SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa: 1 curr_seq: _GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...................((.....))..(((((((.((.(((........))).)).)))))))...._ nucl1: 20, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 19, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 43, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 43, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 42, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 41, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 39, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 38, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 36, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 35, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 34, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 33, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 33, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 32, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 32, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 31, chain1: 0, <---> nucl2: 64, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 31, chainIndex_2: 0, nuclIndex_2: 64 nucl1: 30, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 30, chainIndex_2: 0, nuclIndex_2: 65 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa: 1 curr_seq: _GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...................((.....))..(((((((.((.(((........))).)).)))))))...._ nucl1: 20, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 19, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 43, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 43, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 42, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 41, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 39, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 38, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 36, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 35, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 34, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 33, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 33, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 32, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 32, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 31, chain1: 0, <---> nucl2: 64, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 31, chainIndex_2: 0, nuclIndex_2: 64 nucl1: 30, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 30, chainIndex_2: 0, nuclIndex_2: 65 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa: 1 curr_seq: _GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...................((.....))..(((((((.((.(((........))).)).)))))))...._ nucl1: 20, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 19, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 43, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 43, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 42, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 41, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 39, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 38, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 36, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 35, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 34, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 33, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 33, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 32, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 32, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 31, chain1: 0, <---> nucl2: 64, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 31, chainIndex_2: 0, nuclIndex_2: 64 nucl1: 30, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 30, chainIndex_2: 0, nuclIndex_2: 65 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa: 1 curr_seq: _GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...................((.....))..(((((((.((.(((........))).)).)))))))...._ nucl1: 20, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 19, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 43, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 43, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 42, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 41, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 39, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 38, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 36, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 35, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 34, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 33, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 33, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 32, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 32, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 31, chain1: 0, <---> nucl2: 64, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 31, chainIndex_2: 0, nuclIndex_2: 64 nucl1: 30, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 30, chainIndex_2: 0, nuclIndex_2: 65 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa: 1 curr_seq: _GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...................((.....))..(((((((.((.(((........))).)).)))))))...._ nucl1: 20, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 19, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 43, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 43, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 42, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 41, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 39, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 38, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 36, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 35, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 34, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 33, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 33, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 32, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 32, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 31, chain1: 0, <---> nucl2: 64, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 31, chainIndex_2: 0, nuclIndex_2: 64 nucl1: 30, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 30, chainIndex_2: 0, nuclIndex_2: 65 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa: 1 curr_seq: _GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...................((.....))..(((((((.((.(((........))).)).)))))))...._ nucl1: 20, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 19, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 43, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 43, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 42, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 41, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 39, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 38, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 36, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 35, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 34, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 33, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 33, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 32, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 32, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 31, chain1: 0, <---> nucl2: 64, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 31, chainIndex_2: 0, nuclIndex_2: 64 nucl1: 30, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 30, chainIndex_2: 0, nuclIndex_2: 65 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa: 1 curr_seq: _GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...................((.....))..(((((((.((.(((........))).)).)))))))...._ nucl1: 20, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 19, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 43, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 43, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 42, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 41, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 39, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 38, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 36, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 35, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 34, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 33, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 33, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 32, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 32, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 31, chain1: 0, <---> nucl2: 64, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 31, chainIndex_2: 0, nuclIndex_2: 64 nucl1: 30, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 30, chainIndex_2: 0, nuclIndex_2: 65 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa: 1 curr_seq: _GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...................((.....))..(((((((.((.(((........))).)).)))))))...._ nucl1: 20, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 19, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 43, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 43, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 42, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 41, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 39, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 38, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 36, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 35, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 34, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 33, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 33, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 32, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 32, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 31, chain1: 0, <---> nucl2: 64, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 31, chainIndex_2: 0, nuclIndex_2: 64 nucl1: 30, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 30, chainIndex_2: 0, nuclIndex_2: 65 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa: 1 curr_seq: _GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...................((.....))..(((((((.((.(((........))).)).)))))))...._ nucl1: 20, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 19, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 43, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 43, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 42, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 41, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 39, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 38, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 36, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 35, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 34, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 33, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 33, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 32, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 32, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 31, chain1: 0, <---> nucl2: 64, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 31, chainIndex_2: 0, nuclIndex_2: 64 nucl1: 30, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 30, chainIndex_2: 0, nuclIndex_2: 65 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Tetraloop_10_steps-c5c38540/inputs/seq.fa: 1 curr_seq: _GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GACAACGACUUUCGCCCACGCUCCCUGCAUGUUGUGGAAGGUCCAGUUUUGAGGGGCUAUUACAACUUUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 70 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 355 n_atoms_counter: 355 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...................((.....))..(((((((.((.(((........))).)).)))))))...._ nucl1: 20, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 19, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 43, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 43, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 42, chain1: 0, <---> nucl2: 53, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 53 nucl1: 41, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 39, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 39, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 38, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 38, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 36, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 36, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 35, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 35, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 34, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 34, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 33, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 33, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 32, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 32, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 31, chain1: 0, <---> nucl2: 64, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 31, chainIndex_2: 0, nuclIndex_2: 64 nucl1: 30, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 30, chainIndex_2: 0, nuclIndex_2: 65 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 70.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: 617.883185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 617.883185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.307322 (E_RNA) where: Base-Base interactions energy: -11.561 where: short stacking energy: -11.561 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 902.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: 617.883185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 617.883185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.307322 (E_RNA) where: Base-Base interactions energy: -11.561 where: short stacking energy: -11.561 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 902.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: 617.883185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 617.883185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.307322 (E_RNA) where: Base-Base interactions energy: -11.561 where: short stacking energy: -11.561 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 902.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: 617.883185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 617.883185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.307322 (E_RNA) where: Base-Base interactions energy: -11.561 where: short stacking energy: -11.561 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 902.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: 617.883185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 617.883185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.307322 (E_RNA) where: Base-Base interactions energy: -11.561 where: short stacking energy: -11.561 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 902.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: 617.883185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 617.883185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.307322 (E_RNA) where: Base-Base interactions energy: -11.561 where: short stacking energy: -11.561 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 902.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: 617.883185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 617.883185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.307322 (E_RNA) where: Base-Base interactions energy: -11.561 where: short stacking energy: -11.561 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 902.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: 617.883185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 617.883185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.307322 (E_RNA) where: Base-Base interactions energy: -11.561 where: short stacking energy: -11.561 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 902.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: 617.883185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 617.883185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.307322 (E_RNA) where: Base-Base interactions energy: -11.561 where: short stacking energy: -11.561 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 902.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: 617.883185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 617.883185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.307322 (E_RNA) where: Base-Base interactions energy: -11.561 where: short stacking energy: -11.561 Base-Backbone interact. energy: -0.000 local terms energy: -272.745972 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -63.520 flat angles C4'-P-C4' energy: -51.396 flat angles P-C4'-P energy: -58.791 tors. eta vs tors. theta energy: -31.028 Dist. restrs. and SS energy: 902.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -492.162370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.162370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.341469 (E_RNA) where: Base-Base interactions energy: -307.207 where: short stacking energy: -144.951 Base-Backbone interact. energy: -1.960 local terms energy: -192.174632 where: bonds (distance) C4'-P energy: -47.475 bonds (distance) P-C4' energy: -45.346 flat angles C4'-P-C4' energy: -44.305 flat angles P-C4'-P energy: -27.331 tors. eta vs tors. theta energy: -27.717 Dist. restrs. and SS energy: 9.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -476.887578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.887578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.698958 (E_RNA) where: Base-Base interactions energy: -300.502 where: short stacking energy: -153.906 Base-Backbone interact. energy: -0.274 local terms energy: -182.923150 where: bonds (distance) C4'-P energy: -39.560 bonds (distance) P-C4' energy: -42.903 flat angles C4'-P-C4' energy: -42.746 flat angles P-C4'-P energy: -19.921 tors. eta vs tors. theta energy: -37.792 Dist. restrs. and SS energy: 6.811 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -557.063735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.063735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.011719 (E_RNA) where: Base-Base interactions energy: -351.662 where: short stacking energy: -157.893 Base-Backbone interact. energy: -0.326 local terms energy: -209.023844 where: bonds (distance) C4'-P energy: -39.944 bonds (distance) P-C4' energy: -48.041 flat angles C4'-P-C4' energy: -48.035 flat angles P-C4'-P energy: -27.428 tors. eta vs tors. theta energy: -45.576 Dist. restrs. and SS energy: 3.948 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -409.962987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.962987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.926828 (E_RNA) where: Base-Base interactions energy: -249.155 where: short stacking energy: -122.096 Base-Backbone interact. energy: 4.289 local terms energy: -176.060473 where: bonds (distance) C4'-P energy: -49.489 bonds (distance) P-C4' energy: -43.074 flat angles C4'-P-C4' energy: -41.540 flat angles P-C4'-P energy: -25.603 tors. eta vs tors. theta energy: -16.354 Dist. restrs. and SS energy: 10.964 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -388.428001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.428001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.190990 (E_RNA) where: Base-Base interactions energy: -233.520 where: short stacking energy: -122.309 Base-Backbone interact. energy: 0.383 local terms energy: -160.053545 where: bonds (distance) C4'-P energy: -29.484 bonds (distance) P-C4' energy: -48.543 flat angles C4'-P-C4' energy: -29.949 flat angles P-C4'-P energy: -28.765 tors. eta vs tors. theta energy: -23.312 Dist. restrs. and SS energy: 4.763 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -390.351241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.351241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.727680 (E_RNA) where: Base-Base interactions energy: -246.659 where: short stacking energy: -96.814 Base-Backbone interact. energy: -0.701 local terms energy: -154.368047 where: bonds (distance) C4'-P energy: -46.140 bonds (distance) P-C4' energy: -36.807 flat angles C4'-P-C4' energy: -29.607 flat angles P-C4'-P energy: -25.634 tors. eta vs tors. theta energy: -16.180 Dist. restrs. and SS energy: 11.376 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -335.757553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.757553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.559534 (E_RNA) where: Base-Base interactions energy: -183.641 where: short stacking energy: -86.356 Base-Backbone interact. energy: 0.573 local terms energy: -163.490964 where: bonds (distance) C4'-P energy: -38.311 bonds (distance) P-C4' energy: -41.504 flat angles C4'-P-C4' energy: -35.973 flat angles P-C4'-P energy: -30.963 tors. eta vs tors. theta energy: -16.741 Dist. restrs. and SS energy: 10.802 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -434.298038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.298038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.554752 (E_RNA) where: Base-Base interactions energy: -272.929 where: short stacking energy: -124.727 Base-Backbone interact. energy: -1.434 local terms energy: -169.192430 where: bonds (distance) C4'-P energy: -38.996 bonds (distance) P-C4' energy: -42.377 flat angles C4'-P-C4' energy: -43.287 flat angles P-C4'-P energy: -13.787 tors. eta vs tors. theta energy: -30.745 Dist. restrs. and SS energy: 9.257 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -421.550551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.550551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.224747 (E_RNA) where: Base-Base interactions energy: -270.679 where: short stacking energy: -121.007 Base-Backbone interact. energy: -1.886 local terms energy: -153.660285 where: bonds (distance) C4'-P energy: -33.658 bonds (distance) P-C4' energy: -29.481 flat angles C4'-P-C4' energy: -42.710 flat angles P-C4'-P energy: -23.605 tors. eta vs tors. theta energy: -24.207 Dist. restrs. and SS energy: 4.674 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -292.759959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.759959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.828309 (E_RNA) where: Base-Base interactions energy: -152.802 where: short stacking energy: -66.871 Base-Backbone interact. energy: 1.530 local terms energy: -151.556411 where: bonds (distance) C4'-P energy: -35.645 bonds (distance) P-C4' energy: -48.972 flat angles C4'-P-C4' energy: -27.513 flat angles P-C4'-P energy: -33.678 tors. eta vs tors. theta energy: -5.748 Dist. restrs. and SS energy: 10.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -544.649589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.649589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.103297 (E_RNA) where: Base-Base interactions energy: -350.011 where: short stacking energy: -141.661 Base-Backbone interact. energy: -1.307 local terms energy: -202.785025 where: bonds (distance) C4'-P energy: -41.916 bonds (distance) P-C4' energy: -49.069 flat angles C4'-P-C4' energy: -48.418 flat angles P-C4'-P energy: -32.928 tors. eta vs tors. theta energy: -30.453 Dist. restrs. and SS energy: 9.454 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -599.317498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.317498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.643071 (E_RNA) where: Base-Base interactions energy: -391.102 where: short stacking energy: -178.102 Base-Backbone interact. energy: -1.265 local terms energy: -210.276127 where: bonds (distance) C4'-P energy: -44.252 bonds (distance) P-C4' energy: -44.980 flat angles C4'-P-C4' energy: -47.827 flat angles P-C4'-P energy: -29.462 tors. eta vs tors. theta energy: -43.755 Dist. restrs. and SS energy: 3.326 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -469.397006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.397006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.955774 (E_RNA) where: Base-Base interactions energy: -280.416 where: short stacking energy: -135.450 Base-Backbone interact. energy: -0.531 local terms energy: -194.008780 where: bonds (distance) C4'-P energy: -38.367 bonds (distance) P-C4' energy: -50.956 flat angles C4'-P-C4' energy: -49.517 flat angles P-C4'-P energy: -25.432 tors. eta vs tors. theta energy: -29.737 Dist. restrs. and SS energy: 5.559 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -462.900051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.900051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.582325 (E_RNA) where: Base-Base interactions energy: -290.264 where: short stacking energy: -114.239 Base-Backbone interact. energy: -2.761 local terms energy: -178.557180 where: bonds (distance) C4'-P energy: -45.975 bonds (distance) P-C4' energy: -34.914 flat angles C4'-P-C4' energy: -40.509 flat angles P-C4'-P energy: -30.366 tors. eta vs tors. theta energy: -26.793 Dist. restrs. and SS energy: 8.682 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -447.821825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.821825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.429031 (E_RNA) where: Base-Base interactions energy: -276.232 where: short stacking energy: -146.213 Base-Backbone interact. energy: -0.481 local terms energy: -175.715480 where: bonds (distance) C4'-P energy: -35.511 bonds (distance) P-C4' energy: -45.753 flat angles C4'-P-C4' energy: -37.720 flat angles P-C4'-P energy: -27.768 tors. eta vs tors. theta energy: -28.963 Dist. restrs. and SS energy: 4.607 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -410.769299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.769299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.405356 (E_RNA) where: Base-Base interactions energy: -236.601 where: short stacking energy: -112.021 Base-Backbone interact. energy: -0.089 local terms energy: -178.715484 where: bonds (distance) C4'-P energy: -40.024 bonds (distance) P-C4' energy: -48.025 flat angles C4'-P-C4' energy: -32.671 flat angles P-C4'-P energy: -26.964 tors. eta vs tors. theta energy: -31.032 Dist. restrs. and SS energy: 4.636 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -420.354566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.354566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.132843 (E_RNA) where: Base-Base interactions energy: -247.013 where: short stacking energy: -126.334 Base-Backbone interact. energy: 1.357 local terms energy: -180.476720 where: bonds (distance) C4'-P energy: -37.811 bonds (distance) P-C4' energy: -42.162 flat angles C4'-P-C4' energy: -40.469 flat angles P-C4'-P energy: -36.782 tors. eta vs tors. theta energy: -23.252 Dist. restrs. and SS energy: 5.778 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -404.982449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.982449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.113767 (E_RNA) where: Base-Base interactions energy: -260.947 where: short stacking energy: -112.604 Base-Backbone interact. energy: -0.442 local terms energy: -148.724498 where: bonds (distance) C4'-P energy: -36.891 bonds (distance) P-C4' energy: -35.960 flat angles C4'-P-C4' energy: -36.214 flat angles P-C4'-P energy: -21.169 tors. eta vs tors. theta energy: -18.491 Dist. restrs. and SS energy: 5.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -413.385164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.385164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.830751 (E_RNA) where: Base-Base interactions energy: -260.440 where: short stacking energy: -103.051 Base-Backbone interact. energy: -1.184 local terms energy: -155.207019 where: bonds (distance) C4'-P energy: -39.885 bonds (distance) P-C4' energy: -36.252 flat angles C4'-P-C4' energy: -43.988 flat angles P-C4'-P energy: -17.479 tors. eta vs tors. theta energy: -17.602 Dist. restrs. and SS energy: 3.446 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -320.697355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.697355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.858430 (E_RNA) where: Base-Base interactions energy: -202.241 where: short stacking energy: -104.235 Base-Backbone interact. energy: 0.034 local terms energy: -128.651512 where: bonds (distance) C4'-P energy: -29.397 bonds (distance) P-C4' energy: -28.508 flat angles C4'-P-C4' energy: -37.640 flat angles P-C4'-P energy: -18.220 tors. eta vs tors. theta energy: -14.887 Dist. restrs. and SS energy: 10.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -661.862670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.862670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.555081 (E_RNA) where: Base-Base interactions energy: -442.275 where: short stacking energy: -193.379 Base-Backbone interact. energy: -0.006 local terms energy: -223.273809 where: bonds (distance) C4'-P energy: -39.229 bonds (distance) P-C4' energy: -47.812 flat angles C4'-P-C4' energy: -54.271 flat angles P-C4'-P energy: -28.152 tors. eta vs tors. theta energy: -53.809 Dist. restrs. and SS energy: 3.692 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -524.941369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.941369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.312906 (E_RNA) where: Base-Base interactions energy: -334.542 where: short stacking energy: -131.949 Base-Backbone interact. energy: -0.413 local terms energy: -199.358551 where: bonds (distance) C4'-P energy: -50.217 bonds (distance) P-C4' energy: -37.055 flat angles C4'-P-C4' energy: -45.780 flat angles P-C4'-P energy: -32.630 tors. eta vs tors. theta energy: -33.677 Dist. restrs. and SS energy: 9.372 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -493.830586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.830586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.530306 (E_RNA) where: Base-Base interactions energy: -320.125 where: short stacking energy: -136.686 Base-Backbone interact. energy: -1.828 local terms energy: -174.577396 where: bonds (distance) C4'-P energy: -38.679 bonds (distance) P-C4' energy: -52.077 flat angles C4'-P-C4' energy: -37.300 flat angles P-C4'-P energy: -26.814 tors. eta vs tors. theta energy: -19.707 Dist. restrs. and SS energy: 2.700 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -448.660321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.660321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.254147 (E_RNA) where: Base-Base interactions energy: -285.284 where: short stacking energy: -136.501 Base-Backbone interact. energy: 2.956 local terms energy: -172.926206 where: bonds (distance) C4'-P energy: -47.896 bonds (distance) P-C4' energy: -42.737 flat angles C4'-P-C4' energy: -37.121 flat angles P-C4'-P energy: -24.180 tors. eta vs tors. theta energy: -20.993 Dist. restrs. and SS energy: 6.594 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -458.600283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.600283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.860560 (E_RNA) where: Base-Base interactions energy: -279.110 where: short stacking energy: -134.446 Base-Backbone interact. energy: 2.130 local terms energy: -187.880669 where: bonds (distance) C4'-P energy: -40.883 bonds (distance) P-C4' energy: -40.551 flat angles C4'-P-C4' energy: -39.760 flat angles P-C4'-P energy: -36.749 tors. eta vs tors. theta energy: -29.938 Dist. restrs. and SS energy: 6.260 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -421.968817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.968817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.528079 (E_RNA) where: Base-Base interactions energy: -266.211 where: short stacking energy: -132.114 Base-Backbone interact. energy: -0.556 local terms energy: -159.761779 where: bonds (distance) C4'-P energy: -28.901 bonds (distance) P-C4' energy: -39.991 flat angles C4'-P-C4' energy: -38.650 flat angles P-C4'-P energy: -20.175 tors. eta vs tors. theta energy: -32.045 Dist. restrs. and SS energy: 4.559 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -435.646246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.646246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.151868 (E_RNA) where: Base-Base interactions energy: -276.066 where: short stacking energy: -103.655 Base-Backbone interact. energy: 0.249 local terms energy: -162.335296 where: bonds (distance) C4'-P energy: -43.053 bonds (distance) P-C4' energy: -37.675 flat angles C4'-P-C4' energy: -34.445 flat angles P-C4'-P energy: -29.539 tors. eta vs tors. theta energy: -17.624 Dist. restrs. and SS energy: 2.506 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -414.848986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.848986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.966871 (E_RNA) where: Base-Base interactions energy: -254.729 where: short stacking energy: -112.867 Base-Backbone interact. energy: 0.099 local terms energy: -164.337649 where: bonds (distance) C4'-P energy: -44.896 bonds (distance) P-C4' energy: -44.088 flat angles C4'-P-C4' energy: -32.320 flat angles P-C4'-P energy: -20.011 tors. eta vs tors. theta energy: -23.023 Dist. restrs. and SS energy: 4.118 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -403.114707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.114707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.844728 (E_RNA) where: Base-Base interactions energy: -247.479 where: short stacking energy: -107.182 Base-Backbone interact. energy: -1.754 local terms energy: -170.611801 where: bonds (distance) C4'-P energy: -34.883 bonds (distance) P-C4' energy: -45.230 flat angles C4'-P-C4' energy: -37.625 flat angles P-C4'-P energy: -26.937 tors. eta vs tors. theta energy: -25.936 Dist. restrs. and SS energy: 16.730 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -355.080316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.080316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.997519 (E_RNA) where: Base-Base interactions energy: -220.473 where: short stacking energy: -95.482 Base-Backbone interact. energy: -0.806 local terms energy: -142.718850 where: bonds (distance) C4'-P energy: -23.257 bonds (distance) P-C4' energy: -43.698 flat angles C4'-P-C4' energy: -39.428 flat angles P-C4'-P energy: -16.490 tors. eta vs tors. theta energy: -19.846 Dist. restrs. and SS energy: 8.917 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -678.312759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.312759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.894064 (E_RNA) where: Base-Base interactions energy: -449.635 where: short stacking energy: -212.508 Base-Backbone interact. energy: -2.253 local terms energy: -231.005705 where: bonds (distance) C4'-P energy: -36.598 bonds (distance) P-C4' energy: -48.067 flat angles C4'-P-C4' energy: -51.036 flat angles P-C4'-P energy: -37.446 tors. eta vs tors. theta energy: -57.857 Dist. restrs. and SS energy: 4.581 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -555.717533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.717533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.373946 (E_RNA) where: Base-Base interactions energy: -361.664 where: short stacking energy: -161.061 Base-Backbone interact. energy: -2.200 local terms energy: -198.509472 where: bonds (distance) C4'-P energy: -39.347 bonds (distance) P-C4' energy: -37.802 flat angles C4'-P-C4' energy: -52.122 flat angles P-C4'-P energy: -32.296 tors. eta vs tors. theta energy: -36.943 Dist. restrs. and SS energy: 6.656 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -503.931502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.931502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.043576 (E_RNA) where: Base-Base interactions energy: -318.037 where: short stacking energy: -150.424 Base-Backbone interact. energy: 0.694 local terms energy: -193.700313 where: bonds (distance) C4'-P energy: -48.802 bonds (distance) P-C4' energy: -44.140 flat angles C4'-P-C4' energy: -42.996 flat angles P-C4'-P energy: -24.316 tors. eta vs tors. theta energy: -33.446 Dist. restrs. and SS energy: 7.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -469.155249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.155249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.312128 (E_RNA) where: Base-Base interactions energy: -316.118 where: short stacking energy: -153.633 Base-Backbone interact. energy: 0.999 local terms energy: -162.192818 where: bonds (distance) C4'-P energy: -38.295 bonds (distance) P-C4' energy: -36.899 flat angles C4'-P-C4' energy: -39.152 flat angles P-C4'-P energy: -23.096 tors. eta vs tors. theta energy: -24.750 Dist. restrs. and SS energy: 8.157 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -472.747792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.747792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.413559 (E_RNA) where: Base-Base interactions energy: -283.714 where: short stacking energy: -118.781 Base-Backbone interact. energy: 1.323 local terms energy: -195.022311 where: bonds (distance) C4'-P energy: -47.664 bonds (distance) P-C4' energy: -43.222 flat angles C4'-P-C4' energy: -46.676 flat angles P-C4'-P energy: -27.146 tors. eta vs tors. theta energy: -30.314 Dist. restrs. and SS energy: 4.666 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -494.388155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.388155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.964363 (E_RNA) where: Base-Base interactions energy: -319.498 where: short stacking energy: -147.355 Base-Backbone interact. energy: -0.319 local terms energy: -181.147095 where: bonds (distance) C4'-P energy: -35.928 bonds (distance) P-C4' energy: -41.874 flat angles C4'-P-C4' energy: -50.075 flat angles P-C4'-P energy: -24.629 tors. eta vs tors. theta energy: -28.641 Dist. restrs. and SS energy: 6.576 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -421.925962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.925962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.263340 (E_RNA) where: Base-Base interactions energy: -247.182 where: short stacking energy: -122.249 Base-Backbone interact. energy: -0.629 local terms energy: -178.452704 where: bonds (distance) C4'-P energy: -39.045 bonds (distance) P-C4' energy: -39.717 flat angles C4'-P-C4' energy: -39.551 flat angles P-C4'-P energy: -21.626 tors. eta vs tors. theta energy: -38.514 Dist. restrs. and SS energy: 4.337 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -439.046113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.046113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.883242 (E_RNA) where: Base-Base interactions energy: -279.985 where: short stacking energy: -123.675 Base-Backbone interact. energy: 1.976 local terms energy: -163.874940 where: bonds (distance) C4'-P energy: -33.491 bonds (distance) P-C4' energy: -43.120 flat angles C4'-P-C4' energy: -40.113 flat angles P-C4'-P energy: -24.443 tors. eta vs tors. theta energy: -22.708 Dist. restrs. and SS energy: 2.837 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -388.765784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.765784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.913028 (E_RNA) where: Base-Base interactions energy: -249.534 where: short stacking energy: -103.147 Base-Backbone interact. energy: 0.400 local terms energy: -145.779209 where: bonds (distance) C4'-P energy: -47.621 bonds (distance) P-C4' energy: -36.901 flat angles C4'-P-C4' energy: -24.022 flat angles P-C4'-P energy: -29.209 tors. eta vs tors. theta energy: -8.027 Dist. restrs. and SS energy: 6.147 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -392.646505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.646505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.370217 (E_RNA) where: Base-Base interactions energy: -243.949 where: short stacking energy: -102.671 Base-Backbone interact. energy: -0.124 local terms energy: -151.297752 where: bonds (distance) C4'-P energy: -35.706 bonds (distance) P-C4' energy: -40.426 flat angles C4'-P-C4' energy: -28.087 flat angles P-C4'-P energy: -20.497 tors. eta vs tors. theta energy: -26.582 Dist. restrs. and SS energy: 2.724 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -662.060109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.060109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.772063 (E_RNA) where: Base-Base interactions energy: -436.292 where: short stacking energy: -198.510 Base-Backbone interact. energy: -0.934 local terms energy: -227.546315 where: bonds (distance) C4'-P energy: -43.029 bonds (distance) P-C4' energy: -44.135 flat angles C4'-P-C4' energy: -53.067 flat angles P-C4'-P energy: -34.877 tors. eta vs tors. theta energy: -52.438 Dist. restrs. and SS energy: 2.712 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -565.688221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.688221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.430629 (E_RNA) where: Base-Base interactions energy: -360.595 where: short stacking energy: -159.478 Base-Backbone interact. energy: -0.352 local terms energy: -209.483202 where: bonds (distance) C4'-P energy: -46.378 bonds (distance) P-C4' energy: -46.698 flat angles C4'-P-C4' energy: -50.424 flat angles P-C4'-P energy: -23.068 tors. eta vs tors. theta energy: -42.915 Dist. restrs. and SS energy: 4.742 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -563.068431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.068431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.694309 (E_RNA) where: Base-Base interactions energy: -360.147 where: short stacking energy: -172.475 Base-Backbone interact. energy: -0.188 local terms energy: -207.359320 where: bonds (distance) C4'-P energy: -50.974 bonds (distance) P-C4' energy: -38.427 flat angles C4'-P-C4' energy: -35.501 flat angles P-C4'-P energy: -32.566 tors. eta vs tors. theta energy: -49.891 Dist. restrs. and SS energy: 4.626 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -449.643643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.643643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.636232 (E_RNA) where: Base-Base interactions energy: -282.285 where: short stacking energy: -131.726 Base-Backbone interact. energy: -0.462 local terms energy: -180.889387 where: bonds (distance) C4'-P energy: -34.706 bonds (distance) P-C4' energy: -48.821 flat angles C4'-P-C4' energy: -47.045 flat angles P-C4'-P energy: -21.422 tors. eta vs tors. theta energy: -28.895 Dist. restrs. and SS energy: 13.993 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -477.015142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.015142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.296159 (E_RNA) where: Base-Base interactions energy: -294.118 where: short stacking energy: -160.161 Base-Backbone interact. energy: -0.675 local terms energy: -188.502759 where: bonds (distance) C4'-P energy: -35.003 bonds (distance) P-C4' energy: -46.506 flat angles C4'-P-C4' energy: -36.599 flat angles P-C4'-P energy: -31.648 tors. eta vs tors. theta energy: -38.747 Dist. restrs. and SS energy: 6.