: -48.285 flat angles P-C4'-P energy: -14.465 tors. eta vs tors. theta energy: -1.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 220 Temperature: 0.900000 Total energy: -900.712564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -900.712564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.712564 (E_RNA) where: Base-Base interactions energy: -614.303 where: short stacking energy: -258.314 Base-Backbone interact. energy: -1.454 local terms energy: -284.955449 where: bonds (distance) C4'-P energy: -67.593 bonds (distance) P-C4' energy: -59.145 flat angles C4'-P-C4' energy: -55.378 flat angles P-C4'-P energy: -36.246 tors. eta vs tors. theta energy: -66.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 220 Temperature: 0.964286 Total energy: -846.913815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.913815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -846.913815 (E_RNA) where: Base-Base interactions energy: -575.039 where: short stacking energy: -235.596 Base-Backbone interact. energy: 0.811 local terms energy: -272.685986 where: bonds (distance) C4'-P energy: -52.862 bonds (distance) P-C4' energy: -57.372 flat angles C4'-P-C4' energy: -62.059 flat angles P-C4'-P energy: -44.060 tors. eta vs tors. theta energy: -56.333 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 220 Temperature: 1.028571 Total energy: -704.066587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.066587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.066587 (E_RNA) where: Base-Base interactions energy: -434.139 where: short stacking energy: -210.694 Base-Backbone interact. energy: -3.671 local terms energy: -266.255989 where: bonds (distance) C4'-P energy: -62.102 bonds (distance) P-C4' energy: -55.384 flat angles C4'-P-C4' energy: -66.912 flat angles P-C4'-P energy: -32.803 tors. eta vs tors. theta energy: -49.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 220 Temperature: 1.092857 Total energy: -680.046348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.046348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.046348 (E_RNA) where: Base-Base interactions energy: -428.569 where: short stacking energy: -204.022 Base-Backbone interact. energy: -0.395 local terms energy: -251.082425 where: bonds (distance) C4'-P energy: -53.343 bonds (distance) P-C4' energy: -54.918 flat angles C4'-P-C4' energy: -59.175 flat angles P-C4'-P energy: -41.174 tors. eta vs tors. theta energy: -42.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 220 Temperature: 1.157143 Total energy: -582.114872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.114872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.114872 (E_RNA) where: Base-Base interactions energy: -360.138 where: short stacking energy: -158.829 Base-Backbone interact. energy: 0.407 local terms energy: -222.384798 where: bonds (distance) C4'-P energy: -48.193 bonds (distance) P-C4' energy: -52.929 flat angles C4'-P-C4' energy: -52.404 flat angles P-C4'-P energy: -36.347 tors. eta vs tors. theta energy: -32.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 220 Temperature: 1.221429 Total energy: -492.648104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.648104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.648104 (E_RNA) where: Base-Base interactions energy: -300.357 where: short stacking energy: -131.361 Base-Backbone interact. energy: 1.562 local terms energy: -193.853574 where: bonds (distance) C4'-P energy: -51.417 bonds (distance) P-C4' energy: -57.115 flat angles C4'-P-C4' energy: -43.487 flat angles P-C4'-P energy: -25.073 tors. eta vs tors. theta energy: -16.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 220 Temperature: 1.285714 Total energy: -342.587518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.587518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.587518 (E_RNA) where: Base-Base interactions energy: -160.031 where: short stacking energy: -110.799 Base-Backbone interact. energy: -0.594 local terms energy: -181.962714 where: bonds (distance) C4'-P energy: -53.544 bonds (distance) P-C4' energy: -46.238 flat angles C4'-P-C4' energy: -47.030 flat angles P-C4'-P energy: -30.371 tors. eta vs tors. theta energy: -4.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 220 Temperature: 1.350000 Total energy: -223.601488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.601488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.601488 (E_RNA) where: Base-Base interactions energy: -86.468 where: short stacking energy: -74.877 Base-Backbone interact. energy: 0.547 local terms energy: -137.679814 where: bonds (distance) C4'-P energy: -39.757 bonds (distance) P-C4' energy: -44.974 flat angles C4'-P-C4' energy: -26.175 flat angles P-C4'-P energy: -30.327 tors. eta vs tors. theta energy: 3.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 221 Temperature: 0.900000 Total energy: -945.877899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.877899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.877899 (E_RNA) where: Base-Base interactions energy: -655.570 where: short stacking energy: -273.246 Base-Backbone interact. energy: 1.534 local terms energy: -291.841482 where: bonds (distance) C4'-P energy: -63.952 bonds (distance) P-C4' energy: -61.456 flat angles C4'-P-C4' energy: -60.912 flat angles P-C4'-P energy: -38.060 tors. eta vs tors. theta energy: -67.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 221 Temperature: 0.964286 Total energy: -843.922500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.922500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.922500 (E_RNA) where: Base-Base interactions energy: -570.526 where: short stacking energy: -241.831 Base-Backbone interact. energy: -0.896 local terms energy: -272.500784 where: bonds (distance) C4'-P energy: -46.516 bonds (distance) P-C4' energy: -63.283 flat angles C4'-P-C4' energy: -63.997 flat angles P-C4'-P energy: -41.173 tors. eta vs tors. theta energy: -57.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 221 Temperature: 1.028571 Total energy: -714.211775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.211775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.211775 (E_RNA) where: Base-Base interactions energy: -471.816 where: short stacking energy: -232.530 Base-Backbone interact. energy: -3.115 local terms energy: -239.280878 where: bonds (distance) C4'-P energy: -50.918 bonds (distance) P-C4' energy: -58.671 flat angles C4'-P-C4' energy: -48.712 flat angles P-C4'-P energy: -26.029 tors. eta vs tors. theta energy: -54.950 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 221 Temperature: 1.092857 Total energy: -678.564554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.564554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.564554 (E_RNA) where: Base-Base interactions energy: -436.431 where: short stacking energy: -216.348 Base-Backbone interact. energy: -0.457 local terms energy: -241.676842 where: bonds (distance) C4'-P energy: -49.503 bonds (distance) P-C4' energy: -55.646 flat angles C4'-P-C4' energy: -59.718 flat angles P-C4'-P energy: -25.361 tors. eta vs tors. theta energy: -51.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 221 Temperature: 1.157143 Total energy: -596.770805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.770805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.770805 (E_RNA) where: Base-Base interactions energy: -393.374 where: short stacking energy: -190.118 Base-Backbone interact. energy: 0.385 local terms energy: -203.781802 where: bonds (distance) C4'-P energy: -48.688 bonds (distance) P-C4' energy: -49.401 flat angles C4'-P-C4' energy: -47.053 flat angles P-C4'-P energy: -21.943 tors. eta vs tors. theta energy: -36.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 221 Temperature: 1.221429 Total energy: -503.807933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.807933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.807933 (E_RNA) where: Base-Base interactions energy: -308.939 where: short stacking energy: -132.911 Base-Backbone interact. energy: -2.295 local terms energy: -192.574356 where: bonds (distance) C4'-P energy: -45.611 bonds (distance) P-C4' energy: -48.275 flat angles C4'-P-C4' energy: -44.343 flat angles P-C4'-P energy: -27.815 tors. eta vs tors. theta energy: -26.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 221 Temperature: 1.285714 Total energy: -296.293930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.293930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.293930 (E_RNA) where: Base-Base interactions energy: -133.946 where: short stacking energy: -97.131 Base-Backbone interact. energy: -1.400 local terms energy: -161.658115 where: bonds (distance) C4'-P energy: -45.852 bonds (distance) P-C4' energy: -55.245 flat angles C4'-P-C4' energy: -27.869 flat angles P-C4'-P energy: -26.185 tors. eta vs tors. theta energy: -6.507 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.711 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 221 Temperature: 1.350000 Total energy: -237.943484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.943484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.943484 (E_RNA) where: Base-Base interactions energy: -104.918 where: short stacking energy: -76.110 Base-Backbone interact. energy: 1.919 local terms energy: -134.944323 where: bonds (distance) C4'-P energy: -43.066 bonds (distance) P-C4' energy: -42.804 flat angles C4'-P-C4' energy: -47.606 flat angles P-C4'-P energy: -16.540 tors. eta vs tors. theta energy: 15.071 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 222 Temperature: 0.900000 Total energy: -939.271876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -939.271876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.271876 (E_RNA) where: Base-Base interactions energy: -661.063 where: short stacking energy: -288.458 Base-Backbone interact. energy: 0.522 local terms energy: -278.731163 where: bonds (distance) C4'-P energy: -56.105 bonds (distance) P-C4' energy: -56.869 flat angles C4'-P-C4' energy: -58.964 flat angles P-C4'-P energy: -37.931 tors. eta vs tors. theta energy: -68.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 222 Temperature: 0.964286 Total energy: -846.915509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.915509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -846.915509 (E_RNA) where: Base-Base interactions energy: -569.441 where: short stacking energy: -235.995 Base-Backbone interact. energy: -1.063 local terms energy: -276.411035 where: bonds (distance) C4'-P energy: -45.259 bonds (distance) P-C4' energy: -59.507 flat angles C4'-P-C4' energy: -67.612 flat angles P-C4'-P energy: -45.540 tors. eta vs tors. theta energy: -58.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 222 Temperature: 1.028571 Total energy: -708.886971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.886971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.886971 (E_RNA) where: Base-Base interactions energy: -452.945 where: short stacking energy: -223.150 Base-Backbone interact. energy: -0.755 local terms energy: -255.187184 where: bonds (distance) C4'-P energy: -52.185 bonds (distance) P-C4' energy: -55.906 flat angles C4'-P-C4' energy: -55.167 flat angles P-C4'-P energy: -38.652 tors. eta vs tors. theta energy: -53.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 222 Temperature: 1.092857 Total energy: -638.298291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.298291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.298291 (E_RNA) where: Base-Base interactions energy: -421.119 where: short stacking energy: -215.159 Base-Backbone interact. energy: -0.330 local terms energy: -217.611607 where: bonds (distance) C4'-P energy: -55.255 bonds (distance) P-C4' energy: -36.263 flat angles C4'-P-C4' energy: -56.139 flat angles P-C4'-P energy: -32.691 tors. eta vs tors. theta energy: -37.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.763 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 222 Temperature: 1.157143 Total energy: -657.725788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.725788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.725788 (E_RNA) where: Base-Base interactions energy: -434.904 where: short stacking energy: -209.344 Base-Backbone interact. energy: -1.556 local terms energy: -221.265763 where: bonds (distance) C4'-P energy: -53.408 bonds (distance) P-C4' energy: -52.954 flat angles C4'-P-C4' energy: -52.168 flat angles P-C4'-P energy: -26.605 tors. eta vs tors. theta energy: -36.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 222 Temperature: 1.221429 Total energy: -516.424383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.424383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.424383 (E_RNA) where: Base-Base interactions energy: -338.426 where: short stacking energy: -163.191 Base-Backbone interact. energy: -2.025 local terms energy: -175.974027 where: bonds (distance) C4'-P energy: -32.032 bonds (distance) P-C4' energy: -43.521 flat angles C4'-P-C4' energy: -46.671 flat angles P-C4'-P energy: -24.559 tors. eta vs tors. theta energy: -29.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 222 Temperature: 1.285714 Total energy: -293.191879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.191879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.191879 (E_RNA) where: Base-Base interactions energy: -137.581 where: short stacking energy: -85.860 Base-Backbone interact. energy: -1.850 local terms energy: -153.761563 where: bonds (distance) C4'-P energy: -54.144 bonds (distance) P-C4' energy: -49.477 flat angles C4'-P-C4' energy: -44.243 flat angles P-C4'-P energy: -18.557 tors. eta vs tors. theta energy: 12.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 222 Temperature: 1.350000 Total energy: -242.929794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.929794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.929794 (E_RNA) where: Base-Base interactions energy: -107.595 where: short stacking energy: -79.758 Base-Backbone interact. energy: 0.309 local terms energy: -135.643874 where: bonds (distance) C4'-P energy: -40.939 bonds (distance) P-C4' energy: -46.517 flat angles C4'-P-C4' energy: -38.450 flat angles P-C4'-P energy: -24.057 tors. eta vs tors. theta energy: 14.320 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 223 Temperature: 0.900000 Total energy: -933.355934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -933.355934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -933.355934 (E_RNA) where: Base-Base interactions energy: -650.880 where: short stacking energy: -264.783 Base-Backbone interact. energy: 0.246 local terms energy: -282.722596 where: bonds (distance) C4'-P energy: -59.631 bonds (distance) P-C4' energy: -58.054 flat angles C4'-P-C4' energy: -64.046 flat angles P-C4'-P energy: -35.763 tors. eta vs tors. theta energy: -65.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 223 Temperature: 0.964286 Total energy: -848.734309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.734309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -848.734309 (E_RNA) where: Base-Base interactions energy: -586.708 where: short stacking energy: -259.299 Base-Backbone interact. energy: -1.913 local terms energy: -260.113369 where: bonds (distance) C4'-P energy: -55.714 bonds (distance) P-C4' energy: -51.139 flat angles C4'-P-C4' energy: -51.852 flat angles P-C4'-P energy: -35.996 tors. eta vs tors. theta energy: -65.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 223 Temperature: 1.028571 Total energy: -694.212918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.212918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.212918 (E_RNA) where: Base-Base interactions energy: -476.302 where: short stacking energy: -229.801 Base-Backbone interact. energy: -0.741 local terms energy: -217.169991 where: bonds (distance) C4'-P energy: -36.496 bonds (distance) P-C4' energy: -50.371 flat angles C4'-P-C4' energy: -56.540 flat angles P-C4'-P energy: -28.181 tors. eta vs tors. theta energy: -45.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 223 Temperature: 1.092857 Total energy: -662.633640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.633640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.633640 (E_RNA) where: Base-Base interactions energy: -431.176 where: short stacking energy: -223.610 Base-Backbone interact. energy: -2.988 local terms energy: -228.469728 where: bonds (distance) C4'-P energy: -51.777 bonds (distance) P-C4' energy: -58.196 flat angles C4'-P-C4' energy: -45.105 flat angles P-C4'-P energy: -34.275 tors. eta vs tors. theta energy: -39.116 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 223 Temperature: 1.157143 Total energy: -661.929580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.929580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.929580 (E_RNA) where: Base-Base interactions energy: -437.150 where: short stacking energy: -192.127 Base-Backbone interact. energy: -1.906 local terms energy: -222.873470 where: bonds (distance) C4'-P energy: -49.137 bonds (distance) P-C4' energy: -54.184 flat angles C4'-P-C4' energy: -43.068 flat angles P-C4'-P energy: -26.681 tors. eta vs tors. theta energy: -49.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 223 Temperature: 1.221429 Total energy: -487.422906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.422906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.422906 (E_RNA) where: Base-Base interactions energy: -285.386 where: short stacking energy: -139.432 Base-Backbone interact. energy: -0.621 local terms energy: -201.415710 where: bonds (distance) C4'-P energy: -40.648 bonds (distance) P-C4' energy: -53.034 flat angles C4'-P-C4' energy: -56.900 flat angles P-C4'-P energy: -24.140 tors. eta vs tors. theta energy: -26.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 223 Temperature: 1.285714 Total energy: -288.235242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.235242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.235242 (E_RNA) where: Base-Base interactions energy: -130.947 where: short stacking energy: -73.512 Base-Backbone interact. energy: 3.814 local terms energy: -161.102396 where: bonds (distance) C4'-P energy: -47.850 bonds (distance) P-C4' energy: -49.968 flat angles C4'-P-C4' energy: -49.276 flat angles P-C4'-P energy: -20.530 tors. eta vs tors. theta energy: 6.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 223 Temperature: 1.350000 Total energy: -268.693232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.693232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.693232 (E_RNA) where: Base-Base interactions energy: -116.675 where: short stacking energy: -87.347 Base-Backbone interact. energy: 1.426 local terms energy: -153.444387 where: bonds (distance) C4'-P energy: -46.069 bonds (distance) P-C4' energy: -47.258 flat angles C4'-P-C4' energy: -37.265 flat angles P-C4'-P energy: -25.384 tors. eta vs tors. theta energy: 2.532 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 224 Temperature: 0.900000 Total energy: -927.365613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.365613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.365613 (E_RNA) where: Base-Base interactions energy: -653.767 where: short stacking energy: -262.541 Base-Backbone interact. energy: -1.154 local terms energy: -272.444714 where: bonds (distance) C4'-P energy: -56.704 bonds (distance) P-C4' energy: -50.635 flat angles C4'-P-C4' energy: -61.066 flat angles P-C4'-P energy: -41.539 tors. eta vs tors. theta energy: -62.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 224 Temperature: 0.964286 Total energy: -835.794547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.794547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -835.794547 (E_RNA) where: Base-Base interactions energy: -563.927 where: short stacking energy: -241.944 Base-Backbone interact. energy: -2.112 local terms energy: -269.754684 where: bonds (distance) C4'-P energy: -50.981 bonds (distance) P-C4' energy: -50.850 flat angles C4'-P-C4' energy: -70.019 flat angles P-C4'-P energy: -39.406 tors. eta vs tors. theta energy: -58.499 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 224 Temperature: 1.028571 Total energy: -693.968667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.968667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.968667 (E_RNA) where: Base-Base interactions energy: -448.360 where: short stacking energy: -219.525 Base-Backbone interact. energy: -0.794 local terms energy: -245.276742 where: bonds (distance) C4'-P energy: -49.127 bonds (distance) P-C4' energy: -57.569 flat angles C4'-P-C4' energy: -58.097 flat angles P-C4'-P energy: -33.519 tors. eta vs tors. theta energy: -46.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.462 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 224 Temperature: 1.092857 Total energy: -651.424173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.424173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.424173 (E_RNA) where: Base-Base interactions energy: -426.228 where: short stacking energy: -202.384 Base-Backbone interact. energy: 0.750 local terms energy: -225.945932 where: bonds (distance) C4'-P energy: -46.996 bonds (distance) P-C4' energy: -57.708 flat angles C4'-P-C4' energy: -42.453 flat angles P-C4'-P energy: -38.713 tors. eta vs tors. theta energy: -40.