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -490.835765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.835765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.623404 (E_RNA) where: Base-Base interactions energy: -316.028 where: short stacking energy: -149.956 Base-Backbone interact. energy: -0.782 local terms energy: -180.813669 where: bonds (distance) C4'-P energy: -31.226 bonds (distance) P-C4' energy: -44.341 flat angles C4'-P-C4' energy: -40.710 flat angles P-C4'-P energy: -26.599 tors. eta vs tors. theta energy: -37.938 Dist. restrs. and SS energy: 6.788 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -466.265414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.265414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.754966 (E_RNA) where: Base-Base interactions energy: -305.759 where: short stacking energy: -126.469 Base-Backbone interact. energy: -2.945 local terms energy: -160.051038 where: bonds (distance) C4'-P energy: -40.097 bonds (distance) P-C4' energy: -38.606 flat angles C4'-P-C4' energy: -36.955 flat angles P-C4'-P energy: -20.279 tors. eta vs tors. theta energy: -24.115 Dist. restrs. and SS energy: 2.490 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -424.060985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.060985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.677369 (E_RNA) where: Base-Base interactions energy: -270.503 where: short stacking energy: -124.514 Base-Backbone interact. energy: -0.914 local terms energy: -160.260183 where: bonds (distance) C4'-P energy: -39.388 bonds (distance) P-C4' energy: -38.530 flat angles C4'-P-C4' energy: -32.085 flat angles P-C4'-P energy: -24.143 tors. eta vs tors. theta energy: -26.114 Dist. restrs. and SS energy: 7.616 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -415.779637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.779637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.077146 (E_RNA) where: Base-Base interactions energy: -254.152 where: short stacking energy: -98.367 Base-Backbone interact. energy: 0.347 local terms energy: -162.271456 where: bonds (distance) C4'-P energy: -41.366 bonds (distance) P-C4' energy: -34.966 flat angles C4'-P-C4' energy: -34.417 flat angles P-C4'-P energy: -25.948 tors. eta vs tors. theta energy: -25.574 Dist. restrs. and SS energy: 0.298 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -372.176853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.176853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.548781 (E_RNA) where: Base-Base interactions energy: -236.244 where: short stacking energy: -110.972 Base-Backbone interact. energy: -1.087 local terms energy: -137.218246 where: bonds (distance) C4'-P energy: -33.932 bonds (distance) P-C4' energy: -31.677 flat angles C4'-P-C4' energy: -34.219 flat angles P-C4'-P energy: -18.178 tors. eta vs tors. theta energy: -19.213 Dist. restrs. and SS energy: 2.372 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -673.484084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.484084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.166473 (E_RNA) where: Base-Base interactions energy: -444.591 where: short stacking energy: -202.381 Base-Backbone interact. energy: -0.167 local terms energy: -231.408611 where: bonds (distance) C4'-P energy: -49.255 bonds (distance) P-C4' energy: -44.171 flat angles C4'-P-C4' energy: -47.487 flat angles P-C4'-P energy: -30.691 tors. eta vs tors. theta energy: -59.805 Dist. restrs. and SS energy: 2.682 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -598.488542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.488542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.972162 (E_RNA) where: Base-Base interactions energy: -387.797 where: short stacking energy: -177.215 Base-Backbone interact. energy: 0.522 local terms energy: -214.697458 where: bonds (distance) C4'-P energy: -46.604 bonds (distance) P-C4' energy: -40.384 flat angles C4'-P-C4' energy: -49.555 flat angles P-C4'-P energy: -30.123 tors. eta vs tors. theta energy: -48.031 Dist. restrs. and SS energy: 3.484 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -543.468903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.468903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.853988 (E_RNA) where: Base-Base interactions energy: -347.762 where: short stacking energy: -146.072 Base-Backbone interact. energy: -0.452 local terms energy: -202.640410 where: bonds (distance) C4'-P energy: -40.616 bonds (distance) P-C4' energy: -49.004 flat angles C4'-P-C4' energy: -44.306 flat angles P-C4'-P energy: -31.749 tors. eta vs tors. theta energy: -36.965 Dist. restrs. and SS energy: 7.385 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -495.910496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.910496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.165770 (E_RNA) where: Base-Base interactions energy: -303.345 where: short stacking energy: -146.102 Base-Backbone interact. energy: 0.085 local terms energy: -196.905195 where: bonds (distance) C4'-P energy: -46.368 bonds (distance) P-C4' energy: -41.026 flat angles C4'-P-C4' energy: -37.969 flat angles P-C4'-P energy: -29.629 tors. eta vs tors. theta energy: -41.913 Dist. restrs. and SS energy: 4.255 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -441.593635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.593635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.420553 (E_RNA) where: Base-Base interactions energy: -275.572 where: short stacking energy: -120.928 Base-Backbone interact. energy: 4.791 local terms energy: -181.639658 where: bonds (distance) C4'-P energy: -46.404 bonds (distance) P-C4' energy: -51.861 flat angles C4'-P-C4' energy: -39.157 flat angles P-C4'-P energy: -25.156 tors. eta vs tors. theta energy: -19.061 Dist. restrs. and SS energy: 10.827 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -515.456664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.456664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.137674 (E_RNA) where: Base-Base interactions energy: -350.441 where: short stacking energy: -159.436 Base-Backbone interact. energy: -0.559 local terms energy: -173.137491 where: bonds (distance) C4'-P energy: -39.987 bonds (distance) P-C4' energy: -24.210 flat angles C4'-P-C4' energy: -47.484 flat angles P-C4'-P energy: -32.027 tors. eta vs tors. theta energy: -29.429 Dist. restrs. and SS energy: 8.681 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -476.191138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.191138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.517296 (E_RNA) where: Base-Base interactions energy: -299.663 where: short stacking energy: -137.177 Base-Backbone interact. energy: -2.300 local terms energy: -178.554279 where: bonds (distance) C4'-P energy: -43.015 bonds (distance) P-C4' energy: -49.155 flat angles C4'-P-C4' energy: -40.489 flat angles P-C4'-P energy: -22.016 tors. eta vs tors. theta energy: -23.878 Dist. restrs. and SS energy: 4.326 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -462.814903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.814903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.645262 (E_RNA) where: Base-Base interactions energy: -298.693 where: short stacking energy: -133.210 Base-Backbone interact. energy: -0.787 local terms energy: -165.165231 where: bonds (distance) C4'-P energy: -39.707 bonds (distance) P-C4' energy: -37.398 flat angles C4'-P-C4' energy: -35.313 flat angles P-C4'-P energy: -25.148 tors. eta vs tors. theta energy: -27.599 Dist. restrs. and SS energy: 1.830 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -390.916788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.916788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.848668 (E_RNA) where: Base-Base interactions energy: -223.815 where: short stacking energy: -107.186 Base-Backbone interact. energy: -0.227 local terms energy: -172.806118 where: bonds (distance) C4'-P energy: -36.951 bonds (distance) P-C4' energy: -43.251 flat angles C4'-P-C4' energy: -38.971 flat angles P-C4'-P energy: -30.493 tors. eta vs tors. theta energy: -23.139 Dist. restrs. and SS energy: 5.932 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -395.460665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.460665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.231392 (E_RNA) where: Base-Base interactions energy: -246.584 where: short stacking energy: -124.015 Base-Backbone interact. energy: 0.646 local terms energy: -157.292879 where: bonds (distance) C4'-P energy: -45.564 bonds (distance) P-C4' energy: -42.392 flat angles C4'-P-C4' energy: -31.524 flat angles P-C4'-P energy: -19.861 tors. eta vs tors. theta energy: -17.952 Dist. restrs. and SS energy: 7.771 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -708.800430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.800430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.699129 (E_RNA) where: Base-Base interactions energy: -470.063 where: short stacking energy: -220.963 Base-Backbone interact. energy: -0.782 local terms energy: -239.853661 where: bonds (distance) C4'-P energy: -48.483 bonds (distance) P-C4' energy: -41.545 flat angles C4'-P-C4' energy: -43.716 flat angles P-C4'-P energy: -39.788 tors. eta vs tors. theta energy: -66.322 Dist. restrs. and SS energy: 1.899 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -638.243357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.243357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.140775 (E_RNA) where: Base-Base interactions energy: -413.887 where: short stacking energy: -199.833 Base-Backbone interact. energy: -1.387 local terms energy: -223.866864 where: bonds (distance) C4'-P energy: -45.553 bonds (distance) P-C4' energy: -43.370 flat angles C4'-P-C4' energy: -46.761 flat angles P-C4'-P energy: -30.450 tors. eta vs tors. theta energy: -57.733 Dist. restrs. and SS energy: 0.897 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -562.994544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.994544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.204991 (E_RNA) where: Base-Base interactions energy: -365.158 where: short stacking energy: -164.562 Base-Backbone interact. energy: -1.412 local terms energy: -200.635149 where: bonds (distance) C4'-P energy: -37.968 bonds (distance) P-C4' energy: -48.436 flat angles C4'-P-C4' energy: -42.704 flat angles P-C4'-P energy: -34.368 tors. eta vs tors. theta energy: -37.158 Dist. restrs. and SS energy: 4.210 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -514.806898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.806898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.918521 (E_RNA) where: Base-Base interactions energy: -314.695 where: short stacking energy: -157.141 Base-Backbone interact. energy: -0.434 local terms energy: -204.789469 where: bonds (distance) C4'-P energy: -41.167 bonds (distance) P-C4' energy: -45.271 flat angles C4'-P-C4' energy: -42.697 flat angles P-C4'-P energy: -32.140 tors. eta vs tors. theta energy: -43.514 Dist. restrs. and SS energy: 5.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -533.432053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.432053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.200975 (E_RNA) where: Base-Base interactions energy: -353.482 where: short stacking energy: -163.833 Base-Backbone interact. energy: 1.483 local terms energy: -186.202397 where: bonds (distance) C4'-P energy: -31.210 bonds (distance) P-C4' energy: -39.411 flat angles C4'-P-C4' energy: -40.277 flat angles P-C4'-P energy: -27.496 tors. eta vs tors. theta energy: -47.809 Dist. restrs. and SS energy: 4.769 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -455.258949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.258949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.373867 (E_RNA) where: Base-Base interactions energy: -294.400 where: short stacking energy: -141.126 Base-Backbone interact. energy: 1.087 local terms energy: -171.060847 where: bonds (distance) C4'-P energy: -30.020 bonds (distance) P-C4' energy: -50.009 flat angles C4'-P-C4' energy: -44.252 flat angles P-C4'-P energy: -20.875 tors. eta vs tors. theta energy: -25.905 Dist. restrs. and SS energy: 9.115 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -507.573378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.573378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.865492 (E_RNA) where: Base-Base interactions energy: -319.808 where: short stacking energy: -137.453 Base-Backbone interact. energy: -2.759 local terms energy: -185.297645 where: bonds (distance) C4'-P energy: -35.073 bonds (distance) P-C4' energy: -40.824 flat angles C4'-P-C4' energy: -44.630 flat angles P-C4'-P energy: -31.702 tors. eta vs tors. theta energy: -33.068 Dist. restrs. and SS energy: 0.292 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -438.146534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.146534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.775512 (E_RNA) where: Base-Base interactions energy: -265.928 where: short stacking energy: -111.155 Base-Backbone interact. energy: 0.513 local terms energy: -174.360800 where: bonds (distance) C4'-P energy: -45.828 bonds (distance) P-C4' energy: -30.242 flat angles C4'-P-C4' energy: -44.523 flat angles P-C4'-P energy: -27.032 tors. eta vs tors. theta energy: -26.735 Dist. restrs. and SS energy: 1.629 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -426.802453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.802453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.052096 (E_RNA) where: Base-Base interactions energy: -262.586 where: short stacking energy: -114.360 Base-Backbone interact. energy: -1.261 local terms energy: -168.205517 where: bonds (distance) C4'-P energy: -35.666 bonds (distance) P-C4' energy: -37.465 flat angles C4'-P-C4' energy: -47.615 flat angles P-C4'-P energy: -20.346 tors. eta vs tors. theta energy: -27.113 Dist. restrs. and SS energy: 5.250 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -360.021709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.021709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.043352 (E_RNA) where: Base-Base interactions energy: -235.792 where: short stacking energy: -107.258 Base-Backbone interact. energy: -0.371 local terms energy: -129.880825 where: bonds (distance) C4'-P energy: -33.075 bonds (distance) P-C4' energy: -38.027 flat angles C4'-P-C4' energy: -31.150 flat angles P-C4'-P energy: -19.204 tors. eta vs tors. theta energy: -8.426 Dist. restrs. and SS energy: 6.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -704.999281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.999281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.841396 (E_RNA) where: Base-Base interactions energy: -461.055 where: short stacking energy: -221.307 Base-Backbone interact. energy: -0.912 local terms energy: -245.873510 where: bonds (distance) C4'-P energy: -48.223 bonds (distance) P-C4' energy: -44.180 flat angles C4'-P-C4' energy: -52.337 flat angles P-C4'-P energy: -39.836 tors. eta vs tors. theta energy: -61.297 Dist. restrs. and SS energy: 2.842 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -654.544791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.544791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.593520 (E_RNA) where: Base-Base interactions energy: -440.603 where: short stacking energy: -200.625 Base-Backbone interact. energy: -0.132 local terms energy: -215.858971 where: bonds (distance) C4'-P energy: -38.687 bonds (distance) P-C4' energy: -45.271 flat angles C4'-P-C4' energy: -49.775 flat angles P-C4'-P energy: -28.790 tors. eta vs tors. theta energy: -53.335 Dist. restrs. and SS energy: 2.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -523.614758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.614758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.653121 (E_RNA) where: Base-Base interactions energy: -326.658 where: short stacking energy: -147.776 Base-Backbone interact. energy: 0.930 local terms energy: -201.924510 where: bonds (distance) C4'-P energy: -42.287 bonds (distance) P-C4' energy: -49.309 flat angles C4'-P-C4' energy: -38.705 flat angles P-C4'-P energy: -30.562 tors. eta vs tors. theta energy: -41.061 Dist. restrs. and SS energy: 4.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -589.322039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.322039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.969719 (E_RNA) where: Base-Base interactions energy: -386.353 where: short stacking energy: -184.481 Base-Backbone interact. energy: -1.674 local terms energy: -203.942899 where: bonds (distance) C4'-P energy: -43.184 bonds (distance) P-C4' energy: -41.996 flat angles C4'-P-C4' energy: -45.190 flat angles P-C4'-P energy: -28.589 tors. eta vs tors. theta energy: -44.984 Dist. restrs. and SS energy: 2.648 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -452.216392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.216392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.976523 (E_RNA) where: Base-Base interactions energy: -272.208 where: short stacking energy: -123.810 Base-Backbone interact. energy: -0.342 local terms energy: -182.426836 where: bonds (distance) C4'-P energy: -38.250 bonds (distance) P-C4' energy: -42.794 flat angles C4'-P-C4' energy: -47.142 flat angles P-C4'-P energy: -26.763 tors. eta vs tors. theta energy: -27.477 Dist. restrs. and SS energy: 2.760 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -534.342708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.342708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.838710 (E_RNA) where: Base-Base interactions energy: -328.094 where: short stacking energy: -151.021 Base-Backbone interact. energy: -0.831 local terms energy: -205.913921 where: bonds (distance) C4'-P energy: -41.429 bonds (distance) P-C4' energy: -47.132 flat angles C4'-P-C4' energy: -45.993 flat angles P-C4'-P energy: -36.685 tors. eta vs tors. theta energy: -34.676 Dist. restrs. and SS energy: 0.496 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -410.364828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.364828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.689296 (E_RNA) where: Base-Base interactions energy: -263.642 where: short stacking energy: -124.174 Base-Backbone interact. energy: -1.404 local terms energy: -153.643283 where: bonds (distance) C4'-P energy: -33.027 bonds (distance) P-C4' energy: -35.990 flat angles C4'-P-C4' energy: -41.374 flat angles P-C4'-P energy: -24.191 tors. eta vs tors. theta energy: -19.060 Dist. restrs. and SS energy: 8.324 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -445.545903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.545903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.428938 (E_RNA) where: Base-Base interactions energy: -272.538 where: short stacking energy: -116.223 Base-Backbone interact. energy: -0.837 local terms energy: -173.054109 where: bonds (distance) C4'-P energy: -39.462 bonds (distance) P-C4' energy: -43.323 flat angles C4'-P-C4' energy: -45.999 flat angles P-C4'-P energy: -16.985 tors. eta vs tors. theta energy: -27.285 Dist. restrs. and SS energy: 0.883 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -438.869189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.869189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.047157 (E_RNA) where: Base-Base interactions energy: -268.871 where: short stacking energy: -127.344 Base-Backbone interact. energy: -2.290 local terms energy: -170.885432 where: bonds (distance) C4'-P energy: -39.586 bonds (distance) P-C4' energy: -43.395 flat angles C4'-P-C4' energy: -41.642 flat angles P-C4'-P energy: -19.823 tors. eta vs tors. theta energy: -26.440 Dist. restrs. and SS energy: 3.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -417.784487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.784487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.799787 (E_RNA) where: Base-Base interactions energy: -263.937 where: short stacking energy: -124.919 Base-Backbone interact. energy: -1.053 local terms energy: -160.809783 where: bonds (distance) C4'-P energy: -27.164 bonds (distance) P-C4' energy: -40.971 flat angles C4'-P-C4' energy: -32.423 flat angles P-C4'-P energy: -33.530 tors. eta vs tors. theta energy: -26.722 Dist. restrs. and SS energy: 8.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -696.680207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.680207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.855456 (E_RNA) where: Base-Base interactions energy: -462.825 where: short stacking energy: -208.578 Base-Backbone interact. energy: 0.418 local terms energy: -236.448352 where: bonds (distance) C4'-P energy: -47.098 bonds (distance) P-C4' energy: -54.812 flat angles C4'-P-C4' energy: -42.909 flat angles P-C4'-P energy: -31.274 tors. eta vs tors. theta energy: -60.355 Dist. restrs. and SS energy: 2.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -619.906096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.906096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.287925 (E_RNA) where: Base-Base interactions energy: -410.658 where: short stacking energy: -189.167 Base-Backbone interact. energy: -1.467 local terms energy: -209.162846 where: bonds (distance) C4'-P energy: -48.042 bonds (distance) P-C4' energy: -40.379 flat angles C4'-P-C4' energy: -40.258 flat angles P-C4'-P energy: -26.286 tors. eta vs tors. theta energy: -54.198 Dist. restrs. and SS energy: 1.382 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -615.369842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.369842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.147129 (E_RNA) where: Base-Base interactions energy: -397.637 where: short stacking energy: -201.670 Base-Backbone interact. energy: -0.860 local terms energy: -218.650200 where: bonds (distance) C4'-P energy: -43.649 bonds (distance) P-C4' energy: -38.583 flat angles C4'-P-C4' energy: -50.260 flat angles P-C4'-P energy: -35.760 tors. eta vs tors. theta energy: -50.398 Dist. restrs. and SS energy: 1.777 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -529.803080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.803080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.993753 (E_RNA) where: Base-Base interactions energy: -355.486 where: short stacking energy: -156.848 Base-Backbone interact. energy: -0.542 local terms energy: -183.966104 where: bonds (distance) C4'-P energy: -44.769 bonds (distance) P-C4' energy: -34.566 flat angles C4'-P-C4' energy: -36.152 flat angles P-C4'-P energy: -27.376 tors. eta vs tors. theta energy: -41.104 Dist. restrs. and SS energy: 10.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -566.053587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.053587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.769079 (E_RNA) where: Base-Base interactions energy: -363.731 where: short stacking energy: -169.279 Base-Backbone interact. energy: -1.266 local terms energy: -201.772513 where: bonds (distance) C4'-P energy: -41.635 bonds (distance) P-C4' energy: -46.711 flat angles C4'-P-C4' energy: -41.572 flat angles P-C4'-P energy: -27.545 tors. eta vs tors. theta energy: -44.310 Dist. restrs. and SS energy: 0.715 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -465.492552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.492552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.672090 (E_RNA) where: Base-Base interactions energy: -299.352 where: short stacking energy: -147.461 Base-Backbone interact. energy: -2.502 local terms energy: -165.817666 where: bonds (distance) C4'-P energy: -34.791 bonds (distance) P-C4' energy: -31.108 flat angles C4'-P-C4' energy: -37.760 flat angles P-C4'-P energy: -32.224 tors. eta vs tors. theta energy: -29.935 Dist. restrs. and SS energy: 2.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -468.603885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.603885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.316746 (E_RNA) where: Base-Base interactions energy: -289.179 where: short stacking energy: -136.317 Base-Backbone interact. energy: -0.779 local terms energy: -183.358681 where: bonds (distance) C4'-P energy: -34.668 bonds (distance) P-C4' energy: -47.320 flat angles C4'-P-C4' energy: -41.714 flat angles P-C4'-P energy: -28.636 tors. eta vs tors. theta energy: -31.021 Dist. restrs. and SS energy: 4.713 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -413.749068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.749068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.429320 (E_RNA) where: Base-Base interactions energy: -254.940 where: short stacking energy: -127.566 Base-Backbone interact. energy: -0.981 local terms energy: -167.509259 where: bonds (distance) C4'-P energy: -43.616 bonds (distance) P-C4' energy: -31.773 flat angles C4'-P-C4' energy: -40.234 flat angles P-C4'-P energy: -31.018 tors. eta vs tors. theta energy: -20.869 Dist. restrs. and SS energy: 9.680 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -389.455332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.455332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.578479 (E_RNA) where: Base-Base interactions energy: -248.186 where: short stacking energy: -96.502 Base-Backbone interact. energy: -1.302 local terms energy: -142.090205 where: bonds (distance) C4'-P energy: -32.498 bonds (distance) P-C4' energy: -41.001 flat angles C4'-P-C4' energy: -34.104 flat angles P-C4'-P energy: -24.388 tors. eta vs tors. theta energy: -10.099 Dist. restrs. and SS energy: 2.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -424.062340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.062340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.419144 (E_RNA) where: Base-Base interactions energy: -267.339 where: short stacking energy: -115.883 Base-Backbone interact. energy: -2.169 local terms energy: -161.911067 where: bonds (distance) C4'-P energy: -31.684 bonds (distance) P-C4' energy: -44.522 flat angles C4'-P-C4' energy: -43.343 flat angles P-C4'-P energy: -20.159 tors. eta vs tors. theta energy: -22.202 Dist. restrs. and SS energy: 7.357 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -699.947529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.947529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.587265 (E_RNA) where: Base-Base interactions energy: -478.141 where: short stacking energy: -220.621 Base-Backbone interact. energy: -0.533 local terms energy: -224.913618 where: bonds (distance) C4'-P energy: -43.913 bonds (distance) P-C4' energy: -43.409 flat angles C4'-P-C4' energy: -53.319 flat angles P-C4'-P energy: -28.621 tors. eta vs tors. theta energy: -55.651 Dist. restrs. and SS energy: 3.640 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -629.846758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.846758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.656635 (E_RNA) where: Base-Base interactions energy: -414.888 where: short stacking energy: -175.758 Base-Backbone interact. energy: -0.245 local terms energy: -215.524141 where: bonds (distance) C4'-P energy: -50.210 bonds (distance) P-C4' energy: -44.805 flat angles C4'-P-C4' energy: -48.095 flat angles P-C4'-P energy: -21.303 tors. eta vs tors. theta energy: -51.112 Dist. restrs. and SS energy: 0.810 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -648.269305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.269305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.298836 (E_RNA) where: Base-Base interactions energy: -427.228 where: short stacking energy: -192.969 Base-Backbone interact. energy: 1.177 local terms energy: -224.247842 where: bonds (distance) C4'-P energy: -43.549 bonds (distance) P-C4' energy: -44.832 flat angles C4'-P-C4' energy: -49.731 flat angles P-C4'-P energy: -34.786 tors. eta vs tors. theta energy: -51.350 Dist. restrs. and SS energy: 2.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -561.519661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.519661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.815656 (E_RNA) where: Base-Base interactions energy: -368.056 where: short stacking energy: -175.194 Base-Backbone interact. energy: -1.784 local terms energy: -191.974684 where: bonds (distance) C4'-P energy: -41.883 bonds (distance) P-C4' energy: -40.210 flat angles C4'-P-C4' energy: -38.005 flat angles P-C4'-P energy: -28.473 tors. eta vs tors. theta energy: -43.403 Dist. restrs. and SS energy: 0.296 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -516.478310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.478310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.160135 (E_RNA) where: Base-Base interactions energy: -340.584 where: short stacking energy: -159.882 Base-Backbone interact. energy: -0.609 local terms energy: -181.966688 where: bonds (distance) C4'-P energy: -29.170 bonds (distance) P-C4' energy: -44.134 flat angles C4'-P-C4' energy: -38.587 flat angles P-C4'-P energy: -36.050 tors. eta vs tors. theta energy: -34.026 Dist. restrs. and SS energy: 6.682 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -525.297216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.297216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.821849 (E_RNA) where: Base-Base interactions energy: -344.886 where: short stacking energy: -141.718 Base-Backbone interact. energy: 0.104 local terms energy: -182.039476 where: bonds (distance) C4'-P energy: -40.915 bonds (distance) P-C4' energy: -31.090 flat angles C4'-P-C4' energy: -35.417 flat angles P-C4'-P energy: -34.994 tors. eta vs tors. theta energy: -39.623 Dist. restrs. and SS energy: 1.525 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -494.542803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.542803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.968436 (E_RNA) where: Base-Base interactions energy: -322.821 where: short stacking energy: -147.303 Base-Backbone interact. energy: -1.449 local terms energy: -171.698483 where: bonds (distance) C4'-P energy: -36.826 bonds (distance) P-C4' energy: -37.231 flat angles C4'-P-C4' energy: -38.298 flat angles P-C4'-P energy: -26.068 tors. eta vs tors. theta energy: -33.274 Dist. restrs. and SS energy: 1.426 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -396.371455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.371455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.226322 (E_RNA) where: Base-Base interactions energy: -259.765 where: short stacking energy: -107.475 Base-Backbone interact. energy: 1.358 local terms energy: -141.818703 where: bonds (distance) C4'-P energy: -28.109 bonds (distance) P-C4' energy: -27.746 flat angles C4'-P-C4' energy: -39.085 flat angles P-C4'-P energy: -29.188 tors. eta vs tors. theta energy: -17.690 Dist. restrs. and SS energy: 3.855 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -445.869494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.869494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.404841 (E_RNA) where: Base-Base interactions energy: -286.025 where: short stacking energy: -133.265 Base-Backbone interact. energy: -1.552 local terms energy: -164.827768 where: bonds (distance) C4'-P energy: -23.610 bonds (distance) P-C4' energy: -47.620 flat angles C4'-P-C4' energy: -45.093 flat angles P-C4'-P energy: -17.555 tors. eta vs tors. theta energy: -30.950 Dist. restrs. and SS energy: 6.535 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -427.794316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.794316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.185318 (E_RNA) where: Base-Base interactions energy: -275.623 where: short stacking energy: -120.806 Base-Backbone interact. energy: -1.465 local terms energy: -157.097581 where: bonds (distance) C4'-P energy: -35.836 bonds (distance) P-C4' energy: -38.616 flat angles C4'-P-C4' energy: -43.209 flat angles P-C4'-P energy: -19.929 tors. eta vs tors. theta energy: -19.507 Dist. restrs. and SS energy: 6.391 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -702.668005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.668005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.369641 (E_RNA) where: Base-Base interactions energy: -464.809 where: short stacking energy: -208.367 Base-Backbone interact. energy: -0.547 local terms energy: -239.013221 where: bonds (distance) C4'-P energy: -50.917 bonds (distance) P-C4' energy: -41.915 flat angles C4'-P-C4' energy: -49.347 flat angles P-C4'-P energy: -35.764 tors. eta vs tors. theta energy: -61.070 Dist. restrs. and SS energy: 1.702 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -650.800110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.800110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.112457 (E_RNA) where: Base-Base interactions energy: -431.622 where: short stacking energy: -191.228 Base-Backbone interact. energy: -0.690 local terms energy: -218.800606 where: bonds (distance) C4'-P energy: -43.718 bonds (distance) P-C4' energy: -44.746 flat angles C4'-P-C4' energy: -48.394 flat angles P-C4'-P energy: -29.462 tors. eta vs tors. theta energy: -52.481 Dist. restrs. and SS energy: 0.312 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -647.898630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.898630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.860831 (E_RNA) where: Base-Base interactions energy: -440.047 where: short stacking energy: -183.272 Base-Backbone interact. energy: 0.720 local terms energy: -210.534060 where: bonds (distance) C4'-P energy: -36.483 bonds (distance) P-C4' energy: -45.858 flat angles C4'-P-C4' energy: -50.906 flat angles P-C4'-P energy: -31.780 tors. eta vs tors. theta energy: -45.506 Dist. restrs. and SS energy: 1.962 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -582.475460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.475460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.851133 (E_RNA) where: Base-Base interactions energy: -360.497 where: short stacking energy: -182.633 Base-Backbone interact. energy: -2.501 local terms energy: -219.853154 where: bonds (distance) C4'-P energy: -44.495 bonds (distance) P-C4' energy: -46.696 flat angles C4'-P-C4' energy: -46.937 flat angles P-C4'-P energy: -32.409 tors. eta vs tors. theta energy: -49.315 Dist. restrs. and SS energy: 0.376 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -550.931484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.931484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.071943 (E_RNA) where: Base-Base interactions energy: -377.304 where: short stacking energy: -161.211 Base-Backbone interact. energy: -2.141 local terms energy: -175.626984 where: bonds (distance) C4'-P energy: -40.207 bonds (distance) P-C4' energy: -36.743 flat angles C4'-P-C4' energy: -37.388 flat angles P-C4'-P energy: -28.182 tors. eta vs tors. theta energy: -33.107 Dist. restrs. and SS energy: 4.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -512.502562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.502562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.602043 (E_RNA) where: Base-Base interactions energy: -315.092 where: short stacking energy: -131.153 Base-Backbone interact. energy: -0.722 local terms energy: -198.787204 where: bonds (distance) C4'-P energy: -36.784 bonds (distance) P-C4' energy: -47.301 flat angles C4'-P-C4' energy: -49.263 flat angles P-C4'-P energy: -28.181 tors. eta vs tors. theta energy: -37.259 Dist. restrs. and SS energy: 2.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -551.817776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.817776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.168338 (E_RNA) where: Base-Base interactions energy: -371.691 where: short stacking energy: -170.584 Base-Backbone interact. energy: 2.329 local terms energy: -182.806081 where: bonds (distance) C4'-P energy: -40.853 bonds (distance) P-C4' energy: -26.421 flat angles C4'-P-C4' energy: -48.035 flat angles P-C4'-P energy: -23.636 tors. eta vs tors. theta energy: -43.862 Dist. restrs. and SS energy: 0.351 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -407.953500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.953500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.665316 (E_RNA) where: Base-Base interactions energy: -261.656 where: short stacking energy: -116.283 Base-Backbone interact. energy: -0.946 local terms energy: -151.062554 where: bonds (distance) C4'-P energy: -33.077 bonds (distance) P-C4' energy: -36.876 flat angles C4'-P-C4' energy: -43.664 flat angles P-C4'-P energy: -21.899 tors. eta vs tors. theta energy: -15.546 Dist. restrs. and SS energy: 5.712 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -417.416758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.416758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.717205 (E_RNA) where: Base-Base interactions energy: -273.988 where: short stacking energy: -134.892 Base-Backbone interact. energy: 0.831 local terms energy: -150.560141 where: bonds (distance) C4'-P energy: -33.737 bonds (distance) P-C4' energy: -29.616 flat angles C4'-P-C4' energy: -42.625 flat angles P-C4'-P energy: -21.416 tors. eta vs tors. theta energy: -23.167 Dist. restrs. and SS energy: 6.300 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -438.894298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.894298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.219684 (E_RNA) where: Base-Base interactions energy: -271.731 where: short stacking energy: -123.871 Base-Backbone interact. energy: -0.293 local terms energy: -168.195993 where: bonds (distance) C4'-P energy: -40.344 bonds (distance) P-C4' energy: -41.570 flat angles C4'-P-C4' energy: -38.068 flat angles P-C4'-P energy: -26.648 tors. eta vs tors. theta energy: -21.566 Dist. restrs. and SS energy: 1.325 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -665.757430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.757430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.305231 (E_RNA) where: Base-Base interactions energy: -445.353 where: short stacking energy: -187.326 Base-Backbone interact. energy: -0.549 local terms energy: -221.403669 where: bonds (distance) C4'-P energy: -39.342 bonds (distance) P-C4' energy: -46.079 flat angles C4'-P-C4' energy: -52.166 flat angles P-C4'-P energy: -31.744 tors. eta vs tors. theta energy: -52.073 Dist. restrs. and SS energy: 1.548 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -671.658928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.658928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.496210 (E_RNA) where: Base-Base interactions energy: -451.134 where: short stacking energy: -191.778 Base-Backbone interact. energy: -1.021 local terms energy: -221.341093 where: bonds (distance) C4'-P energy: -45.847 bonds (distance) P-C4' energy: -49.340 flat angles C4'-P-C4' energy: -43.184 flat angles P-C4'-P energy: -30.065 tors. eta vs tors. theta energy: -52.905 Dist. restrs. and SS energy: 1.837 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -621.012755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.012755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.127756 (E_RNA) where: Base-Base interactions energy: -413.257 where: short stacking energy: -183.399 Base-Backbone interact. energy: -2.604 local terms energy: -206.267261 where: bonds (distance) C4'-P energy: -40.733 bonds (distance) P-C4' energy: -38.910 flat angles C4'-P-C4' energy: -45.865 flat angles P-C4'-P energy: -28.018 tors. eta vs tors. theta energy: -52.742 Dist. restrs. and SS energy: 1.115 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -579.005714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.005714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.307161 (E_RNA) where: Base-Base interactions energy: -367.494 where: short stacking energy: -183.597 Base-Backbone interact. energy: -0.599 local terms energy: -211.213753 where: bonds (distance) C4'-P energy: -49.337 bonds (distance) P-C4' energy: -35.648 flat angles C4'-P-C4' energy: -48.616 flat angles P-C4'-P energy: -29.178 tors. eta vs tors. theta energy: -48.435 Dist. restrs. and SS energy: 0.301 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -561.695564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.695564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.523264 (E_RNA) where: Base-Base interactions energy: -376.864 where: short stacking energy: -178.625 Base-Backbone interact. energy: 0.033 local terms energy: -189.691720 where: bonds (distance) C4'-P energy: -39.153 bonds (distance) P-C4' energy: -40.851 flat angles C4'-P-C4' energy: -45.909 flat angles P-C4'-P energy: -23.812 tors. eta vs tors. theta energy: -39.966 Dist. restrs. and SS energy: 4.828 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -542.565635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.565635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.503733 (E_RNA) where: Base-Base interactions energy: -347.541 where: short stacking energy: -161.464 Base-Backbone interact. energy: -1.040 local terms energy: -194.922369 where: bonds (distance) C4'-P energy: -42.268 bonds (distance) P-C4' energy: -39.641 flat angles C4'-P-C4' energy: -46.310 flat angles P-C4'-P energy: -29.794 tors. eta vs tors. theta energy: -36.910 Dist. restrs. and SS energy: 0.938 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -490.780774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.780774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.013286 (E_RNA) where: Base-Base interactions energy: -319.845 where: short stacking energy: -153.619 Base-Backbone interact. energy: -0.412 local terms energy: -172.757074 where: bonds (distance) C4'-P energy: -39.031 bonds (distance) P-C4' energy: -42.798 flat angles C4'-P-C4' energy: -31.622 flat angles P-C4'-P energy: -25.634 tors. eta vs tors. theta energy: -33.671 Dist. restrs. and SS energy: 2.233 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -424.926513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.926513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.861265 (E_RNA) where: Base-Base interactions energy: -249.451 where: short stacking energy: -110.902 Base-Backbone interact. energy: 1.677 local terms energy: -179.086646 where: bonds (distance) C4'-P energy: -38.022 bonds (distance) P-C4' energy: -42.746 flat angles C4'-P-C4' energy: -42.525 flat angles P-C4'-P energy: -35.657 tors. eta vs tors. theta energy: -20.136 Dist. restrs. and SS energy: 1.935 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -408.102081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.102081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.672279 (E_RNA) where: Base-Base interactions energy: -266.605 where: short stacking energy: -117.678 Base-Backbone interact. energy: 2.500 local terms energy: -147.566683 where: bonds (distance) C4'-P energy: -38.781 bonds (distance) P-C4' energy: -28.496 flat angles C4'-P-C4' energy: -40.237 flat angles P-C4'-P energy: -15.331 tors. eta vs tors. theta energy: -24.723 Dist. restrs. and SS energy: 3.570 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -460.474943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.474943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.644491 (E_RNA) where: Base-Base interactions energy: -299.383 where: short stacking energy: -138.795 Base-Backbone interact. energy: -0.687 local terms energy: -160.574726 where: bonds (distance) C4'-P energy: -40.580 bonds (distance) P-C4' energy: -38.270 flat angles C4'-P-C4' energy: -35.903 flat angles P-C4'-P energy: -18.528 tors. eta vs tors. theta energy: -27.294 Dist. restrs. and SS energy: 0.170 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -669.694922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.694922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.274917 (E_RNA) where: Base-Base interactions energy: -443.551 where: short stacking energy: -203.083 Base-Backbone interact. energy: -2.325 local terms energy: -225.398852 where: bonds (distance) C4'-P energy: -42.905 bonds (distance) P-C4' energy: -49.135 flat angles C4'-P-C4' energy: -49.288 flat angles P-C4'-P energy: -28.665 tors. eta vs tors. theta energy: -55.407 Dist. restrs. and SS energy: 1.580 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -663.396584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.396584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.882536 (E_RNA) where: Base-Base interactions energy: -440.632 where: short stacking energy: -193.099 Base-Backbone interact. energy: -0.462 local terms energy: -223.788398 where: bonds (distance) C4'-P energy: -46.422 bonds (distance) P-C4' energy: -45.089 flat angles C4'-P-C4' energy: -47.647 flat angles P-C4'-P energy: -34.907 tors. eta vs tors. theta energy: -49.723 Dist. restrs. and SS energy: 1.486 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -615.601183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.601183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.083734 (E_RNA) where: Base-Base interactions energy: -393.368 where: short stacking energy: -202.673 Base-Backbone interact. energy: 0.366 local terms energy: -223.081358 where: bonds (distance) C4'-P energy: -47.752 bonds (distance) P-C4' energy: -39.294 flat angles C4'-P-C4' energy: -47.779 flat angles P-C4'-P energy: -27.441 tors. eta vs tors. theta energy: -60.815 Dist. restrs. and SS energy: 0.483 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -587.881081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.881081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.065284 (E_RNA) where: Base-Base interactions energy: -394.877 where: short stacking energy: -183.696 Base-Backbone interact. energy: -2.236 local terms energy: -195.952425 where: bonds (distance) C4'-P energy: -34.699 bonds (distance) P-C4' energy: -42.770 flat angles C4'-P-C4' energy: -44.601 flat angles P-C4'-P energy: -30.007 tors. eta vs tors. theta energy: -43.875 Dist. restrs. and SS energy: 5.184 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -579.521107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.521107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.969651 (E_RNA) where: Base-Base interactions energy: -365.368 where: short stacking energy: -173.107 Base-Backbone interact. energy: -0.617 local terms energy: -213.984733 where: bonds (distance) C4'-P energy: -44.451 bonds (distance) P-C4' energy: -42.659 flat angles C4'-P-C4' energy: -45.667 flat angles P-C4'-P energy: -35.822 tors. eta vs tors. theta energy: -45.386 Dist. restrs. and SS energy: 0.449 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -525.606826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.606826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.671222 (E_RNA) where: Base-Base interactions energy: -347.074 where: short stacking energy: -136.370 Base-Backbone interact. energy: -1.763 local terms energy: -181.834111 where: bonds (distance) C4'-P energy: -45.356 bonds (distance) P-C4' energy: -33.353 flat angles C4'-P-C4' energy: -36.133 flat angles P-C4'-P energy: -28.157 tors. eta vs tors. theta energy: -38.835 Dist. restrs. and SS energy: 5.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -524.084987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.084987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.442232 (E_RNA) where: Base-Base interactions energy: -362.525 where: short stacking energy: -163.880 Base-Backbone interact. energy: -0.272 local terms energy: -161.645001 where: bonds (distance) C4'-P energy: -27.070 bonds (distance) P-C4' energy: -33.635 flat angles C4'-P-C4' energy: -36.613 flat angles P-C4'-P energy: -28.556 tors. eta vs tors. theta energy: -35.770 Dist. restrs. and SS energy: 0.357 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -490.772160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.772160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.206429 (E_RNA) where: Base-Base interactions energy: -314.208 where: short stacking energy: -144.667 Base-Backbone interact. energy: -2.388 local terms energy: -174.610504 where: bonds (distance) C4'-P energy: -44.118 bonds (distance) P-C4' energy: -39.614 flat angles C4'-P-C4' energy: -40.509 flat angles P-C4'-P energy: -24.699 tors. eta vs tors. theta energy: -25.671 Dist. restrs. and SS energy: 0.434 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -477.515936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.515936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.935640 (E_RNA) where: Base-Base interactions energy: -323.745 where: short stacking energy: -149.025 Base-Backbone interact. energy: -1.348 local terms energy: -152.842496 where: bonds (distance) C4'-P energy: -21.528 bonds (distance) P-C4' energy: -34.998 flat angles C4'-P-C4' energy: -31.639 flat angles P-C4'-P energy: -28.733 tors. eta vs tors. theta energy: -35.944 Dist. restrs. and SS energy: 0.420 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -389.092638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.092638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.029117 (E_RNA) where: Base-Base interactions energy: -247.636 where: short stacking energy: -110.713 Base-Backbone interact. energy: -0.541 local terms energy: -143.851992 where: bonds (distance) C4'-P energy: -25.943 bonds (distance) P-C4' energy: -33.105 flat angles C4'-P-C4' energy: -43.311 flat angles P-C4'-P energy: -28.795 tors. eta vs tors. theta energy: -12.699 Dist. restrs. and SS energy: 2.936 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -682.793528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.793528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.667620 (E_RNA) where: Base-Base interactions energy: -464.659 where: short stacking energy: -194.043 Base-Backbone interact. energy: -0.178 local terms energy: -219.830546 where: bonds (distance) C4'-P energy: -39.853 bonds (distance) P-C4' energy: -48.061 flat angles C4'-P-C4' energy: -47.983 flat angles P-C4'-P energy: -31.635 tors. eta vs tors. theta energy: -52.298 Dist. restrs. and SS energy: 1.874 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -683.600145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.600145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.652908 (E_RNA) where: Base-Base interactions energy: -450.660 where: short stacking energy: -210.297 Base-Backbone interact. energy: -0.624 local terms energy: -234.368284 where: bonds (distance) C4'-P energy: -48.780 bonds (distance) P-C4' energy: -45.826 flat angles C4'-P-C4' energy: -50.859 flat angles P-C4'-P energy: -27.407 tors. eta vs tors. theta energy: -61.496 Dist. restrs. and SS energy: 2.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -623.204302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -623.204302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -623.764638 (E_RNA) where: Base-Base interactions energy: -391.659 where: short stacking energy: -199.413 Base-Backbone interact. energy: -0.402 local terms energy: -231.703399 where: bonds (distance) C4'-P energy: -46.348 bonds (distance) P-C4' energy: -44.306 flat angles C4'-P-C4' energy: -52.891 flat angles P-C4'-P energy: -29.967 tors. eta vs tors. theta energy: -58.192 Dist. restrs. and SS energy: 0.560 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -619.002542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.002542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.396075 (E_RNA) where: Base-Base interactions energy: -415.116 where: short stacking energy: -195.678 Base-Backbone interact. energy: -0.750 local terms energy: -205.530090 where: bonds (distance) C4'-P energy: -36.870 bonds (distance) P-C4' energy: -43.947 flat angles C4'-P-C4' energy: -46.062 flat angles P-C4'-P energy: -25.930 tors. eta vs tors. theta energy: -52.721 Dist. restrs. and SS energy: 2.394 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -624.592911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.592911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.747391 (E_RNA) where: Base-Base interactions energy: -429.503 where: short stacking energy: -175.892 Base-Backbone interact. energy: -0.704 local terms energy: -194.539902 where: bonds (distance) C4'-P energy: -41.765 bonds (distance) P-C4' energy: -45.582 flat angles C4'-P-C4' energy: -36.774 flat angles P-C4'-P energy: -19.797 tors. eta vs tors. theta energy: -50.622 Dist. restrs. and SS energy: 0.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -540.847822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.847822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.030960 (E_RNA) where: Base-Base interactions energy: -360.665 where: short stacking energy: -171.480 Base-Backbone interact. energy: 0.246 local terms energy: -180.612274 where: bonds (distance) C4'-P energy: -41.632 bonds (distance) P-C4' energy: -22.550 flat angles C4'-P-C4' energy: -49.915 flat angles P-C4'-P energy: -27.313 tors. eta vs tors. theta energy: -39.203 Dist. restrs. and SS energy: 0.183 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -464.204563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.204563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.033809 (E_RNA) where: Base-Base interactions energy: -287.182 where: short stacking energy: -137.914 Base-Backbone interact. energy: 1.301 local terms energy: -186.153662 where: bonds (distance) C4'-P energy: -37.242 bonds (distance) P-C4' energy: -41.810 flat angles C4'-P-C4' energy: -42.979 flat angles P-C4'-P energy: -29.100 tors. eta vs tors. theta energy: -35.022 Dist. restrs. and SS energy: 7.829 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -530.327665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.327665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.767580 (E_RNA) where: Base-Base interactions energy: -354.764 where: short stacking energy: -155.387 Base-Backbone interact. energy: 0.765 local terms energy: -176.768195 where: bonds (distance) C4'-P energy: -27.682 bonds (distance) P-C4' energy: -47.118 flat angles C4'-P-C4' energy: -38.030 flat angles P-C4'-P energy: -16.105 tors. eta vs tors. theta energy: -47.834 Dist. restrs. and SS energy: 0.440 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -484.133559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.133559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.954879 (E_RNA) where: Base-Base interactions energy: -308.557 where: short stacking energy: -153.188 Base-Backbone interact. energy: -1.229 local terms energy: -175.168866 where: bonds (distance) C4'-P energy: -35.593 bonds (distance) P-C4' energy: -40.439 flat angles C4'-P-C4' energy: -40.076 flat angles P-C4'-P energy: -28.847 tors. eta vs tors. theta energy: -30.214 Dist. restrs. and SS energy: 0.821 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -408.040387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.040387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.051733 (E_RNA) where: Base-Base interactions energy: -269.407 where: short stacking energy: -116.041 Base-Backbone interact. energy: -0.379 local terms energy: -145.266471 where: bonds (distance) C4'-P energy: -30.302 bonds (distance) P-C4' energy: -31.950 flat angles C4'-P-C4' energy: -35.537 flat angles P-C4'-P energy: -23.112 tors. eta vs tors. theta energy: -24.365 Dist. restrs. and SS energy: 7.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -695.797647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.797647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.632748 (E_RNA) where: Base-Base interactions energy: -476.139 where: short stacking energy: -209.593 Base-Backbone interact. energy: -0.414 local terms energy: -221.080041 where: bonds (distance) C4'-P energy: -45.580 bonds (distance) P-C4' energy: -49.340 flat angles C4'-P-C4' energy: -42.122 flat angles P-C4'-P energy: -37.573 tors. eta vs tors. theta energy: -46.464 Dist. restrs. and SS energy: 1.835 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -658.912480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.912480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.322742 (E_RNA) where: Base-Base interactions energy: -435.302 where: short stacking energy: -192.220 Base-Backbone interact. energy: -1.236 local terms energy: -225.784856 where: bonds (distance) C4'-P energy: -45.534 bonds (distance) P-C4' energy: -44.076 flat angles C4'-P-C4' energy: -49.012 flat angles P-C4'-P energy: -32.220 tors. eta vs tors. theta energy: -54.942 Dist. restrs. and SS energy: 3.410 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -647.794390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.794390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.875508 (E_RNA) where: Base-Base interactions energy: -418.557 where: short stacking energy: -185.527 Base-Backbone interact. energy: -2.441 local terms energy: -229.877595 where: bonds (distance) C4'-P energy: -50.299 bonds (distance) P-C4' energy: -46.157 flat angles C4'-P-C4' energy: -48.301 flat angles P-C4'-P energy: -37.361 tors. eta vs tors. theta energy: -47.760 Dist. restrs. and SS energy: 3.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -575.759691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.759691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.907017 (E_RNA) where: Base-Base interactions energy: -361.908 where: short stacking energy: -175.486 Base-Backbone interact. energy: -0.166 local terms energy: -213.833737 where: bonds (distance) C4'-P energy: -39.651 bonds (distance) P-C4' energy: -43.485 flat angles C4'-P-C4' energy: -51.914 flat angles P-C4'-P energy: -32.622 tors. eta vs tors. theta energy: -46.162 Dist. restrs. and SS energy: 0.147 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -628.417573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.417573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.141369 (E_RNA) where: Base-Base interactions energy: -415.693 where: short stacking energy: -186.867 Base-Backbone interact. energy: -1.951 local terms energy: -211.497018 where: bonds (distance) C4'-P energy: -44.568 bonds (distance) P-C4' energy: -46.943 flat angles C4'-P-C4' energy: -44.730 flat angles P-C4'-P energy: -26.180 tors. eta vs tors. theta energy: -49.075 Dist. restrs. and SS energy: 0.724 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -535.814766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.814766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.426031 (E_RNA) where: Base-Base interactions energy: -326.297 where: short stacking energy: -146.143 Base-Backbone interact. energy: -1.639 local terms energy: -208.489694 where: bonds (distance) C4'-P energy: -45.039 bonds (distance) P-C4' energy: -49.891 flat angles C4'-P-C4' energy: -40.076 flat angles P-C4'-P energy: -32.623 tors. eta vs tors. theta energy: -40.861 Dist. restrs. and SS energy: 0.611 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -512.843463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.843463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.724608 (E_RNA) where: Base-Base interactions energy: -334.024 where: short stacking energy: -147.250 Base-Backbone interact. energy: 0.553 local terms energy: -180.253830 where: bonds (distance) C4'-P energy: -40.507 bonds (distance) P-C4' energy: -39.483 flat angles C4'-P-C4' energy: -27.755 flat angles P-C4'-P energy: -31.224 tors. eta vs tors. theta energy: -41.285 Dist. restrs. and SS energy: 0.881 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -441.840736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.840736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.796570 (E_RNA) where: Base-Base interactions energy: -276.503 where: short stacking energy: -111.851 Base-Backbone interact. energy: -1.449 local terms energy: -169.844598 where: bonds (distance) C4'-P energy: -38.515 bonds (distance) P-C4' energy: -36.580 flat angles C4'-P-C4' energy: -39.706 flat angles P-C4'-P energy: -33.521 tors. eta vs tors. theta energy: -21.522 Dist. restrs. and SS energy: 5.956 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -490.070930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.070930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.441924 (E_RNA) where: Base-Base interactions energy: -320.002 where: short stacking energy: -150.668 Base-Backbone interact. energy: -0.868 local terms energy: -171.571353 where: bonds (distance) C4'-P energy: -37.305 bonds (distance) P-C4' energy: -30.536 flat angles C4'-P-C4' energy: -33.219 flat angles P-C4'-P energy: -30.671 tors. eta vs tors. theta energy: -39.840 Dist. restrs. and SS energy: 2.371 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -404.946409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.946409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.549604 (E_RNA) where: Base-Base interactions energy: -250.535 where: short stacking energy: -109.410 Base-Backbone interact. energy: -1.770 local terms energy: -159.244758 where: bonds (distance) C4'-P energy: -40.582 bonds (distance) P-C4' energy: -36.395 flat angles C4'-P-C4' energy: -40.195 flat angles P-C4'-P energy: -27.917 tors. eta vs tors. theta energy: -14.157 Dist. restrs. and SS energy: 6.603 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -696.994953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.994953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.110918 (E_RNA) where: Base-Base interactions energy: -461.947 where: short stacking energy: -187.816 Base-Backbone interact. energy: -2.129 local terms energy: -235.034816 where: bonds (distance) C4'-P energy: -46.086 bonds (distance) P-C4' energy: -55.486 flat angles C4'-P-C4' energy: -46.888 flat angles P-C4'-P energy: -34.087 tors. eta vs tors. theta energy: -52.488 Dist. restrs. and SS energy: 2.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -672.233535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.233535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.978408 (E_RNA) where: Base-Base interactions energy: -452.405 where: short stacking energy: -200.078 Base-Backbone interact. energy: -0.803 local terms energy: -223.770249 where: bonds (distance) C4'-P energy: -42.996 bonds (distance) P-C4' energy: -40.345 flat angles C4'-P-C4' energy: -46.866 flat angles P-C4'-P energy: -39.721 tors. eta vs tors. theta energy: -53.842 Dist. restrs. and SS energy: 4.745 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -654.320834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.320834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.360428 (E_RNA) where: Base-Base interactions energy: -437.695 where: short stacking energy: -194.612 Base-Backbone interact. energy: -0.629 local terms energy: -218.036722 where: bonds (distance) C4'-P energy: -44.869 bonds (distance) P-C4' energy: -37.671 flat angles C4'-P-C4' energy: -45.081 flat angles P-C4'-P energy: -34.000 tors. eta vs tors. theta energy: -56.416 Dist. restrs. and SS energy: 2.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -624.421557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.421557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.421557 (E_RNA) where: Base-Base interactions energy: -412.076 where: short stacking energy: -183.327 Base-Backbone interact. energy: -2.406 local terms energy: -209.939899 where: bonds (distance) C4'-P energy: -36.213 bonds (distance) P-C4' energy: -42.913 flat angles C4'-P-C4' energy: -43.727 flat angles P-C4'-P energy: -34.246 tors. eta vs tors. theta energy: -52.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -534.209279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.209279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.674774 (E_RNA) where: Base-Base interactions energy: -335.473 where: short stacking energy: -160.425 Base-Backbone interact. energy: -0.906 local terms energy: -198.295904 where: bonds (distance) C4'-P energy: -40.356 bonds (distance) P-C4' energy: -41.908 flat angles C4'-P-C4' energy: -46.266 flat angles P-C4'-P energy: -29.087 tors. eta vs tors. theta energy: -40.679 Dist. restrs. and SS energy: 0.465 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -522.260732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.260732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.099567 (E_RNA) where: Base-Base interactions energy: -336.448 where: short stacking energy: -165.041 Base-Backbone interact. energy: -0.719 local terms energy: -186.932654 where: bonds (distance) C4'-P energy: -35.870 bonds (distance) P-C4' energy: -41.584 flat angles C4'-P-C4' energy: -38.342 flat angles P-C4'-P energy: -26.769 tors. eta vs tors. theta energy: -44.368 Dist. restrs. and SS energy: 1.839 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -532.289739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.289739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.243577 (E_RNA) where: Base-Base interactions energy: -327.047 where: short stacking energy: -162.527 Base-Backbone interact. energy: -1.032 local terms energy: -205.164969 where: bonds (distance) C4'-P energy: -37.334 bonds (distance) P-C4' energy: -48.286 flat angles C4'-P-C4' energy: -42.262 flat angles P-C4'-P energy: -32.798 tors. eta vs tors. theta energy: -44.485 Dist. restrs. and SS energy: 0.954 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -482.112863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.112863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.457516 (E_RNA) where: Base-Base interactions energy: -326.086 where: short stacking energy: -150.029 Base-Backbone interact. energy: -0.720 local terms energy: -155.651032 where: bonds (distance) C4'-P energy: -37.622 bonds (distance) P-C4' energy: -32.243 flat angles C4'-P-C4' energy: -34.268 flat angles P-C4'-P energy: -17.045 tors. eta vs tors. theta energy: -34.474 Dist. restrs. and SS energy: 0.345 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -404.608240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.608240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.281018 (E_RNA) where: Base-Base interactions energy: -245.960 where: short stacking energy: -106.931 Base-Backbone interact. energy: 1.177 local terms energy: -165.498328 where: bonds (distance) C4'-P energy: -41.010 bonds (distance) P-C4' energy: -43.172 flat angles C4'-P-C4' energy: -42.790 flat angles P-C4'-P energy: -17.830 tors. eta vs tors. theta energy: -20.696 Dist. restrs. and SS energy: 5.673 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -415.594496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.594496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.182021 (E_RNA) where: Base-Base interactions energy: -276.505 where: short stacking energy: -119.172 Base-Backbone interact. energy: -0.676 local terms energy: -143.000984 where: bonds (distance) C4'-P energy: -31.020 bonds (distance) P-C4' energy: -37.433 flat angles C4'-P-C4' energy: -42.852 flat angles P-C4'-P energy: -14.106 tors. eta vs tors. theta energy: -17.590 Dist. restrs. and SS energy: 4.588 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -699.904289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.904289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.490545 (E_RNA) where: Base-Base interactions energy: -488.515 where: short stacking energy: -204.501 Base-Backbone interact. energy: 2.157 local terms energy: -215.132739 where: bonds (distance) C4'-P energy: -42.964 bonds (distance) P-C4' energy: -43.850 flat angles C4'-P-C4' energy: -40.192 flat angles P-C4'-P energy: -37.120 tors. eta vs tors. theta energy: -51.008 Dist. restrs. and SS energy: 1.586 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -689.272770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.272770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.708489 (E_RNA) where: Base-Base interactions energy: -472.243 where: short stacking energy: -206.556 Base-Backbone interact. energy: -0.115 local terms energy: -221.350647 where: bonds (distance) C4'-P energy: -44.861 bonds (distance) P-C4' energy: -45.801 flat angles C4'-P-C4' energy: -49.988 flat angles P-C4'-P energy: -25.919 tors. eta vs tors. theta energy: -54.781 Dist. restrs. and SS energy: 4.436 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -658.275615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.275615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.209312 (E_RNA) where: Base-Base interactions energy: -441.624 where: short stacking energy: -196.568 Base-Backbone interact. energy: 0.806 local terms energy: -222.391246 where: bonds (distance) C4'-P energy: -47.042 bonds (distance) P-C4' energy: -34.922 flat angles C4'-P-C4' energy: -44.225 flat angles P-C4'-P energy: -37.107 tors. eta vs tors. theta energy: -59.095 Dist. restrs. and SS energy: 4.934 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -664.290361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.290361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.500827 (E_RNA) where: Base-Base interactions energy: -446.748 where: short stacking energy: -204.282 Base-Backbone interact. energy: -1.076 local terms energy: -216.676501 where: bonds (distance) C4'-P energy: -31.825 bonds (distance) P-C4' energy: -45.528 flat angles C4'-P-C4' energy: -49.154 flat angles P-C4'-P energy: -31.458 tors. eta vs tors. theta energy: -58.712 Dist. restrs. and SS energy: 0.210 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -579.410208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.410208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.595173 (E_RNA) where: Base-Base interactions energy: -370.095 where: short stacking energy: -182.296 Base-Backbone interact. energy: 1.925 local terms energy: -211.425618 where: bonds (distance) C4'-P energy: -50.995 bonds (distance) P-C4' energy: -40.739 flat angles C4'-P-C4' energy: -46.213 flat angles P-C4'-P energy: -29.170 tors. eta vs tors. theta energy: -44.308 Dist. restrs. and SS energy: 0.185 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -530.293669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.293669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.845022 (E_RNA) where: Base-Base interactions energy: -347.073 where: short stacking energy: -151.021 Base-Backbone interact. energy: -0.074 local terms energy: -183.697808 where: bonds (distance) C4'-P energy: -38.642 bonds (distance) P-C4' energy: -39.131 flat angles C4'-P-C4' energy: -45.123 flat angles P-C4'-P energy: -25.101 tors. eta vs tors. theta energy: -35.700 Dist. restrs. and SS energy: 0.551 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -545.524158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.524158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.807409 (E_RNA) where: Base-Base interactions energy: -358.910 where: short stacking energy: -167.598 Base-Backbone interact. energy: -0.570 local terms energy: -186.326694 where: bonds (distance) C4'-P energy: -36.673 bonds (distance) P-C4' energy: -41.212 flat angles C4'-P-C4' energy: -41.481 flat angles P-C4'-P energy: -27.503 tors. eta vs tors. theta energy: -39.457 Dist. restrs. and SS energy: 0.283 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -486.277758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.277758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.434255 (E_RNA) where: Base-Base interactions energy: -315.452 where: short stacking energy: -163.872 Base-Backbone interact. energy: 1.497 local terms energy: -172.479886 where: bonds (distance) C4'-P energy: -37.827 bonds (distance) P-C4' energy: -38.241 flat angles C4'-P-C4' energy: -46.108 flat angles P-C4'-P energy: -16.011 tors. eta vs tors. theta energy: -34.294 Dist. restrs. and SS energy: 0.156 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -439.955698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.955698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.914422 (E_RNA) where: Base-Base interactions energy: -272.218 where: short stacking energy: -130.775 Base-Backbone interact. energy: 0.468 local terms energy: -170.164481 where: bonds (distance) C4'-P energy: -35.793 bonds (distance) P-C4' energy: -33.195 flat angles C4'-P-C4' energy: -38.193 flat angles P-C4'-P energy: -26.229 tors. eta vs tors. theta energy: -36.754 Dist. restrs. and SS energy: 1.959 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -404.574633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.574633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.533451 (E_RNA) where: Base-Base interactions energy: -272.281 where: short stacking energy: -128.815 Base-Backbone interact. energy: -1.460 local terms energy: -132.792135 where: bonds (distance) C4'-P energy: -20.342 bonds (distance) P-C4' energy: -26.539 flat angles C4'-P-C4' energy: -35.867 flat angles P-C4'-P energy: -27.026 tors. eta vs tors. theta energy: -23.018 Dist. restrs. and SS energy: 1.959 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -695.513584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.513584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.226951 (E_RNA) where: Base-Base interactions energy: -471.772 where: short stacking energy: -199.978 Base-Backbone interact. energy: -0.082 local terms energy: -225.372479 where: bonds (distance) C4'-P energy: -39.550 bonds (distance) P-C4' energy: -50.824 flat angles C4'-P-C4' energy: -50.625 flat angles P-C4'-P energy: -35.537 tors. eta vs tors. theta energy: -48.836 Dist. restrs. and SS energy: 1.713 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -681.641196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.641196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.426420 (E_RNA) where: Base-Base interactions energy: -464.306 where: short stacking energy: -211.152 Base-Backbone interact. energy: -1.258 local terms energy: -219.862189 where: bonds (distance) C4'-P energy: -40.686 bonds (distance) P-C4' energy: -47.699 flat angles C4'-P-C4' energy: -42.709 flat angles P-C4'-P energy: -35.109 tors. eta vs tors. theta energy: -53.659 Dist. restrs. and SS energy: 3.785 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -651.564698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.564698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.592292 (E_RNA) where: Base-Base interactions energy: -431.589 where: short stacking energy: -190.941 Base-Backbone interact. energy: 1.249 local terms energy: -224.251954 where: bonds (distance) C4'-P energy: -43.230 bonds (distance) P-C4' energy: -47.215 flat angles C4'-P-C4' energy: -46.295 flat angles P-C4'-P energy: -29.933 tors. eta vs tors. theta energy: -57.580 Dist. restrs. and SS energy: 3.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -624.440337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.440337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -625.223419 (E_RNA) where: Base-Base interactions energy: -408.097 where: short stacking energy: -180.374 Base-Backbone interact. energy: -0.452 local terms energy: -216.674304 where: bonds (distance) C4'-P energy: -42.291 bonds (distance) P-C4' energy: -37.294 flat angles C4'-P-C4' energy: -52.952 flat angles P-C4'-P energy: -28.549 tors. eta vs tors. theta energy: -55.589 Dist. restrs. and SS energy: 0.783 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -564.704993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.704993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.139739 (E_RNA) where: Base-Base interactions energy: -360.919 where: short stacking energy: -176.041 Base-Backbone interact. energy: -0.581 local terms energy: -203.639988 where: bonds (distance) C4'-P energy: -41.784 bonds (distance) P-C4' energy: -41.230 flat angles C4'-P-C4' energy: -48.069 flat angles P-C4'-P energy: -27.627 tors. eta vs tors. theta energy: -44.930 Dist. restrs. and SS energy: 0.435 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -557.804151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.804151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.273112 (E_RNA) where: Base-Base interactions energy: -340.040 where: short stacking energy: -165.379 Base-Backbone interact. energy: -0.156 local terms energy: -218.077325 where: bonds (distance) C4'-P energy: -43.085 bonds (distance) P-C4' energy: -44.748 flat angles C4'-P-C4' energy: -45.917 flat angles P-C4'-P energy: -35.521 tors. eta vs tors. theta energy: -48.806 Dist. restrs. and SS energy: 0.469 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -531.019440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.019440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.069551 (E_RNA) where: Base-Base interactions energy: -331.139 where: short stacking energy: -166.782 Base-Backbone interact. energy: -0.918 local terms energy: -199.012415 where: bonds (distance) C4'-P energy: -35.178 bonds (distance) P-C4' energy: -44.757 flat angles C4'-P-C4' energy: -44.860 flat angles P-C4'-P energy: -26.855 tors. eta vs tors. theta energy: -47.362 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -492.132971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.132971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.024137 (E_RNA) where: Base-Base interactions energy: -324.328 where: short stacking energy: -147.501 Base-Backbone interact. energy: -0.912 local terms energy: -167.784108 where: bonds (distance) C4'-P energy: -36.593 bonds (distance) P-C4' energy: -40.927 flat angles C4'-P-C4' energy: -35.030 flat angles P-C4'-P energy: -24.244 tors. eta vs tors. theta energy: -30.989 Dist. restrs. and SS energy: 0.891 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -464.773334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.773334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.587017 (E_RNA) where: Base-Base interactions energy: -294.316 where: short stacking energy: -133.238 Base-Backbone interact. energy: -0.537 local terms energy: -170.734482 where: bonds (distance) C4'-P energy: -40.878 bonds (distance) P-C4' energy: -40.426 flat angles C4'-P-C4' energy: -45.991 flat angles P-C4'-P energy: -26.659 tors. eta vs tors. theta energy: -16.781 Dist. restrs. and SS energy: 0.814 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -386.856607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.856607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.631927 (E_RNA) where: Base-Base interactions energy: -238.731 where: short stacking energy: -94.544 Base-Backbone interact. energy: -0.371 local terms energy: -149.529847 where: bonds (distance) C4'-P energy: -37.856 bonds (distance) P-C4' energy: -37.925 flat angles C4'-P-C4' energy: -37.972 flat angles P-C4'-P energy: -23.184 tors. eta vs tors. theta energy: -12.593 Dist. restrs. and SS energy: 1.775 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -717.224738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.224738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.366257 (E_RNA) where: Base-Base interactions energy: -484.091 where: short stacking energy: -216.147 Base-Backbone interact. energy: -0.876 local terms energy: -234.399339 where: bonds (distance) C4'-P energy: -42.041 bonds (distance) P-C4' energy: -50.769 flat angles C4'-P-C4' energy: -51.242 flat angles P-C4'-P energy: -34.922 tors. eta vs tors. theta energy: -55.426 Dist. restrs. and SS energy: 2.142 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -689.451706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.451706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.048555 (E_RNA) where: Base-Base interactions energy: -458.753 where: short stacking energy: -211.498 Base-Backbone interact. energy: -0.736 local terms energy: -231.559140 where: bonds (distance) C4'-P energy: -44.531 bonds (distance) P-C4' energy: -44.710 flat angles C4'-P-C4' energy: -52.714 flat angles P-C4'-P energy: -30.965 tors. eta vs tors. theta energy: -58.639 Dist. restrs. and SS energy: 1.597 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -647.078955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.078955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.836784 (E_RNA) where: Base-Base interactions energy: -437.337 where: short stacking energy: -200.197 Base-Backbone interact. energy: 2.935 local terms energy: -213.434444 where: bonds (distance) C4'-P energy: -42.324 bonds (distance) P-C4' energy: -44.444 flat angles C4'-P-C4' energy: -44.938 flat angles P-C4'-P energy: -24.192 tors. eta vs tors. theta energy: -57.537 Dist. restrs. and SS energy: 0.758 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -598.665142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.665142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.857801 (E_RNA) where: Base-Base interactions energy: -397.785 where: short stacking energy: -173.945 Base-Backbone interact. energy: -1.842 local terms energy: -205.231634 where: bonds (distance) C4'-P energy: -39.308 bonds (distance) P-C4' energy: -44.806 flat angles C4'-P-C4' energy: -49.053 flat angles P-C4'-P energy: -28.649 tors. eta vs tors. theta energy: -43.416 Dist. restrs. and SS energy: 6.193 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -557.206658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.206658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.504823 (E_RNA) where: Base-Base interactions energy: -356.153 where: short stacking energy: -189.051 Base-Backbone interact. energy: -0.528 local terms energy: -200.824553 where: bonds (distance) C4'-P energy: -37.507 bonds (distance) P-C4' energy: -37.336 flat angles C4'-P-C4' energy: -51.944 flat angles P-C4'-P energy: -32.396 tors. eta vs tors. theta energy: -41.641 Dist. restrs. and SS energy: 0.298 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -547.868229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.868229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.011308 (E_RNA) where: Base-Base interactions energy: -365.511 where: short stacking energy: -169.216 Base-Backbone interact. energy: -0.780 local terms energy: -181.720290 where: bonds (distance) C4'-P energy: -35.276 bonds (distance) P-C4' energy: -45.680 flat angles C4'-P-C4' energy: -39.777 flat angles P-C4'-P energy: -23.245 tors. eta vs tors. theta energy: -37.743 Dist. restrs. and SS energy: 0.143 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -502.671829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.671829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.868070 (E_RNA) where: Base-Base interactions energy: -325.526 where: short stacking energy: -157.655 Base-Backbone interact. energy: -0.560 local terms energy: -177.781370 where: bonds (distance) C4'-P energy: -40.294 bonds (distance) P-C4' energy: -42.142 flat angles C4'-P-C4' energy: -39.592 flat angles P-C4'-P energy: -22.805 tors. eta vs tors. theta energy: -32.949 Dist. restrs. and SS energy: 1.196 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -513.333905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.333905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.572500 (E_RNA) where: Base-Base interactions energy: -336.692 where: short stacking energy: -161.344 Base-Backbone interact. energy: 0.817 local terms energy: -177.697533 where: bonds (distance) C4'-P energy: -34.389 bonds (distance) P-C4' energy: -42.496 flat angles C4'-P-C4' energy: -38.682 flat angles P-C4'-P energy: -26.917 tors. eta vs tors. theta energy: -35.213 Dist. restrs. and SS energy: 0.239 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -488.564830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.564830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.253852 (E_RNA) where: Base-Base interactions energy: -314.510 where: short stacking energy: -145.666 Base-Backbone interact. energy: 0.591 local terms energy: -175.334379 where: bonds (distance) C4'-P energy: -36.836 bonds (distance) P-C4' energy: -45.940 flat angles C4'-P-C4' energy: -50.124 flat angles P-C4'-P energy: -14.163 tors. eta vs tors. theta energy: -28.271 Dist. restrs. and SS energy: 0.689 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -400.658937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.658937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.834939 (E_RNA) where: Base-Base interactions energy: -239.351 where: short stacking energy: -104.123 Base-Backbone interact. energy: -0.858 local terms energy: -164.625685 where: bonds (distance) C4'-P energy: -46.460 bonds (distance) P-C4' energy: -38.274 flat angles C4'-P-C4' energy: -37.971 flat angles P-C4'-P energy: -23.130 tors. eta vs tors. theta energy: -18.791 Dist. restrs. and SS energy: 4.176 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -718.768498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.768498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.920274 (E_RNA) where: Base-Base interactions energy: -481.421 where: short stacking energy: -214.494 Base-Backbone interact. energy: -1.732 local terms energy: -237.767735 where: bonds (distance) C4'-P energy: -44.972 bonds (distance) P-C4' energy: -46.964 flat angles C4'-P-C4' energy: -51.348 flat angles P-C4'-P energy: -35.625 tors. eta vs tors. theta energy: -58.860 Dist. restrs. and SS energy: 2.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -675.671867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.671867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.392907 (E_RNA) where: Base-Base interactions energy: -457.105 where: short stacking energy: -210.833 Base-Backbone interact. energy: -0.686 local terms energy: -218.600998 where: bonds (distance) C4'-P energy: -44.112 bonds (distance) P-C4' energy: -48.409 flat angles C4'-P-C4' energy: -42.125 flat angles P-C4'-P energy: -31.094 tors. eta vs tors. theta energy: -52.862 Dist. restrs. and SS energy: 0.721 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -658.472882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.472882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.052475 (E_RNA) where: Base-Base interactions energy: -441.215 where: short stacking energy: -192.252 Base-Backbone interact. energy: -1.652 local terms energy: -219.186039 where: bonds (distance) C4'-P energy: -38.273 bonds (distance) P-C4' energy: -42.158 flat angles C4'-P-C4' energy: -51.204 flat angles P-C4'-P energy: -34.611 tors. eta vs tors. theta energy: -52.941 Dist. restrs. and SS energy: 3.580 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -622.033244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.033244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.521339 (E_RNA) where: Base-Base interactions energy: -411.284 where: short stacking energy: -184.816 Base-Backbone interact. energy: -1.344 local terms energy: -215.893497 where: bonds (distance) C4'-P energy: -39.459 bonds (distance) P-C4' energy: -44.974 flat angles C4'-P-C4' energy: -44.268 flat angles P-C4'-P energy: -33.225 tors. eta vs tors. theta energy: -53.967 Dist. restrs. and SS energy: 6.488 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -555.150739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.150739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.234229 (E_RNA) where: Base-Base interactions energy: -344.574 where: short stacking energy: -178.093 Base-Backbone interact. energy: -0.189 local terms energy: -211.471271 where: bonds (distance) C4'-P energy: -44.822 bonds (distance) P-C4' energy: -44.934 flat angles C4'-P-C4' energy: -51.630 flat angles P-C4'-P energy: -28.161 tors. eta vs tors. theta energy: -41.924 Dist. restrs. and SS energy: 1.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -523.370221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.370221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.581607 (E_RNA) where: Base-Base interactions energy: -335.372 where: short stacking energy: -147.818 Base-Backbone interact. energy: -0.479 local terms energy: -187.730937 where: bonds (distance) C4'-P energy: -38.399 bonds (distance) P-C4' energy: -36.672 flat angles C4'-P-C4' energy: -40.060 flat angles P-C4'-P energy: -28.960 tors. eta vs tors. theta energy: -43.639 Dist. restrs. and SS energy: 0.211 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -520.378349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.378349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.820872 (E_RNA) where: Base-Base interactions energy: -331.170 where: short stacking energy: -160.222 Base-Backbone interact. energy: 0.043 local terms energy: -189.693409 where: bonds (distance) C4'-P energy: -43.633 bonds (distance) P-C4' energy: -41.061 flat angles C4'-P-C4' energy: -44.397 flat angles P-C4'-P energy: -27.699 tors. eta vs tors. theta energy: -32.903 Dist. restrs. and SS energy: 0.443 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -503.874553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.874553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.789972 (E_RNA) where: Base-Base interactions energy: -331.700 where: short stacking energy: -166.741 Base-Backbone interact. energy: 0.727 local terms energy: -173.816625 where: bonds (distance) C4'-P energy: -32.647 bonds (distance) P-C4' energy: -35.603 flat angles C4'-P-C4' energy: -43.372 flat angles P-C4'-P energy: -27.308 tors. eta vs tors. theta energy: -34.888 Dist. restrs. and SS energy: 0.915 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -485.675122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.675122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.485713 (E_RNA) where: Base-Base interactions energy: -307.453 where: short stacking energy: -141.182 Base-Backbone interact. energy: -0.295 local terms energy: -178.737167 where: bonds (distance) C4'-P energy: -40.428 bonds (distance) P-C4' energy: -43.538 flat angles C4'-P-C4' energy: -37.216 flat angles P-C4'-P energy: -34.676 tors. eta vs tors. theta energy: -22.880 Dist. restrs. and SS energy: 0.811 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -382.730799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.730799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.978314 (E_RNA) where: Base-Base interactions energy: -250.861 where: short stacking energy: -100.057 Base-Backbone interact. energy: 1.274 local terms energy: -136.391735 where: bonds (distance) C4'-P energy: -41.365 bonds (distance) P-C4' energy: -20.546 flat angles C4'-P-C4' energy: -37.855 flat angles P-C4'-P energy: -23.322 tors. eta vs tors. theta energy: -13.305 Dist. restrs. and SS energy: 3.248 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -694.599293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.599293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.198967 (E_RNA) where: Base-Base interactions energy: -456.401 where: short stacking energy: -218.367 Base-Backbone interact. energy: -0.832 local terms energy: -237.965458 where: bonds (distance) C4'-P energy: -49.536 bonds (distance) P-C4' energy: -51.659 flat angles C4'-P-C4' energy: -46.115 flat angles P-C4'-P energy: -35.457 tors. eta vs tors. theta energy: -55.198 Dist. restrs. and SS energy: 0.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -710.740596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -710.740596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.533807 (E_RNA) where: Base-Base interactions energy: -480.171 where: short stacking energy: -207.839 Base-Backbone interact. energy: -1.044 local terms energy: -231.319488 where: bonds (distance) C4'-P energy: -46.887 bonds (distance) P-C4' energy: -40.126 flat angles C4'-P-C4' energy: -53.608 flat angles P-C4'-P energy: -37.697 tors. eta vs tors. theta energy: -53.001 Dist. restrs. and SS energy: 1.793 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -670.052374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -670.052374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.880326 (E_RNA) where: Base-Base interactions energy: -444.952 where: short stacking energy: -198.036 Base-Backbone interact. energy: -1.462 local terms energy: -231.466273 where: bonds (distance) C4'-P energy: -49.963 bonds (distance) P-C4' energy: -47.523 flat angles C4'-P-C4' energy: -46.736 flat angles P-C4'-P energy: -30.263 tors. eta vs tors. theta energy: -56.981 Dist. restrs. and SS energy: 7.828 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -638.112629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.112629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.193894 (E_RNA) where: Base-Base interactions energy: -411.959 where: short stacking energy: -185.439 Base-Backbone interact. energy: -1.447 local terms energy: -226.787687 where: bonds (distance) C4'-P energy: -43.679 bonds (distance) P-C4' energy: -40.722 flat angles C4'-P-C4' energy: -48.913 flat angles P-C4'-P energy: -40.366 tors. eta vs tors. theta energy: -53.107 Dist. restrs. and SS energy: 2.