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 224 Temperature: 1.157143 Total energy: -655.129438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.129438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.129438 (E_RNA) where: Base-Base interactions energy: -436.957 where: short stacking energy: -214.794 Base-Backbone interact. energy: -1.353 local terms energy: -216.819584 where: bonds (distance) C4'-P energy: -37.893 bonds (distance) P-C4' energy: -57.135 flat angles C4'-P-C4' energy: -55.947 flat angles P-C4'-P energy: -27.522 tors. eta vs tors. theta energy: -38.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 224 Temperature: 1.221429 Total energy: -485.793017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.793017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.793017 (E_RNA) where: Base-Base interactions energy: -309.705 where: short stacking energy: -151.839 Base-Backbone interact. energy: -0.421 local terms energy: -175.666530 where: bonds (distance) C4'-P energy: -42.662 bonds (distance) P-C4' energy: -49.940 flat angles C4'-P-C4' energy: -38.848 flat angles P-C4'-P energy: -30.937 tors. eta vs tors. theta energy: -13.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 224 Temperature: 1.285714 Total energy: -321.129480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.129480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.129480 (E_RNA) where: Base-Base interactions energy: -190.040 where: short stacking energy: -80.421 Base-Backbone interact. energy: 1.744 local terms energy: -132.833518 where: bonds (distance) C4'-P energy: -40.663 bonds (distance) P-C4' energy: -42.485 flat angles C4'-P-C4' energy: -37.302 flat angles P-C4'-P energy: -25.683 tors. eta vs tors. theta energy: 13.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 224 Temperature: 1.350000 Total energy: -250.355454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.355454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.355454 (E_RNA) where: Base-Base interactions energy: -122.976 where: short stacking energy: -86.346 Base-Backbone interact. energy: 3.329 local terms energy: -130.707792 where: bonds (distance) C4'-P energy: -38.389 bonds (distance) P-C4' energy: -54.669 flat angles C4'-P-C4' energy: -33.174 flat angles P-C4'-P energy: -19.013 tors. eta vs tors. theta energy: 14.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 225 Temperature: 0.900000 Total energy: -923.139970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -923.139970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.139970 (E_RNA) where: Base-Base interactions energy: -642.181 where: short stacking energy: -276.800 Base-Backbone interact. energy: -2.346 local terms energy: -278.613335 where: bonds (distance) C4'-P energy: -57.787 bonds (distance) P-C4' energy: -57.465 flat angles C4'-P-C4' energy: -61.364 flat angles P-C4'-P energy: -40.874 tors. eta vs tors. theta energy: -61.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 225 Temperature: 0.964286 Total energy: -849.293199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.293199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.293199 (E_RNA) where: Base-Base interactions energy: -583.661 where: short stacking energy: -248.175 Base-Backbone interact. energy: -1.952 local terms energy: -263.680125 where: bonds (distance) C4'-P energy: -42.385 bonds (distance) P-C4' energy: -57.505 flat angles C4'-P-C4' energy: -63.947 flat angles P-C4'-P energy: -37.597 tors. eta vs tors. theta energy: -62.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 225 Temperature: 1.028571 Total energy: -712.775640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.775640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.775640 (E_RNA) where: Base-Base interactions energy: -479.032 where: short stacking energy: -229.384 Base-Backbone interact. energy: 2.087 local terms energy: -235.830964 where: bonds (distance) C4'-P energy: -48.956 bonds (distance) P-C4' energy: -53.367 flat angles C4'-P-C4' energy: -52.644 flat angles P-C4'-P energy: -28.436 tors. eta vs tors. theta energy: -52.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 225 Temperature: 1.092857 Total energy: -698.476023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.476023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.476023 (E_RNA) where: Base-Base interactions energy: -452.609 where: short stacking energy: -220.232 Base-Backbone interact. energy: -0.719 local terms energy: -245.148572 where: bonds (distance) C4'-P energy: -46.906 bonds (distance) P-C4' energy: -57.394 flat angles C4'-P-C4' energy: -52.351 flat angles P-C4'-P energy: -33.172 tors. eta vs tors. theta energy: -55.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 225 Temperature: 1.157143 Total energy: -653.410874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.410874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.410874 (E_RNA) where: Base-Base interactions energy: -421.936 where: short stacking energy: -207.503 Base-Backbone interact. energy: -0.124 local terms energy: -231.350452 where: bonds (distance) C4'-P energy: -40.956 bonds (distance) P-C4' energy: -57.597 flat angles C4'-P-C4' energy: -53.262 flat angles P-C4'-P energy: -38.062 tors. eta vs tors. theta energy: -41.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 225 Temperature: 1.221429 Total energy: -487.624675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.624675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.624675 (E_RNA) where: Base-Base interactions energy: -298.780 where: short stacking energy: -145.682 Base-Backbone interact. energy: -0.913 local terms energy: -187.931536 where: bonds (distance) C4'-P energy: -44.591 bonds (distance) P-C4' energy: -43.418 flat angles C4'-P-C4' energy: -53.233 flat angles P-C4'-P energy: -31.133 tors. eta vs tors. theta energy: -15.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 225 Temperature: 1.285714 Total energy: -325.097486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.097486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.097486 (E_RNA) where: Base-Base interactions energy: -171.374 where: short stacking energy: -97.718 Base-Backbone interact. energy: 0.854 local terms energy: -154.578253 where: bonds (distance) C4'-P energy: -34.594 bonds (distance) P-C4' energy: -50.731 flat angles C4'-P-C4' energy: -42.203 flat angles P-C4'-P energy: -20.625 tors. eta vs tors. theta energy: -6.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 225 Temperature: 1.350000 Total energy: -215.150663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.150663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.150663 (E_RNA) where: Base-Base interactions energy: -81.375 where: short stacking energy: -61.215 Base-Backbone interact. energy: 2.450 local terms energy: -136.225765 where: bonds (distance) C4'-P energy: -54.584 bonds (distance) P-C4' energy: -52.445 flat angles C4'-P-C4' energy: -16.925 flat angles P-C4'-P energy: -18.675 tors. eta vs tors. theta energy: 6.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 226 Temperature: 0.900000 Total energy: -928.577076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -928.577076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.577076 (E_RNA) where: Base-Base interactions energy: -654.571 where: short stacking energy: -277.719 Base-Backbone interact. energy: -2.669 local terms energy: -271.336885 where: bonds (distance) C4'-P energy: -59.912 bonds (distance) P-C4' energy: -57.641 flat angles C4'-P-C4' energy: -53.716 flat angles P-C4'-P energy: -45.678 tors. eta vs tors. theta energy: -54.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 226 Temperature: 0.964286 Total energy: -837.770638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.770638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.770638 (E_RNA) where: Base-Base interactions energy: -564.709 where: short stacking energy: -243.881 Base-Backbone interact. energy: -0.701 local terms energy: -272.361286 where: bonds (distance) C4'-P energy: -55.676 bonds (distance) P-C4' energy: -49.048 flat angles C4'-P-C4' energy: -64.173 flat angles P-C4'-P energy: -46.136 tors. eta vs tors. theta energy: -57.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 226 Temperature: 1.028571 Total energy: -714.754298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.754298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.754298 (E_RNA) where: Base-Base interactions energy: -473.710 where: short stacking energy: -233.775 Base-Backbone interact. energy: -1.303 local terms energy: -239.741701 where: bonds (distance) C4'-P energy: -49.947 bonds (distance) P-C4' energy: -49.561 flat angles C4'-P-C4' energy: -64.807 flat angles P-C4'-P energy: -26.593 tors. eta vs tors. theta energy: -48.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 226 Temperature: 1.092857 Total energy: -705.458868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.458868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.458868 (E_RNA) where: Base-Base interactions energy: -449.045 where: short stacking energy: -219.726 Base-Backbone interact. energy: 0.300 local terms energy: -256.714720 where: bonds (distance) C4'-P energy: -54.140 bonds (distance) P-C4' energy: -58.723 flat angles C4'-P-C4' energy: -53.695 flat angles P-C4'-P energy: -39.390 tors. eta vs tors. theta energy: -50.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 226 Temperature: 1.157143 Total energy: -644.203275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.203275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.203275 (E_RNA) where: Base-Base interactions energy: -429.808 where: short stacking energy: -198.721 Base-Backbone interact. energy: -0.811 local terms energy: -213.584272 where: bonds (distance) C4'-P energy: -39.787 bonds (distance) P-C4' energy: -53.508 flat angles C4'-P-C4' energy: -44.648 flat angles P-C4'-P energy: -37.734 tors. eta vs tors. theta energy: -37.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 226 Temperature: 1.221429 Total energy: -517.447394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.447394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.447394 (E_RNA) where: Base-Base interactions energy: -318.328 where: short stacking energy: -160.080 Base-Backbone interact. energy: -0.262 local terms energy: -198.856967 where: bonds (distance) C4'-P energy: -40.702 bonds (distance) P-C4' energy: -44.776 flat angles C4'-P-C4' energy: -51.197 flat angles P-C4'-P energy: -32.385 tors. eta vs tors. theta energy: -29.