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -563.841026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.841026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.162924 (E_RNA) where: Base-Base interactions energy: -349.148 where: short stacking energy: -170.913 Base-Backbone interact. energy: -1.292 local terms energy: -213.723283 where: bonds (distance) C4'-P energy: -39.392 bonds (distance) P-C4' energy: -44.260 flat angles C4'-P-C4' energy: -44.525 flat angles P-C4'-P energy: -36.268 tors. eta vs tors. theta energy: -49.279 Dist. restrs. and SS energy: 0.322 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -560.289338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.289338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.690723 (E_RNA) where: Base-Base interactions energy: -354.698 where: short stacking energy: -164.323 Base-Backbone interact. energy: -0.448 local terms energy: -205.544273 where: bonds (distance) C4'-P energy: -41.403 bonds (distance) P-C4' energy: -44.671 flat angles C4'-P-C4' energy: -43.779 flat angles P-C4'-P energy: -37.074 tors. eta vs tors. theta energy: -38.616 Dist. restrs. and SS energy: 0.401 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -527.511217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.511217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.775914 (E_RNA) where: Base-Base interactions energy: -327.440 where: short stacking energy: -151.170 Base-Backbone interact. energy: -0.039 local terms energy: -200.296852 where: bonds (distance) C4'-P energy: -36.652 bonds (distance) P-C4' energy: -42.905 flat angles C4'-P-C4' energy: -45.259 flat angles P-C4'-P energy: -33.036 tors. eta vs tors. theta energy: -42.445 Dist. restrs. and SS energy: 0.265 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -518.768988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.768988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.979125 (E_RNA) where: Base-Base interactions energy: -337.685 where: short stacking energy: -161.337 Base-Backbone interact. energy: 0.540 local terms energy: -182.834323 where: bonds (distance) C4'-P energy: -27.237 bonds (distance) P-C4' energy: -42.830 flat angles C4'-P-C4' energy: -48.451 flat angles P-C4'-P energy: -30.652 tors. eta vs tors. theta energy: -33.664 Dist. restrs. and SS energy: 1.210 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -504.251531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.251531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.004405 (E_RNA) where: Base-Base interactions energy: -327.300 where: short stacking energy: -147.819 Base-Backbone interact. energy: 0.352 local terms energy: -178.056722 where: bonds (distance) C4'-P energy: -36.039 bonds (distance) P-C4' energy: -43.105 flat angles C4'-P-C4' energy: -39.117 flat angles P-C4'-P energy: -30.304 tors. eta vs tors. theta energy: -29.492 Dist. restrs. and SS energy: 0.753 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -444.221574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.221574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.487178 (E_RNA) where: Base-Base interactions energy: -295.887 where: short stacking energy: -126.878 Base-Backbone interact. energy: -0.726 local terms energy: -147.873700 where: bonds (distance) C4'-P energy: -35.136 bonds (distance) P-C4' energy: -36.319 flat angles C4'-P-C4' energy: -28.346 flat angles P-C4'-P energy: -27.061 tors. eta vs tors. theta energy: -21.011 Dist. restrs. and SS energy: 0.266 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -696.374373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.374373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.602505 (E_RNA) where: Base-Base interactions energy: -466.920 where: short stacking energy: -220.514 Base-Backbone interact. energy: 1.859 local terms energy: -231.541314 where: bonds (distance) C4'-P energy: -46.817 bonds (distance) P-C4' energy: -46.876 flat angles C4'-P-C4' energy: -49.977 flat angles P-C4'-P energy: -33.548 tors. eta vs tors. theta energy: -54.323 Dist. restrs. and SS energy: 0.228 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -700.139844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.139844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.503690 (E_RNA) where: Base-Base interactions energy: -475.291 where: short stacking energy: -211.677 Base-Backbone interact. energy: -0.322 local terms energy: -225.891409 where: bonds (distance) C4'-P energy: -44.710 bonds (distance) P-C4' energy: -46.380 flat angles C4'-P-C4' energy: -43.033 flat angles P-C4'-P energy: -35.978 tors. eta vs tors. theta energy: -55.791 Dist. restrs. and SS energy: 1.364 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -683.593686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.593686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.987207 (E_RNA) where: Base-Base interactions energy: -473.863 where: short stacking energy: -201.138 Base-Backbone interact. energy: -1.947 local terms energy: -216.177114 where: bonds (distance) C4'-P energy: -34.378 bonds (distance) P-C4' energy: -42.859 flat angles C4'-P-C4' energy: -50.605 flat angles P-C4'-P energy: -36.653 tors. eta vs tors. theta energy: -51.682 Dist. restrs. and SS energy: 8.394 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -643.928412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.928412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.761037 (E_RNA) where: Base-Base interactions energy: -419.432 where: short stacking energy: -195.248 Base-Backbone interact. energy: -1.676 local terms energy: -225.652486 where: bonds (distance) C4'-P energy: -45.662 bonds (distance) P-C4' energy: -41.643 flat angles C4'-P-C4' energy: -51.571 flat angles P-C4'-P energy: -28.912 tors. eta vs tors. theta energy: -57.864 Dist. restrs. and SS energy: 2.833 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -569.612519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.612519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.119505 (E_RNA) where: Base-Base interactions energy: -363.919 where: short stacking energy: -167.012 Base-Backbone interact. energy: -1.973 local terms energy: -204.227460 where: bonds (distance) C4'-P energy: -45.731 bonds (distance) P-C4' energy: -34.803 flat angles C4'-P-C4' energy: -43.388 flat angles P-C4'-P energy: -32.416 tors. eta vs tors. theta energy: -47.889 Dist. restrs. and SS energy: 0.507 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -541.481922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.481922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.727596 (E_RNA) where: Base-Base interactions energy: -340.772 where: short stacking energy: -163.895 Base-Backbone interact. energy: 2.468 local terms energy: -203.423387 where: bonds (distance) C4'-P energy: -41.618 bonds (distance) P-C4' energy: -45.250 flat angles C4'-P-C4' energy: -50.584 flat angles P-C4'-P energy: -22.580 tors. eta vs tors. theta energy: -43.392 Dist. restrs. and SS energy: 0.246 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -529.596337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.596337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.179100 (E_RNA) where: Base-Base interactions energy: -354.913 where: short stacking energy: -159.320 Base-Backbone interact. energy: -0.700 local terms energy: -174.565947 where: bonds (distance) C4'-P energy: -17.267 bonds (distance) P-C4' energy: -41.427 flat angles C4'-P-C4' energy: -44.064 flat angles P-C4'-P energy: -21.746 tors. eta vs tors. theta energy: -50.062 Dist. restrs. and SS energy: 0.583 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -527.609065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.609065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.988906 (E_RNA) where: Base-Base interactions energy: -329.537 where: short stacking energy: -165.196 Base-Backbone interact. energy: -0.355 local terms energy: -199.097315 where: bonds (distance) C4'-P energy: -38.787 bonds (distance) P-C4' energy: -44.420 flat angles C4'-P-C4' energy: -45.328 flat angles P-C4'-P energy: -28.542 tors. eta vs tors. theta energy: -42.020 Dist. restrs. and SS energy: 1.380 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -498.955982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.955982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.346658 (E_RNA) where: Base-Base interactions energy: -323.434 where: short stacking energy: -146.352 Base-Backbone interact. energy: -1.779 local terms energy: -174.132981 where: bonds (distance) C4'-P energy: -34.601 bonds (distance) P-C4' energy: -43.254 flat angles C4'-P-C4' energy: -37.029 flat angles P-C4'-P energy: -23.373 tors. eta vs tors. theta energy: -35.875 Dist. restrs. and SS energy: 0.391 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -449.497781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.497781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.215510 (E_RNA) where: Base-Base interactions energy: -295.662 where: short stacking energy: -129.028 Base-Backbone interact. energy: -0.495 local terms energy: -154.058350 where: bonds (distance) C4'-P energy: -33.370 bonds (distance) P-C4' energy: -34.307 flat angles C4'-P-C4' energy: -33.688 flat angles P-C4'-P energy: -29.089 tors. eta vs tors. theta energy: -23.605 Dist. restrs. and SS energy: 0.718 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -711.822934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.822934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.032004 (E_RNA) where: Base-Base interactions energy: -480.767 where: short stacking energy: -203.057 Base-Backbone interact. energy: -0.400 local terms energy: -232.864270 where: bonds (distance) C4'-P energy: -42.228 bonds (distance) P-C4' energy: -54.065 flat angles C4'-P-C4' energy: -47.379 flat angles P-C4'-P energy: -34.685 tors. eta vs tors. theta energy: -54.507 Dist. restrs. and SS energy: 2.209 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -685.572168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.572168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.065692 (E_RNA) where: Base-Base interactions energy: -453.086 where: short stacking energy: -196.833 Base-Backbone interact. energy: -0.867 local terms energy: -232.113282 where: bonds (distance) C4'-P energy: -51.526 bonds (distance) P-C4' energy: -46.959 flat angles C4'-P-C4' energy: -41.907 flat angles P-C4'-P energy: -36.365 tors. eta vs tors. theta energy: -55.356 Dist. restrs. and SS energy: 0.494 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -683.815707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.815707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.524843 (E_RNA) where: Base-Base interactions energy: -475.439 where: short stacking energy: -218.999 Base-Backbone interact. energy: -0.988 local terms energy: -213.098035 where: bonds (distance) C4'-P energy: -38.879 bonds (distance) P-C4' energy: -41.868 flat angles C4'-P-C4' energy: -48.144 flat angles P-C4'-P energy: -27.067 tors. eta vs tors. theta energy: -57.140 Dist. restrs. and SS energy: 5.709 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -616.468785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -616.468785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.388108 (E_RNA) where: Base-Base interactions energy: -417.935 where: short stacking energy: -191.759 Base-Backbone interact. energy: -1.209 local terms energy: -200.244055 where: bonds (distance) C4'-P energy: -40.454 bonds (distance) P-C4' energy: -43.843 flat angles C4'-P-C4' energy: -44.690 flat angles P-C4'-P energy: -25.520 tors. eta vs tors. theta energy: -45.738 Dist. restrs. and SS energy: 2.919 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -576.769200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.769200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.024013 (E_RNA) where: Base-Base interactions energy: -374.946 where: short stacking energy: -175.297 Base-Backbone interact. energy: -1.210 local terms energy: -200.867878 where: bonds (distance) C4'-P energy: -45.272 bonds (distance) P-C4' energy: -40.732 flat angles C4'-P-C4' energy: -42.889 flat angles P-C4'-P energy: -25.810 tors. eta vs tors. theta energy: -46.165 Dist. restrs. and SS energy: 0.255 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -595.084879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.084879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.473272 (E_RNA) where: Base-Base interactions energy: -395.310 where: short stacking energy: -186.509 Base-Backbone interact. energy: -0.318 local terms energy: -199.845421 where: bonds (distance) C4'-P energy: -29.449 bonds (distance) P-C4' energy: -36.373 flat angles C4'-P-C4' energy: -51.087 flat angles P-C4'-P energy: -29.970 tors. eta vs tors. theta energy: -52.967 Dist. restrs. and SS energy: 0.388 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -548.088955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.088955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.869017 (E_RNA) where: Base-Base interactions energy: -363.487 where: short stacking energy: -177.156 Base-Backbone interact. energy: 0.115 local terms energy: -185.496646 where: bonds (distance) C4'-P energy: -34.749 bonds (distance) P-C4' energy: -28.404 flat angles C4'-P-C4' energy: -52.031 flat angles P-C4'-P energy: -22.296 tors. eta vs tors. theta energy: -48.017 Dist. restrs. and SS energy: 0.780 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -500.698303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.698303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.668046 (E_RNA) where: Base-Base interactions energy: -340.653 where: short stacking energy: -159.241 Base-Backbone interact. energy: 0.359 local terms energy: -162.373756 where: bonds (distance) C4'-P energy: -34.060 bonds (distance) P-C4' energy: -40.315 flat angles C4'-P-C4' energy: -34.071 flat angles P-C4'-P energy: -21.335 tors. eta vs tors. theta energy: -32.592 Dist. restrs. and SS energy: 1.970 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -508.510178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.510178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.087673 (E_RNA) where: Base-Base interactions energy: -336.404 where: short stacking energy: -154.220 Base-Backbone interact. energy: 0.673 local terms energy: -173.356038 where: bonds (distance) C4'-P energy: -23.425 bonds (distance) P-C4' energy: -37.970 flat angles C4'-P-C4' energy: -47.185 flat angles P-C4'-P energy: -29.154 tors. eta vs tors. theta energy: -35.622 Dist. restrs. and SS energy: 0.577 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -477.605480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.605480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.064789 (E_RNA) where: Base-Base interactions energy: -299.944 where: short stacking energy: -143.696 Base-Backbone interact. energy: -0.462 local terms energy: -177.658228 where: bonds (distance) C4'-P energy: -36.328 bonds (distance) P-C4' energy: -40.819 flat angles C4'-P-C4' energy: -51.145 flat angles P-C4'-P energy: -26.335 tors. eta vs tors. theta energy: -23.031 Dist. restrs. and SS energy: 0.459 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -712.637053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.637053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.322742 (E_RNA) where: Base-Base interactions energy: -483.274 where: short stacking energy: -218.447 Base-Backbone interact. energy: -0.655 local terms energy: -230.393943 where: bonds (distance) C4'-P energy: -46.566 bonds (distance) P-C4' energy: -37.963 flat angles C4'-P-C4' energy: -46.190 flat angles P-C4'-P energy: -38.777 tors. eta vs tors. theta energy: -60.897 Dist. restrs. and SS energy: 1.686 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -690.375176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.375176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.873786 (E_RNA) where: Base-Base interactions energy: -464.332 where: short stacking energy: -211.890 Base-Backbone interact. energy: -0.785 local terms energy: -229.756029 where: bonds (distance) C4'-P energy: -49.038 bonds (distance) P-C4' energy: -38.926 flat angles C4'-P-C4' energy: -52.430 flat angles P-C4'-P energy: -27.377 tors. eta vs tors. theta energy: -61.984 Dist. restrs. and SS energy: 4.499 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -673.723881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.723881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.377034 (E_RNA) where: Base-Base interactions energy: -447.718 where: short stacking energy: -196.372 Base-Backbone interact. energy: -2.124 local terms energy: -224.534871 where: bonds (distance) C4'-P energy: -45.413 bonds (distance) P-C4' energy: -47.993 flat angles C4'-P-C4' energy: -44.674 flat angles P-C4'-P energy: -36.815 tors. eta vs tors. theta energy: -49.640 Dist. restrs. and SS energy: 0.653 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -632.712261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -632.712261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.218991 (E_RNA) where: Base-Base interactions energy: -421.595 where: short stacking energy: -196.156 Base-Backbone interact. energy: -0.428 local terms energy: -213.196199 where: bonds (distance) C4'-P energy: -44.923 bonds (distance) P-C4' energy: -37.527 flat angles C4'-P-C4' energy: -42.519 flat angles P-C4'-P energy: -37.003 tors. eta vs tors. theta energy: -51.223 Dist. restrs. and SS energy: 2.507 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -583.034836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.034836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.182878 (E_RNA) where: Base-Base interactions energy: -386.771 where: short stacking energy: -192.687 Base-Backbone interact. energy: 2.339 local terms energy: -198.750782 where: bonds (distance) C4'-P energy: -37.755 bonds (distance) P-C4' energy: -37.445 flat angles C4'-P-C4' energy: -39.245 flat angles P-C4'-P energy: -34.644 tors. eta vs tors. theta energy: -49.661 Dist. restrs. and SS energy: 0.148 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -581.262579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -581.262579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.506542 (E_RNA) where: Base-Base interactions energy: -381.259 where: short stacking energy: -165.914 Base-Backbone interact. energy: 2.038 local terms energy: -202.285633 where: bonds (distance) C4'-P energy: -44.134 bonds (distance) P-C4' energy: -40.376 flat angles C4'-P-C4' energy: -46.624 flat angles P-C4'-P energy: -24.512 tors. eta vs tors. theta energy: -46.640 Dist. restrs. and SS energy: 0.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -554.273745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.273745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.408297 (E_RNA) where: Base-Base interactions energy: -348.075 where: short stacking energy: -165.288 Base-Backbone interact. energy: 3.035 local terms energy: -209.368881 where: bonds (distance) C4'-P energy: -43.294 bonds (distance) P-C4' energy: -44.208 flat angles C4'-P-C4' energy: -45.769 flat angles P-C4'-P energy: -32.361 tors. eta vs tors. theta energy: -43.737 Dist. restrs. and SS energy: 0.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -489.372835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.372835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.942039 (E_RNA) where: Base-Base interactions energy: -334.343 where: short stacking energy: -144.866 Base-Backbone interact. energy: -2.065 local terms energy: -153.533574 where: bonds (distance) C4'-P energy: -33.627 bonds (distance) P-C4' energy: -28.131 flat angles C4'-P-C4' energy: -38.085 flat angles P-C4'-P energy: -22.843 tors. eta vs tors. theta energy: -30.847 Dist. restrs. and SS energy: 0.569 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -480.265596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.265596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.143303 (E_RNA) where: Base-Base interactions energy: -312.666 where: short stacking energy: -135.719 Base-Backbone interact. energy: 0.396 local terms energy: -168.873266 where: bonds (distance) C4'-P energy: -29.777 bonds (distance) P-C4' energy: -43.228 flat angles C4'-P-C4' energy: -42.140 flat angles P-C4'-P energy: -22.806 tors. eta vs tors. theta energy: -30.923 Dist. restrs. and SS energy: 0.878 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -452.993404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.993404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.384237 (E_RNA) where: Base-Base interactions energy: -307.816 where: short stacking energy: -129.770 Base-Backbone interact. energy: -0.532 local terms energy: -145.036177 where: bonds (distance) C4'-P energy: -31.209 bonds (distance) P-C4' energy: -33.567 flat angles C4'-P-C4' energy: -35.968 flat angles P-C4'-P energy: -18.357 tors. eta vs tors. theta energy: -25.936 Dist. restrs. and SS energy: 0.391 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -705.099217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.099217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.276659 (E_RNA) where: Base-Base interactions energy: -480.326 where: short stacking energy: -213.193 Base-Backbone interact. energy: -1.021 local terms energy: -224.929612 where: bonds (distance) C4'-P energy: -36.569 bonds (distance) P-C4' energy: -52.198 flat angles C4'-P-C4' energy: -51.281 flat angles P-C4'-P energy: -35.597 tors. eta vs tors. theta energy: -49.284 Dist. restrs. and SS energy: 1.177 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -698.463221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.463221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.985817 (E_RNA) where: Base-Base interactions energy: -469.218 where: short stacking energy: -218.392 Base-Backbone interact. energy: 1.101 local terms energy: -233.869230 where: bonds (distance) C4'-P energy: -47.603 bonds (distance) P-C4' energy: -36.556 flat angles C4'-P-C4' energy: -52.390 flat angles P-C4'-P energy: -35.259 tors. eta vs tors. theta energy: -62.061 Dist. restrs. and SS energy: 3.523 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -675.175621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.175621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.372583 (E_RNA) where: Base-Base interactions energy: -439.081 where: short stacking energy: -199.116 Base-Backbone interact. energy: -0.632 local terms energy: -235.659386 where: bonds (distance) C4'-P energy: -49.721 bonds (distance) P-C4' energy: -44.420 flat angles C4'-P-C4' energy: -52.634 flat angles P-C4'-P energy: -36.700 tors. eta vs tors. theta energy: -52.185 Dist. restrs. and SS energy: 0.197 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -642.168333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.168333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.319776 (E_RNA) where: Base-Base interactions energy: -427.626 where: short stacking energy: -185.054 Base-Backbone interact. energy: -1.779 local terms energy: -215.914344 where: bonds (distance) C4'-P energy: -42.451 bonds (distance) P-C4' energy: -44.383 flat angles C4'-P-C4' energy: -45.310 flat angles P-C4'-P energy: -35.325 tors. eta vs tors. theta energy: -48.445 Dist. restrs. and SS energy: 3.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -622.177324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.177324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.348029 (E_RNA) where: Base-Base interactions energy: -427.165 where: short stacking energy: -189.050 Base-Backbone interact. energy: -2.500 local terms energy: -192.682990 where: bonds (distance) C4'-P energy: -42.100 bonds (distance) P-C4' energy: -35.833 flat angles C4'-P-C4' energy: -41.124 flat angles P-C4'-P energy: -23.498 tors. eta vs tors. theta energy: -50.128 Dist. restrs. and SS energy: 0.171 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -598.548341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.548341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.748275 (E_RNA) where: Base-Base interactions energy: -388.959 where: short stacking energy: -180.130 Base-Backbone interact. energy: -0.295 local terms energy: -209.494853 where: bonds (distance) C4'-P energy: -49.670 bonds (distance) P-C4' energy: -40.007 flat angles C4'-P-C4' energy: -46.229 flat angles P-C4'-P energy: -27.732 tors. eta vs tors. theta energy: -45.858 Dist. restrs. and SS energy: 0.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -542.985545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.985545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.248686 (E_RNA) where: Base-Base interactions energy: -340.821 where: short stacking energy: -164.605 Base-Backbone interact. energy: -1.288 local terms energy: -201.139083 where: bonds (distance) C4'-P energy: -39.560 bonds (distance) P-C4' energy: -34.361 flat angles C4'-P-C4' energy: -42.858 flat angles P-C4'-P energy: -41.319 tors. eta vs tors. theta energy: -43.041 Dist. restrs. and SS energy: 0.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -489.030873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.030873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.247888 (E_RNA) where: Base-Base interactions energy: -305.517 where: short stacking energy: -152.370 Base-Backbone interact. energy: -0.414 local terms energy: -184.317024 where: bonds (distance) C4'-P energy: -41.771 bonds (distance) P-C4' energy: -45.309 flat angles C4'-P-C4' energy: -43.099 flat angles P-C4'-P energy: -23.482 tors. eta vs tors. theta energy: -30.657 Dist. restrs. and SS energy: 1.217 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -521.254200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.254200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.871697 (E_RNA) where: Base-Base interactions energy: -355.755 where: short stacking energy: -167.368 Base-Backbone interact. energy: -0.864 local terms energy: -165.252749 where: bonds (distance) C4'-P energy: -40.146 bonds (distance) P-C4' energy: -32.781 flat angles C4'-P-C4' energy: -35.102 flat angles P-C4'-P energy: -21.643 tors. eta vs tors. theta energy: -35.581 Dist. restrs. and SS energy: 0.617 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -468.883710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.883710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.794495 (E_RNA) where: Base-Base interactions energy: -315.992 where: short stacking energy: -138.304 Base-Backbone interact. energy: 0.288 local terms energy: -154.090998 where: bonds (distance) C4'-P energy: -31.107 bonds (distance) P-C4' energy: -25.911 flat angles C4'-P-C4' energy: -34.552 flat angles P-C4'-P energy: -24.492 tors. eta vs tors. theta energy: -38.029 Dist. restrs. and SS energy: 0.911 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -714.502121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.502121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.473426 (E_RNA) where: Base-Base interactions energy: -483.890 where: short stacking energy: -229.778 Base-Backbone interact. energy: -1.282 local terms energy: -230.300805 where: bonds (distance) C4'-P energy: -47.811 bonds (distance) P-C4' energy: -44.873 flat angles C4'-P-C4' energy: -45.223 flat angles P-C4'-P energy: -33.648 tors. eta vs tors. theta energy: -58.746 Dist. restrs. and SS energy: 0.971 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -707.147018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.147018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.911984 (E_RNA) where: Base-Base interactions energy: -477.882 where: short stacking energy: -217.718 Base-Backbone interact. energy: -0.929 local terms energy: -232.101322 where: bonds (distance) C4'-P energy: -39.791 bonds (distance) P-C4' energy: -47.460 flat angles C4'-P-C4' energy: -49.379 flat angles P-C4'-P energy: -32.278 tors. eta vs tors. theta energy: -63.192 Dist. restrs. and SS energy: 3.765 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -663.955742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.955742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.122284 (E_RNA) where: Base-Base interactions energy: -452.821 where: short stacking energy: -190.974 Base-Backbone interact. energy: -1.050 local terms energy: -210.250718 where: bonds (distance) C4'-P energy: -39.748 bonds (distance) P-C4' energy: -50.059 flat angles C4'-P-C4' energy: -51.536 flat angles P-C4'-P energy: -26.549 tors. eta vs tors. theta energy: -42.359 Dist. restrs. and SS energy: 0.167 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -633.052426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.052426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.667525 (E_RNA) where: Base-Base interactions energy: -410.389 where: short stacking energy: -202.188 Base-Backbone interact. energy: -0.944 local terms energy: -224.333613 where: bonds (distance) C4'-P energy: -47.004 bonds (distance) P-C4' energy: -39.625 flat angles C4'-P-C4' energy: -50.893 flat angles P-C4'-P energy: -26.778 tors. eta vs tors. theta energy: -60.034 Dist. restrs. and SS energy: 2.615 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -622.388443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.388443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.924676 (E_RNA) where: Base-Base interactions energy: -427.271 where: short stacking energy: -187.700 Base-Backbone interact. energy: -1.097 local terms energy: -194.555933 where: bonds (distance) C4'-P energy: -28.124 bonds (distance) P-C4' energy: -45.006 flat angles C4'-P-C4' energy: -46.741 flat angles P-C4'-P energy: -22.851 tors. eta vs tors. theta energy: -51.833 Dist. restrs. and SS energy: 0.536 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -566.439933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.439933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.134881 (E_RNA) where: Base-Base interactions energy: -361.135 where: short stacking energy: -177.425 Base-Backbone interact. energy: -0.960 local terms energy: -205.039844 where: bonds (distance) C4'-P energy: -42.324 bonds (distance) P-C4' energy: -40.420 flat angles C4'-P-C4' energy: -52.083 flat angles P-C4'-P energy: -25.506 tors. eta vs tors. theta energy: -44.706 Dist. restrs. and SS energy: 0.695 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -557.717473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.717473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.231638 (E_RNA) where: Base-Base interactions energy: -367.159 where: short stacking energy: -170.148 Base-Backbone interact. energy: -0.173 local terms energy: -190.899196 where: bonds (distance) C4'-P energy: -37.914 bonds (distance) P-C4' energy: -41.884 flat angles C4'-P-C4' energy: -39.066 flat angles P-C4'-P energy: -26.518 tors. eta vs tors. theta energy: -45.517 Dist. restrs. and SS energy: 0.514 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -519.064051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.064051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.373688 (E_RNA) where: Base-Base interactions energy: -328.701 where: short stacking energy: -156.806 Base-Backbone interact. energy: -0.482 local terms energy: -191.190154 where: bonds (distance) C4'-P energy: -41.726 bonds (distance) P-C4' energy: -35.994 flat angles C4'-P-C4' energy: -45.744 flat angles P-C4'-P energy: -19.695 tors. eta vs tors. theta energy: -48.030 Dist. restrs. and SS energy: 1.310 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -477.695510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.695510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.085881 (E_RNA) where: Base-Base interactions energy: -306.052 where: short stacking energy: -148.076 Base-Backbone interact. energy: 0.793 local terms energy: -172.826855 where: bonds (distance) C4'-P energy: -38.293 bonds (distance) P-C4' energy: -38.142 flat angles C4'-P-C4' energy: -30.322 flat angles P-C4'-P energy: -25.024 tors. eta vs tors. theta energy: -41.047 Dist. restrs. and SS energy: 0.390 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -469.398208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.398208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.679760 (E_RNA) where: Base-Base interactions energy: -314.595 where: short stacking energy: -146.360 Base-Backbone interact. energy: 2.420 local terms energy: -157.504268 where: bonds (distance) C4'-P energy: -32.060 bonds (distance) P-C4' energy: -35.061 flat angles C4'-P-C4' energy: -35.919 flat angles P-C4'-P energy: -19.290 tors. eta vs tors. theta energy: -35.175 Dist. restrs. and SS energy: 0.282 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -706.906931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.906931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.683903 (E_RNA) where: Base-Base interactions energy: -468.075 where: short stacking energy: -224.096 Base-Backbone interact. energy: 1.008 local terms energy: -242.617688 where: bonds (distance) C4'-P energy: -43.960 bonds (distance) P-C4' energy: -48.451 flat angles C4'-P-C4' energy: -54.407 flat angles P-C4'-P energy: -35.071 tors. eta vs tors. theta energy: -60.729 Dist. restrs. and SS energy: 2.777 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -693.122433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.122433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.713113 (E_RNA) where: Base-Base interactions energy: -470.040 where: short stacking energy: -199.363 Base-Backbone interact. energy: -1.901 local terms energy: -224.772346 where: bonds (distance) C4'-P energy: -41.958 bonds (distance) P-C4' energy: -51.559 flat angles C4'-P-C4' energy: -45.094 flat angles P-C4'-P energy: -27.549 tors. eta vs tors. theta energy: -58.613 Dist. restrs. and SS energy: 3.591 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -669.755633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.755633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.060756 (E_RNA) where: Base-Base interactions energy: -444.113 where: short stacking energy: -200.459 Base-Backbone interact. energy: 1.056 local terms energy: -228.004290 where: bonds (distance) C4'-P energy: -42.706 bonds (distance) P-C4' energy: -45.031 flat angles C4'-P-C4' energy: -40.838 flat angles P-C4'-P energy: -38.901 tors. eta vs tors. theta energy: -60.529 Dist. restrs. and SS energy: 1.305 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -645.682134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.682134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.450442 (E_RNA) where: Base-Base interactions energy: -430.661 where: short stacking energy: -196.808 Base-Backbone interact. energy: -0.042 local terms energy: -218.748139 where: bonds (distance) C4'-P energy: -41.698 bonds (distance) P-C4' energy: -35.226 flat angles C4'-P-C4' energy: -51.101 flat angles P-C4'-P energy: -35.533 tors. eta vs tors. theta energy: -55.189 Dist. restrs. and SS energy: 3.768 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -643.320512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.320512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.063475 (E_RNA) where: Base-Base interactions energy: -422.364 where: short stacking energy: -198.501 Base-Backbone interact. energy: 0.636 local terms energy: -222.334738 where: bonds (distance) C4'-P energy: -41.205 bonds (distance) P-C4' energy: -49.884 flat angles C4'-P-C4' energy: -49.385 flat angles P-C4'-P energy: -29.771 tors. eta vs tors. theta energy: -52.089 Dist. restrs. and SS energy: 0.743 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -558.728536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.728536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.126587 (E_RNA) where: Base-Base interactions energy: -355.692 where: short stacking energy: -171.209 Base-Backbone interact. energy: -0.070 local terms energy: -203.364999 where: bonds (distance) C4'-P energy: -44.160 bonds (distance) P-C4' energy: -38.114 flat angles C4'-P-C4' energy: -44.819 flat angles P-C4'-P energy: -28.341 tors. eta vs tors. theta energy: -47.931 Dist. restrs. and SS energy: 0.398 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -520.630459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.630459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.187386 (E_RNA) where: Base-Base interactions energy: -335.469 where: short stacking energy: -167.327 Base-Backbone interact. energy: -0.620 local terms energy: -185.098181 where: bonds (distance) C4'-P energy: -37.039 bonds (distance) P-C4' energy: -31.712 flat angles C4'-P-C4' energy: -41.832 flat angles P-C4'-P energy: -31.691 tors. eta vs tors. theta energy: -42.824 Dist. restrs. and SS energy: 0.557 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -533.770203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.770203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.390741 (E_RNA) where: Base-Base interactions energy: -348.144 where: short stacking energy: -161.261 Base-Backbone interact. energy: -0.385 local terms energy: -185.860902 where: bonds (distance) C4'-P energy: -42.613 bonds (distance) P-C4' energy: -38.844 flat angles C4'-P-C4' energy: -38.159 flat angles P-C4'-P energy: -24.247 tors. eta vs tors. theta energy: -41.998 Dist. restrs. and SS energy: 0.621 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -501.362414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.362414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.080767 (E_RNA) where: Base-Base interactions energy: -327.896 where: short stacking energy: -150.224 Base-Backbone interact. energy: -0.283 local terms energy: -173.901496 where: bonds (distance) C4'-P energy: -35.009 bonds (distance) P-C4' energy: -34.954 flat angles C4'-P-C4' energy: -40.097 flat angles P-C4'-P energy: -31.977 tors. eta vs tors. theta energy: -31.865 Dist. restrs. and SS energy: 0.718 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -486.048919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.048919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.966253 (E_RNA) where: Base-Base interactions energy: -304.608 where: short stacking energy: -138.691 Base-Backbone interact. energy: 0.067 local terms energy: -182.424653 where: bonds (distance) C4'-P energy: -35.775 bonds (distance) P-C4' energy: -42.456 flat angles C4'-P-C4' energy: -45.013 flat angles P-C4'-P energy: -33.148 tors. eta vs tors. theta energy: -26.033 Dist. restrs. and SS energy: 0.917 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -688.923784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.923784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.690148 (E_RNA) where: Base-Base interactions energy: -455.408 where: short stacking energy: -217.514 Base-Backbone interact. energy: -0.831 local terms energy: -234.450570 where: bonds (distance) C4'-P energy: -50.726 bonds (distance) P-C4' energy: -39.713 flat angles C4'-P-C4' energy: -52.205 flat angles P-C4'-P energy: -36.973 tors. eta vs tors. theta energy: -54.834 Dist. restrs. and SS energy: 1.766 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -714.500971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.500971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.909897 (E_RNA) where: Base-Base interactions energy: -480.229 where: short stacking energy: -209.750 Base-Backbone interact. energy: -1.350 local terms energy: -234.331185 where: bonds (distance) C4'-P energy: -46.518 bonds (distance) P-C4' energy: -42.454 flat angles C4'-P-C4' energy: -49.734 flat angles P-C4'-P energy: -37.037 tors. eta vs tors. theta energy: -58.588 Dist. restrs. and SS energy: 1.409 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -676.536266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.536266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.754518 (E_RNA) where: Base-Base interactions energy: -452.068 where: short stacking energy: -205.728 Base-Backbone interact. energy: -1.924 local terms energy: -222.762573 where: bonds (distance) C4'-P energy: -46.926 bonds (distance) P-C4' energy: -43.502 flat angles C4'-P-C4' energy: -49.953 flat angles P-C4'-P energy: -33.205 tors. eta vs tors. theta energy: -49.177 Dist. restrs. and SS energy: 0.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -643.838864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.838864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.292861 (E_RNA) where: Base-Base interactions energy: -423.406 where: short stacking energy: -199.988 Base-Backbone interact. energy: -0.037 local terms energy: -223.849687 where: bonds (distance) C4'-P energy: -45.060 bonds (distance) P-C4' energy: -46.644 flat angles C4'-P-C4' energy: -52.869 flat angles P-C4'-P energy: -23.660 tors. eta vs tors. theta energy: -55.617 Dist. restrs. and SS energy: 3.454 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -615.829329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.829329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.338110 (E_RNA) where: Base-Base interactions energy: -411.532 where: short stacking energy: -176.791 Base-Backbone interact. energy: -0.264 local terms energy: -204.542228 where: bonds (distance) C4'-P energy: -41.018 bonds (distance) P-C4' energy: -42.669 flat angles C4'-P-C4' energy: -44.847 flat angles P-C4'-P energy: -31.093 tors. eta vs tors. theta energy: -44.915 Dist. restrs. and SS energy: 0.509 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -556.750386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.750386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.522922 (E_RNA) where: Base-Base interactions energy: -352.843 where: short stacking energy: -171.671 Base-Backbone interact. energy: -1.405 local terms energy: -203.274533 where: bonds (distance) C4'-P energy: -36.730 bonds (distance) P-C4' energy: -44.910 flat angles C4'-P-C4' energy: -38.078 flat angles P-C4'-P energy: -38.337 tors. eta vs tors. theta energy: -45.220 Dist. restrs. and SS energy: 0.773 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -551.803904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.803904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.083689 (E_RNA) where: Base-Base interactions energy: -359.208 where: short stacking energy: -172.082 Base-Backbone interact. energy: 5.717 local terms energy: -199.592946 where: bonds (distance) C4'-P energy: -35.801 bonds (distance) P-C4' energy: -45.414 flat angles C4'-P-C4' energy: -39.225 flat angles P-C4'-P energy: -32.363 tors. eta vs tors. theta energy: -46.790 Dist. restrs. and SS energy: 1.280 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -521.664633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.664633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.966387 (E_RNA) where: Base-Base interactions energy: -347.649 where: short stacking energy: -143.129 Base-Backbone interact. energy: 1.407 local terms energy: -178.725130 where: bonds (distance) C4'-P energy: -42.265 bonds (distance) P-C4' energy: -36.782 flat angles C4'-P-C4' energy: -36.470 flat angles P-C4'-P energy: -25.337 tors. eta vs tors. theta energy: -37.871 Dist. restrs. and SS energy: 3.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -511.403282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.403282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.718076 (E_RNA) where: Base-Base interactions energy: -333.961 where: short stacking energy: -148.761 Base-Backbone interact. energy: 0.440 local terms energy: -178.196383 where: bonds (distance) C4'-P energy: -37.877 bonds (distance) P-C4' energy: -32.703 flat angles C4'-P-C4' energy: -39.731 flat angles P-C4'-P energy: -24.150 tors. eta vs tors. theta energy: -43.735 Dist. restrs. and SS energy: 0.315 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -511.847620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.847620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.702156 (E_RNA) where: Base-Base interactions energy: -345.277 where: short stacking energy: -151.964 Base-Backbone interact. energy: -0.664 local terms energy: -166.760855 where: bonds (distance) C4'-P energy: -33.080 bonds (distance) P-C4' energy: -43.409 flat angles C4'-P-C4' energy: -29.897 flat angles P-C4'-P energy: -15.486 tors. eta vs tors. theta energy: -44.888 Dist. restrs. and SS energy: 0.855 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -722.761907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.761907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.956505 (E_RNA) where: Base-Base interactions energy: -479.696 where: short stacking energy: -203.722 Base-Backbone interact. energy: -0.025 local terms energy: -244.236203 where: bonds (distance) C4'-P energy: -45.296 bonds (distance) P-C4' energy: -46.155 flat angles C4'-P-C4' energy: -49.085 flat angles P-C4'-P energy: -40.075 tors. eta vs tors. theta energy: -63.625 Dist. restrs. and SS energy: 1.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -671.552418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.552418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.165908 (E_RNA) where: Base-Base interactions energy: -454.173 where: short stacking energy: -201.207 Base-Backbone interact. energy: -1.531 local terms energy: -219.461722 where: bonds (distance) C4'-P energy: -37.902 bonds (distance) P-C4' energy: -45.762 flat angles C4'-P-C4' energy: -47.984 flat angles P-C4'-P energy: -32.196 tors. eta vs tors. theta energy: -55.616 Dist. restrs. and SS energy: 3.613 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -707.759031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.759031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.808939 (E_RNA) where: Base-Base interactions energy: -476.969 where: short stacking energy: -217.829 Base-Backbone interact. energy: -1.023 local terms energy: -230.816436 where: bonds (distance) C4'-P energy: -41.016 bonds (distance) P-C4' energy: -40.928 flat angles C4'-P-C4' energy: -42.970 flat angles P-C4'-P energy: -35.502 tors. eta vs tors. theta energy: -70.400 Dist. restrs. and SS energy: 1.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -635.210246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.210246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.920078 (E_RNA) where: Base-Base interactions energy: -426.900 where: short stacking energy: -196.685 Base-Backbone interact. energy: -0.834 local terms energy: -209.186047 where: bonds (distance) C4'-P energy: -44.759 bonds (distance) P-C4' energy: -38.849 flat angles C4'-P-C4' energy: -47.600 flat angles P-C4'-P energy: -29.340 tors. eta vs tors. theta energy: -48.639 Dist. restrs. and SS energy: 1.710 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -588.966810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.966810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.560332 (E_RNA) where: Base-Base interactions energy: -382.850 where: short stacking energy: -168.477 Base-Backbone interact. energy: -0.880 local terms energy: -205.830455 where: bonds (distance) C4'-P energy: -39.878 bonds (distance) P-C4' energy: -46.571 flat angles C4'-P-C4' energy: -47.088 flat angles P-C4'-P energy: -26.426 tors. eta vs tors. theta energy: -45.866 Dist. restrs. and SS energy: 0.594 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -562.813869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.813869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.123371 (E_RNA) where: Base-Base interactions energy: -366.729 where: short stacking energy: -174.798 Base-Backbone interact. energy: -0.557 local terms energy: -197.837578 where: bonds (distance) C4'-P energy: -42.481 bonds (distance) P-C4' energy: -43.833 flat angles C4'-P-C4' energy: -38.511 flat angles P-C4'-P energy: -22.239 tors. eta vs tors. theta energy: -50.774 Dist. restrs. and SS energy: 2.310 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -550.684094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.684094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.221775 (E_RNA) where: Base-Base interactions energy: -357.620 where: short stacking energy: -165.135 Base-Backbone interact. energy: -0.448 local terms energy: -194.154326 where: bonds (distance) C4'-P energy: -39.817 bonds (distance) P-C4' energy: -40.642 flat angles C4'-P-C4' energy: -45.443 flat angles P-C4'-P energy: -33.769 tors. eta vs tors. theta energy: -34.483 Dist. restrs. and SS energy: 1.538 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -512.025352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.025352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.263637 (E_RNA) where: Base-Base interactions energy: -334.974 where: short stacking energy: -154.041 Base-Backbone interact. energy: 0.736 local terms energy: -179.025334 where: bonds (distance) C4'-P energy: -40.354 bonds (distance) P-C4' energy: -39.531 flat angles C4'-P-C4' energy: -43.059 flat angles P-C4'-P energy: -26.638 tors. eta vs tors. theta energy: -29.443 Dist. restrs. and SS energy: 1.238 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -504.162884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.162884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.835723 (E_RNA) where: Base-Base interactions energy: -333.801 where: short stacking energy: -159.461 Base-Backbone interact. energy: -0.787 local terms energy: -170.247188 where: bonds (distance) C4'-P energy: -35.385 bonds (distance) P-C4' energy: -34.412 flat angles C4'-P-C4' energy: -31.648 flat angles P-C4'-P energy: -31.332 tors. eta vs tors. theta energy: -37.470 Dist. restrs. and SS energy: 0.673 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -487.826813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.826813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.811872 (E_RNA) where: Base-Base interactions energy: -321.282 where: short stacking energy: -159.679 Base-Backbone interact. energy: 0.454 local terms energy: -167.984575 where: bonds (distance) C4'-P energy: -39.291 bonds (distance) P-C4' energy: -19.369 flat angles C4'-P-C4' energy: -40.876 flat angles P-C4'-P energy: -30.772 tors. eta vs tors. theta energy: -37.677 Dist. restrs. and SS energy: 0.985 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -744.682108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.682108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.751058 (E_RNA) where: Base-Base interactions energy: -495.483 where: short stacking energy: -213.971 Base-Backbone interact. energy: -1.108 local terms energy: -249.160434 where: bonds (distance) C4'-P energy: -42.920 bonds (distance) P-C4' energy: -51.241 flat angles C4'-P-C4' energy: -52.570 flat angles P-C4'-P energy: -37.871 tors. eta vs tors. theta energy: -64.558 Dist. restrs. and SS energy: 1.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -714.206988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.206988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.543135 (E_RNA) where: Base-Base interactions energy: -474.832 where: short stacking energy: -214.036 Base-Backbone interact. energy: -0.008 local terms energy: -239.703214 where: bonds (distance) C4'-P energy: -46.172 bonds (distance) P-C4' energy: -48.591 flat angles C4'-P-C4' energy: -49.236 flat angles P-C4'-P energy: -34.119 tors. eta vs tors. theta energy: -61.584 Dist. restrs. and SS energy: 0.336 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -672.855369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.855369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.983692 (E_RNA) where: Base-Base interactions energy: -452.482 where: short stacking energy: -196.580 Base-Backbone interact. energy: -1.251 local terms energy: -222.250627 where: bonds (distance) C4'-P energy: -42.779 bonds (distance) P-C4' energy: -37.164 flat angles C4'-P-C4' energy: -52.325 flat angles P-C4'-P energy: -37.425 tors. eta vs tors. theta energy: -52.559 Dist. restrs. and SS energy: 3.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -640.382816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.382816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.916476 (E_RNA) where: Base-Base interactions energy: -434.976 where: short stacking energy: -181.863 Base-Backbone interact. energy: -1.232 local terms energy: -207.707782 where: bonds (distance) C4'-P energy: -41.248 bonds (distance) P-C4' energy: -43.182 flat angles C4'-P-C4' energy: -44.692 flat angles P-C4'-P energy: -29.247 tors. eta vs tors. theta energy: -49.338 Dist. restrs. and SS energy: 3.534 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -578.066286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.066286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.476524 (E_RNA) where: Base-Base interactions energy: -377.171 where: short stacking energy: -165.520 Base-Backbone interact. energy: -0.106 local terms energy: -201.199432 where: bonds (distance) C4'-P energy: -40.805 bonds (distance) P-C4' energy: -43.385 flat angles C4'-P-C4' energy: -45.674 flat angles P-C4'-P energy: -34.281 tors. eta vs tors. theta energy: -37.054 Dist. restrs. and SS energy: 0.410 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -556.767904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.767904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.324155 (E_RNA) where: Base-Base interactions energy: -374.353 where: short stacking energy: -169.953 Base-Backbone interact. energy: -1.020 local terms energy: -181.951025 where: bonds (distance) C4'-P energy: -38.850 bonds (distance) P-C4' energy: -42.125 flat angles C4'-P-C4' energy: -44.323 flat angles P-C4'-P energy: -17.866 tors. eta vs tors. theta energy: -38.787 Dist. restrs. and SS energy: 0.556 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -553.021175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.021175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.447994 (E_RNA) where: Base-Base interactions energy: -361.795 where: short stacking energy: -177.103 Base-Backbone interact. energy: -1.775 local terms energy: -189.877662 where: bonds (distance) C4'-P energy: -33.781 bonds (distance) P-C4' energy: -39.083 flat angles C4'-P-C4' energy: -41.081 flat angles P-C4'-P energy: -27.080 tors. eta vs tors. theta energy: -48.853 Dist. restrs. and SS energy: 0.427 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -519.801540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.801540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.362760 (E_RNA) where: Base-Base interactions energy: -335.594 where: short stacking energy: -158.436 Base-Backbone interact. energy: -0.789 local terms energy: -183.980023 where: bonds (distance) C4'-P energy: -28.434 bonds (distance) P-C4' energy: -49.861 flat angles C4'-P-C4' energy: -30.347 flat angles P-C4'-P energy: -27.190 tors. eta vs tors. theta energy: -48.148 Dist. restrs. and SS energy: 0.561 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -503.229515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.229515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.736141 (E_RNA) where: Base-Base interactions energy: -320.277 where: short stacking energy: -150.509 Base-Backbone interact. energy: -0.344 local terms energy: -183.114927 where: bonds (distance) C4'-P energy: -31.349 bonds (distance) P-C4' energy: -36.262 flat angles C4'-P-C4' energy: -42.457 flat angles P-C4'-P energy: -33.492 tors. eta vs tors. theta energy: -39.555 Dist. restrs. and SS energy: 0.507 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -462.537014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.537014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.116686 (E_RNA) where: Base-Base interactions energy: -302.986 where: short stacking energy: -138.094 Base-Backbone interact. energy: -2.164 local terms energy: -157.966391 where: bonds (distance) C4'-P energy: -37.342 bonds (distance) P-C4' energy: -29.587 flat angles C4'-P-C4' energy: -38.891 flat angles P-C4'-P energy: -23.780 tors. eta vs tors. theta energy: -28.366 Dist. restrs. and SS energy: 0.580 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -724.797073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.797073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -726.742396 (E_RNA) where: Base-Base interactions energy: -484.438 where: short stacking energy: -231.329 Base-Backbone interact. energy: -1.097 local terms energy: -241.207414 where: bonds (distance) C4'-P energy: -40.953 bonds (distance) P-C4' energy: -48.268 flat angles C4'-P-C4' energy: -53.398 flat angles P-C4'-P energy: -32.667 tors. eta vs tors. theta energy: -65.921 Dist. restrs. and SS energy: 1.945 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -698.021215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.021215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.293494 (E_RNA) where: Base-Base interactions energy: -471.516 where: short stacking energy: -221.900 Base-Backbone interact. energy: -1.373 local terms energy: -225.404707 where: bonds (distance) C4'-P energy: -32.824 bonds (distance) P-C4' energy: -41.227 flat angles C4'-P-C4' energy: -53.974 flat angles P-C4'-P energy: -28.923 tors. eta vs tors. theta energy: -68.458 Dist. restrs. and SS energy: 0.272 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -631.127650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -631.127650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.628293 (E_RNA) where: Base-Base interactions energy: -413.048 where: short stacking energy: -191.714 Base-Backbone interact. energy: -1.107 local terms energy: -219.473639 where: bonds (distance) C4'-P energy: -42.666 bonds (distance) P-C4' energy: -53.966 flat angles C4'-P-C4' energy: -46.530 flat angles P-C4'-P energy: -30.817 tors. eta vs tors. theta energy: -45.494 Dist. restrs. and SS energy: 2.501 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -661.281188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.281188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.162851 (E_RNA) where: Base-Base interactions energy: -453.323 where: short stacking energy: -196.524 Base-Backbone interact. energy: -1.462 local terms energy: -209.377516 where: bonds (distance) C4'-P energy: -40.819 bonds (distance) P-C4' energy: -39.113 flat angles C4'-P-C4' energy: -42.031 flat angles P-C4'-P energy: -34.927 tors. eta vs tors. theta energy: -52.488 Dist. restrs. and SS energy: 2.882 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -619.575500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.575500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.564195 (E_RNA) where: Base-Base interactions energy: -421.332 where: short stacking energy: -194.576 Base-Backbone interact. energy: -1.178 local terms energy: -202.054716 where: bonds (distance) C4'-P energy: -42.860 bonds (distance) P-C4' energy: -44.750 flat angles C4'-P-C4' energy: -45.652 flat angles P-C4'-P energy: -15.717 tors. eta vs tors. theta energy: -53.076 Dist. restrs. and SS energy: 4.989 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -565.450038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.450038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.599378 (E_RNA) where: Base-Base interactions energy: -380.217 where: short stacking energy: -165.775 Base-Backbone interact. energy: -1.238 local terms energy: -184.144768 where: bonds (distance) C4'-P energy: -40.360 bonds (distance) P-C4' energy: -42.770 flat angles C4'-P-C4' energy: -34.411 flat angles P-C4'-P energy: -28.734 tors. eta vs tors. theta energy: -37.869 Dist. restrs. and SS energy: 0.149 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -553.738233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.738233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.904534 (E_RNA) where: Base-Base interactions energy: -364.816 where: short stacking energy: -182.046 Base-Backbone interact. energy: 0.072 local terms energy: -189.160372 where: bonds (distance) C4'-P energy: -32.476 bonds (distance) P-C4' energy: -38.766 flat angles C4'-P-C4' energy: -40.764 flat angles P-C4'-P energy: -26.438 tors. eta vs tors. theta energy: -50.717 Dist. restrs. and SS energy: 0.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -511.944916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.944916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.705310 (E_RNA) where: Base-Base interactions energy: -328.557 where: short stacking energy: -150.761 Base-Backbone interact. energy: -0.462 local terms energy: -183.686053 where: bonds (distance) C4'-P energy: -34.149 bonds (distance) P-C4' energy: -37.264 flat angles C4'-P-C4' energy: -47.151 flat angles P-C4'-P energy: -32.670 tors. eta vs tors. theta energy: -32.452 Dist. restrs. and SS energy: 0.760 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -486.852620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.852620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.501319 (E_RNA) where: Base-Base interactions energy: -313.514 where: short stacking energy: -152.986 Base-Backbone interact. energy: -0.630 local terms energy: -173.356938 where: bonds (distance) C4'-P energy: -43.673 bonds (distance) P-C4' energy: -30.761 flat angles C4'-P-C4' energy: -38.648 flat angles P-C4'-P energy: -19.689 tors. eta vs tors. theta energy: -40.586 Dist. restrs. and SS energy: 0.649 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -469.181801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.181801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.571194 (E_RNA) where: Base-Base interactions energy: -294.703 where: short stacking energy: -141.329 Base-Backbone interact. energy: 2.024 local terms energy: -178.892915 where: bonds (distance) C4'-P energy: -33.935 bonds (distance) P-C4' energy: -38.022 flat angles C4'-P-C4' energy: -38.313 flat angles P-C4'-P energy: -28.358 tors. eta vs tors. theta energy: -40.265 Dist. restrs. and SS energy: 2.389 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -743.758124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -743.758124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.819250 (E_RNA) where: Base-Base interactions energy: -502.256 where: short stacking energy: -222.701 Base-Backbone interact. energy: 0.995 local terms energy: -244.557840 where: bonds (distance) C4'-P energy: -52.354 bonds (distance) P-C4' energy: -45.304 flat angles C4'-P-C4' energy: -45.718 flat angles P-C4'-P energy: -38.880 tors. eta vs tors. theta energy: -62.302 Dist. restrs. and SS energy: 2.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -708.129395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.129395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.529356 (E_RNA) where: Base-Base interactions energy: -473.570 where: short stacking energy: -215.923 Base-Backbone interact. energy: -0.285 local terms energy: -234.674440 where: bonds (distance) C4'-P energy: -44.540 bonds (distance) P-C4' energy: -43.127 flat angles C4'-P-C4' energy: -51.197 flat angles P-C4'-P energy: -32.705 tors. eta vs tors. theta energy: -63.106 Dist. restrs. and SS energy: 0.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -675.365730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.365730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.884217 (E_RNA) where: Base-Base interactions energy: -447.881 where: short stacking energy: -197.660 Base-Backbone interact. energy: -2.312 local terms energy: -229.691576 where: bonds (distance) C4'-P energy: -42.858 bonds (distance) P-C4' energy: -43.216 flat angles C4'-P-C4' energy: -47.495 flat angles P-C4'-P energy: -36.103 tors. eta vs tors. theta energy: -60.020 Dist. restrs. and SS energy: 4.518 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -646.197154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -646.197154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.431225 (E_RNA) where: Base-Base interactions energy: -419.368 where: short stacking energy: -196.200 Base-Backbone interact. energy: -0.160 local terms energy: -226.903271 where: bonds (distance) C4'-P energy: -46.449 bonds (distance) P-C4' energy: -47.524 flat angles C4'-P-C4' energy: -50.481 flat angles P-C4'-P energy: -29.392 tors. eta vs tors. theta energy: -53.057 Dist. restrs. and SS energy: 0.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -588.533570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.533570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.075110 (E_RNA) where: Base-Base interactions energy: -394.272 where: short stacking energy: -186.870 Base-Backbone interact. energy: -0.714 local terms energy: -198.088952 where: bonds (distance) C4'-P energy: -33.747 bonds (distance) P-C4' energy: -44.326 flat angles C4'-P-C4' energy: -45.629 flat angles P-C4'-P energy: -29.534 tors. eta vs tors. theta energy: -44.853 Dist. restrs. and SS energy: 4.542 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -577.274042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.274042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.727513 (E_RNA) where: Base-Base interactions energy: -379.515 where: short stacking energy: -188.966 Base-Backbone interact. energy: -2.707 local terms energy: -195.504879 where: bonds (distance) C4'-P energy: -49.109 bonds (distance) P-C4' energy: -37.995 flat angles C4'-P-C4' energy: -42.217 flat angles P-C4'-P energy: -23.966 tors. eta vs tors. theta energy: -42.218 Dist. restrs. and SS energy: 0.453 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -551.891851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.891851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.191279 (E_RNA) where: Base-Base interactions energy: -358.557 where: short stacking energy: -163.365 Base-Backbone interact. energy: -0.086 local terms energy: -193.548399 where: bonds (distance) C4'-P energy: -41.383 bonds (distance) P-C4' energy: -42.497 flat angles C4'-P-C4' energy: -39.038 flat angles P-C4'-P energy: -29.004 tors. eta vs tors. theta energy: -41.626 Dist. restrs. and SS energy: 0.299 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -528.366616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.366616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.615053 (E_RNA) where: Base-Base interactions energy: -335.270 where: short stacking energy: -161.814 Base-Backbone interact. energy: -0.822 local terms energy: -193.523358 where: bonds (distance) C4'-P energy: -42.541 bonds (distance) P-C4' energy: -42.093 flat angles C4'-P-C4' energy: -40.282 flat angles P-C4'-P energy: -27.917 tors. eta vs tors. theta energy: -40.690 Dist. restrs. and SS energy: 1.248 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -481.609043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.609043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.076437 (E_RNA) where: Base-Base interactions energy: -311.825 where: short stacking energy: -139.772 Base-Backbone interact. energy: -1.565 local terms energy: -168.686656 where: bonds (distance) C4'-P energy: -33.311 bonds (distance) P-C4' energy: -44.576 flat angles C4'-P-C4' energy: -37.120 flat angles P-C4'-P energy: -23.131 tors. eta vs tors. theta energy: -30.549 Dist. restrs. and SS energy: 0.467 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -448.168656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.168656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.457248 (E_RNA) where: Base-Base interactions energy: -281.890 where: short stacking energy: -140.980 Base-Backbone interact. energy: -0.645 local terms energy: -166.922166 where: bonds (distance) C4'-P energy: -39.571 bonds (distance) P-C4' energy: -37.229 flat angles C4'-P-C4' energy: -39.607 flat angles P-C4'-P energy: -25.598 tors. eta vs tors. theta energy: -24.917 Dist. restrs. and SS energy: 1.289 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -734.655527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.655527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.931163 (E_RNA) where: Base-Base interactions energy: -490.185 where: short stacking energy: -212.934 Base-Backbone interact. energy: -1.194 local terms energy: -243.551551 where: bonds (distance) C4'-P energy: -49.398 bonds (distance) P-C4' energy: -47.308 flat angles C4'-P-C4' energy: -51.158 flat angles P-C4'-P energy: -36.731 tors. eta vs tors. theta energy: -58.957 Dist. restrs. and SS energy: 0.276 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -687.188492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.188492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.537456 (E_RNA) where: Base-Base interactions energy: -457.846 where: short stacking energy: -213.339 Base-Backbone interact. energy: 0.562 local terms energy: -230.253784 where: bonds (distance) C4'-P energy: -49.388 bonds (distance) P-C4' energy: -40.769 flat angles C4'-P-C4' energy: -48.753 flat angles P-C4'-P energy: -32.416 tors. eta vs tors. theta energy: -58.928 Dist. restrs. and SS energy: 0.349 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -667.328494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.328494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.102146 (E_RNA) where: Base-Base interactions energy: -440.505 where: short stacking energy: -188.813 Base-Backbone interact. energy: -2.110 local terms energy: -230.488015 where: bonds (distance) C4'-P energy: -45.300 bonds (distance) P-C4' energy: -46.976 flat angles C4'-P-C4' energy: -51.040 flat angles P-C4'-P energy: -33.434 tors. eta vs tors. theta energy: -53.737 Dist. restrs. and SS energy: 5.774 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -609.800593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -609.800593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.282861 (E_RNA) where: Base-Base interactions energy: -408.423 where: short stacking energy: -192.348 Base-Backbone interact. energy: -0.661 local terms energy: -201.198797 where: bonds (distance) C4'-P energy: -40.742 bonds (distance) P-C4' energy: -45.386 flat angles C4'-P-C4' energy: -43.132 flat angles P-C4'-P energy: -21.870 tors. eta vs tors. theta energy: -50.069 Dist. restrs. and SS energy: 0.482 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -594.156448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.156448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.754857 (E_RNA) where: Base-Base interactions energy: -399.804 where: short stacking energy: -184.316 Base-Backbone interact. energy: 0.883 local terms energy: -203.833710 where: bonds (distance) C4'-P energy: -45.338 bonds (distance) P-C4' energy: -31.684 flat angles C4'-P-C4' energy: -46.191 flat angles P-C4'-P energy: -33.346 tors. eta vs tors. theta energy: -47.274 Dist. restrs. and SS energy: 8.598 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -571.009734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.009734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.495447 (E_RNA) where: Base-Base interactions energy: -374.675 where: short stacking energy: -192.166 Base-Backbone interact. energy: -0.134 local terms energy: -196.686272 where: bonds (distance) C4'-P energy: -33.670 bonds (distance) P-C4' energy: -39.126 flat angles C4'-P-C4' energy: -47.275 flat angles P-C4'-P energy: -24.596 tors. eta vs tors. theta energy: -52.019 Dist. restrs. and SS energy: 0.486 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -536.638805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.638805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.090627 (E_RNA) where: Base-Base interactions energy: -342.379 where: short stacking energy: -140.978 Base-Backbone interact. energy: -0.635 local terms energy: -194.075788 where: bonds (distance) C4'-P energy: -41.296 bonds (distance) P-C4' energy: -42.856 flat angles C4'-P-C4' energy: -40.252 flat angles P-C4'-P energy: -30.023 tors. eta vs tors. theta energy: -39.650 Dist. restrs. and SS energy: 0.452 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -533.805737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.805737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.401826 (E_RNA) where: Base-Base interactions energy: -333.088 where: short stacking energy: -164.191 Base-Backbone interact. energy: -0.323 local terms energy: -200.991193 where: bonds (distance) C4'-P energy: -42.989 bonds (distance) P-C4' energy: -51.372 flat angles C4'-P-C4' energy: -39.702 flat angles P-C4'-P energy: -17.915 tors. eta vs tors. theta energy: -49.013 Dist. restrs. and SS energy: 0.596 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -424.357486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.357486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.391348 (E_RNA) where: Base-Base interactions energy: -261.083 where: short stacking energy: -126.447 Base-Backbone interact. energy: -2.039 local terms energy: -163.268699 where: bonds (distance) C4'-P energy: -39.167 bonds (distance) P-C4' energy: -34.645 flat angles C4'-P-C4' energy: -41.425 flat angles P-C4'-P energy: -21.441 tors. eta vs tors. theta energy: -26.591 Dist. restrs. and SS energy: 2.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -475.585177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.585177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.858644 (E_RNA) where: Base-Base interactions energy: -296.998 where: short stacking energy: -135.619 Base-Backbone interact. energy: -1.446 local terms energy: -177.414420 where: bonds (distance) C4'-P energy: -42.472 bonds (distance) P-C4' energy: -44.530 flat angles C4'-P-C4' energy: -34.862 flat angles P-C4'-P energy: -20.606 tors. eta vs tors. theta energy: -34.945 Dist. restrs. and SS energy: 0.273 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -732.342569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.342569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.702909 (E_RNA) where: Base-Base interactions energy: -497.073 where: short stacking energy: -207.874 Base-Backbone interact. energy: -0.620 local terms energy: -235.009664 where: bonds (distance) C4'-P energy: -43.234 bonds (distance) P-C4' energy: -47.053 flat angles C4'-P-C4' energy: -49.837 flat angles P-C4'-P energy: -34.418 tors. eta vs tors. theta energy: -60.468 Dist. restrs. and SS energy: 0.360 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -691.827998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.827998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.144149 (E_RNA) where: Base-Base interactions energy: -455.708 where: short stacking energy: -213.545 Base-Backbone interact. energy: -0.182 local terms energy: -236.254573 where: bonds (distance) C4'-P energy: -45.606 bonds (distance) P-C4' energy: -48.222 flat angles C4'-P-C4' energy: -53.379 flat angles P-C4'-P energy: -24.375 tors. eta vs tors. theta energy: -64.672 Dist. restrs. and SS energy: 0.316 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -663.047788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.047788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.508164 (E_RNA) where: Base-Base interactions energy: -435.286 where: short stacking energy: -210.828 Base-Backbone interact. energy: -1.676 local terms energy: -228.546909 where: bonds (distance) C4'-P energy: -39.482 bonds (distance) P-C4' energy: -44.218 flat angles C4'-P-C4' energy: -48.464 flat angles P-C4'-P energy: -34.732 tors. eta vs tors. theta energy: -61.650 Dist. restrs. and SS energy: 2.460 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -646.163743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -646.163743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.280884 (E_RNA) where: Base-Base interactions energy: -435.444 where: short stacking energy: -197.024 Base-Backbone interact. energy: -0.866 local terms energy: -215.970536 where: bonds (distance) C4'-P energy: -45.695 bonds (distance) P-C4' energy: -38.287 flat angles C4'-P-C4' energy: -48.670 flat angles P-C4'-P energy: -33.267 tors. eta vs tors. theta energy: -50.052 Dist. restrs. and SS energy: 6.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -620.520758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -620.520758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.887734 (E_RNA) where: Base-Base interactions energy: -428.674 where: short stacking energy: -190.684 Base-Backbone interact. energy: -0.089 local terms energy: -192.124075 where: bonds (distance) C4'-P energy: -42.309 bonds (distance) P-C4' energy: -36.883 flat angles C4'-P-C4' energy: -39.736 flat angles P-C4'-P energy: -19.630 tors. eta vs tors. theta energy: -53.566 Dist. restrs. and SS energy: 0.367 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -563.427282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.427282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.723407 (E_RNA) where: Base-Base interactions energy: -363.075 where: short stacking energy: -182.271 Base-Backbone interact. energy: -0.810 local terms energy: -199.837805 where: bonds (distance) C4'-P energy: -44.301 bonds (distance) P-C4' energy: -42.374 flat angles C4'-P-C4' energy: -43.437 flat angles P-C4'-P energy: -21.071 tors. eta vs tors. theta energy: -48.655 Dist. restrs. and SS energy: 0.296 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -534.501221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.501221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.792438 (E_RNA) where: Base-Base interactions energy: -330.250 where: short stacking energy: -150.032 Base-Backbone interact. energy: -0.340 local terms energy: -204.201752 where: bonds (distance) C4'-P energy: -46.297 bonds (distance) P-C4' energy: -44.175 flat angles C4'-P-C4' energy: -45.788 flat angles P-C4'-P energy: -26.883 tors. eta vs tors. theta energy: -41.059 Dist. restrs. and SS energy: 0.291 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -507.918661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.918661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.789520 (E_RNA) where: Base-Base interactions energy: -337.285 where: short stacking energy: -149.587 Base-Backbone interact. energy: 0.802 local terms energy: -172.306349 where: bonds (distance) C4'-P energy: -39.058 bonds (distance) P-C4' energy: -38.934 flat angles C4'-P-C4' energy: -37.938 flat angles P-C4'-P energy: -16.946 tors. eta vs tors. theta energy: -39.432 Dist. restrs. and SS energy: 0.871 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -445.762440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.762440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.601100 (E_RNA) where: Base-Base interactions energy: -288.124 where: short stacking energy: -135.649 Base-Backbone interact. energy: -0.881 local terms energy: -157.596389 where: bonds (distance) C4'-P energy: -36.217 bonds (distance) P-C4' energy: -45.347 flat angles C4'-P-C4' energy: -32.984 flat angles P-C4'-P energy: -14.502 tors. eta vs tors. theta energy: -28.546 Dist. restrs. and SS energy: 0.839 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -483.206849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.206849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.548854 (E_RNA) where: Base-Base interactions energy: -298.624 where: short stacking energy: -135.157 Base-Backbone interact. energy: -0.077 local terms energy: -184.847905 where: bonds (distance) C4'-P energy: -29.658 bonds (distance) P-C4' energy: -46.904 flat angles C4'-P-C4' energy: -42.282 flat angles P-C4'-P energy: -31.809 tors. eta vs tors. theta energy: -34.196 Dist. restrs. and SS energy: 0.342 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -724.358036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.358036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.847122 (E_RNA) where: Base-Base interactions energy: -468.514 where: short stacking energy: -213.132 Base-Backbone interact. energy: -1.233 local terms energy: -255.100213 where: bonds (distance) C4'-P energy: -51.145 bonds (distance) P-C4' energy: -52.832 flat angles C4'-P-C4' energy: -49.997 flat angles P-C4'-P energy: -36.970 tors. eta vs tors. theta energy: -64.156 Dist. restrs. and SS energy: 0.489 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -717.444671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.444671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.689597 (E_RNA) where: Base-Base interactions energy: -478.331 where: short stacking energy: -216.577 Base-Backbone interact. energy: -0.831 local terms energy: -240.527581 where: bonds (distance) C4'-P energy: -52.683 bonds (distance) P-C4' energy: -54.065 flat angles C4'-P-C4' energy: -50.069 flat angles P-C4'-P energy: -26.253 tors. eta vs tors. theta energy: -57.458 Dist. restrs. and SS energy: 2.245 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -661.250625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.250625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.561915 (E_RNA) where: Base-Base interactions energy: -441.632 where: short stacking energy: -203.830 Base-Backbone interact. energy: -1.382 local terms energy: -220.547564 where: bonds (distance) C4'-P energy: -46.247 bonds (distance) P-C4' energy: -49.484 flat angles C4'-P-C4' energy: -42.016 flat angles P-C4'-P energy: -32.694 tors. eta vs tors. theta energy: -50.106 Dist. restrs. and SS energy: 2.311 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -640.921734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.921734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.908754 (E_RNA) where: Base-Base interactions energy: -426.977 where: short stacking energy: -194.631 Base-Backbone interact. energy: -0.345 local terms energy: -215.586766 where: bonds (distance) C4'-P energy: -46.267 bonds (distance) P-C4' energy: -45.048 flat angles C4'-P-C4' energy: -42.874 flat angles P-C4'-P energy: -30.634 tors. eta vs tors. theta energy: -50.764 Dist. restrs. and SS energy: 1.987 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -617.741486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -617.741486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.995993 (E_RNA) where: Base-Base interactions energy: -398.962 where: short stacking energy: -172.974 Base-Backbone interact. energy: -1.294 local terms energy: -217.740545 where: bonds (distance) C4'-P energy: -38.685 bonds (distance) P-C4' energy: -54.692 flat angles C4'-P-C4' energy: -42.610 flat angles P-C4'-P energy: -33.498 tors. eta vs tors. theta energy: -48.255 Dist. restrs. and SS energy: 0.255 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -534.597342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.597342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.250547 (E_RNA) where: Base-Base interactions energy: -348.701 where: short stacking energy: -166.252 Base-Backbone interact. energy: -1.616 local terms energy: -184.933031 where: bonds (distance) C4'-P energy: -32.527 bonds (distance) P-C4' energy: -37.582 flat angles C4'-P-C4' energy: -48.559 flat angles P-C4'-P energy: -21.838 tors. eta vs tors. theta energy: -44.427 Dist. restrs. and SS energy: 0.653 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -530.423797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.423797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.641308 (E_RNA) where: Base-Base interactions energy: -348.565 where: short stacking energy: -172.787 Base-Backbone interact. energy: 0.412 local terms energy: -182.489070 where: bonds (distance) C4'-P energy: -38.007 bonds (distance) P-C4' energy: -34.530 flat angles C4'-P-C4' energy: -31.665 flat angles P-C4'-P energy: -29.670 tors. eta vs tors. theta energy: -48.617 Dist. restrs. and SS energy: 0.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -516.319838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.319838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.144576 (E_RNA) where: Base-Base interactions energy: -340.750 where: short stacking energy: -171.906 Base-Backbone interact. energy: -0.289 local terms energy: -176.105504 where: bonds (distance) C4'-P energy: -33.715 bonds (distance) P-C4' energy: -37.347 flat angles C4'-P-C4' energy: -39.771 flat angles P-C4'-P energy: -24.987 tors. eta vs tors. theta energy: -40.286 Dist. restrs. and SS energy: 0.825 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -485.201974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.201974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.432525 (E_RNA) where: Base-Base interactions energy: -308.510 where: short stacking energy: -137.770 Base-Backbone interact. energy: 0.576 local terms energy: -177.498733 where: bonds (distance) C4'-P energy: -35.714 bonds (distance) P-C4' energy: -41.683 flat angles C4'-P-C4' energy: -37.749 flat angles P-C4'-P energy: -29.323 tors. eta vs tors. theta energy: -33.030 Dist. restrs. and SS energy: 0.231 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -436.874081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.874081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.905066 (E_RNA) where: Base-Base interactions energy: -272.952 where: short stacking energy: -111.590 Base-Backbone interact. energy: -0.377 local terms energy: -165.575690 where: bonds (distance) C4'-P energy: -45.024 bonds (distance) P-C4' energy: -41.475 flat angles C4'-P-C4' energy: -33.913 flat angles P-C4'-P energy: -23.862 tors. eta vs tors. theta energy: -21.302 Dist. restrs. and SS energy: 2.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -698.567284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.567284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.144316 (E_RNA) where: Base-Base interactions energy: -470.176 where: short stacking energy: -205.942 Base-Backbone interact. energy: 1.663 local terms energy: -230.631762 where: bonds (distance) C4'-P energy: -46.468 bonds (distance) P-C4' energy: -41.713 flat angles C4'-P-C4' energy: -52.583 flat angles P-C4'-P energy: -30.596 tors. eta vs tors. theta energy: -59.272 Dist. restrs. and SS energy: 0.577 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -726.577815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.577815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.218193 (E_RNA) where: Base-Base interactions energy: -482.479 where: short stacking energy: -215.683 Base-Backbone interact. energy: 0.882 local terms energy: -245.621676 where: bonds (distance) C4'-P energy: -50.630 bonds (distance) P-C4' energy: -36.485 flat angles C4'-P-C4' energy: -53.902 flat angles P-C4'-P energy: -43.911 tors. eta vs tors. theta energy: -60.693 Dist. restrs. and SS energy: 0.640 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -672.807324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.807324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.538239 (E_RNA) where: Base-Base interactions energy: -456.110 where: short stacking energy: -213.288 Base-Backbone interact. energy: -1.725 local terms energy: -217.702850 where: bonds (distance) C4'-P energy: -45.921 bonds (distance) P-C4' energy: -38.577 flat angles C4'-P-C4' energy: -42.515 flat angles P-C4'-P energy: -30.881 tors. eta vs tors. theta energy: -59.809 Dist. restrs. and SS energy: 2.731 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -642.832246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.832246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.685142 (E_RNA) where: Base-Base interactions energy: -432.863 where: short stacking energy: -193.675 Base-Backbone interact. energy: -1.446 local terms energy: -210.376204 where: bonds (distance) C4'-P energy: -46.439 bonds (distance) P-C4' energy: -38.301 flat angles C4'-P-C4' energy: -46.390 flat angles P-C4'-P energy: -26.777 tors. eta vs tors. theta energy: -52.468 Dist. restrs. and SS energy: 1.853 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -611.049245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.049245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.432420 (E_RNA) where: Base-Base interactions energy: -396.510 where: short stacking energy: -177.408 Base-Backbone interact. energy: -2.338 local terms energy: -212.584403 where: bonds (distance) C4'-P energy: -39.041 bonds (distance) P-C4' energy: -46.988 flat angles C4'-P-C4' energy: -49.078 flat angles P-C4'-P energy: -32.773 tors. eta vs tors. theta energy: -44.706 Dist. restrs. and SS energy: 0.383 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -524.939820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.939820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.090942 (E_RNA) where: Base-Base interactions energy: -334.016 where: short stacking energy: -161.523 Base-Backbone interact. energy: -0.783 local terms energy: -190.292101 where: bonds (distance) C4'-P energy: -41.877 bonds (distance) P-C4' energy: -35.295 flat angles C4'-P-C4' energy: -40.527 flat angles P-C4'-P energy: -31.559 tors. eta vs tors. theta energy: -41.034 Dist. restrs. and SS energy: 0.