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 226 Temperature: 1.285714 Total energy: -325.011139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.011139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.011139 (E_RNA) where: Base-Base interactions energy: -165.522 where: short stacking energy: -86.832 Base-Backbone interact. energy: 1.977 local terms energy: -161.466852 where: bonds (distance) C4'-P energy: -48.129 bonds (distance) P-C4' energy: -58.823 flat angles C4'-P-C4' energy: -41.818 flat angles P-C4'-P energy: -13.613 tors. eta vs tors. theta energy: 0.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 226 Temperature: 1.350000 Total energy: -214.843619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.843619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.843619 (E_RNA) where: Base-Base interactions energy: -77.059 where: short stacking energy: -75.443 Base-Backbone interact. energy: 2.500 local terms energy: -140.284595 where: bonds (distance) C4'-P energy: -38.983 bonds (distance) P-C4' energy: -59.668 flat angles C4'-P-C4' energy: -34.340 flat angles P-C4'-P energy: -16.936 tors. eta vs tors. theta energy: 9.642 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 227 Temperature: 0.900000 Total energy: -926.837631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -926.837631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.837631 (E_RNA) where: Base-Base interactions energy: -647.426 where: short stacking energy: -280.020 Base-Backbone interact. energy: 0.605 local terms energy: -280.016461 where: bonds (distance) C4'-P energy: -58.770 bonds (distance) P-C4' energy: -63.177 flat angles C4'-P-C4' energy: -57.748 flat angles P-C4'-P energy: -42.606 tors. eta vs tors. theta energy: -57.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 227 Temperature: 0.964286 Total energy: -832.728768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.728768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.728768 (E_RNA) where: Base-Base interactions energy: -572.277 where: short stacking energy: -259.006 Base-Backbone interact. energy: -0.732 local terms energy: -259.719703 where: bonds (distance) C4'-P energy: -44.332 bonds (distance) P-C4' energy: -63.700 flat angles C4'-P-C4' energy: -56.242 flat angles P-C4'-P energy: -39.083 tors. eta vs tors. theta energy: -56.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 227 Temperature: 1.028571 Total energy: -719.181079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.181079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.181079 (E_RNA) where: Base-Base interactions energy: -461.803 where: short stacking energy: -212.845 Base-Backbone interact. energy: -1.610 local terms energy: -255.768350 where: bonds (distance) C4'-P energy: -45.390 bonds (distance) P-C4' energy: -60.953 flat angles C4'-P-C4' energy: -58.676 flat angles P-C4'-P energy: -38.327 tors. eta vs tors. theta energy: -52.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 227 Temperature: 1.092857 Total energy: -684.633368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.633368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.633368 (E_RNA) where: Base-Base interactions energy: -448.664 where: short stacking energy: -225.656 Base-Backbone interact. energy: -0.251 local terms energy: -235.717820 where: bonds (distance) C4'-P energy: -44.887 bonds (distance) P-C4' energy: -52.487 flat angles C4'-P-C4' energy: -60.059 flat angles P-C4'-P energy: -27.978 tors. eta vs tors. theta energy: -50.307 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 227 Temperature: 1.157143 Total energy: -632.072885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -632.072885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.072885 (E_RNA) where: Base-Base interactions energy: -397.033 where: short stacking energy: -176.714 Base-Backbone interact. energy: -0.955 local terms energy: -234.085480 where: bonds (distance) C4'-P energy: -54.596 bonds (distance) P-C4' energy: -46.329 flat angles C4'-P-C4' energy: -57.756 flat angles P-C4'-P energy: -31.074 tors. eta vs tors. theta energy: -44.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 227 Temperature: 1.221429 Total energy: -484.446255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.446255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.446255 (E_RNA) where: Base-Base interactions energy: -296.675 where: short stacking energy: -141.290 Base-Backbone interact. energy: -1.337 local terms energy: -186.433761 where: bonds (distance) C4'-P energy: -35.186 bonds (distance) P-C4' energy: -49.810 flat angles C4'-P-C4' energy: -50.600 flat angles P-C4'-P energy: -34.173 tors. eta vs tors. theta energy: -16.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 227 Temperature: 1.285714 Total energy: -303.692788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.692788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.692788 (E_RNA) where: Base-Base interactions energy: -145.611 where: short stacking energy: -85.994 Base-Backbone interact. energy: 0.628 local terms energy: -158.709654 where: bonds (distance) C4'-P energy: -52.801 bonds (distance) P-C4' energy: -48.581 flat angles C4'-P-C4' energy: -38.061 flat angles P-C4'-P energy: -21.222 tors. eta vs tors. theta energy: 1.955 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 227 Temperature: 1.350000 Total energy: -217.867283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.867283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.867283 (E_RNA) where: Base-Base interactions energy: -82.781 where: short stacking energy: -70.012 Base-Backbone interact. energy: 4.119 local terms energy: -139.205421 where: bonds (distance) C4'-P energy: -46.021 bonds (distance) P-C4' energy: -55.412 flat angles C4'-P-C4' energy: -31.661 flat angles P-C4'-P energy: -20.501 tors. eta vs tors. theta energy: 14.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 228 Temperature: 0.900000 Total energy: -905.716033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -905.716033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.716033 (E_RNA) where: Base-Base interactions energy: -613.060 where: short stacking energy: -266.891 Base-Backbone interact. energy: -0.639 local terms energy: -292.017634 where: bonds (distance) C4'-P energy: -58.720 bonds (distance) P-C4' energy: -65.966 flat angles C4'-P-C4' energy: -64.227 flat angles P-C4'-P energy: -40.037 tors. eta vs tors. theta energy: -63.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 228 Temperature: 0.964286 Total energy: -843.396369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.396369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.396369 (E_RNA) where: Base-Base interactions energy: -562.956 where: short stacking energy: -246.592 Base-Backbone interact. energy: -0.254 local terms energy: -280.186353 where: bonds (distance) C4'-P energy: -62.117 bonds (distance) P-C4' energy: -64.254 flat angles C4'-P-C4' energy: -60.134 flat angles P-C4'-P energy: -32.534 tors. eta vs tors. theta energy: -61.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 228 Temperature: 1.028571 Total energy: -683.007791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.007791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.007791 (E_RNA) where: Base-Base interactions energy: -442.029 where: short stacking energy: -203.096 Base-Backbone interact. energy: -1.161 local terms energy: -239.817970 where: bonds (distance) C4'-P energy: -40.840 bonds (distance) P-C4' energy: -52.208 flat angles C4'-P-C4' energy: -61.775 flat angles P-C4'-P energy: -47.390 tors. eta vs tors. theta energy: -37.604 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 228 Temperature: 1.092857 Total energy: -643.370260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.370260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.370260 (E_RNA) where: Base-Base interactions energy: -404.135 where: short stacking energy: -208.116 Base-Backbone interact. energy: -1.288 local terms energy: -237.947550 where: bonds (distance) C4'-P energy: -56.071 bonds (distance) P-C4' energy: -50.257 flat angles C4'-P-C4' energy: -51.139 flat angles P-C4'-P energy: -31.415 tors. eta vs tors. theta energy: -49.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 228 Temperature: 1.157143 Total energy: -649.996993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.996993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.996993 (E_RNA) where: Base-Base interactions energy: -415.968 where: short stacking energy: -202.777 Base-Backbone interact. energy: -1.341 local terms energy: -232.687836 where: bonds (distance) C4'-P energy: -52.848 bonds (distance) P-C4' energy: -39.878 flat angles C4'-P-C4' energy: -62.458 flat angles P-C4'-P energy: -30.847 tors. eta vs tors. theta energy: -46.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 228 Temperature: 1.221429 Total energy: -457.590166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.590166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.590166 (E_RNA) where: Base-Base interactions energy: -263.159 where: short stacking energy: -128.137 Base-Backbone interact. energy: -1.069 local terms energy: -193.361708 where: bonds (distance) C4'-P energy: -54.059 bonds (distance) P-C4' energy: -53.679 flat angles C4'-P-C4' energy: -43.100 flat angles P-C4'-P energy: -28.256 tors. eta vs tors. theta energy: -14.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 228 Temperature: 1.285714 Total energy: -325.690241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.690241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.690241 (E_RNA) where: Base-Base interactions energy: -161.854 where: short stacking energy: -86.441 Base-Backbone interact. energy: 2.699 local terms energy: -166.534782 where: bonds (distance) C4'-P energy: -43.060 bonds (distance) P-C4' energy: -53.524 flat angles C4'-P-C4' energy: -43.117 flat angles P-C4'-P energy: -28.236 tors. eta vs tors. theta energy: 1.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 228 Temperature: 1.350000 Total energy: -197.194129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.194129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.194129 (E_RNA) where: Base-Base interactions energy: -82.552 where: short stacking energy: -67.595 Base-Backbone interact. energy: 1.013 local terms energy: -115.655774 where: bonds (distance) C4'-P energy: -28.326 bonds (distance) P-C4' energy: -41.967 flat angles C4'-P-C4' energy: -50.114 flat angles P-C4'-P energy: -21.778 tors. eta vs tors. theta energy: 26.