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -532.602658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.602658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.139517 (E_RNA) where: Base-Base interactions energy: -337.923 where: short stacking energy: -153.168 Base-Backbone interact. energy: -1.729 local terms energy: -193.488185 where: bonds (distance) C4'-P energy: -38.719 bonds (distance) P-C4' energy: -38.444 flat angles C4'-P-C4' energy: -44.066 flat angles P-C4'-P energy: -27.132 tors. eta vs tors. theta energy: -45.128 Dist. restrs. and SS energy: 0.537 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -515.809527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.809527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.841713 (E_RNA) where: Base-Base interactions energy: -334.123 where: short stacking energy: -153.540 Base-Backbone interact. energy: -0.351 local terms energy: -181.366964 where: bonds (distance) C4'-P energy: -44.012 bonds (distance) P-C4' energy: -33.171 flat angles C4'-P-C4' energy: -43.872 flat angles P-C4'-P energy: -25.789 tors. eta vs tors. theta energy: -34.523 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -472.939123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.939123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.309699 (E_RNA) where: Base-Base interactions energy: -316.038 where: short stacking energy: -145.499 Base-Backbone interact. energy: -2.205 local terms energy: -155.067260 where: bonds (distance) C4'-P energy: -38.368 bonds (distance) P-C4' energy: -27.882 flat angles C4'-P-C4' energy: -34.222 flat angles P-C4'-P energy: -25.990 tors. eta vs tors. theta energy: -28.605 Dist. restrs. and SS energy: 0.371 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -457.620522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.620522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.037749 (E_RNA) where: Base-Base interactions energy: -292.830 where: short stacking energy: -141.343 Base-Backbone interact. energy: 0.354 local terms energy: -167.561985 where: bonds (distance) C4'-P energy: -32.844 bonds (distance) P-C4' energy: -43.567 flat angles C4'-P-C4' energy: -37.241 flat angles P-C4'-P energy: -15.480 tors. eta vs tors. theta energy: -38.430 Dist. restrs. and SS energy: 2.417 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -744.973647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.973647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.904957 (E_RNA) where: Base-Base interactions energy: -522.439 where: short stacking energy: -224.303 Base-Backbone interact. energy: -0.564 local terms energy: -225.901573 where: bonds (distance) C4'-P energy: -38.435 bonds (distance) P-C4' energy: -44.488 flat angles C4'-P-C4' energy: -50.558 flat angles P-C4'-P energy: -27.124 tors. eta vs tors. theta energy: -65.298 Dist. restrs. and SS energy: 3.931 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -686.570437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.570437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.141193 (E_RNA) where: Base-Base interactions energy: -466.110 where: short stacking energy: -210.748 Base-Backbone interact. energy: 2.015 local terms energy: -223.046192 where: bonds (distance) C4'-P energy: -41.457 bonds (distance) P-C4' energy: -41.713 flat angles C4'-P-C4' energy: -44.648 flat angles P-C4'-P energy: -35.763 tors. eta vs tors. theta energy: -59.465 Dist. restrs. and SS energy: 0.571 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -651.884817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.884817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.328343 (E_RNA) where: Base-Base interactions energy: -428.719 where: short stacking energy: -208.628 Base-Backbone interact. energy: 1.543 local terms energy: -227.152101 where: bonds (distance) C4'-P energy: -40.915 bonds (distance) P-C4' energy: -47.120 flat angles C4'-P-C4' energy: -44.598 flat angles P-C4'-P energy: -34.893 tors. eta vs tors. theta energy: -59.626 Dist. restrs. and SS energy: 2.444 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -621.165129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.165129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.165191 (E_RNA) where: Base-Base interactions energy: -405.302 where: short stacking energy: -195.644 Base-Backbone interact. energy: -2.730 local terms energy: -216.133258 where: bonds (distance) C4'-P energy: -35.579 bonds (distance) P-C4' energy: -44.356 flat angles C4'-P-C4' energy: -47.088 flat angles P-C4'-P energy: -32.480 tors. eta vs tors. theta energy: -56.630 Dist. restrs. and SS energy: 3.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -617.021975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -617.021975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.256365 (E_RNA) where: Base-Base interactions energy: -398.996 where: short stacking energy: -182.815 Base-Backbone interact. energy: -0.366 local terms energy: -217.894087 where: bonds (distance) C4'-P energy: -48.947 bonds (distance) P-C4' energy: -43.775 flat angles C4'-P-C4' energy: -43.570 flat angles P-C4'-P energy: -30.188 tors. eta vs tors. theta energy: -51.414 Dist. restrs. and SS energy: 0.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -541.430766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.430766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.737244 (E_RNA) where: Base-Base interactions energy: -347.702 where: short stacking energy: -154.563 Base-Backbone interact. energy: -1.092 local terms energy: -192.943443 where: bonds (distance) C4'-P energy: -44.915 bonds (distance) P-C4' energy: -44.585 flat angles C4'-P-C4' energy: -45.009 flat angles P-C4'-P energy: -19.181 tors. eta vs tors. theta energy: -39.255 Dist. restrs. and SS energy: 0.306 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -514.911451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.911451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.635518 (E_RNA) where: Base-Base interactions energy: -328.470 where: short stacking energy: -154.409 Base-Backbone interact. energy: -0.499 local terms energy: -186.666659 where: bonds (distance) C4'-P energy: -35.621 bonds (distance) P-C4' energy: -47.840 flat angles C4'-P-C4' energy: -40.635 flat angles P-C4'-P energy: -25.024 tors. eta vs tors. theta energy: -37.547 Dist. restrs. and SS energy: 0.724 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -514.610615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.610615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.843554 (E_RNA) where: Base-Base interactions energy: -330.193 where: short stacking energy: -155.290 Base-Backbone interact. energy: 0.887 local terms energy: -185.537541 where: bonds (distance) C4'-P energy: -40.189 bonds (distance) P-C4' energy: -41.242 flat angles C4'-P-C4' energy: -43.849 flat angles P-C4'-P energy: -30.198 tors. eta vs tors. theta energy: -30.059 Dist. restrs. and SS energy: 0.233 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -480.926147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.926147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.806280 (E_RNA) where: Base-Base interactions energy: -309.098 where: short stacking energy: -146.159 Base-Backbone interact. energy: -0.581 local terms energy: -174.128027 where: bonds (distance) C4'-P energy: -35.573 bonds (distance) P-C4' energy: -43.404 flat angles C4'-P-C4' energy: -34.825 flat angles P-C4'-P energy: -21.581 tors. eta vs tors. theta energy: -38.746 Dist. restrs. and SS energy: 2.880 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -488.231319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.231319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.831209 (E_RNA) where: Base-Base interactions energy: -314.377 where: short stacking energy: -144.038 Base-Backbone interact. energy: 2.388 local terms energy: -176.841635 where: bonds (distance) C4'-P energy: -37.918 bonds (distance) P-C4' energy: -35.304 flat angles C4'-P-C4' energy: -39.434 flat angles P-C4'-P energy: -32.875 tors. eta vs tors. theta energy: -31.311 Dist. restrs. and SS energy: 0.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -752.181916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.181916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.128725 (E_RNA) where: Base-Base interactions energy: -504.719 where: short stacking energy: -217.853 Base-Backbone interact. energy: 0.121 local terms energy: -251.530690 where: bonds (distance) C4'-P energy: -46.916 bonds (distance) P-C4' energy: -50.367 flat angles C4'-P-C4' energy: -52.915 flat angles P-C4'-P energy: -39.557 tors. eta vs tors. theta energy: -61.776 Dist. restrs. and SS energy: 3.947 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -709.142918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.142918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.365637 (E_RNA) where: Base-Base interactions energy: -472.479 where: short stacking energy: -210.491 Base-Backbone interact. energy: -0.236 local terms energy: -236.650769 where: bonds (distance) C4'-P energy: -46.348 bonds (distance) P-C4' energy: -46.314 flat angles C4'-P-C4' energy: -51.201 flat angles P-C4'-P energy: -32.349 tors. eta vs tors. theta energy: -60.438 Dist. restrs. and SS energy: 0.223 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -650.234565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.234565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.239635 (E_RNA) where: Base-Base interactions energy: -439.980 where: short stacking energy: -203.054 Base-Backbone interact. energy: -1.526 local terms energy: -210.733714 where: bonds (distance) C4'-P energy: -45.907 bonds (distance) P-C4' energy: -38.288 flat angles C4'-P-C4' energy: -43.964 flat angles P-C4'-P energy: -28.897 tors. eta vs tors. theta energy: -53.679 Dist. restrs. and SS energy: 2.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -614.174033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.174033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.234043 (E_RNA) where: Base-Base interactions energy: -400.247 where: short stacking energy: -169.509 Base-Backbone interact. energy: -1.511 local terms energy: -215.475933 where: bonds (distance) C4'-P energy: -46.253 bonds (distance) P-C4' energy: -43.957 flat angles C4'-P-C4' energy: -42.195 flat angles P-C4'-P energy: -33.192 tors. eta vs tors. theta energy: -49.879 Dist. restrs. and SS energy: 3.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -592.036777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.036777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.080791 (E_RNA) where: Base-Base interactions energy: -392.929 where: short stacking energy: -183.495 Base-Backbone interact. energy: -0.899 local terms energy: -198.253333 where: bonds (distance) C4'-P energy: -34.987 bonds (distance) P-C4' energy: -43.204 flat angles C4'-P-C4' energy: -43.649 flat angles P-C4'-P energy: -28.989 tors. eta vs tors. theta energy: -47.424 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -576.849244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.849244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.154729 (E_RNA) where: Base-Base interactions energy: -375.195 where: short stacking energy: -177.968 Base-Backbone interact. energy: -0.846 local terms energy: -201.113419 where: bonds (distance) C4'-P energy: -45.396 bonds (distance) P-C4' energy: -36.149 flat angles C4'-P-C4' energy: -44.298 flat angles P-C4'-P energy: -29.622 tors. eta vs tors. theta energy: -45.648 Dist. restrs. and SS energy: 0.305 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -527.032318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.032318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.552258 (E_RNA) where: Base-Base interactions energy: -344.354 where: short stacking energy: -158.803 Base-Backbone interact. energy: -1.059 local terms energy: -182.139138 where: bonds (distance) C4'-P energy: -35.484 bonds (distance) P-C4' energy: -38.639 flat angles C4'-P-C4' energy: -47.805 flat angles P-C4'-P energy: -31.116 tors. eta vs tors. theta energy: -29.094 Dist. restrs. and SS energy: 0.520 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -502.412571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.412571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.642377 (E_RNA) where: Base-Base interactions energy: -327.914 where: short stacking energy: -149.896 Base-Backbone interact. energy: -0.111 local terms energy: -177.618012 where: bonds (distance) C4'-P energy: -35.103 bonds (distance) P-C4' energy: -37.822 flat angles C4'-P-C4' energy: -41.763 flat angles P-C4'-P energy: -22.725 tors. eta vs tors. theta energy: -40.204 Dist. restrs. and SS energy: 3.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -493.481221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.481221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.622158 (E_RNA) where: Base-Base interactions energy: -319.841 where: short stacking energy: -148.068 Base-Backbone interact. energy: 1.643 local terms energy: -176.424121 where: bonds (distance) C4'-P energy: -39.410 bonds (distance) P-C4' energy: -34.095 flat angles C4'-P-C4' energy: -42.240 flat angles P-C4'-P energy: -27.585 tors. eta vs tors. theta energy: -33.095 Dist. restrs. and SS energy: 1.141 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -477.775697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.775697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.143247 (E_RNA) where: Base-Base interactions energy: -308.526 where: short stacking energy: -139.358 Base-Backbone interact. energy: 1.218 local terms energy: -170.835151 where: bonds (distance) C4'-P energy: -38.412 bonds (distance) P-C4' energy: -35.832 flat angles C4'-P-C4' energy: -37.001 flat angles P-C4'-P energy: -22.879 tors. eta vs tors. theta energy: -36.711 Dist. restrs. and SS energy: 0.368 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -756.727438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.727438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.240371 (E_RNA) where: Base-Base interactions energy: -512.165 where: short stacking energy: -225.748 Base-Backbone interact. energy: -0.478 local terms energy: -245.597442 where: bonds (distance) C4'-P energy: -43.648 bonds (distance) P-C4' energy: -46.676 flat angles C4'-P-C4' energy: -51.125 flat angles P-C4'-P energy: -31.392 tors. eta vs tors. theta energy: -72.756 Dist. restrs. and SS energy: 1.513 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -691.028524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.028524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.412787 (E_RNA) where: Base-Base interactions energy: -468.602 where: short stacking energy: -212.477 Base-Backbone interact. energy: -0.548 local terms energy: -222.262971 where: bonds (distance) C4'-P energy: -42.623 bonds (distance) P-C4' energy: -38.175 flat angles C4'-P-C4' energy: -48.999 flat angles P-C4'-P energy: -32.333 tors. eta vs tors. theta energy: -60.133 Dist. restrs. and SS energy: 0.384 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -668.170612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.170612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.123678 (E_RNA) where: Base-Base interactions energy: -455.182 where: short stacking energy: -212.777 Base-Backbone interact. energy: -1.401 local terms energy: -214.540568 where: bonds (distance) C4'-P energy: -42.500 bonds (distance) P-C4' energy: -35.488 flat angles C4'-P-C4' energy: -45.876 flat angles P-C4'-P energy: -34.687 tors. eta vs tors. theta energy: -55.990 Dist. restrs. and SS energy: 2.953 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -590.416319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.416319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.353679 (E_RNA) where: Base-Base interactions energy: -390.936 where: short stacking energy: -168.716 Base-Backbone interact. energy: -1.482 local terms energy: -201.935503 where: bonds (distance) C4'-P energy: -39.688 bonds (distance) P-C4' energy: -40.845 flat angles C4'-P-C4' energy: -43.756 flat angles P-C4'-P energy: -28.901 tors. eta vs tors. theta energy: -48.746 Dist. restrs. and SS energy: 3.937 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -590.105186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.105186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.897443 (E_RNA) where: Base-Base interactions energy: -390.692 where: short stacking energy: -176.164 Base-Backbone interact. energy: -1.356 local terms energy: -198.849421 where: bonds (distance) C4'-P energy: -45.090 bonds (distance) P-C4' energy: -43.743 flat angles C4'-P-C4' energy: -39.953 flat angles P-C4'-P energy: -30.176 tors. eta vs tors. theta energy: -39.886 Dist. restrs. and SS energy: 0.792 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -586.298300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.298300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.435455 (E_RNA) where: Base-Base interactions energy: -377.584 where: short stacking energy: -180.954 Base-Backbone interact. energy: -2.161 local terms energy: -206.690365 where: bonds (distance) C4'-P energy: -31.036 bonds (distance) P-C4' energy: -37.320 flat angles C4'-P-C4' energy: -51.767 flat angles P-C4'-P energy: -36.937 tors. eta vs tors. theta energy: -49.630 Dist. restrs. and SS energy: 0.137 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -538.622617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.622617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.529713 (E_RNA) where: Base-Base interactions energy: -366.330 where: short stacking energy: -164.635 Base-Backbone interact. energy: -0.391 local terms energy: -172.809369 where: bonds (distance) C4'-P energy: -26.109 bonds (distance) P-C4' energy: -38.265 flat angles C4'-P-C4' energy: -45.214 flat angles P-C4'-P energy: -29.424 tors. eta vs tors. theta energy: -33.797 Dist. restrs. and SS energy: 0.907 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -492.615365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.615365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.639285 (E_RNA) where: Base-Base interactions energy: -313.736 where: short stacking energy: -157.213 Base-Backbone interact. energy: -0.885 local terms energy: -185.017677 where: bonds (distance) C4'-P energy: -42.340 bonds (distance) P-C4' energy: -22.650 flat angles C4'-P-C4' energy: -42.918 flat angles P-C4'-P energy: -36.723 tors. eta vs tors. theta energy: -40.386 Dist. restrs. and SS energy: 7.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -489.385237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.385237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.211917 (E_RNA) where: Base-Base interactions energy: -323.194 where: short stacking energy: -146.104 Base-Backbone interact. energy: 0.777 local terms energy: -167.794917 where: bonds (distance) C4'-P energy: -41.843 bonds (distance) P-C4' energy: -34.483 flat angles C4'-P-C4' energy: -41.603 flat angles P-C4'-P energy: -21.705 tors. eta vs tors. theta energy: -28.162 Dist. restrs. and SS energy: 0.827 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -470.789870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.789870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.138411 (E_RNA) where: Base-Base interactions energy: -312.490 where: short stacking energy: -137.477 Base-Backbone interact. energy: 0.823 local terms energy: -159.471686 where: bonds (distance) C4'-P energy: -36.353 bonds (distance) P-C4' energy: -31.110 flat angles C4'-P-C4' energy: -36.959 flat angles P-C4'-P energy: -19.961 tors. eta vs tors. theta energy: -35.089 Dist. restrs. and SS energy: 0.349 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -766.110659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.110659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.465902 (E_RNA) where: Base-Base interactions energy: -504.204 where: short stacking energy: -230.565 Base-Backbone interact. energy: -1.517 local terms energy: -260.744945 where: bonds (distance) C4'-P energy: -50.097 bonds (distance) P-C4' energy: -46.144 flat angles C4'-P-C4' energy: -58.727 flat angles P-C4'-P energy: -41.441 tors. eta vs tors. theta energy: -64.336 Dist. restrs. and SS energy: 0.355 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -704.549939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.549939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.615541 (E_RNA) where: Base-Base interactions energy: -468.891 where: short stacking energy: -203.469 Base-Backbone interact. energy: -2.436 local terms energy: -233.288012 where: bonds (distance) C4'-P energy: -46.829 bonds (distance) P-C4' energy: -50.191 flat angles C4'-P-C4' energy: -49.942 flat angles P-C4'-P energy: -28.706 tors. eta vs tors. theta energy: -57.620 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -664.098002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.098002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.428563 (E_RNA) where: Base-Base interactions energy: -448.750 where: short stacking energy: -204.011 Base-Backbone interact. energy: 0.900 local terms energy: -218.579226 where: bonds (distance) C4'-P energy: -31.345 bonds (distance) P-C4' energy: -42.178 flat angles C4'-P-C4' energy: -51.537 flat angles P-C4'-P energy: -34.753 tors. eta vs tors. theta energy: -58.765 Dist. restrs. and SS energy: 2.331 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -633.690886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.690886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.853003 (E_RNA) where: Base-Base interactions energy: -413.442 where: short stacking energy: -193.299 Base-Backbone interact. energy: -0.908 local terms energy: -219.502383 where: bonds (distance) C4'-P energy: -43.101 bonds (distance) P-C4' energy: -42.896 flat angles C4'-P-C4' energy: -41.667 flat angles P-C4'-P energy: -42.545 tors. eta vs tors. theta energy: -49.293 Dist. restrs. and SS energy: 0.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -551.236072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.236072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.766681 (E_RNA) where: Base-Base interactions energy: -369.551 where: short stacking energy: -166.775 Base-Backbone interact. energy: -1.312 local terms energy: -186.904226 where: bonds (distance) C4'-P energy: -34.642 bonds (distance) P-C4' energy: -41.472 flat angles C4'-P-C4' energy: -44.330 flat angles P-C4'-P energy: -33.047 tors. eta vs tors. theta energy: -33.414 Dist. restrs. and SS energy: 6.531 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -600.142401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.142401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.303541 (E_RNA) where: Base-Base interactions energy: -387.999 where: short stacking energy: -176.023 Base-Backbone interact. energy: -1.065 local terms energy: -211.240152 where: bonds (distance) C4'-P energy: -44.403 bonds (distance) P-C4' energy: -44.944 flat angles C4'-P-C4' energy: -43.201 flat angles P-C4'-P energy: -35.426 tors. eta vs tors. theta energy: -43.265 Dist. restrs. and SS energy: 0.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -537.595865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.595865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.119129 (E_RNA) where: Base-Base interactions energy: -350.547 where: short stacking energy: -166.007 Base-Backbone interact. energy: -0.387 local terms energy: -188.185406 where: bonds (distance) C4'-P energy: -28.111 bonds (distance) P-C4' energy: -46.260 flat angles C4'-P-C4' energy: -45.602 flat angles P-C4'-P energy: -29.947 tors. eta vs tors. theta energy: -38.265 Dist. restrs. and SS energy: 1.523 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -491.620555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.620555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.507268 (E_RNA) where: Base-Base interactions energy: -298.624 where: short stacking energy: -144.354 Base-Backbone interact. energy: -1.264 local terms energy: -194.618871 where: bonds (distance) C4'-P energy: -37.737 bonds (distance) P-C4' energy: -49.038 flat angles C4'-P-C4' energy: -39.895 flat angles P-C4'-P energy: -24.426 tors. eta vs tors. theta energy: -43.523 Dist. restrs. and SS energy: 2.887 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -457.322863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.322863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.112696 (E_RNA) where: Base-Base interactions energy: -303.929 where: short stacking energy: -139.733 Base-Backbone interact. energy: 0.430 local terms energy: -159.613016 where: bonds (distance) C4'-P energy: -31.241 bonds (distance) P-C4' energy: -42.642 flat angles C4'-P-C4' energy: -41.389 flat angles P-C4'-P energy: -21.200 tors. eta vs tors. theta energy: -23.140 Dist. restrs. and SS energy: 5.790 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -468.476691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.476691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.981520 (E_RNA) where: Base-Base interactions energy: -293.086 where: short stacking energy: -130.576 Base-Backbone interact. energy: -0.517 local terms energy: -177.378425 where: bonds (distance) C4'-P energy: -42.568 bonds (distance) P-C4' energy: -34.931 flat angles C4'-P-C4' energy: -43.164 flat angles P-C4'-P energy: -25.550 tors. eta vs tors. theta energy: -31.165 Dist. restrs. and SS energy: 2.505 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -772.192388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.192388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.757279 (E_RNA) where: Base-Base interactions energy: -514.086 where: short stacking energy: -231.876 Base-Backbone interact. energy: 0.636 local terms energy: -259.306832 where: bonds (distance) C4'-P energy: -49.126 bonds (distance) P-C4' energy: -45.596 flat angles C4'-P-C4' energy: -54.605 flat angles P-C4'-P energy: -40.966 tors. eta vs tors. theta energy: -69.014 Dist. restrs. and SS energy: 0.565 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -711.986459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.986459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.676210 (E_RNA) where: Base-Base interactions energy: -477.268 where: short stacking energy: -207.532 Base-Backbone interact. energy: -0.717 local terms energy: -234.691243 where: bonds (distance) C4'-P energy: -47.762 bonds (distance) P-C4' energy: -49.606 flat angles C4'-P-C4' energy: -50.607 flat angles P-C4'-P energy: -31.281 tors. eta vs tors. theta energy: -55.435 Dist. restrs. and SS energy: 0.690 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -658.991926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.991926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.834024 (E_RNA) where: Base-Base interactions energy: -430.753 where: short stacking energy: -213.628 Base-Backbone interact. energy: -1.221 local terms energy: -229.860009 where: bonds (distance) C4'-P energy: -37.278 bonds (distance) P-C4' energy: -43.075 flat angles C4'-P-C4' energy: -52.177 flat angles P-C4'-P energy: -35.488 tors. eta vs tors. theta energy: -61.843 Dist. restrs. and SS energy: 2.842 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -658.886193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.886193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.160147 (E_RNA) where: Base-Base interactions energy: -433.124 where: short stacking energy: -198.796 Base-Backbone interact. energy: -1.188 local terms energy: -224.847758 where: bonds (distance) C4'-P energy: -42.759 bonds (distance) P-C4' energy: -48.448 flat angles C4'-P-C4' energy: -40.079 flat angles P-C4'-P energy: -38.875 tors. eta vs tors. theta energy: -54.688 Dist. restrs. and SS energy: 0.274 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -630.104728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.104728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.422400 (E_RNA) where: Base-Base interactions energy: -411.647 where: short stacking energy: -186.266 Base-Backbone interact. energy: -0.712 local terms energy: -218.063611 where: bonds (distance) C4'-P energy: -39.359 bonds (distance) P-C4' energy: -50.098 flat angles C4'-P-C4' energy: -46.069 flat angles P-C4'-P energy: -31.034 tors. eta vs tors. theta energy: -51.504 Dist. restrs. and SS energy: 0.318 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -575.752882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.752882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.583241 (E_RNA) where: Base-Base interactions energy: -372.998 where: short stacking energy: -173.499 Base-Backbone interact. energy: -2.429 local terms energy: -203.156837 where: bonds (distance) C4'-P energy: -39.091 bonds (distance) P-C4' energy: -51.702 flat angles C4'-P-C4' energy: -46.573 flat angles P-C4'-P energy: -25.244 tors. eta vs tors. theta energy: -40.547 Dist. restrs. and SS energy: 2.830 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -547.460836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.460836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.140775 (E_RNA) where: Base-Base interactions energy: -357.011 where: short stacking energy: -166.322 Base-Backbone interact. energy: -1.581 local terms energy: -189.549350 where: bonds (distance) C4'-P energy: -37.319 bonds (distance) P-C4' energy: -36.360 flat angles C4'-P-C4' energy: -44.727 flat angles P-C4'-P energy: -30.496 tors. eta vs tors. theta energy: -40.648 Dist. restrs. and SS energy: 0.680 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -516.451199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.451199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.639452 (E_RNA) where: Base-Base interactions energy: -335.101 where: short stacking energy: -160.932 Base-Backbone interact. energy: -1.173 local terms energy: -180.365030 where: bonds (distance) C4'-P energy: -36.757 bonds (distance) P-C4' energy: -34.141 flat angles C4'-P-C4' energy: -38.571 flat angles P-C4'-P energy: -30.177 tors. eta vs tors. theta energy: -40.720 Dist. restrs. and SS energy: 0.188 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -490.551728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.551728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.598064 (E_RNA) where: Base-Base interactions energy: -321.862 where: short stacking energy: -147.857 Base-Backbone interact. energy: -1.225 local terms energy: -167.511360 where: bonds (distance) C4'-P energy: -27.184 bonds (distance) P-C4' energy: -46.593 flat angles C4'-P-C4' energy: -33.775 flat angles P-C4'-P energy: -30.445 tors. eta vs tors. theta energy: -29.514 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -478.464920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.464920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.930303 (E_RNA) where: Base-Base interactions energy: -317.743 where: short stacking energy: -142.048 Base-Backbone interact. energy: -0.405 local terms energy: -161.782803 where: bonds (distance) C4'-P energy: -30.965 bonds (distance) P-C4' energy: -43.193 flat angles C4'-P-C4' energy: -34.345 flat angles P-C4'-P energy: -22.827 tors. eta vs tors. theta energy: -30.452 Dist. restrs. and SS energy: 1.465 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -743.141676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -743.141676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.443841 (E_RNA) where: Base-Base interactions energy: -498.767 where: short stacking energy: -230.288 Base-Backbone interact. energy: -0.501 local terms energy: -244.175467 where: bonds (distance) C4'-P energy: -44.346 bonds (distance) P-C4' energy: -41.148 flat angles C4'-P-C4' energy: -51.667 flat angles P-C4'-P energy: -41.608 tors. eta vs tors. theta energy: -65.407 Dist. restrs. and SS energy: 0.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -696.874513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.874513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.022414 (E_RNA) where: Base-Base interactions energy: -472.330 where: short stacking energy: -203.984 Base-Backbone interact. energy: -1.027 local terms energy: -223.665650 where: bonds (distance) C4'-P energy: -37.447 bonds (distance) P-C4' energy: -50.349 flat angles C4'-P-C4' energy: -45.415 flat angles P-C4'-P energy: -31.850 tors. eta vs tors. theta energy: -58.605 Dist. restrs. and SS energy: 0.148 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -642.674244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.674244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.811188 (E_RNA) where: Base-Base interactions energy: -418.606 where: short stacking energy: -201.885 Base-Backbone interact. energy: -0.542 local terms energy: -226.663120 where: bonds (distance) C4'-P energy: -38.486 bonds (distance) P-C4' energy: -42.958 flat angles C4'-P-C4' energy: -52.002 flat angles P-C4'-P energy: -36.790 tors. eta vs tors. theta energy: -56.426 Dist. restrs. and SS energy: 3.137 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -638.267266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.267266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.603178 (E_RNA) where: Base-Base interactions energy: -414.657 where: short stacking energy: -195.081 Base-Backbone interact. energy: -0.626 local terms energy: -223.320398 where: bonds (distance) C4'-P energy: -43.949 bonds (distance) P-C4' energy: -47.961 flat angles C4'-P-C4' energy: -45.409 flat angles P-C4'-P energy: -30.944 tors. eta vs tors. theta energy: -55.058 Dist. restrs. and SS energy: 0.336 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -658.805127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.805127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.298955 (E_RNA) where: Base-Base interactions energy: -435.186 where: short stacking energy: -195.368 Base-Backbone interact. energy: -0.730 local terms energy: -223.383110 where: bonds (distance) C4'-P energy: -43.579 bonds (distance) P-C4' energy: -40.153 flat angles C4'-P-C4' energy: -49.443 flat angles P-C4'-P energy: -31.710 tors. eta vs tors. theta energy: -58.497 Dist. restrs. and SS energy: 0.494 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -570.338923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.338923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.304674 (E_RNA) where: Base-Base interactions energy: -382.501 where: short stacking energy: -166.208 Base-Backbone interact. energy: 0.084 local terms energy: -189.887479 where: bonds (distance) C4'-P energy: -34.711 bonds (distance) P-C4' energy: -38.382 flat angles C4'-P-C4' energy: -48.662 flat angles P-C4'-P energy: -29.010 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 1.966 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -536.554377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.554377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.783724 (E_RNA) where: Base-Base interactions energy: -353.734 where: short stacking energy: -163.826 Base-Backbone interact. energy: -0.894 local terms energy: -182.155743 where: bonds (distance) C4'-P energy: -32.419 bonds (distance) P-C4' energy: -31.307 flat angles C4'-P-C4' energy: -39.776 flat angles P-C4'-P energy: -32.825 tors. eta vs tors. theta energy: -45.829 Dist. restrs. and SS energy: 0.229 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -516.925007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.925007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.654420 (E_RNA) where: Base-Base interactions energy: -331.512 where: short stacking energy: -147.177 Base-Backbone interact. energy: 2.225 local terms energy: -188.367452 where: bonds (distance) C4'-P energy: -42.073 bonds (distance) P-C4' energy: -44.624 flat angles C4'-P-C4' energy: -42.673 flat angles P-C4'-P energy: -27.268 tors. eta vs tors. theta energy: -31.730 Dist. restrs. and SS energy: 0.729 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -518.966782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.966782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.174799 (E_RNA) where: Base-Base interactions energy: -337.424 where: short stacking energy: -153.302 Base-Backbone interact. energy: -1.407 local terms energy: -180.343835 where: bonds (distance) C4'-P energy: -34.808 bonds (distance) P-C4' energy: -43.469 flat angles C4'-P-C4' energy: -43.851 flat angles P-C4'-P energy: -20.996 tors. eta vs tors. theta energy: -37.220 Dist. restrs. and SS energy: 0.208 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -465.377386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.377386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.553679 (E_RNA) where: Base-Base interactions energy: -301.991 where: short stacking energy: -127.436 Base-Backbone interact. energy: 3.029 local terms energy: -167.591637 where: bonds (distance) C4'-P energy: -38.795 bonds (distance) P-C4' energy: -41.117 flat angles C4'-P-C4' energy: -36.945 flat angles P-C4'-P energy: -24.551 tors. eta vs tors. theta energy: -26.184 Dist. restrs. and SS energy: 1.176 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -707.218173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.218173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.658322 (E_RNA) where: Base-Base interactions energy: -471.573 where: short stacking energy: -219.723 Base-Backbone interact. energy: 0.155 local terms energy: -236.240248 where: bonds (distance) C4'-P energy: -38.569 bonds (distance) P-C4' energy: -42.836 flat angles C4'-P-C4' energy: -54.821 flat angles P-C4'-P energy: -33.975 tors. eta vs tors. theta energy: -66.039 Dist. restrs. and SS energy: 0.440 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -703.164034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.164034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.395097 (E_RNA) where: Base-Base interactions energy: -461.785 where: short stacking energy: -190.752 Base-Backbone interact. energy: 0.306 local terms energy: -241.916094 where: bonds (distance) C4'-P energy: -43.728 bonds (distance) P-C4' energy: -51.253 flat angles C4'-P-C4' energy: -52.008 flat angles P-C4'-P energy: -38.836 tors. eta vs tors. theta energy: -56.090 Dist. restrs. and SS energy: 0.231 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -663.832636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.832636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.113466 (E_RNA) where: Base-Base interactions energy: -434.596 where: short stacking energy: -211.556 Base-Backbone interact. energy: 0.531 local terms energy: -230.049221 where: bonds (distance) C4'-P energy: -46.300 bonds (distance) P-C4' energy: -48.548 flat angles C4'-P-C4' energy: -48.792 flat angles P-C4'-P energy: -30.563 tors. eta vs tors. theta energy: -55.847 Dist. restrs. and SS energy: 0.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -618.497918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.497918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.627014 (E_RNA) where: Base-Base interactions energy: -395.374 where: short stacking energy: -200.372 Base-Backbone interact. energy: -3.168 local terms energy: -223.084767 where: bonds (distance) C4'-P energy: -44.479 bonds (distance) P-C4' energy: -46.676 flat angles C4'-P-C4' energy: -43.232 flat angles P-C4'-P energy: -34.438 tors. eta vs tors. theta energy: -54.259 Dist. restrs. and SS energy: 3.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -656.683937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.683937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.271498 (E_RNA) where: Base-Base interactions energy: -436.561 where: short stacking energy: -187.800 Base-Backbone interact. energy: -1.154 local terms energy: -219.556885 where: bonds (distance) C4'-P energy: -44.411 bonds (distance) P-C4' energy: -45.874 flat angles C4'-P-C4' energy: -45.343 flat angles P-C4'-P energy: -25.284 tors. eta vs tors. theta energy: -58.645 Dist. restrs. and SS energy: 0.588 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -542.578045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.578045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.875459 (E_RNA) where: Base-Base interactions energy: -358.817 where: short stacking energy: -167.297 Base-Backbone interact. energy: -2.393 local terms energy: -183.665242 where: bonds (distance) C4'-P energy: -47.226 bonds (distance) P-C4' energy: -35.533 flat angles C4'-P-C4' energy: -39.425 flat angles P-C4'-P energy: -25.140 tors. eta vs tors. theta energy: -36.342 Dist. restrs. and SS energy: 2.297 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -521.812134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.812134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.098727 (E_RNA) where: Base-Base interactions energy: -352.041 where: short stacking energy: -158.148 Base-Backbone interact. energy: 0.295 local terms energy: -170.352437 where: bonds (distance) C4'-P energy: -29.869 bonds (distance) P-C4' energy: -41.284 flat angles C4'-P-C4' energy: -40.319 flat angles P-C4'-P energy: -22.776 tors. eta vs tors. theta energy: -36.104 Dist. restrs. and SS energy: 0.287 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -524.592566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.592566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.378709 (E_RNA) where: Base-Base interactions energy: -330.233 where: short stacking energy: -155.199 Base-Backbone interact. energy: -0.868 local terms energy: -194.278135 where: bonds (distance) C4'-P energy: -43.183 bonds (distance) P-C4' energy: -39.336 flat angles C4'-P-C4' energy: -43.585 flat angles P-C4'-P energy: -23.131 tors. eta vs tors. theta energy: -45.042 Dist. restrs. and SS energy: 0.786 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -494.890019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.890019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.261780 (E_RNA) where: Base-Base interactions energy: -317.999 where: short stacking energy: -147.370 Base-Backbone interact. energy: -1.329 local terms energy: -175.933241 where: bonds (distance) C4'-P energy: -34.541 bonds (distance) P-C4' energy: -31.816 flat angles C4'-P-C4' energy: -38.580 flat angles P-C4'-P energy: -35.442 tors. eta vs tors. theta energy: -35.554 Dist. restrs. and SS energy: 0.372 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -457.046194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.046194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.464215 (E_RNA) where: Base-Base interactions energy: -305.848 where: short stacking energy: -126.352 Base-Backbone interact. energy: 0.394 local terms energy: -152.010836 where: bonds (distance) C4'-P energy: -37.044 bonds (distance) P-C4' energy: -29.161 flat angles C4'-P-C4' energy: -39.654 flat angles P-C4'-P energy: -19.900 tors. eta vs tors. theta energy: -26.252 Dist. restrs. and SS energy: 0.418 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -727.782881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.782881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.023587 (E_RNA) where: Base-Base interactions energy: -481.677 where: short stacking energy: -213.366 Base-Backbone interact. energy: -0.611 local terms energy: -245.735142 where: bonds (distance) C4'-P energy: -39.990 bonds (distance) P-C4' energy: -46.001 flat angles C4'-P-C4' energy: -50.510 flat angles P-C4'-P energy: -44.105 tors. eta vs tors. theta energy: -65.129 Dist. restrs. and SS energy: 0.241 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -707.910592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.910592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.231598 (E_RNA) where: Base-Base interactions energy: -467.788 where: short stacking energy: -211.101 Base-Backbone interact. energy: 1.925 local terms energy: -242.368458 where: bonds (distance) C4'-P energy: -51.532 bonds (distance) P-C4' energy: -40.958 flat angles C4'-P-C4' energy: -52.299 flat angles P-C4'-P energy: -34.619 tors. eta vs tors. theta energy: -62.961 Dist. restrs. and SS energy: 0.321 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -676.034019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.034019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.435227 (E_RNA) where: Base-Base interactions energy: -445.960 where: short stacking energy: -199.971 Base-Backbone interact. energy: -0.840 local terms energy: -229.635596 where: bonds (distance) C4'-P energy: -40.464 bonds (distance) P-C4' energy: -49.924 flat angles C4'-P-C4' energy: -48.070 flat angles P-C4'-P energy: -31.033 tors. eta vs tors. theta energy: -60.144 Dist. restrs. and SS energy: 0.401 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -680.210818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.210818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.536745 (E_RNA) where: Base-Base interactions energy: -455.236 where: short stacking energy: -204.582 Base-Backbone interact. energy: -0.626 local terms energy: -224.674296 where: bonds (distance) C4'-P energy: -42.230 bonds (distance) P-C4' energy: -41.635 flat angles C4'-P-C4' energy: -49.120 flat angles P-C4'-P energy: -30.268 tors. eta vs tors. theta energy: -61.421 Dist. restrs. and SS energy: 0.326 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -602.439495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.439495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.345894 (E_RNA) where: Base-Base interactions energy: -395.115 where: short stacking energy: -192.518 Base-Backbone interact. energy: -1.331 local terms energy: -209.899978 where: bonds (distance) C4'-P energy: -37.331 bonds (distance) P-C4' energy: -44.851 flat angles C4'-P-C4' energy: -51.031 flat angles P-C4'-P energy: -30.751 tors. eta vs tors. theta energy: -45.936 Dist. restrs. and SS energy: 3.906 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -527.166828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.166828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.565976 (E_RNA) where: Base-Base interactions energy: -344.925 where: short stacking energy: -147.478 Base-Backbone interact. energy: -0.600 local terms energy: -182.041365 where: bonds (distance) C4'-P energy: -41.013 bonds (distance) P-C4' energy: -50.862 flat angles C4'-P-C4' energy: -31.549 flat angles P-C4'-P energy: -27.086 tors. eta vs tors. theta energy: -31.531 Dist. restrs. and SS energy: 0.399 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -530.006888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.006888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.565460 (E_RNA) where: Base-Base interactions energy: -352.798 where: short stacking energy: -156.138 Base-Backbone interact. energy: 3.457 local terms energy: -184.225309 where: bonds (distance) C4'-P energy: -33.276 bonds (distance) P-C4' energy: -42.097 flat angles C4'-P-C4' energy: -34.353 flat angles P-C4'-P energy: -33.475 tors. eta vs tors. theta energy: -41.025 Dist. restrs. and SS energy: 3.559 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -514.329524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.329524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.947583 (E_RNA) where: Base-Base interactions energy: -348.319 where: short stacking energy: -151.440 Base-Backbone interact. energy: -1.437 local terms energy: -165.191557 where: bonds (distance) C4'-P energy: -31.110 bonds (distance) P-C4' energy: -22.586 flat angles C4'-P-C4' energy: -41.836 flat angles P-C4'-P energy: -30.569 tors. eta vs tors. theta energy: -39.090 Dist. restrs. and SS energy: 0.618 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -492.539685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.539685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.709129 (E_RNA) where: Base-Base interactions energy: -312.013 where: short stacking energy: -152.557 Base-Backbone interact. energy: -0.334 local terms energy: -181.362230 where: bonds (distance) C4'-P energy: -37.987 bonds (distance) P-C4' energy: -38.846 flat angles C4'-P-C4' energy: -35.917 flat angles P-C4'-P energy: -26.877 tors. eta vs tors. theta energy: -41.735 Dist. restrs. and SS energy: 1.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -444.479253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.479253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.370955 (E_RNA) where: Base-Base interactions energy: -269.229 where: short stacking energy: -136.381 Base-Backbone interact. energy: -0.685 local terms energy: -176.457058 where: bonds (distance) C4'-P energy: -47.372 bonds (distance) P-C4' energy: -32.937 flat angles C4'-P-C4' energy: -43.556 flat angles P-C4'-P energy: -20.310 tors. eta vs tors. theta energy: -32.281 Dist. restrs. and SS energy: 1.892 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -739.758288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -739.758288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.903916 (E_RNA) where: Base-Base interactions energy: -497.923 where: short stacking energy: -233.716 Base-Backbone interact. energy: -0.259 local terms energy: -241.722633 where: bonds (distance) C4'-P energy: -44.652 bonds (distance) P-C4' energy: -43.590 flat angles C4'-P-C4' energy: -47.770 flat angles P-C4'-P energy: -36.822 tors. eta vs tors. theta energy: -68.889 Dist. restrs. and SS energy: 0.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -706.695281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.695281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.763367 (E_RNA) where: Base-Base interactions energy: -479.388 where: short stacking energy: -213.055 Base-Backbone interact. energy: -2.090 local terms energy: -225.285773 where: bonds (distance) C4'-P energy: -45.641 bonds (distance) P-C4' energy: -38.870 flat angles C4'-P-C4' energy: -47.873 flat angles P-C4'-P energy: -31.479 tors. eta vs tors. theta energy: -61.422 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -688.608940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.608940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.729149 (E_RNA) where: Base-Base interactions energy: -453.748 where: short stacking energy: -222.120 Base-Backbone interact. energy: -0.478 local terms energy: -234.503108 where: bonds (distance) C4'-P energy: -44.985 bonds (distance) P-C4' energy: -45.077 flat angles C4'-P-C4' energy: -50.503 flat angles P-C4'-P energy: -26.290 tors. eta vs tors. theta energy: -67.648 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -656.890671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.890671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.152636 (E_RNA) where: Base-Base interactions energy: -434.463 where: short stacking energy: -182.572 Base-Backbone interact. energy: -0.969 local terms energy: -221.720977 where: bonds (distance) C4'-P energy: -36.250 bonds (distance) P-C4' energy: -42.127 flat angles C4'-P-C4' energy: -48.184 flat angles P-C4'-P energy: -34.109 tors. eta vs tors. theta energy: -61.051 Dist. restrs. and SS energy: 0.262 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -593.685206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.685206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.628218 (E_RNA) where: Base-Base interactions energy: -389.059 where: short stacking energy: -195.051 Base-Backbone interact. energy: -0.894 local terms energy: -206.675545 where: bonds (distance) C4'-P energy: -30.020 bonds (distance) P-C4' energy: -43.665 flat angles C4'-P-C4' energy: -43.842 flat angles P-C4'-P energy: -36.469 tors. eta vs tors. theta energy: -52.679 Dist. restrs. and SS energy: 2.943 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -579.544827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.544827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.029532 (E_RNA) where: Base-Base interactions energy: -370.971 where: short stacking energy: -171.072 Base-Backbone interact. energy: 0.356 local terms energy: -210.415067 where: bonds (distance) C4'-P energy: -40.032 bonds (distance) P-C4' energy: -41.695 flat angles C4'-P-C4' energy: -48.891 flat angles P-C4'-P energy: -27.857 tors. eta vs tors. theta energy: -51.941 Dist. restrs. and SS energy: 1.485 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -543.250325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.250325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.523746 (E_RNA) where: Base-Base interactions energy: -368.670 where: short stacking energy: -177.348 Base-Backbone interact. energy: 3.360 local terms energy: -178.213765 where: bonds (distance) C4'-P energy: -32.931 bonds (distance) P-C4' energy: -41.094 flat angles C4'-P-C4' energy: -36.207 flat angles P-C4'-P energy: -20.276 tors. eta vs tors. theta energy: -47.705 Dist. restrs. and SS energy: 0.273 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -506.936371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.936371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.765202 (E_RNA) where: Base-Base interactions energy: -324.324 where: short stacking energy: -152.890 Base-Backbone interact. energy: -0.647 local terms energy: -183.794225 where: bonds (distance) C4'-P energy: -38.676 bonds (distance) P-C4' energy: -38.368 flat angles C4'-P-C4' energy: -45.687 flat angles P-C4'-P energy: -22.930 tors. eta vs tors. theta energy: -38.133 Dist. restrs. and SS energy: 1.829 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -518.901448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.901448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.599933 (E_RNA) where: Base-Base interactions energy: -340.824 where: short stacking energy: -147.887 Base-Backbone interact. energy: 2.168 local terms energy: -180.944152 where: bonds (distance) C4'-P energy: -40.581 bonds (distance) P-C4' energy: -43.731 flat angles C4'-P-C4' energy: -46.625 flat angles P-C4'-P energy: -24.371 tors. eta vs tors. theta energy: -25.637 Dist. restrs. and SS energy: 0.698 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -478.830623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.830623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.684074 (E_RNA) where: Base-Base interactions energy: -318.330 where: short stacking energy: -148.995 Base-Backbone interact. energy: 0.740 local terms energy: -164.093915 where: bonds (distance) C4'-P energy: -43.281 bonds (distance) P-C4' energy: -25.483 flat angles C4'-P-C4' energy: -34.329 flat angles P-C4'-P energy: -23.087 tors. eta vs tors. theta energy: -37.914 Dist. restrs. and SS energy: 2.853 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -734.569995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.569995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.787186 (E_RNA) where: Base-Base interactions energy: -494.556 where: short stacking energy: -223.805 Base-Backbone interact. energy: -1.044 local terms energy: -239.187688 where: bonds (distance) C4'-P energy: -50.621 bonds (distance) P-C4' energy: -39.191 flat angles C4'-P-C4' energy: -52.304 flat angles P-C4'-P energy: -35.932 tors. eta vs tors. theta energy: -61.140 Dist. restrs. and SS energy: 0.217 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -701.723295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.723295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.450958 (E_RNA) where: Base-Base interactions energy: -463.152 where: short stacking energy: -213.923 Base-Backbone interact. energy: -1.650 local terms energy: -237.649368 where: bonds (distance) C4'-P energy: -47.617 bonds (distance) P-C4' energy: -45.393 flat angles C4'-P-C4' energy: -44.882 flat angles P-C4'-P energy: -31.315 tors. eta vs tors. theta energy: -68.443 Dist. restrs. and SS energy: 0.728 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -699.619236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.619236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.551543 (E_RNA) where: Base-Base interactions energy: -463.735 where: short stacking energy: -221.557 Base-Backbone interact. energy: -0.718 local terms energy: -236.098673 where: bonds (distance) C4'-P energy: -50.240 bonds (distance) P-C4' energy: -41.929 flat angles C4'-P-C4' energy: -43.773 flat angles P-C4'-P energy: -38.203 tors. eta vs tors. theta energy: -61.954 Dist. restrs. and SS energy: 0.932 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -619.208320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.208320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.559548 (E_RNA) where: Base-Base interactions energy: -409.429 where: short stacking energy: -187.790 Base-Backbone interact. energy: -0.643 local terms energy: -212.487912 where: bonds (distance) C4'-P energy: -41.424 bonds (distance) P-C4' energy: -42.596 flat angles C4'-P-C4' energy: -43.780 flat angles P-C4'-P energy: -31.705 tors. eta vs tors. theta energy: -52.983 Dist. restrs. and SS energy: 3.351 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -639.719064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -639.719064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.450533 (E_RNA) where: Base-Base interactions energy: -423.630 where: short stacking energy: -197.594 Base-Backbone interact. energy: -0.832 local terms energy: -215.988446 where: bonds (distance) C4'-P energy: -36.963 bonds (distance) P-C4' energy: -51.112 flat angles C4'-P-C4' energy: -42.523 flat angles P-C4'-P energy: -27.225 tors. eta vs tors. theta energy: -58.165 Dist. restrs. and SS energy: 0.731 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -577.077627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.077627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.353274 (E_RNA) where: Base-Base interactions energy: -383.484 where: short stacking energy: -179.523 Base-Backbone interact. energy: 0.511 local terms energy: -194.379582 where: bonds (distance) C4'-P energy: -40.209 bonds (distance) P-C4' energy: -36.654 flat angles C4'-P-C4' energy: -44.643 flat angles P-C4'-P energy: -25.270 tors. eta vs tors. theta energy: -47.603 Dist. restrs. and SS energy: 0.276 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -557.733584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.733584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.028215 (E_RNA) where: Base-Base interactions energy: -359.631 where: short stacking energy: -164.892 Base-Backbone interact. energy: -0.877 local terms energy: -197.519639 where: bonds (distance) C4'-P energy: -34.855 bonds (distance) P-C4' energy: -52.540 flat angles C4'-P-C4' energy: -40.030 flat angles P-C4'-P energy: -18.248 tors. eta vs tors. theta energy: -51.847 Dist. restrs. and SS energy: 0.295 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -515.863708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.863708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.470186 (E_RNA) where: Base-Base interactions energy: -317.718 where: short stacking energy: -154.287 Base-Backbone interact. energy: 0.489 local terms energy: -200.241557 where: bonds (distance) C4'-P energy: -44.527 bonds (distance) P-C4' energy: -42.368 flat angles C4'-P-C4' energy: -44.992 flat angles P-C4'-P energy: -31.107 tors. eta vs tors. theta energy: -37.248 Dist. restrs. and SS energy: 1.606 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -464.122293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.122293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.196131 (E_RNA) where: Base-Base interactions energy: -300.528 where: short stacking energy: -136.872 Base-Backbone interact. energy: -1.772 local terms energy: -163.895452 where: bonds (distance) C4'-P energy: -34.237 bonds (distance) P-C4' energy: -38.078 flat angles C4'-P-C4' energy: -43.049 flat angles P-C4'-P energy: -27.767 tors. eta vs tors. theta energy: -20.764 Dist. restrs. and SS energy: 2.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -502.140231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.140231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.813393 (E_RNA) where: Base-Base interactions energy: -327.220 where: short stacking energy: -148.312 Base-Backbone interact. energy: -1.129 local terms energy: -174.464376 where: bonds (distance) C4'-P energy: -33.992 bonds (distance) P-C4' energy: -34.210 flat angles C4'-P-C4' energy: -37.589 flat angles P-C4'-P energy: -29.206 tors. eta vs tors. theta energy: -39.467 Dist. restrs. and SS energy: 0.673 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -729.006003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.006003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.112434 (E_RNA) where: Base-Base interactions energy: -491.882 where: short stacking energy: -220.544 Base-Backbone interact. energy: 0.603 local terms energy: -237.833628 where: bonds (distance) C4'-P energy: -49.288 bonds (distance) P-C4' energy: -37.671 flat angles C4'-P-C4' energy: -53.093 flat angles P-C4'-P energy: -33.472 tors. eta vs tors. theta energy: -64.309 Dist. restrs. and SS energy: 0.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -707.957305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.957305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.246925 (E_RNA) where: Base-Base interactions energy: -481.554 where: short stacking energy: -222.450 Base-Backbone interact. energy: -0.720 local terms energy: -225.972562 where: bonds (distance) C4'-P energy: -45.678 bonds (distance) P-C4' energy: -45.315 flat angles C4'-P-C4' energy: -41.054 flat angles P-C4'-P energy: -36.326 tors. eta vs tors. theta energy: -57.600 Dist. restrs. and SS energy: 0.290 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -700.199312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.199312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.715065 (E_RNA) where: Base-Base interactions energy: -466.103 where: short stacking energy: -227.806 Base-Backbone interact. energy: 3.021 local terms energy: -237.633033 where: bonds (distance) C4'-P energy: -47.726 bonds (distance) P-C4' energy: -42.367 flat angles C4'-P-C4' energy: -49.541 flat angles P-C4'-P energy: -33.143 tors. eta vs tors. theta energy: -64.856 Dist. restrs. and SS energy: 0.516 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -607.227677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.227677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.181312 (E_RNA) where: Base-Base interactions energy: -388.442 where: short stacking energy: -186.953 Base-Backbone interact. energy: -0.970 local terms energy: -219.769167 where: bonds (distance) C4'-P energy: -41.385 bonds (distance) P-C4' energy: -41.216 flat angles C4'-P-C4' energy: -46.641 flat angles P-C4'-P energy: -33.000 tors. eta vs tors. theta energy: -57.527 Dist. restrs. and SS energy: 1.954 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -629.937262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.937262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.207536 (E_RNA) where: Base-Base interactions energy: -417.089 where: short stacking energy: -194.507 Base-Backbone interact. energy: -0.497 local terms energy: -212.620745 where: bonds (distance) C4'-P energy: -46.550 bonds (distance) P-C4' energy: -42.274 flat angles C4'-P-C4' energy: -41.967 flat angles P-C4'-P energy: -22.480 tors. eta vs tors. theta energy: -59.350 Dist. restrs. and SS energy: 0.270 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -589.047491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.047491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.390089 (E_RNA) where: Base-Base interactions energy: -386.292 where: short stacking energy: -181.558 Base-Backbone interact. energy: -1.009 local terms energy: -202.089532 where: bonds (distance) C4'-P energy: -39.706 bonds (distance) P-C4' energy: -38.399 flat angles C4'-P-C4' energy: -40.713 flat angles P-C4'-P energy: -32.751 tors. eta vs tors. theta energy: -50.520 Dist. restrs. and SS energy: 0.343 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -545.912305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.912305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.350118 (E_RNA) where: Base-Base interactions energy: -348.682 where: short stacking energy: -157.347 Base-Backbone interact. energy: 1.942 local terms energy: -199.609246 where: bonds (distance) C4'-P energy: -39.728 bonds (distance) P-C4' energy: -40.787 flat angles C4'-P-C4' energy: -42.339 flat angles P-C4'-P energy: -33.791 tors. eta vs tors. theta energy: -42.965 Dist. restrs. and SS energy: 0.438 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -532.307689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.307689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.003386 (E_RNA) where: Base-Base interactions energy: -334.721 where: short stacking energy: -161.158 Base-Backbone interact. energy: -1.199 local terms energy: -197.084252 where: bonds (distance) C4'-P energy: -35.324 bonds (distance) P-C4' energy: -44.347 flat angles C4'-P-C4' energy: -49.700 flat angles P-C4'-P energy: -29.782 tors. eta vs tors. theta energy: -37.932 Dist. restrs. and SS energy: 0.696 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -507.917598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.917598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.250129 (E_RNA) where: Base-Base interactions energy: -334.149 where: short stacking energy: -156.308 Base-Backbone interact. energy: 0.109 local terms energy: -174.210688 where: bonds (distance) C4'-P energy: -38.510 bonds (distance) P-C4' energy: -34.753 flat angles C4'-P-C4' energy: -35.649 flat angles P-C4'-P energy: -29.188 tors. eta vs tors. theta energy: -36.110 Dist. restrs. and SS energy: 0.333 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -454.351439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.351439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.663440 (E_RNA) where: Base-Base interactions energy: -281.487 where: short stacking energy: -136.745 Base-Backbone interact. energy: -0.324 local terms energy: -174.851779 where: bonds (distance) C4'-P energy: -49.329 bonds (distance) P-C4' energy: -31.904 flat angles C4'-P-C4' energy: -36.584 flat angles P-C4'-P energy: -20.078 tors. eta vs tors. theta energy: -36.956 Dist. restrs. and SS energy: 2.312 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -753.090880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.090880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.341392 (E_RNA) where: Base-Base interactions energy: -504.081 where: short stacking energy: -230.872 Base-Backbone interact. energy: -1.346 local terms energy: -247.913980 where: bonds (distance) C4'-P energy: -48.294 bonds (distance) P-C4' energy: -40.096 flat angles C4'-P-C4' energy: -51.507 flat angles P-C4'-P energy: -41.224 tors. eta vs tors. theta energy: -66.793 Dist. restrs. and SS energy: 0.251 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -709.320892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.320892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.713711 (E_RNA) where: Base-Base interactions energy: -483.895 where: short stacking energy: -206.004 Base-Backbone interact. energy: -1.666 local terms energy: -224.153512 where: bonds (distance) C4'-P energy: -42.899 bonds (distance) P-C4' energy: -45.588 flat angles C4'-P-C4' energy: -47.295 flat angles P-C4'-P energy: -34.040 tors. eta vs tors. theta energy: -54.331 Dist. restrs. and SS energy: 0.393 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -690.703210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.703210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.847674 (E_RNA) where: Base-Base interactions energy: -470.127 where: short stacking energy: -208.476 Base-Backbone interact. energy: -2.303 local terms energy: -218.417445 where: bonds (distance) C4'-P energy: -32.628 bonds (distance) P-C4' energy: -47.092 flat angles C4'-P-C4' energy: -51.928 flat angles P-C4'-P energy: -27.360 tors. eta vs tors. theta energy: -59.410 Dist. restrs. and SS energy: 0.144 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -660.921968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.921968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.001480 (E_RNA) where: Base-Base interactions energy: -436.422 where: short stacking energy: -195.289 Base-Backbone interact. energy: -1.142 local terms energy: -224.436739 where: bonds (distance) C4'-P energy: -47.406 bonds (distance) P-C4' energy: -41.995 flat angles C4'-P-C4' energy: -41.874 flat angles P-C4'-P energy: -34.655 tors. eta vs tors. theta energy: -58.507 Dist. restrs. and SS energy: 1.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -575.205642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.205642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.019075 (E_RNA) where: Base-Base interactions energy: -368.187 where: short stacking energy: -165.113 Base-Backbone interact. energy: 3.881 local terms energy: -213.712573 where: bonds (distance) C4'-P energy: -38.683 bonds (distance) P-C4' energy: -46.099 flat angles C4'-P-C4' energy: -45.253 flat angles P-C4'-P energy: -31.225 tors. eta vs tors. theta energy: -52.453 Dist. restrs. and SS energy: 2.813 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -554.908929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.908929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.401566 (E_RNA) where: Base-Base interactions energy: -353.715 where: short stacking energy: -156.693 Base-Backbone interact. energy: -1.899 local terms energy: -199.787670 where: bonds (distance) C4'-P energy: -49.961 bonds (distance) P-C4' energy: -45.264 flat angles C4'-P-C4' energy: -47.738 flat angles P-C4'-P energy: -22.430 tors. eta vs tors. theta energy: -34.394 Dist. restrs. and SS energy: 0.493 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -543.032576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.032576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.329334 (E_RNA) where: Base-Base interactions energy: -344.874 where: short stacking energy: -169.298 Base-Backbone interact. energy: -0.279 local terms energy: -199.176982 where: bonds (distance) C4'-P energy: -45.848 bonds (distance) P-C4' energy: -33.191 flat angles C4'-P-C4' energy: -43.224 flat angles P-C4'-P energy: -32.669 tors. eta vs tors. theta energy: -44.244 Dist. restrs. and SS energy: 1.297 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -534.450843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.450843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.751455 (E_RNA) where: Base-Base interactions energy: -341.108 where: short stacking energy: -156.856 Base-Backbone interact. energy: 0.198 local terms energy: -193.841400 where: bonds (distance) C4'-P energy: -40.514 bonds (distance) P-C4' energy: -42.159 flat angles C4'-P-C4' energy: -40.620 flat angles P-C4'-P energy: -22.575 tors. eta vs tors. theta energy: -47.973 Dist. restrs. and SS energy: 0.301 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -498.928793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.928793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.533063 (E_RNA) where: Base-Base interactions energy: -314.513 where: short stacking energy: -151.700 Base-Backbone interact. energy: -1.123 local terms energy: -183.896771 where: bonds (distance) C4'-P energy: -34.613 bonds (distance) P-C4' energy: -45.291 flat angles C4'-P-C4' energy: -42.295 flat angles P-C4'-P energy: -20.888 tors. eta vs tors. theta energy: -40.810 Dist. restrs. and SS energy: 0.604 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -425.417070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.417070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.015972 (E_RNA) where: Base-Base interactions energy: -276.398 where: short stacking energy: -120.166 Base-Backbone interact. energy: -0.971 local terms energy: -154.646808 where: bonds (distance) C4'-P energy: -29.142 bonds (distance) P-C4' energy: -36.910 flat angles C4'-P-C4' energy: -31.941 flat angles P-C4'-P energy: -28.341 tors. eta vs tors. theta energy: -28.312 Dist. restrs. and SS energy: 6.599 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -755.194009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.194009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.633005 (E_RNA) where: Base-Base interactions energy: -500.649 where: short stacking energy: -226.640 Base-Backbone interact. energy: 0.285 local terms energy: -255.268963 where: bonds (distance) C4'-P energy: -45.355 bonds (distance) P-C4' energy: -48.942 flat angles C4'-P-C4' energy: -60.317 flat angles P-C4'-P energy: -36.000 tors. eta vs tors. theta energy: -64.655 Dist. restrs. and SS energy: 0.439 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -713.077991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.077991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.332973 (E_RNA) where: Base-Base interactions energy: -483.101 where: short stacking energy: -203.133 Base-Backbone interact. energy: -0.598 local terms energy: -229.633908 where: bonds (distance) C4'-P energy: -42.138 bonds (distance) P-C4' energy: -40.758 flat angles C4'-P-C4' energy: -51.264 flat angles P-C4'-P energy: -31.929 tors. eta vs tors. theta energy: -63.544 Dist. restrs. and SS energy: 0.255 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -713.411786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.411786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.680533 (E_RNA) where: Base-Base interactions energy: -472.814 where: short stacking energy: -200.072 Base-Backbone interact. energy: -1.311 local terms energy: -239.555081 where: bonds (distance) C4'-P energy: -40.592 bonds (distance) P-C4' energy: -49.564 flat angles C4'-P-C4' energy: -49.896 flat angles P-C4'-P energy: -36.399 tors. eta vs tors. theta energy: -63.103 Dist. restrs. and SS energy: 0.269 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -679.691244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.691244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.929246 (E_RNA) where: Base-Base interactions energy: -449.010 where: short stacking energy: -216.230 Base-Backbone interact. energy: -0.698 local terms energy: -230.220696 where: bonds (distance) C4'-P energy: -40.246 bonds (distance) P-C4' energy: -39.916 flat angles C4'-P-C4' energy: -52.711 flat angles P-C4'-P energy: -28.415 tors. eta vs tors. theta energy: -68.933 Dist. restrs. and SS energy: 0.238 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -614.040122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.040122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.476637 (E_RNA) where: Base-Base interactions energy: -410.162 where: short stacking energy: -193.193 Base-Backbone interact. energy: -0.524 local terms energy: -203.790587 where: bonds (distance) C4'-P energy: -31.062 bonds (distance) P-C4' energy: -37.188 flat angles C4'-P-C4' energy: -50.046 flat angles P-C4'-P energy: -26.204 tors. eta vs tors. theta energy: -59.291 Dist. restrs. and SS energy: 0.437 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -553.756458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.756458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.941781 (E_RNA) where: Base-Base interactions energy: -357.519 where: short stacking energy: -171.066 Base-Backbone interact. energy: -2.675 local terms energy: -194.748075 where: bonds (distance) C4'-P energy: -34.106 bonds (distance) P-C4' energy: -47.868 flat angles C4'-P-C4' energy: -46.221 flat angles P-C4'-P energy: -29.940 tors. eta vs tors. theta energy: -36.614 Dist. restrs. and SS energy: 1.185 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -570.490295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.490295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.700117 (E_RNA) where: Base-Base interactions energy: -374.598 where: short stacking energy: -177.673 Base-Backbone interact. energy: 0.949 local terms energy: -197.050874 where: bonds (distance) C4'-P energy: -39.276 bonds (distance) P-C4' energy: -35.895 flat angles C4'-P-C4' energy: -48.026 flat angles P-C4'-P energy: -30.414 tors. eta vs tors. theta energy: -43.440 Dist. restrs. and SS energy: 0.210 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -513.491727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.491727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.776015 (E_RNA) where: Base-Base interactions energy: -322.972 where: short stacking energy: -149.947 Base-Backbone interact. energy: 0.873 local terms energy: -191.677307 where: bonds (distance) C4'-P energy: -39.071 bonds (distance) P-C4' energy: -38.405 flat angles C4'-P-C4' energy: -39.998 flat angles P-C4'-P energy: -33.405 tors. eta vs tors. theta energy: -40.798 Dist. restrs. and SS energy: 0.284 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -465.538178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.538178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.145189 (E_RNA) where: Base-Base interactions energy: -298.276 where: short stacking energy: -155.236 Base-Backbone interact. energy: 2.480 local terms energy: -171.349807 where: bonds (distance) C4'-P energy: -31.612 bonds (distance) P-C4' energy: -39.274 flat angles C4'-P-C4' energy: -38.048 flat angles P-C4'-P energy: -27.100 tors. eta vs tors. theta energy: -35.316 Dist. restrs. and SS energy: 1.607 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -469.339620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.339620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.180677 (E_RNA) where: Base-Base interactions energy: -299.062 where: short stacking energy: -132.522 Base-Backbone interact. energy: 2.665 local terms energy: -173.783792 where: bonds (distance) C4'-P energy: -38.639 bonds (distance) P-C4' energy: -37.971 flat angles C4'-P-C4' energy: -44.044 flat angles P-C4'-P energy: -22.073 tors. eta vs tors. theta energy: -31.057 Dist. restrs. and SS energy: 0.841 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -742.271032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.271032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -742.938206 (E_RNA) where: Base-Base interactions energy: -489.851 where: short stacking energy: -225.668 Base-Backbone interact. energy: -0.904 local terms energy: -252.183529 where: bonds (distance) C4'-P energy: -47.430 bonds (distance) P-C4' energy: -48.648 flat angles C4'-P-C4' energy: -51.510 flat angles P-C4'-P energy: -36.792 tors. eta vs tors. theta energy: -67.804 Dist. restrs. and SS energy: 0.667 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -717.159654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.159654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.299502 (E_RNA) where: Base-Base interactions energy: -476.758 where: short stacking energy: -199.320 Base-Backbone interact. energy: -1.484 local terms energy: -239.057844 where: bonds (distance) C4'-P energy: -49.683 bonds (distance) P-C4' energy: -46.420 flat angles C4'-P-C4' energy: -43.992 flat angles P-C4'-P energy: -36.442 tors. eta vs tors. theta energy: -62.521 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -676.708465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.708465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.974694 (E_RNA) where: Base-Base interactions energy: -455.624 where: short stacking energy: -208.392 Base-Backbone interact. energy: -1.049 local terms energy: -220.301392 where: bonds (distance) C4'-P energy: -47.514 bonds (distance) P-C4' energy: -36.842 flat angles C4'-P-C4' energy: -48.137 flat angles P-C4'-P energy: -27.761 tors. eta vs tors. theta energy: -60.047 Dist. restrs. and SS energy: 0.266 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -642.162983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.162983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.460112 (E_RNA) where: Base-Base interactions energy: -427.445 where: short stacking energy: -189.922 Base-Backbone interact. energy: -0.563 local terms energy: -214.452123 where: bonds (distance) C4'-P energy: -37.927 bonds (distance) P-C4' energy: -41.266 flat angles C4'-P-C4' energy: -44.756 flat angles P-C4'-P energy: -40.549 tors. eta vs tors. theta energy: -49.953 Dist. restrs. and SS energy: 0.297 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -623.457564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -623.457564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.214916 (E_RNA) where: Base-Base interactions energy: -402.535 where: short stacking energy: -199.223 Base-Backbone interact. energy: -0.927 local terms energy: -220.752876 where: bonds (distance) C4'-P energy: -44.955 bonds (distance) P-C4' energy: -48.738 flat angles C4'-P-C4' energy: -49.307 flat angles P-C4'-P energy: -23.727 tors. eta vs tors. theta energy: -54.025 Dist. restrs. and SS energy: 0.757 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -584.708716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.708716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.763399 (E_RNA) where: Base-Base interactions energy: -380.426 where: short stacking energy: -168.579 Base-Backbone interact. energy: -1.057 local terms energy: -204.279913 where: bonds (distance) C4'-P energy: -46.110 bonds (distance) P-C4' energy: -41.227 flat angles C4'-P-C4' energy: -45.614 flat angles P-C4'-P energy: -24.272 tors. eta vs tors. theta energy: -47.056 Dist. restrs. and SS energy: 1.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -554.541492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.541492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.027755 (E_RNA) where: Base-Base interactions energy: -362.574 where: short stacking energy: -175.086 Base-Backbone interact. energy: -0.573 local terms energy: -193.881425 where: bonds (distance) C4'-P energy: -40.034 bonds (distance) P-C4' energy: -43.177 flat angles C4'-P-C4' energy: -39.157 flat angles P-C4'-P energy: -29.734 tors. eta vs tors. theta energy: -41.779 Dist. restrs. and SS energy: 2.486 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -520.813910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.813910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.386608 (E_RNA) where: Base-Base interactions energy: -325.625 where: short stacking energy: -160.767 Base-Backbone interact. energy: -1.081 local terms energy: -194.681000 where: bonds (distance) C4'-P energy: -41.792 bonds (distance) P-C4' energy: -37.999 flat angles C4'-P-C4' energy: -40.579 flat angles P-C4'-P energy: -27.485 tors. eta vs tors. theta energy: -46.826 Dist. restrs. and SS energy: 0.573 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -489.043388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.043388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.668522 (E_RNA) where: Base-Base interactions energy: -303.807 where: short stacking energy: -137.690 Base-Backbone interact. energy: -0.849 local terms energy: -185.012798 where: bonds (distance) C4'-P energy: -44.510 bonds (distance) P-C4' energy: -43.790 flat angles C4'-P-C4' energy: -39.763 flat angles P-C4'-P energy: -27.556 tors. eta vs tors. theta energy: -29.394 Dist. restrs. and SS energy: 0.625 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -479.351505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.351505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.001912 (E_RNA) where: Base-Base interactions energy: -303.988 where: short stacking energy: -140.859 Base-Backbone interact. energy: 0.277 local terms energy: -177.291308 where: bonds (distance) C4'-P energy: -34.368 bonds (distance) P-C4' energy: -43.558 flat angles C4'-P-C4' energy: -40.626 flat angles P-C4'-P energy: -22.207 tors. eta vs tors. theta energy: -36.532 Dist. restrs. and SS energy: 1.650 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -738.958565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.958565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.327254 (E_RNA) where: Base-Base interactions energy: -503.591 where: short stacking energy: -228.837 Base-Backbone interact. energy: 0.190 local terms energy: -235.925553 where: bonds (distance) C4'-P energy: -42.202 bonds (distance) P-C4' energy: -43.991 flat angles C4'-P-C4' energy: -48.510 flat angles P-C4'-P energy: -34.857 tors. eta vs tors. theta energy: -66.366 Dist. restrs. and SS energy: 0.369 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -706.137748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.137748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.278807 (E_RNA) where: Base-Base interactions energy: -478.203 where: short stacking energy: -214.577 Base-Backbone interact. energy: -2.105 local terms energy: -225.970694 where: bonds (distance) C4'-P energy: -37.330 bonds (distance) P-C4' energy: -48.492 flat angles C4'-P-C4' energy: -48.576 flat angles P-C4'-P energy: -29.883 tors. eta vs tors. theta energy: -61.690 Dist. restrs. and SS energy: 0.141 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -702.106483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.106483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.644057 (E_RNA) where: Base-Base interactions energy: -467.295 where: short stacking energy: -215.020 Base-Backbone interact. energy: -0.373 local terms energy: -234.975934 where: bonds (distance) C4'-P energy: -50.696 bonds (distance) P-C4' energy: -44.016 flat angles C4'-P-C4' energy: -49.743 flat angles P-C4'-P energy: -26.974 tors. eta vs tors. theta energy: -63.547 Dist. restrs. and SS energy: 0.538 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -655.702920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.702920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.123563 (E_RNA) where: Base-Base interactions energy: -435.624 where: short stacking energy: -210.079 Base-Backbone interact. energy: -1.053 local terms energy: -219.446881 where: bonds (distance) C4'-P energy: -34.420 bonds (distance) P-C4' energy: -37.368 flat angles C4'-P-C4' energy: -49.471 flat angles P-C4'-P energy: -33.950 tors. eta vs tors. theta energy: -64.237 Dist. restrs. and SS energy: 0.421 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -631.938845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -631.938845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.019473 (E_RNA) where: Base-Base interactions energy: -425.290 where: short stacking energy: -179.084 Base-Backbone interact. energy: -1.304 local terms energy: -205.425337 where: bonds (distance) C4'-P energy: -34.546 bonds (distance) P-C4' energy: -40.127 flat angles C4'-P-C4' energy: -49.557 flat angles P-C4'-P energy: -30.339 tors. eta vs tors. theta energy: -50.857 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -574.745893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.745893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.180922 (E_RNA) where: Base-Base interactions energy: -377.452 where: short stacking energy: -180.634 Base-Backbone interact. energy: -0.764 local terms energy: -196.965180 where: bonds (distance) C4'-P energy: -35.582 bonds (distance) P-C4' energy: -39.315 flat angles C4'-P-C4' energy: -42.628 flat angles P-C4'-P energy: -29.040 tors. eta vs tors. theta energy: -50.400 Dist. restrs. and SS energy: 0.435 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -540.847940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.847940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.414921 (E_RNA) where: Base-Base interactions energy: -339.213 where: short stacking energy: -163.207 Base-Backbone interact. energy: -0.625 local terms energy: -201.576863 where: bonds (distance) C4'-P energy: -42.951 bonds (distance) P-C4' energy: -36.185 flat angles C4'-P-C4' energy: -44.118 flat angles P-C4'-P energy: -35.027 tors. eta vs tors. theta energy: -43.297 Dist. restrs. and SS energy: 0.567 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -518.386341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.386341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.039324 (E_RNA) where: Base-Base interactions energy: -323.002 where: short stacking energy: -154.201 Base-Backbone interact. energy: -1.336 local terms energy: -194.701924 where: bonds (distance) C4'-P energy: -45.262 bonds (distance) P-C4' energy: -38.920 flat angles C4'-P-C4' energy: -41.576 flat angles P-C4'-P energy: -27.132 tors. eta vs tors. theta energy: -41.812 Dist. restrs. and SS energy: 0.653 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -518.536212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.536212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.151034 (E_RNA) where: Base-Base interactions energy: -323.398 where: short stacking energy: -155.921 Base-Backbone interact. energy: -0.273 local terms energy: -195.479705 where: bonds (distance) C4'-P energy: -40.226 bonds (distance) P-C4' energy: -45.933 flat angles C4'-P-C4' energy: -43.944 flat angles P-C4'-P energy: -27.480 tors. eta vs tors. theta energy: -37.896 Dist. restrs. and SS energy: 0.615 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -465.914502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.914502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.165441 (E_RNA) where: Base-Base interactions energy: -311.512 where: short stacking energy: -137.087 Base-Backbone interact. energy: -1.187 local terms energy: -154.466486 where: bonds (distance) C4'-P energy: -40.667 bonds (distance) P-C4' energy: -41.903 flat angles C4'-P-C4' energy: -33.150 flat angles P-C4'-P energy: -20.771 tors. eta vs tors. theta energy: -17.976 Dist. restrs. and SS energy: 1.251 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -735.452670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.452670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.234651 (E_RNA) where: Base-Base interactions energy: -496.644 where: short stacking energy: -232.480 Base-Backbone interact. energy: -0.743 local terms energy: -238.847721 where: bonds (distance) C4'-P energy: -38.779 bonds (distance) P-C4' energy: -44.474 flat angles C4'-P-C4' energy: -50.024 flat angles P-C4'-P energy: -39.931 tors. eta vs tors. theta energy: -65.639 Dist. restrs. and SS energy: 0.782 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -705.087632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.087632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.650493 (E_RNA) where: Base-Base interactions energy: -465.053 where: short stacking energy: -205.246 Base-Backbone interact. energy: -0.366 local terms energy: -240.231506 where: bonds (distance) C4'-P energy: -47.413 bonds (distance) P-C4' energy: -55.208 flat angles C4'-P-C4' energy: -47.454 flat angles P-C4'-P energy: -29.922 tors. eta vs tors. theta energy: -60.235 Dist. restrs. and SS energy: 0.563 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -693.559090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.559090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.904617 (E_RNA) where: Base-Base interactions energy: -474.142 where: short stacking energy: -218.765 Base-Backbone interact. energy: -1.116 local terms energy: -218.646195 where: bonds (distance) C4'-P energy: -35.796 bonds (distance) P-C4' energy: -44.067 flat angles C4'-P-C4' energy: -42.009 flat angles P-C4'-P energy: -31.568 tors. eta vs tors. theta energy: -65.207 Dist. restrs. and SS energy: 0.346 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -666.426031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.426031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.088640 (E_RNA) where: Base-Base interactions energy: -457.884 where: short stacking energy: -207.087 Base-Backbone interact. energy: -0.776 local terms energy: -208.428856 where: bonds (distance) C4'-P energy: -45.417 bonds (distance) P-C4' energy: -42.628 flat angles C4'-P-C4' energy: -41.576 flat angles P-C4'-P energy: -19.230 tors. eta vs tors. theta energy: -59.577 Dist. restrs. and SS energy: 0.663 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -643.847442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.847442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.731890 (E_RNA) where: Base-Base interactions energy: -437.198 where: short stacking energy: -187.188 Base-Backbone interact. energy: -2.164 local terms energy: -205.369229 where: bonds (distance) C4'-P energy: -35.074 bonds (distance) P-C4' energy: -38.418 flat angles C4'-P-C4' energy: -44.614 flat angles P-C4'-P energy: -31.640 tors. eta vs tors. theta energy: -55.622 Dist. restrs. and SS energy: 0.884 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -554.783311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.783311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.912729 (E_RNA) where: Base-Base interactions energy: -381.713 where: short stacking energy: -181.969 Base-Backbone interact. energy: -0.122 local terms energy: -175.078276 where: bonds (distance) C4'-P energy: -35.417 bonds (distance) P-C4' energy: -36.792 flat angles C4'-P-C4' energy: -35.062 flat angles P-C4'-P energy: -23.296 tors. eta vs tors. theta energy: -44.512 Dist. restrs. and SS energy: 2.