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 229 Temperature: 0.900000 Total energy: -905.839492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -905.839492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.839492 (E_RNA) where: Base-Base interactions energy: -633.022 where: short stacking energy: -271.724 Base-Backbone interact. energy: -0.495 local terms energy: -272.321982 where: bonds (distance) C4'-P energy: -51.208 bonds (distance) P-C4' energy: -58.717 flat angles C4'-P-C4' energy: -68.647 flat angles P-C4'-P energy: -33.299 tors. eta vs tors. theta energy: -60.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 229 Temperature: 0.964286 Total energy: -827.289433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.289433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -827.289433 (E_RNA) where: Base-Base interactions energy: -566.008 where: short stacking energy: -261.977 Base-Backbone interact. energy: -0.389 local terms energy: -260.892847 where: bonds (distance) C4'-P energy: -58.014 bonds (distance) P-C4' energy: -49.446 flat angles C4'-P-C4' energy: -55.459 flat angles P-C4'-P energy: -40.744 tors. eta vs tors. theta energy: -57.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 229 Temperature: 1.028571 Total energy: -692.920372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.920372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.920372 (E_RNA) where: Base-Base interactions energy: -451.366 where: short stacking energy: -215.095 Base-Backbone interact. energy: 0.021 local terms energy: -241.575405 where: bonds (distance) C4'-P energy: -52.585 bonds (distance) P-C4' energy: -57.138 flat angles C4'-P-C4' energy: -51.481 flat angles P-C4'-P energy: -34.947 tors. eta vs tors. theta energy: -45.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 229 Temperature: 1.092857 Total energy: -656.889489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.889489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.889489 (E_RNA) where: Base-Base interactions energy: -426.938 where: short stacking energy: -214.114 Base-Backbone interact. energy: 0.504 local terms energy: -230.454762 where: bonds (distance) C4'-P energy: -48.124 bonds (distance) P-C4' energy: -48.980 flat angles C4'-P-C4' energy: -57.643 flat angles P-C4'-P energy: -29.086 tors. eta vs tors. theta energy: -46.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 229 Temperature: 1.157143 Total energy: -654.177604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.177604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.177604 (E_RNA) where: Base-Base interactions energy: -407.533 where: short stacking energy: -179.592 Base-Backbone interact. energy: -0.764 local terms energy: -245.880727 where: bonds (distance) C4'-P energy: -49.161 bonds (distance) P-C4' energy: -58.821 flat angles C4'-P-C4' energy: -58.811 flat angles P-C4'-P energy: -35.293 tors. eta vs tors. theta energy: -43.795 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 229 Temperature: 1.221429 Total energy: -491.525064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.525064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.525064 (E_RNA) where: Base-Base interactions energy: -323.510 where: short stacking energy: -156.391 Base-Backbone interact. energy: -1.314 local terms energy: -166.700943 where: bonds (distance) C4'-P energy: -37.579 bonds (distance) P-C4' energy: -42.755 flat angles C4'-P-C4' energy: -40.867 flat angles P-C4'-P energy: -19.107 tors. eta vs tors. theta energy: -26.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 229 Temperature: 1.285714 Total energy: -339.482312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.482312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.482312 (E_RNA) where: Base-Base interactions energy: -182.149 where: short stacking energy: -108.751 Base-Backbone interact. energy: 1.352 local terms energy: -158.685932 where: bonds (distance) C4'-P energy: -48.069 bonds (distance) P-C4' energy: -57.191 flat angles C4'-P-C4' energy: -30.147 flat angles P-C4'-P energy: -26.793 tors. eta vs tors. theta energy: 3.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 229 Temperature: 1.350000 Total energy: -225.932115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.932115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.932115 (E_RNA) where: Base-Base interactions energy: -94.903 where: short stacking energy: -85.080 Base-Backbone interact. energy: 0.330 local terms energy: -131.359478 where: bonds (distance) C4'-P energy: -42.364 bonds (distance) P-C4' energy: -50.672 flat angles C4'-P-C4' energy: -31.261 flat angles P-C4'-P energy: -18.992 tors. eta vs tors. theta energy: 11.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 230 Temperature: 0.900000 Total energy: -908.858493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -908.858493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -908.858493 (E_RNA) where: Base-Base interactions energy: -637.448 where: short stacking energy: -266.821 Base-Backbone interact. energy: -1.665 local terms energy: -269.745632 where: bonds (distance) C4'-P energy: -57.876 bonds (distance) P-C4' energy: -61.439 flat angles C4'-P-C4' energy: -49.682 flat angles P-C4'-P energy: -41.807 tors. eta vs tors. theta energy: -58.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 230 Temperature: 0.964286 Total energy: -829.025929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.025929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.025929 (E_RNA) where: Base-Base interactions energy: -558.429 where: short stacking energy: -247.698 Base-Backbone interact. energy: 1.991 local terms energy: -272.588024 where: bonds (distance) C4'-P energy: -52.772 bonds (distance) P-C4' energy: -53.958 flat angles C4'-P-C4' energy: -60.668 flat angles P-C4'-P energy: -48.949 tors. eta vs tors. theta energy: -56.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 230 Temperature: 1.028571 Total energy: -699.189874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.189874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.189874 (E_RNA) where: Base-Base interactions energy: -466.113 where: short stacking energy: -216.747 Base-Backbone interact. energy: 2.744 local terms energy: -235.820294 where: bonds (distance) C4'-P energy: -45.171 bonds (distance) P-C4' energy: -46.680 flat angles C4'-P-C4' energy: -51.400 flat angles P-C4'-P energy: -41.348 tors. eta vs tors. theta energy: -51.222 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 230 Temperature: 1.092857 Total energy: -651.666337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.666337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.666337 (E_RNA) where: Base-Base interactions energy: -434.648 where: short stacking energy: -214.232 Base-Backbone interact. energy: 2.535 local terms energy: -219.553416 where: bonds (distance) C4'-P energy: -43.808 bonds (distance) P-C4' energy: -46.545 flat angles C4'-P-C4' energy: -62.326 flat angles P-C4'-P energy: -19.633 tors. eta vs tors. theta energy: -47.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 230 Temperature: 1.157143 Total energy: -635.727254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.727254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.727254 (E_RNA) where: Base-Base interactions energy: -395.026 where: short stacking energy: -181.751 Base-Backbone interact. energy: -1.921 local terms energy: -238.780732 where: bonds (distance) C4'-P energy: -50.575 bonds (distance) P-C4' energy: -49.879 flat angles C4'-P-C4' energy: -56.866 flat angles P-C4'-P energy: -36.822 tors. eta vs tors. theta energy: -44.639 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 230 Temperature: 1.221429 Total energy: -484.084509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.084509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.084509 (E_RNA) where: Base-Base interactions energy: -288.466 where: short stacking energy: -134.380 Base-Backbone interact. energy: -0.779 local terms energy: -194.839387 where: bonds (distance) C4'-P energy: -49.733 bonds (distance) P-C4' energy: -49.555 flat angles C4'-P-C4' energy: -43.296 flat angles P-C4'-P energy: -30.553 tors. eta vs tors. theta energy: -21.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 230 Temperature: 1.285714 Total energy: -318.574132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.574132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.574132 (E_RNA) where: Base-Base interactions energy: -142.553 where: short stacking energy: -83.793 Base-Backbone interact. energy: -0.950 local terms energy: -175.071471 where: bonds (distance) C4'-P energy: -45.499 bonds (distance) P-C4' energy: -48.700 flat angles C4'-P-C4' energy: -52.368 flat angles P-C4'-P energy: -28.684 tors. eta vs tors. theta energy: 0.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 230 Temperature: 1.350000 Total energy: -224.257258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.257258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.257258 (E_RNA) where: Base-Base interactions energy: -70.265 where: short stacking energy: -66.331 Base-Backbone interact. energy: 3.250 local terms energy: -157.242273 where: bonds (distance) C4'-P energy: -43.217 bonds (distance) P-C4' energy: -54.498 flat angles C4'-P-C4' energy: -49.369 flat angles P-C4'-P energy: -33.118 tors. eta vs tors. theta energy: 22.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 231 Temperature: 0.900000 Total energy: -890.235453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -890.235453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -890.235453 (E_RNA) where: Base-Base interactions energy: -602.527 where: short stacking energy: -267.496 Base-Backbone interact. energy: -1.861 local terms energy: -285.846752 where: bonds (distance) C4'-P energy: -58.456 bonds (distance) P-C4' energy: -56.789 flat angles C4'-P-C4' energy: -66.003 flat angles P-C4'-P energy: -38.369 tors. eta vs tors. theta energy: -66.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 231 Temperature: 0.964286 Total energy: -845.503839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.503839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.503839 (E_RNA) where: Base-Base interactions energy: -563.827 where: short stacking energy: -268.407 Base-Backbone interact. energy: -0.243 local terms energy: -281.434064 where: bonds (distance) C4'-P energy: -65.385 bonds (distance) P-C4' energy: -63.279 flat angles C4'-P-C4' energy: -50.852 flat angles P-C4'-P energy: -44.277 tors. eta vs tors. theta energy: -57.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 231 Temperature: 1.028571 Total energy: -689.637853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.637853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.637853 (E_RNA) where: Base-Base interactions energy: -449.532 where: short stacking energy: -220.378 Base-Backbone interact. energy: 3.108 local terms energy: -243.213976 where: bonds (distance) C4'-P energy: -40.114 bonds (distance) P-C4' energy: -57.216 flat angles C4'-P-C4' energy: -65.874 flat angles P-C4'-P energy: -33.675 tors. eta vs tors. theta energy: -46.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 231 Temperature: 1.092857 Total energy: -685.828790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.828790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.828790 (E_RNA) where: Base-Base interactions energy: -454.186 where: short stacking energy: -221.629 Base-Backbone interact. energy: 0.006 local terms energy: -231.649136 where: bonds (distance) C4'-P energy: -48.309 bonds (distance) P-C4' energy: -43.049 flat angles C4'-P-C4' energy: -55.705 flat angles P-C4'-P energy: -35.267 tors. eta vs tors. theta energy: -49.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 231 Temperature: 1.157143 Total energy: -627.145057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -627.145057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -627.145057 (E_RNA) where: Base-Base interactions energy: -406.820 where: short stacking energy: -185.182 Base-Backbone interact. energy: 1.193 local terms energy: -221.518713 where: bonds (distance) C4'-P energy: -57.852 bonds (distance) P-C4' energy: -56.163 flat angles C4'-P-C4' energy: -56.141 flat angles P-C4'-P energy: -21.503 tors. eta vs tors. theta energy: -29.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 231 Temperature: 1.221429 Total energy: -477.930576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.930576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.930576 (E_RNA) where: Base-Base interactions energy: -286.165 where: short stacking energy: -144.952 Base-Backbone interact. energy: -0.459 local terms energy: -191.306573 where: bonds (distance) C4'-P energy: -53.535 bonds (distance) P-C4' energy: -51.800 flat angles C4'-P-C4' energy: -46.921 flat angles P-C4'-P energy: -29.219 tors. eta vs tors. theta energy: -9.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 231 Temperature: 1.285714 Total energy: -307.092283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.092283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.092283 (E_RNA) where: Base-Base interactions energy: -141.838 where: short stacking energy: -91.599 Base-Backbone interact. energy: 1.633 local terms energy: -166.887979 where: bonds (distance) C4'-P energy: -41.706 bonds (distance) P-C4' energy: -47.617 flat angles C4'-P-C4' energy: -47.054 flat angles P-C4'-P energy: -32.610 tors. eta vs tors. theta energy: 2.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 231 Temperature: 1.350000 Total energy: -242.798264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.798264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.798264 (E_RNA) where: Base-Base interactions energy: -82.883 where: short stacking energy: -66.554 Base-Backbone interact. energy: -2.884 local terms energy: -157.031581 where: bonds (distance) C4'-P energy: -54.518 bonds (distance) P-C4' energy: -48.098 flat angles C4'-P-C4' energy: -43.423 flat angles P-C4'-P energy: -20.088 tors. eta vs tors. theta energy: 9.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 232 Temperature: 0.900000 Total energy: -928.514552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -928.514552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.514552 (E_RNA) where: Base-Base interactions energy: -660.696 where: short stacking energy: -291.296 Base-Backbone interact. energy: -0.752 local terms energy: -267.067097 where: bonds (distance) C4'-P energy: -50.553 bonds (distance) P-C4' energy: -56.713 flat angles C4'-P-C4' energy: -56.905 flat angles P-C4'-P energy: -40.357 tors. eta vs tors. theta energy: -62.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 232 Temperature: 0.964286 Total energy: -850.274492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.274492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -850.274492 (E_RNA) where: Base-Base interactions energy: -579.791 where: short stacking energy: -270.132 Base-Backbone interact. energy: -2.656 local terms energy: -267.828038 where: bonds (distance) C4'-P energy: -49.253 bonds (distance) P-C4' energy: -55.255 flat angles C4'-P-C4' energy: -56.894 flat angles P-C4'-P energy: -47.667 tors. eta vs tors. theta energy: -58.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 232 Temperature: 1.028571 Total energy: -714.702938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.702938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.702938 (E_RNA) where: Base-Base interactions energy: -460.744 where: short stacking energy: -220.158 Base-Backbone interact. energy: -1.002 local terms energy: -252.957005 where: bonds (distance) C4'-P energy: -58.087 bonds (distance) P-C4' energy: -57.538 flat angles C4'-P-C4' energy: -54.333 flat angles P-C4'-P energy: -36.329 tors. eta vs tors. theta energy: -46.671 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 232 Temperature: 1.092857 Total energy: -691.018108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.018108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.018108 (E_RNA) where: Base-Base interactions energy: -443.724 where: short stacking energy: -234.821 Base-Backbone interact. energy: -0.853 local terms energy: -246.441702 where: bonds (distance) C4'-P energy: -57.177 bonds (distance) P-C4' energy: -52.995 flat angles C4'-P-C4' energy: -55.724 flat angles P-C4'-P energy: -34.389 tors. eta vs tors. theta energy: -46.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 232 Temperature: 1.157143 Total energy: -571.938129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.938129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.938129 (E_RNA) where: Base-Base interactions energy: -355.136 where: short stacking energy: -171.755 Base-Backbone interact. energy: -0.080 local terms energy: -216.722405 where: bonds (distance) C4'-P energy: -51.752 bonds (distance) P-C4' energy: -48.219 flat angles C4'-P-C4' energy: -53.243 flat angles P-C4'-P energy: -26.116 tors. eta vs tors. theta energy: -37.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 232 Temperature: 1.221429 Total energy: -485.356135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.356135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.356135 (E_RNA) where: Base-Base interactions energy: -296.456 where: short stacking energy: -135.420 Base-Backbone interact. energy: -0.939 local terms energy: -187.961960 where: bonds (distance) C4'-P energy: -57.266 bonds (distance) P-C4' energy: -46.853 flat angles C4'-P-C4' energy: -45.177 flat angles P-C4'-P energy: -28.745 tors. eta vs tors. theta energy: -9.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 232 Temperature: 1.285714 Total energy: -323.093662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.093662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.093662 (E_RNA) where: Base-Base interactions energy: -163.157 where: short stacking energy: -92.490 Base-Backbone interact. energy: -0.991 local terms energy: -158.945059 where: bonds (distance) C4'-P energy: -42.072 bonds (distance) P-C4' energy: -56.804 flat angles C4'-P-C4' energy: -42.797 flat angles P-C4'-P energy: -29.510 tors. eta vs tors. theta energy: 12.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 232 Temperature: 1.350000 Total energy: -219.851444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.851444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.851444 (E_RNA) where: Base-Base interactions energy: -63.717 where: short stacking energy: -54.599 Base-Backbone interact. energy: 0.064 local terms energy: -156.197959 where: bonds (distance) C4'-P energy: -49.034 bonds (distance) P-C4' energy: -53.297 flat angles C4'-P-C4' energy: -43.236 flat angles P-C4'-P energy: -23.761 tors. eta vs tors. theta energy: 13.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) out arg RESULTS//1/Two-chained_RNA-102b556e_01 ================================== temp. level: 1, replica: 4 ===================================== Write number: 233 Temperature: 0.900000 Total energy: -912.841016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -912.841016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -912.841016 (E_RNA) where: Base-Base interactions energy: -641.447 where: short stacking energy: -289.468 Base-Backbone interact. energy: 2.144 local terms energy: -273.537763 where: bonds (distance) C4'-P energy: -53.884 bonds (distance) P-C4' energy: -61.404 flat angles C4'-P-C4' energy: -61.459 flat angles P-C4'-P energy: -36.800 tors. eta vs tors. theta energy: -59.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 233 Temperature: 0.964286 Total energy: -811.502581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -811.502581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -811.502581 (E_RNA) where: Base-Base interactions energy: -538.365 where: short stacking energy: -244.251 Base-Backbone interact. energy: -0.131 local terms energy: -273.006035 where: bonds (distance) C4'-P energy: -60.369 bonds (distance) P-C4' energy: -55.831 flat angles C4'-P-C4' energy: -59.454 flat angles P-C4'-P energy: -42.795 tors. eta vs tors. theta energy: -54.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 233 Temperature: 1.028571 Total energy: -729.078353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.078353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.078353 (E_RNA) where: Base-Base interactions energy: -459.511 where: short stacking energy: -239.557 Base-Backbone interact. energy: 1.129 local terms energy: -270.696843 where: bonds (distance) C4'-P energy: -44.466 bonds (distance) P-C4' energy: -64.205 flat angles C4'-P-C4' energy: -60.930 flat angles P-C4'-P energy: -44.155 tors. eta vs tors. theta energy: -56.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 233 Temperature: 1.092857 Total energy: -701.692360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.692360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.692360 (E_RNA) where: Base-Base interactions energy: -460.667 where: short stacking energy: -235.360 Base-Backbone interact. energy: -0.488 local terms energy: -240.537418 where: bonds (distance) C4'-P energy: -46.844 bonds (distance) P-C4' energy: -53.656 flat angles C4'-P-C4' energy: -55.633 flat angles P-C4'-P energy: -33.916 tors. eta vs tors. theta energy: -50.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 233 Temperature: 1.157143 Total energy: -610.575931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -610.575931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.575931 (E_RNA) where: Base-Base interactions energy: -412.837 where: short stacking energy: -185.162 Base-Backbone interact. energy: -0.140 local terms energy: -197.598891 where: bonds (distance) C4'-P energy: -46.224 bonds (distance) P-C4' energy: -46.730 flat angles C4'-P-C4' energy: -47.548 flat angles P-C4'-P energy: -37.307 tors. eta vs tors. theta energy: -19.790 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 233 Temperature: 1.221429 Total energy: -540.173353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.173353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.173353 (E_RNA) where: Base-Base interactions energy: -322.486 where: short stacking energy: -153.797 Base-Backbone interact. energy: 1.240 local terms energy: -218.927437 where: bonds (distance) C4'-P energy: -48.037 bonds (distance) P-C4' energy: -51.668 flat angles C4'-P-C4' energy: -53.954 flat angles P-C4'-P energy: -33.800 tors. eta vs tors. theta energy: -31.467 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 233 Temperature: 1.285714 Total energy: -346.094967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.094967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.094967 (E_RNA) where: Base-Base interactions energy: -181.679 where: short stacking energy: -103.141 Base-Backbone interact. energy: -0.693 local terms energy: -163.723531 where: bonds (distance) C4'-P energy: -53.566 bonds (distance) P-C4' energy: -51.912 flat angles C4'-P-C4' energy: -42.887 flat angles P-C4'-P energy: -18.535 tors. eta vs tors. theta energy: 3.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 233 Temperature: 1.350000 Total energy: -220.653129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.653129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.653129 (E_RNA) where: Base-Base interactions energy: -69.898 where: short stacking energy: -64.563 Base-Backbone interact. energy: -0.060 local terms energy: -153.016325 where: bonds (distance) C4'-P energy: -45.429 bonds (distance) P-C4' energy: -50.949 flat angles C4'-P-C4' energy: -49.434 flat angles P-C4'-P energy: -17.995 tors. eta vs tors. theta energy: 10.791 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 2.322 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 234 Temperature: 0.900000 Total energy: -915.433609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -915.433609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -915.433609 (E_RNA) where: Base-Base interactions energy: -642.307 where: short stacking energy: -278.400 Base-Backbone interact. energy: -1.528 local terms energy: -271.598747 where: bonds (distance) C4'-P energy: -58.353 bonds (distance) P-C4' energy: -52.857 flat angles C4'-P-C4' energy: -57.921 flat angles P-C4'-P energy: -43.406 tors. eta vs tors. theta energy: -59.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 234 Temperature: 0.964286 Total energy: -842.209306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -842.209306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -842.209306 (E_RNA) where: Base-Base interactions energy: -569.390 where: short stacking energy: -255.999 Base-Backbone interact. energy: -0.959 local terms energy: -271.860342 where: bonds (distance) C4'-P energy: -50.124 bonds (distance) P-C4' energy: -61.155 flat angles C4'-P-C4' energy: -59.103 flat angles P-C4'-P energy: -44.349 tors. eta vs tors. theta energy: -57.128 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 234 Temperature: 1.028571 Total energy: -717.771627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.771627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.771627 (E_RNA) where: Base-Base interactions energy: -448.122 where: short stacking energy: -209.530 Base-Backbone interact. energy: -1.225 local terms energy: -268.424881 where: bonds (distance) C4'-P energy: -61.174 bonds (distance) P-C4' energy: -58.448 flat angles C4'-P-C4' energy: -63.101 flat angles P-C4'-P energy: -37.943 tors. eta vs tors. theta energy: -47.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 234 Temperature: 1.092857 Total energy: -700.393067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.393067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.393067 (E_RNA) where: Base-Base interactions energy: -457.881 where: short stacking energy: -230.446 Base-Backbone interact. energy: 1.470 local terms energy: -243.981915 where: bonds (distance) C4'-P energy: -54.606 bonds (distance) P-C4' energy: -53.592 flat angles C4'-P-C4' energy: -52.437 flat angles P-C4'-P energy: -32.354 tors. eta vs tors. theta energy: -50.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 234 Temperature: 1.157143 Total energy: -598.829710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.829710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.829710 (E_RNA) where: Base-Base interactions energy: -393.924 where: short stacking energy: -187.198 Base-Backbone interact. energy: -0.336 local terms energy: -204.569715 where: bonds (distance) C4'-P energy: -57.860 bonds (distance) P-C4' energy: -48.295 flat angles C4'-P-C4' energy: -44.705 flat angles P-C4'-P energy: -28.563 tors. eta vs tors. theta energy: -25.147 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 234 Temperature: 1.221429 Total energy: -533.499183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.499183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.499183 (E_RNA) where: Base-Base interactions energy: -329.494 where: short stacking energy: -159.132 Base-Backbone interact. energy: 0.464 local terms energy: -204.468966 where: bonds (distance) C4'-P energy: -44.026 bonds (distance) P-C4' energy: -50.809 flat angles C4'-P-C4' energy: -56.171 flat angles P-C4'-P energy: -25.334 tors. eta vs tors. theta energy: -28.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 234 Temperature: 1.285714 Total energy: -404.648985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.648985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.648985 (E_RNA) where: Base-Base interactions energy: -219.031 where: short stacking energy: -107.768 Base-Backbone interact. energy: -0.588 local terms energy: -185.029801 where: bonds (distance) C4'-P energy: -52.133 bonds (distance) P-C4' energy: -53.033 flat angles C4'-P-C4' energy: -42.819 flat angles P-C4'-P energy: -23.236 tors. eta vs tors. theta energy: -13.809 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 234 Temperature: 1.350000 Total energy: -225.078482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.078482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.078482 (E_RNA) where: Base-Base interactions energy: -78.463 where: short stacking energy: -69.262 Base-Backbone interact. energy: -0.521 local terms energy: -146.094530 where: bonds (distance) C4'-P energy: -46.469 bonds (distance) P-C4' energy: -54.310 flat angles C4'-P-C4' energy: -25.377 flat angles P-C4'-P energy: -25.776 tors. eta vs tors. theta energy: 5.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 235 Temperature: 0.900000 Total energy: -895.152274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -895.152274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -895.152274 (E_RNA) where: Base-Base interactions energy: -614.013 where: short stacking energy: -273.530 Base-Backbone interact. energy: -1.944 local terms energy: -279.195044 where: bonds (distance) C4'-P energy: -46.981 bonds (distance) P-C4' energy: -62.241 flat angles C4'-P-C4' energy: -65.437 flat angles P-C4'-P energy: -43.481 tors. eta vs tors. theta energy: -61.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 235 Temperature: 0.964286 Total energy: -859.257508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -859.257508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.257508 (E_RNA) where: Base-Base interactions energy: -580.072 where: short stacking energy: -252.590 Base-Backbone interact. energy: -0.250 local terms energy: -278.935266 where: bonds (distance) C4'-P energy: -55.622 bonds (distance) P-C4' energy: -56.796 flat angles C4'-P-C4' energy: -66.450 flat angles P-C4'-P energy: -40.039 tors. eta vs tors. theta energy: -60.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 235 Temperature: 1.028571 Total energy: -732.750250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.750250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.750250 (E_RNA) where: Base-Base interactions energy: -473.812 where: short stacking energy: -218.172 Base-Backbone interact. energy: -1.942 local terms energy: -256.996142 where: bonds (distance) C4'-P energy: -58.997 bonds (distance) P-C4' energy: -47.907 flat angles C4'-P-C4' energy: -61.714 flat angles P-C4'-P energy: -38.916 tors. eta vs tors. theta energy: -49.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 235 Temperature: 1.092857 Total energy: -722.355843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.355843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.355843 (E_RNA) where: Base-Base interactions energy: -476.821 where: short stacking energy: -224.664 Base-Backbone interact. energy: -0.605 local terms energy: -244.929054 where: bonds (distance) C4'-P energy: -53.834 bonds (distance) P-C4' energy: -53.698 flat angles C4'-P-C4' energy: -58.117 flat angles P-C4'-P energy: -29.866 tors. eta vs tors. theta energy: -49.414 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 235 Temperature: 1.157143 Total energy: -643.243800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.243800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.243800 (E_RNA) where: Base-Base interactions energy: -425.662 where: short stacking energy: -201.417 Base-Backbone interact. energy: -1.019 local terms energy: -216.562412 where: bonds (distance) C4'-P energy: -47.534 bonds (distance) P-C4' energy: -54.882 flat angles C4'-P-C4' energy: -54.149 flat angles P-C4'-P energy: -27.020 tors. eta vs tors. theta energy: -32.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 235 Temperature: 1.221429 Total energy: -573.639377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.639377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.639377 (E_RNA) where: Base-Base interactions energy: -368.735 where: short stacking energy: -155.925 Base-Backbone interact. energy: -0.666 local terms energy: -204.238156 where: bonds (distance) C4'-P energy: -42.031 bonds (distance) P-C4' energy: -51.220 flat angles C4'-P-C4' energy: -55.160 flat angles P-C4'-P energy: -28.987 tors. eta vs tors. theta energy: -26.840 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 235 Temperature: 1.285714 Total energy: -387.427566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.427566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.427566 (E_RNA) where: Base-Base interactions energy: -212.081 where: short stacking energy: -108.055 Base-Backbone interact. energy: -0.554 local terms energy: -174.792972 where: bonds (distance) C4'-P energy: -50.725 bonds (distance) P-C4' energy: -56.416 flat angles C4'-P-C4' energy: -41.876 flat angles P-C4'-P energy: -26.463 tors. eta vs tors. theta energy: 0.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 235 Temperature: 1.350000 Total energy: -230.688239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.688239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.688239 (E_RNA) where: Base-Base interactions energy: -76.170 where: short stacking energy: -71.165 Base-Backbone interact. energy: -0.715 local terms energy: -153.802881 where: bonds (distance) C4'-P energy: -48.520 bonds (distance) P-C4' energy: -58.902 flat angles C4'-P-C4' energy: -30.523 flat angles P-C4'-P energy: -25.518 tors. eta vs tors. theta energy: 9.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 236 Temperature: 0.900000 Total energy: -922.164439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.164439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.164439 (E_RNA) where: Base-Base interactions energy: -637.927 where: short stacking energy: -270.939 Base-Backbone interact. energy: -0.807 local terms energy: -283.430565 where: bonds (distance) C4'-P energy: -55.282 bonds (distance) P-C4' energy: -60.195 flat angles C4'-P-C4' energy: -60.546 flat angles P-C4'-P energy: -39.167 tors. eta vs tors. theta energy: -68.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 236 Temperature: 0.964286 Total energy: -833.578153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.578153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.578153 (E_RNA) where: Base-Base interactions energy: -575.827 where: short stacking energy: -253.378 Base-Backbone interact. energy: -1.706 local terms energy: -256.045349 where: bonds (distance) C4'-P energy: -44.872 bonds (distance) P-C4' energy: -55.534 flat angles C4'-P-C4' energy: -60.189 flat angles P-C4'-P energy: -40.506 tors. eta vs tors. theta energy: -54.944 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 236 Temperature: 1.028571 Total energy: -728.891913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.891913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.891913 (E_RNA) where: Base-Base interactions energy: -475.929 where: short stacking energy: -210.149 Base-Backbone interact. energy: -2.991 local terms energy: -249.971522 where: bonds (distance) C4'-P energy: -52.988 bonds (distance) P-C4' energy: -57.339 flat angles C4'-P-C4' energy: -58.081 flat angles P-C4'-P energy: -35.529 tors. eta vs tors. theta energy: -46.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 236 Temperature: 1.092857 Total energy: -695.846741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.846741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.846741 (E_RNA) where: Base-Base interactions energy: -458.839 where: short stacking energy: -219.750 Base-Backbone interact. energy: -1.112 local terms energy: -235.895547 where: bonds (distance) C4'-P energy: -46.939 bonds (distance) P-C4' energy: -56.124 flat angles C4'-P-C4' energy: -50.724 flat angles P-C4'-P energy: -30.897 tors. eta vs tors. theta energy: -51.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 236 Temperature: 1.157143 Total energy: -596.544720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.544720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.544720 (E_RNA) where: Base-Base interactions energy: -387.866 where: short stacking energy: -155.277 Base-Backbone interact. energy: -0.755 local terms energy: -207.923740 where: bonds (distance) C4'-P energy: -49.282 bonds (distance) P-C4' energy: -44.763 flat angles C4'-P-C4' energy: -53.466 flat angles P-C4'-P energy: -38.544 tors. eta vs tors. theta energy: -21.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 236 Temperature: 1.221429 Total energy: -545.949942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.949942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.949942 (E_RNA) where: Base-Base interactions energy: -354.424 where: short stacking energy: -153.328 Base-Backbone interact. energy: -1.049 local terms energy: -190.476094 where: bonds (distance) C4'-P energy: -53.973 bonds (distance) P-C4' energy: -41.739 flat angles C4'-P-C4' energy: -37.436 flat angles P-C4'-P energy: -33.658 tors. eta vs tors. theta energy: -23.671 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 236 Temperature: 1.285714 Total energy: -376.159674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.159674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.159674 (E_RNA) where: Base-Base interactions energy: -218.284 where: short stacking energy: -99.153 Base-Backbone interact. energy: -0.776 local terms energy: -157.099424 where: bonds (distance) C4'-P energy: -44.927 bonds (distance) P-C4' energy: -49.402 flat angles C4'-P-C4' energy: -34.642 flat angles P-C4'-P energy: -29.685 tors. eta vs tors. theta energy: 1.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 236 Temperature: 1.350000 Total energy: -229.416011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.416011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.416011 (E_RNA) where: Base-Base interactions energy: -87.205 where: short stacking energy: -73.264 Base-Backbone interact. energy: 1.732 local terms energy: -143.942672 where: bonds (distance) C4'-P energy: -50.856 bonds (distance) P-C4' energy: -43.618 flat angles C4'-P-C4' energy: -25.976 flat angles P-C4'-P energy: -33.640 tors. eta vs tors. theta energy: 10.147 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 237 Temperature: 0.900000 Total energy: -930.915306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -930.915306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.915306 (E_RNA) where: Base-Base interactions energy: -645.667 where: short stacking energy: -268.730 Base-Backbone interact. energy: -0.144 local terms energy: -285.103986 where: bonds (distance) C4'-P energy: -61.057 bonds (distance) P-C4' energy: -62.910 flat angles C4'-P-C4' energy: -59.433 flat angles P-C4'-P energy: -40.379 tors. eta vs tors. theta energy: -61.324 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 237 Temperature: 0.964286 Total energy: -855.983108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.983108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.983108 (E_RNA) where: Base-Base interactions energy: -595.358 where: short stacking energy: -255.635 Base-Backbone interact. energy: 0.634 local terms energy: -261.259140 where: bonds (distance) C4'-P energy: -53.373 bonds (distance) P-C4' energy: -52.697 flat angles C4'-P-C4' energy: -56.663 flat angles P-C4'-P energy: -35.155 tors. eta vs tors. theta energy: -63.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 237 Temperature: 1.028571 Total energy: -756.471550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.471550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.471550 (E_RNA) where: Base-Base interactions energy: -479.257 where: short stacking energy: -226.367 Base-Backbone interact. energy: -1.206 local terms energy: -276.009307 where: bonds (distance) C4'-P energy: -58.422 bonds (distance) P-C4' energy: -58.672 flat angles C4'-P-C4' energy: -62.021 flat angles P-C4'-P energy: -41.004 tors. eta vs tors. theta energy: -55.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 237 Temperature: 1.092857 Total energy: -672.266952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.266952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.266952 (E_RNA) where: Base-Base interactions energy: -428.974 where: short stacking energy: -214.464 Base-Backbone interact. energy: -0.729 local terms energy: -242.563759 where: bonds (distance) C4'-P energy: -47.251 bonds (distance) P-C4' energy: -58.344 flat angles C4'-P-C4' energy: -62.279 flat angles P-C4'-P energy: -29.834 tors. eta vs tors. theta energy: -44.856 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 237 Temperature: 1.157143 Total energy: -599.330811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.330811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.330811 (E_RNA) where: Base-Base interactions energy: -397.393 where: short stacking energy: -169.427 Base-Backbone interact. energy: -0.771 local terms energy: -201.166715 where: bonds (distance) C4'-P energy: -51.679 bonds (distance) P-C4' energy: -59.778 flat angles C4'-P-C4' energy: -44.380 flat angles P-C4'-P energy: -23.663 tors. eta vs tors. theta energy: -21.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 237 Temperature: 1.221429 Total energy: -509.133417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.133417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.133417 (E_RNA) where: Base-Base interactions energy: -324.560 where: short stacking energy: -132.320 Base-Backbone interact. energy: 1.998 local terms energy: -186.571081 where: bonds (distance) C4'-P energy: -45.307 bonds (distance) P-C4' energy: -49.686 flat angles C4'-P-C4' energy: -45.867 flat angles P-C4'-P energy: -26.023 tors. eta vs tors. theta energy: -19.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 237 Temperature: 1.285714 Total energy: -366.454427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.454427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.454427 (E_RNA) where: Base-Base interactions energy: -204.020 where: short stacking energy: -91.288 Base-Backbone interact. energy: 2.265 local terms energy: -164.698507 where: bonds (distance) C4'-P energy: -49.953 bonds (distance) P-C4' energy: -51.018 flat angles C4'-P-C4' energy: -46.479 flat angles P-C4'-P energy: -21.565 tors. eta vs tors. theta energy: 4.316 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 237 Temperature: 1.350000 Total energy: -227.874192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.874192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.874192 (E_RNA) where: Base-Base interactions energy: -74.872 where: short stacking energy: -66.414 Base-Backbone interact. energy: 0.653 local terms energy: -153.655244 where: bonds (distance) C4'-P energy: -46.484 bonds (distance) P-C4' energy: -47.851 flat angles C4'-P-C4' energy: -34.655 flat angles P-C4'-P energy: -32.420 tors. eta vs tors. theta energy: 7.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)