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -559.125377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.125377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.788001 (E_RNA) where: Base-Base interactions energy: -360.382 where: short stacking energy: -166.496 Base-Backbone interact. energy: -0.689 local terms energy: -198.716952 where: bonds (distance) C4'-P energy: -37.074 bonds (distance) P-C4' energy: -44.275 flat angles C4'-P-C4' energy: -40.361 flat angles P-C4'-P energy: -28.232 tors. eta vs tors. theta energy: -48.775 Dist. restrs. and SS energy: 0.663 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -538.075569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.075569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.224510 (E_RNA) where: Base-Base interactions energy: -342.743 where: short stacking energy: -157.170 Base-Backbone interact. energy: -0.062 local terms energy: -196.418931 where: bonds (distance) C4'-P energy: -41.369 bonds (distance) P-C4' energy: -45.662 flat angles C4'-P-C4' energy: -40.417 flat angles P-C4'-P energy: -27.292 tors. eta vs tors. theta energy: -41.680 Dist. restrs. and SS energy: 1.149 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -480.977618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.977618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.025931 (E_RNA) where: Base-Base interactions energy: -300.858 where: short stacking energy: -158.973 Base-Backbone interact. energy: -1.947 local terms energy: -179.220850 where: bonds (distance) C4'-P energy: -38.604 bonds (distance) P-C4' energy: -39.126 flat angles C4'-P-C4' energy: -45.205 flat angles P-C4'-P energy: -17.875 tors. eta vs tors. theta energy: -38.412 Dist. restrs. and SS energy: 1.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -467.382141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.382141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.141165 (E_RNA) where: Base-Base interactions energy: -290.347 where: short stacking energy: -125.584 Base-Backbone interact. energy: -1.724 local terms energy: -176.070652 where: bonds (distance) C4'-P energy: -36.500 bonds (distance) P-C4' energy: -42.048 flat angles C4'-P-C4' energy: -37.593 flat angles P-C4'-P energy: -27.291 tors. eta vs tors. theta energy: -32.639 Dist. restrs. and SS energy: 0.759 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -748.382732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.382732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.850091 (E_RNA) where: Base-Base interactions energy: -497.450 where: short stacking energy: -229.652 Base-Backbone interact. energy: -0.550 local terms energy: -250.849950 where: bonds (distance) C4'-P energy: -47.128 bonds (distance) P-C4' energy: -49.196 flat angles C4'-P-C4' energy: -49.924 flat angles P-C4'-P energy: -36.340 tors. eta vs tors. theta energy: -68.262 Dist. restrs. and SS energy: 0.467 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -715.552667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.552667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.030575 (E_RNA) where: Base-Base interactions energy: -467.573 where: short stacking energy: -230.320 Base-Backbone interact. energy: -1.038 local terms energy: -247.419387 where: bonds (distance) C4'-P energy: -43.579 bonds (distance) P-C4' energy: -47.670 flat angles C4'-P-C4' energy: -53.784 flat angles P-C4'-P energy: -35.146 tors. eta vs tors. theta energy: -67.240 Dist. restrs. and SS energy: 0.478 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -682.828273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.828273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.513843 (E_RNA) where: Base-Base interactions energy: -442.757 where: short stacking energy: -205.288 Base-Backbone interact. energy: -1.662 local terms energy: -239.095110 where: bonds (distance) C4'-P energy: -39.604 bonds (distance) P-C4' energy: -49.324 flat angles C4'-P-C4' energy: -43.050 flat angles P-C4'-P energy: -44.027 tors. eta vs tors. theta energy: -63.090 Dist. restrs. and SS energy: 0.686 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -683.831126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.831126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.883615 (E_RNA) where: Base-Base interactions energy: -447.493 where: short stacking energy: -210.334 Base-Backbone interact. energy: -1.195 local terms energy: -235.194822 where: bonds (distance) C4'-P energy: -44.923 bonds (distance) P-C4' energy: -52.095 flat angles C4'-P-C4' energy: -50.420 flat angles P-C4'-P energy: -33.883 tors. eta vs tors. theta energy: -53.874 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -621.603453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.603453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.130334 (E_RNA) where: Base-Base interactions energy: -416.313 where: short stacking energy: -186.052 Base-Backbone interact. energy: -1.792 local terms energy: -204.025306 where: bonds (distance) C4'-P energy: -38.896 bonds (distance) P-C4' energy: -44.605 flat angles C4'-P-C4' energy: -46.412 flat angles P-C4'-P energy: -24.837 tors. eta vs tors. theta energy: -49.275 Dist. restrs. and SS energy: 0.527 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -529.613307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.613307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.111297 (E_RNA) where: Base-Base interactions energy: -337.590 where: short stacking energy: -158.149 Base-Backbone interact. energy: -0.325 local terms energy: -192.196574 where: bonds (distance) C4'-P energy: -35.133 bonds (distance) P-C4' energy: -42.667 flat angles C4'-P-C4' energy: -39.234 flat angles P-C4'-P energy: -29.549 tors. eta vs tors. theta energy: -45.613 Dist. restrs. and SS energy: 0.498 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -569.537560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.537560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.719518 (E_RNA) where: Base-Base interactions energy: -373.575 where: short stacking energy: -173.507 Base-Backbone interact. energy: -2.664 local terms energy: -194.480897 where: bonds (distance) C4'-P energy: -40.104 bonds (distance) P-C4' energy: -41.651 flat angles C4'-P-C4' energy: -43.960 flat angles P-C4'-P energy: -24.406 tors. eta vs tors. theta energy: -44.359 Dist. restrs. and SS energy: 1.182 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -504.687538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.687538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.496927 (E_RNA) where: Base-Base interactions energy: -329.179 where: short stacking energy: -155.851 Base-Backbone interact. energy: -0.105 local terms energy: -176.212910 where: bonds (distance) C4'-P energy: -45.410 bonds (distance) P-C4' energy: -31.058 flat angles C4'-P-C4' energy: -42.539 flat angles P-C4'-P energy: -23.257 tors. eta vs tors. theta energy: -33.950 Dist. restrs. and SS energy: 0.809 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -501.769211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.769211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.943429 (E_RNA) where: Base-Base interactions energy: -316.769 where: short stacking energy: -145.617 Base-Backbone interact. energy: -1.132 local terms energy: -185.042449 where: bonds (distance) C4'-P energy: -41.082 bonds (distance) P-C4' energy: -33.782 flat angles C4'-P-C4' energy: -47.034 flat angles P-C4'-P energy: -31.663 tors. eta vs tors. theta energy: -31.480 Dist. restrs. and SS energy: 1.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -464.607579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.607579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.415807 (E_RNA) where: Base-Base interactions energy: -303.434 where: short stacking energy: -141.126 Base-Backbone interact. energy: -0.293 local terms energy: -161.689146 where: bonds (distance) C4'-P energy: -35.124 bonds (distance) P-C4' energy: -41.687 flat angles C4'-P-C4' energy: -30.650 flat angles P-C4'-P energy: -18.374 tors. eta vs tors. theta energy: -35.855 Dist. restrs. and SS energy: 0.808 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -737.554242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.554242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.772737 (E_RNA) where: Base-Base interactions energy: -494.934 where: short stacking energy: -238.716 Base-Backbone interact. energy: -1.072 local terms energy: -241.766976 where: bonds (distance) C4'-P energy: -41.624 bonds (distance) P-C4' energy: -36.872 flat angles C4'-P-C4' energy: -55.405 flat angles P-C4'-P energy: -36.945 tors. eta vs tors. theta energy: -70.922 Dist. restrs. and SS energy: 0.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -723.019333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -723.019333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.260287 (E_RNA) where: Base-Base interactions energy: -483.474 where: short stacking energy: -220.743 Base-Backbone interact. energy: -0.336 local terms energy: -239.449873 where: bonds (distance) C4'-P energy: -44.145 bonds (distance) P-C4' energy: -40.644 flat angles C4'-P-C4' energy: -50.433 flat angles P-C4'-P energy: -39.137 tors. eta vs tors. theta energy: -65.090 Dist. restrs. and SS energy: 0.241 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -678.166298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.166298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.412707 (E_RNA) where: Base-Base interactions energy: -479.246 where: short stacking energy: -204.727 Base-Backbone interact. energy: -1.766 local terms energy: -197.400508 where: bonds (distance) C4'-P energy: -40.180 bonds (distance) P-C4' energy: -30.439 flat angles C4'-P-C4' energy: -45.747 flat angles P-C4'-P energy: -23.137 tors. eta vs tors. theta energy: -57.897 Dist. restrs. and SS energy: 0.246 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -624.635078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.635078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.983044 (E_RNA) where: Base-Base interactions energy: -412.144 where: short stacking energy: -189.336 Base-Backbone interact. energy: -1.498 local terms energy: -211.340913 where: bonds (distance) C4'-P energy: -46.742 bonds (distance) P-C4' energy: -41.486 flat angles C4'-P-C4' energy: -43.651 flat angles P-C4'-P energy: -26.621 tors. eta vs tors. theta energy: -52.840 Dist. restrs. and SS energy: 0.348 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -658.721515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.721515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.160881 (E_RNA) where: Base-Base interactions energy: -448.922 where: short stacking energy: -201.969 Base-Backbone interact. energy: 3.557 local terms energy: -213.796481 where: bonds (distance) C4'-P energy: -41.484 bonds (distance) P-C4' energy: -44.975 flat angles C4'-P-C4' energy: -43.755 flat angles P-C4'-P energy: -25.037 tors. eta vs tors. theta energy: -58.546 Dist. restrs. and SS energy: 0.439 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -553.149704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.149704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.688528 (E_RNA) where: Base-Base interactions energy: -363.808 where: short stacking energy: -167.729 Base-Backbone interact. energy: -1.822 local terms energy: -188.058257 where: bonds (distance) C4'-P energy: -33.924 bonds (distance) P-C4' energy: -36.761 flat angles C4'-P-C4' energy: -43.232 flat angles P-C4'-P energy: -33.247 tors. eta vs tors. theta energy: -40.894 Dist. restrs. and SS energy: 0.539 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -538.557693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.557693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.558397 (E_RNA) where: Base-Base interactions energy: -354.205 where: short stacking energy: -171.683 Base-Backbone interact. energy: 1.430 local terms energy: -186.783576 where: bonds (distance) C4'-P energy: -39.522 bonds (distance) P-C4' energy: -43.944 flat angles C4'-P-C4' energy: -42.382 flat angles P-C4'-P energy: -17.772 tors. eta vs tors. theta energy: -43.164 Dist. restrs. and SS energy: 1.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -541.159950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.159950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.486328 (E_RNA) where: Base-Base interactions energy: -351.003 where: short stacking energy: -170.688 Base-Backbone interact. energy: -0.742 local terms energy: -189.741395 where: bonds (distance) C4'-P energy: -37.575 bonds (distance) P-C4' energy: -33.369 flat angles C4'-P-C4' energy: -46.735 flat angles P-C4'-P energy: -27.663 tors. eta vs tors. theta energy: -44.399 Dist. restrs. and SS energy: 0.326 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -502.457394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.457394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.083711 (E_RNA) where: Base-Base interactions energy: -328.300 where: short stacking energy: -154.795 Base-Backbone interact. energy: 0.375 local terms energy: -175.159359 where: bonds (distance) C4'-P energy: -35.426 bonds (distance) P-C4' energy: -37.946 flat angles C4'-P-C4' energy: -41.250 flat angles P-C4'-P energy: -23.474 tors. eta vs tors. theta energy: -37.063 Dist. restrs. and SS energy: 0.626 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -468.288455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.288455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.673329 (E_RNA) where: Base-Base interactions energy: -307.609 where: short stacking energy: -142.180 Base-Backbone interact. energy: -0.832 local terms energy: -160.232082 where: bonds (distance) C4'-P energy: -32.252 bonds (distance) P-C4' energy: -37.505 flat angles C4'-P-C4' energy: -30.540 flat angles P-C4'-P energy: -27.418 tors. eta vs tors. theta energy: -32.517 Dist. restrs. and SS energy: 0.385 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -735.567002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.567002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.647870 (E_RNA) where: Base-Base interactions energy: -484.510 where: short stacking energy: -200.727 Base-Backbone interact. energy: -0.629 local terms energy: -250.508385 where: bonds (distance) C4'-P energy: -43.739 bonds (distance) P-C4' energy: -48.843 flat angles C4'-P-C4' energy: -54.907 flat angles P-C4'-P energy: -38.216 tors. eta vs tors. theta energy: -64.803 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -725.408360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.408360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.617048 (E_RNA) where: Base-Base interactions energy: -489.961 where: short stacking energy: -232.397 Base-Backbone interact. energy: 0.913 local terms energy: -236.569087 where: bonds (distance) C4'-P energy: -37.999 bonds (distance) P-C4' energy: -50.725 flat angles C4'-P-C4' energy: -51.882 flat angles P-C4'-P energy: -33.614 tors. eta vs tors. theta energy: -62.350 Dist. restrs. and SS energy: 0.209 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -686.548112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.548112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.834431 (E_RNA) where: Base-Base interactions energy: -464.929 where: short stacking energy: -214.410 Base-Backbone interact. energy: -2.017 local terms energy: -219.888339 where: bonds (distance) C4'-P energy: -40.254 bonds (distance) P-C4' energy: -44.094 flat angles C4'-P-C4' energy: -48.263 flat angles P-C4'-P energy: -25.450 tors. eta vs tors. theta energy: -61.827 Dist. restrs. and SS energy: 0.286 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -648.601848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.601848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.933743 (E_RNA) where: Base-Base interactions energy: -429.000 where: short stacking energy: -182.008 Base-Backbone interact. energy: -1.217 local terms energy: -218.716737 where: bonds (distance) C4'-P energy: -43.886 bonds (distance) P-C4' energy: -44.285 flat angles C4'-P-C4' energy: -49.017 flat angles P-C4'-P energy: -29.265 tors. eta vs tors. theta energy: -52.264 Dist. restrs. and SS energy: 0.332 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -574.896202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.896202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.187060 (E_RNA) where: Base-Base interactions energy: -370.896 where: short stacking energy: -184.320 Base-Backbone interact. energy: -0.443 local terms energy: -203.848438 where: bonds (distance) C4'-P energy: -42.680 bonds (distance) P-C4' energy: -35.175 flat angles C4'-P-C4' energy: -45.054 flat angles P-C4'-P energy: -23.193 tors. eta vs tors. theta energy: -57.747 Dist. restrs. and SS energy: 0.291 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -611.159073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.159073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -612.119628 (E_RNA) where: Base-Base interactions energy: -392.933 where: short stacking energy: -187.686 Base-Backbone interact. energy: -1.223 local terms energy: -217.963797 where: bonds (distance) C4'-P energy: -34.641 bonds (distance) P-C4' energy: -49.937 flat angles C4'-P-C4' energy: -47.643 flat angles P-C4'-P energy: -29.558 tors. eta vs tors. theta energy: -56.185 Dist. restrs. and SS energy: 0.961 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -549.879245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.879245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.165022 (E_RNA) where: Base-Base interactions energy: -339.747 where: short stacking energy: -163.316 Base-Backbone interact. energy: -1.310 local terms energy: -209.108975 where: bonds (distance) C4'-P energy: -39.046 bonds (distance) P-C4' energy: -42.882 flat angles C4'-P-C4' energy: -51.009 flat angles P-C4'-P energy: -35.087 tors. eta vs tors. theta energy: -41.086 Dist. restrs. and SS energy: 0.286 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -526.976751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.976751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.129087 (E_RNA) where: Base-Base interactions energy: -347.723 where: short stacking energy: -168.144 Base-Backbone interact. energy: 0.246 local terms energy: -179.651597 where: bonds (distance) C4'-P energy: -26.384 bonds (distance) P-C4' energy: -41.755 flat angles C4'-P-C4' energy: -39.428 flat angles P-C4'-P energy: -30.231 tors. eta vs tors. theta energy: -41.854 Dist. restrs. and SS energy: 0.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -489.193171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.193171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.446422 (E_RNA) where: Base-Base interactions energy: -318.212 where: short stacking energy: -161.818 Base-Backbone interact. energy: -0.236 local terms energy: -170.998269 where: bonds (distance) C4'-P energy: -43.863 bonds (distance) P-C4' energy: -34.057 flat angles C4'-P-C4' energy: -42.643 flat angles P-C4'-P energy: -21.912 tors. eta vs tors. theta energy: -28.523 Dist. restrs. and SS energy: 0.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -474.152953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.152953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.965050 (E_RNA) where: Base-Base interactions energy: -307.007 where: short stacking energy: -146.773 Base-Backbone interact. energy: -0.348 local terms energy: -169.610037 where: bonds (distance) C4'-P energy: -34.723 bonds (distance) P-C4' energy: -40.816 flat angles C4'-P-C4' energy: -41.241 flat angles P-C4'-P energy: -22.364 tors. eta vs tors. theta energy: -30.466 Dist. restrs. and SS energy: 2.812 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -748.906220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.906220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.992904 (E_RNA) where: Base-Base interactions energy: -505.953 where: short stacking energy: -217.693 Base-Backbone interact. energy: -2.173 local terms energy: -240.867128 where: bonds (distance) C4'-P energy: -49.130 bonds (distance) P-C4' energy: -50.581 flat angles C4'-P-C4' energy: -45.229 flat angles P-C4'-P energy: -30.706 tors. eta vs tors. theta energy: -65.222 Dist. restrs. and SS energy: 0.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -719.280674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.280674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.586896 (E_RNA) where: Base-Base interactions energy: -490.022 where: short stacking energy: -216.907 Base-Backbone interact. energy: 1.983 local terms energy: -231.547217 where: bonds (distance) C4'-P energy: -41.838 bonds (distance) P-C4' energy: -43.330 flat angles C4'-P-C4' energy: -48.424 flat angles P-C4'-P energy: -35.564 tors. eta vs tors. theta energy: -62.392 Dist. restrs. and SS energy: 0.306 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -666.344577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.344577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.849699 (E_RNA) where: Base-Base interactions energy: -447.922 where: short stacking energy: -200.567 Base-Backbone interact. energy: 0.625 local terms energy: -219.551889 where: bonds (distance) C4'-P energy: -34.612 bonds (distance) P-C4' energy: -44.997 flat angles C4'-P-C4' energy: -53.077 flat angles P-C4'-P energy: -33.833 tors. eta vs tors. theta energy: -53.032 Dist. restrs. and SS energy: 0.505 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -668.924185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.924185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.623332 (E_RNA) where: Base-Base interactions energy: -451.423 where: short stacking energy: -218.784 Base-Backbone interact. energy: -0.782 local terms energy: -217.419228 where: bonds (distance) C4'-P energy: -37.831 bonds (distance) P-C4' energy: -39.838 flat angles C4'-P-C4' energy: -49.404 flat angles P-C4'-P energy: -31.133 tors. eta vs tors. theta energy: -59.214 Dist. restrs. and SS energy: 0.699 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -605.715505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.715505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.962068 (E_RNA) where: Base-Base interactions energy: -385.160 where: short stacking energy: -186.828 Base-Backbone interact. energy: 0.716 local terms energy: -221.518983 where: bonds (distance) C4'-P energy: -40.928 bonds (distance) P-C4' energy: -38.877 flat angles C4'-P-C4' energy: -50.064 flat angles P-C4'-P energy: -35.057 tors. eta vs tors. theta energy: -56.592 Dist. restrs. and SS energy: 0.247 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -584.953574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.953574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.614386 (E_RNA) where: Base-Base interactions energy: -385.867 where: short stacking energy: -170.793 Base-Backbone interact. energy: -0.939 local terms energy: -198.808367 where: bonds (distance) C4'-P energy: -35.651 bonds (distance) P-C4' energy: -33.793 flat angles C4'-P-C4' energy: -45.822 flat angles P-C4'-P energy: -33.132 tors. eta vs tors. theta energy: -50.410 Dist. restrs. and SS energy: 0.661 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -552.820861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.820861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.662017 (E_RNA) where: Base-Base interactions energy: -365.167 where: short stacking energy: -177.936 Base-Backbone interact. energy: 1.255 local terms energy: -189.749689 where: bonds (distance) C4'-P energy: -45.151 bonds (distance) P-C4' energy: -42.240 flat angles C4'-P-C4' energy: -41.940 flat angles P-C4'-P energy: -13.466 tors. eta vs tors. theta energy: -46.952 Dist. restrs. and SS energy: 0.841 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -500.108057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.108057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.179147 (E_RNA) where: Base-Base interactions energy: -312.062 where: short stacking energy: -144.258 Base-Backbone interact. energy: -0.190 local terms energy: -189.927768 where: bonds (distance) C4'-P energy: -31.798 bonds (distance) P-C4' energy: -43.793 flat angles C4'-P-C4' energy: -41.326 flat angles P-C4'-P energy: -29.235 tors. eta vs tors. theta energy: -43.776 Dist. restrs. and SS energy: 2.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -488.380709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.380709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.179154 (E_RNA) where: Base-Base interactions energy: -313.498 where: short stacking energy: -131.487 Base-Backbone interact. energy: -0.479 local terms energy: -175.202875 where: bonds (distance) C4'-P energy: -38.747 bonds (distance) P-C4' energy: -39.923 flat angles C4'-P-C4' energy: -37.381 flat angles P-C4'-P energy: -27.227 tors. eta vs tors. theta energy: -31.926 Dist. restrs. and SS energy: 0.798 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -482.260299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.260299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.747461 (E_RNA) where: Base-Base interactions energy: -304.870 where: short stacking energy: -145.193 Base-Backbone interact. energy: 1.557 local terms energy: -180.434313 where: bonds (distance) C4'-P energy: -43.899 bonds (distance) P-C4' energy: -38.415 flat angles C4'-P-C4' energy: -42.990 flat angles P-C4'-P energy: -25.031 tors. eta vs tors. theta energy: -30.099 Dist. restrs. and SS energy: 1.487 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -716.994250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.994250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.000835 (E_RNA) where: Base-Base interactions energy: -498.310 where: short stacking energy: -226.846 Base-Backbone interact. energy: 2.226 local terms energy: -220.917313 where: bonds (distance) C4'-P energy: -42.203 bonds (distance) P-C4' energy: -30.911 flat angles C4'-P-C4' energy: -46.033 flat angles P-C4'-P energy: -34.725 tors. eta vs tors. theta energy: -67.045 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -727.098588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.098588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.666105 (E_RNA) where: Base-Base interactions energy: -493.861 where: short stacking energy: -212.475 Base-Backbone interact. energy: -1.193 local terms energy: -232.612049 where: bonds (distance) C4'-P energy: -41.131 bonds (distance) P-C4' energy: -43.637 flat angles C4'-P-C4' energy: -46.946 flat angles P-C4'-P energy: -37.480 tors. eta vs tors. theta energy: -63.418 Dist. restrs. and SS energy: 0.568 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -692.269501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.269501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.489516 (E_RNA) where: Base-Base interactions energy: -457.558 where: short stacking energy: -223.742 Base-Backbone interact. energy: -1.753 local terms energy: -233.178982 where: bonds (distance) C4'-P energy: -45.808 bonds (distance) P-C4' energy: -46.426 flat angles C4'-P-C4' energy: -46.857 flat angles P-C4'-P energy: -32.336 tors. eta vs tors. theta energy: -61.751 Dist. restrs. and SS energy: 0.220 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -641.017951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -641.017951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -641.336916 (E_RNA) where: Base-Base interactions energy: -429.894 where: short stacking energy: -185.842 Base-Backbone interact. energy: -0.915 local terms energy: -210.527908 where: bonds (distance) C4'-P energy: -44.919 bonds (distance) P-C4' energy: -44.039 flat angles C4'-P-C4' energy: -43.325 flat angles P-C4'-P energy: -25.721 tors. eta vs tors. theta energy: -52.523 Dist. restrs. and SS energy: 0.319 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -598.376556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.376556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.618258 (E_RNA) where: Base-Base interactions energy: -397.993 where: short stacking energy: -176.490 Base-Backbone interact. energy: -0.355 local terms energy: -202.270844 where: bonds (distance) C4'-P energy: -42.389 bonds (distance) P-C4' energy: -34.094 flat angles C4'-P-C4' energy: -46.842 flat angles P-C4'-P energy: -32.139 tors. eta vs tors. theta energy: -46.806 Dist. restrs. and SS energy: 2.242 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -585.456849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.456849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.887231 (E_RNA) where: Base-Base interactions energy: -372.583 where: short stacking energy: -176.016 Base-Backbone interact. energy: -1.642 local terms energy: -211.662758 where: bonds (distance) C4'-P energy: -33.790 bonds (distance) P-C4' energy: -46.727 flat angles C4'-P-C4' energy: -48.184 flat angles P-C4'-P energy: -32.837 tors. eta vs tors. theta energy: -50.124 Dist. restrs. and SS energy: 0.430 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -534.064830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.064830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.481619 (E_RNA) where: Base-Base interactions energy: -342.012 where: short stacking energy: -157.307 Base-Backbone interact. energy: -0.018 local terms energy: -192.452271 where: bonds (distance) C4'-P energy: -35.058 bonds (distance) P-C4' energy: -43.740 flat angles C4'-P-C4' energy: -37.184 flat angles P-C4'-P energy: -36.587 tors. eta vs tors. theta energy: -39.883 Dist. restrs. and SS energy: 0.417 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -506.274697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.274697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.531782 (E_RNA) where: Base-Base interactions energy: -335.943 where: short stacking energy: -167.149 Base-Backbone interact. energy: -0.615 local terms energy: -169.973749 where: bonds (distance) C4'-P energy: -32.440 bonds (distance) P-C4' energy: -36.825 flat angles C4'-P-C4' energy: -39.813 flat angles P-C4'-P energy: -19.993 tors. eta vs tors. theta energy: -40.902 Dist. restrs. and SS energy: 0.257 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -473.590994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.590994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.111662 (E_RNA) where: Base-Base interactions energy: -306.322 where: short stacking energy: -127.626 Base-Backbone interact. energy: -0.343 local terms energy: -168.447179 where: bonds (distance) C4'-P energy: -44.304 bonds (distance) P-C4' energy: -35.450 flat angles C4'-P-C4' energy: -34.372 flat angles P-C4'-P energy: -23.811 tors. eta vs tors. theta energy: -30.511 Dist. restrs. and SS energy: 1.521 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -471.924357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.924357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.337943 (E_RNA) where: Base-Base interactions energy: -296.388 where: short stacking energy: -122.954 Base-Backbone interact. energy: -0.757 local terms energy: -176.193110 where: bonds (distance) C4'-P energy: -36.896 bonds (distance) P-C4' energy: -41.880 flat angles C4'-P-C4' energy: -33.136 flat angles P-C4'-P energy: -27.945 tors. eta vs tors. theta energy: -36.336 Dist. restrs. and SS energy: 1.414 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -725.403347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.403347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.457539 (E_RNA) where: Base-Base interactions energy: -491.691 where: short stacking energy: -207.295 Base-Backbone interact. energy: 2.317 local terms energy: -236.083351 where: bonds (distance) C4'-P energy: -45.899 bonds (distance) P-C4' energy: -52.753 flat angles C4'-P-C4' energy: -48.293 flat angles P-C4'-P energy: -32.731 tors. eta vs tors. theta energy: -56.408 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -721.990336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.990336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.094358 (E_RNA) where: Base-Base interactions energy: -486.790 where: short stacking energy: -202.297 Base-Backbone interact. energy: -0.539 local terms energy: -234.765824 where: bonds (distance) C4'-P energy: -41.002 bonds (distance) P-C4' energy: -46.024 flat angles C4'-P-C4' energy: -50.804 flat angles P-C4'-P energy: -37.993 tors. eta vs tors. theta energy: -58.943 Dist. restrs. and SS energy: 0.104 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -682.669193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.669193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.822556 (E_RNA) where: Base-Base interactions energy: -454.087 where: short stacking energy: -216.999 Base-Backbone interact. energy: -1.341 local terms energy: -227.394838 where: bonds (distance) C4'-P energy: -38.226 bonds (distance) P-C4' energy: -49.279 flat angles C4'-P-C4' energy: -47.396 flat angles P-C4'-P energy: -30.291 tors. eta vs tors. theta energy: -62.204 Dist. restrs. and SS energy: 0.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -653.941071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.941071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.364742 (E_RNA) where: Base-Base interactions energy: -446.262 where: short stacking energy: -202.082 Base-Backbone interact. energy: 0.359 local terms energy: -208.462042 where: bonds (distance) C4'-P energy: -41.638 bonds (distance) P-C4' energy: -38.732 flat angles C4'-P-C4' energy: -42.073 flat angles P-C4'-P energy: -28.043 tors. eta vs tors. theta energy: -57.976 Dist. restrs. and SS energy: 0.424 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -608.017257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.017257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.477626 (E_RNA) where: Base-Base interactions energy: -414.936 where: short stacking energy: -199.596 Base-Backbone interact. energy: -0.310 local terms energy: -193.231470 where: bonds (distance) C4'-P energy: -39.537 bonds (distance) P-C4' energy: -40.479 flat angles C4'-P-C4' energy: -43.698 flat angles P-C4'-P energy: -16.886 tors. eta vs tors. theta energy: -52.631 Dist. restrs. and SS energy: 0.460 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -613.189902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.189902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.327082 (E_RNA) where: Base-Base interactions energy: -409.630 where: short stacking energy: -186.261 Base-Backbone interact. energy: 1.284 local terms energy: -204.980719 where: bonds (distance) C4'-P energy: -40.660 bonds (distance) P-C4' energy: -40.136 flat angles C4'-P-C4' energy: -43.615 flat angles P-C4'-P energy: -25.313 tors. eta vs tors. theta energy: -55.257 Dist. restrs. and SS energy: 0.137 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -525.462722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.462722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.997591 (E_RNA) where: Base-Base interactions energy: -330.685 where: short stacking energy: -152.562 Base-Backbone interact. energy: -1.025 local terms energy: -194.287582 where: bonds (distance) C4'-P energy: -42.484 bonds (distance) P-C4' energy: -42.774 flat angles C4'-P-C4' energy: -35.870 flat angles P-C4'-P energy: -33.241 tors. eta vs tors. theta energy: -39.918 Dist. restrs. and SS energy: 0.535 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -520.349668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.349668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.654123 (E_RNA) where: Base-Base interactions energy: -334.648 where: short stacking energy: -157.114 Base-Backbone interact. energy: 0.846 local terms energy: -186.852575 where: bonds (distance) C4'-P energy: -36.487 bonds (distance) P-C4' energy: -41.542 flat angles C4'-P-C4' energy: -33.683 flat angles P-C4'-P energy: -29.643 tors. eta vs tors. theta energy: -45.497 Dist. restrs. and SS energy: 0.304 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -485.581656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.581656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.716663 (E_RNA) where: Base-Base interactions energy: -318.733 where: short stacking energy: -154.442 Base-Backbone interact. energy: -0.948 local terms energy: -166.035238 where: bonds (distance) C4'-P energy: -33.638 bonds (distance) P-C4' energy: -34.528 flat angles C4'-P-C4' energy: -34.036 flat angles P-C4'-P energy: -32.332 tors. eta vs tors. theta energy: -31.501 Dist. restrs. and SS energy: 0.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -487.584223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.584223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.006431 (E_RNA) where: Base-Base interactions energy: -329.962 where: short stacking energy: -145.302 Base-Backbone interact. energy: -1.125 local terms energy: -156.918993 where: bonds (distance) C4'-P energy: -26.534 bonds (distance) P-C4' energy: -30.028 flat angles C4'-P-C4' energy: -44.154 flat angles P-C4'-P energy: -23.529 tors. eta vs tors. theta energy: -32.674 Dist. restrs. and SS energy: 0.422 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -742.310798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.310798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -742.426470 (E_RNA) where: Base-Base interactions energy: -490.134 where: short stacking energy: -214.393 Base-Backbone interact. energy: -2.523 local terms energy: -249.769314 where: bonds (distance) C4'-P energy: -38.690 bonds (distance) P-C4' energy: -47.995 flat angles C4'-P-C4' energy: -57.024 flat angles P-C4'-P energy: -37.869 tors. eta vs tors. theta energy: -68.192 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -718.699772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.699772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.842937 (E_RNA) where: Base-Base interactions energy: -474.180 where: short stacking energy: -204.650 Base-Backbone interact. energy: -1.302 local terms energy: -244.361261 where: bonds (distance) C4'-P energy: -46.198 bonds (distance) P-C4' energy: -50.696 flat angles C4'-P-C4' energy: -48.087 flat angles P-C4'-P energy: -33.077 tors. eta vs tors. theta energy: -66.304 Dist. restrs. and SS energy: 1.143 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -708.888269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.888269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.990309 (E_RNA) where: Base-Base interactions energy: -469.567 where: short stacking energy: -221.036 Base-Backbone interact. energy: -1.928 local terms energy: -237.496057 where: bonds (distance) C4'-P energy: -40.832 bonds (distance) P-C4' energy: -47.212 flat angles C4'-P-C4' energy: -50.775 flat angles P-C4'-P energy: -31.948 tors. eta vs tors. theta energy: -66.730 Dist. restrs. and SS energy: 0.102 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -678.344617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.344617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.513420 (E_RNA) where: Base-Base interactions energy: -462.644 where: short stacking energy: -198.913 Base-Backbone interact. energy: -0.951 local terms energy: -214.918305 where: bonds (distance) C4'-P energy: -38.622 bonds (distance) P-C4' energy: -44.813 flat angles C4'-P-C4' energy: -43.828 flat angles P-C4'-P energy: -27.878 tors. eta vs tors. theta energy: -59.779 Dist. restrs. and SS energy: 0.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -633.426418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.426418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.741015 (E_RNA) where: Base-Base interactions energy: -425.024 where: short stacking energy: -209.635 Base-Backbone interact. energy: -0.466 local terms energy: -208.250936 where: bonds (distance) C4'-P energy: -38.689 bonds (distance) P-C4' energy: -37.437 flat angles C4'-P-C4' energy: -45.219 flat angles P-C4'-P energy: -28.714 tors. eta vs tors. theta energy: -58.192 Dist. restrs. and SS energy: 0.315 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -592.919327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.919327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.612955 (E_RNA) where: Base-Base interactions energy: -398.231 where: short stacking energy: -188.859 Base-Backbone interact. energy: 0.208 local terms energy: -195.590453 where: bonds (distance) C4'-P energy: -37.514 bonds (distance) P-C4' energy: -35.401 flat angles C4'-P-C4' energy: -46.746 flat angles P-C4'-P energy: -32.413 tors. eta vs tors. theta energy: -43.516 Dist. restrs. and SS energy: 0.694 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -564.863818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.863818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.594562 (E_RNA) where: Base-Base interactions energy: -365.443 where: short stacking energy: -177.551 Base-Backbone interact. energy: 1.208 local terms energy: -201.359586 where: bonds (distance) C4'-P energy: -44.910 bonds (distance) P-C4' energy: -36.542 flat angles C4'-P-C4' energy: -45.523 flat angles P-C4'-P energy: -25.826 tors. eta vs tors. theta energy: -48.558 Dist. restrs. and SS energy: 0.731 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -493.539787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.539787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.359207 (E_RNA) where: Base-Base interactions energy: -328.165 where: short stacking energy: -146.245 Base-Backbone interact. energy: 0.367 local terms energy: -166.560880 where: bonds (distance) C4'-P energy: -39.115 bonds (distance) P-C4' energy: -43.033 flat angles C4'-P-C4' energy: -33.692 flat angles P-C4'-P energy: -17.899 tors. eta vs tors. theta energy: -32.822 Dist. restrs. and SS energy: 0.819 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -479.191999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.191999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.753124 (E_RNA) where: Base-Base interactions energy: -295.341 where: short stacking energy: -141.630 Base-Backbone interact. energy: 0.053 local terms energy: -184.465203 where: bonds (distance) C4'-P energy: -32.022 bonds (distance) P-C4' energy: -46.629 flat angles C4'-P-C4' energy: -39.567 flat angles P-C4'-P energy: -34.439 tors. eta vs tors. theta energy: -31.808 Dist. restrs. and SS energy: 0.561 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -457.450680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.450680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.759199 (E_RNA) where: Base-Base interactions energy: -305.491 where: short stacking energy: -136.908 Base-Backbone interact. energy: -1.791 local terms energy: -150.477103 where: bonds (distance) C4'-P energy: -17.761 bonds (distance) P-C4' energy: -42.394 flat angles C4'-P-C4' energy: -37.257 flat angles P-C4'-P energy: -23.776 tors. eta vs tors. theta energy: -29.289 Dist. restrs. and SS energy: 0.309 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -732.272722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.272722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.489237 (E_RNA) where: Base-Base interactions energy: -495.766 where: short stacking energy: -209.193 Base-Backbone interact. energy: -0.552 local terms energy: -236.171265 where: bonds (distance) C4'-P energy: -44.185 bonds (distance) P-C4' energy: -43.876 flat angles C4'-P-C4' energy: -52.992 flat angles P-C4'-P energy: -33.398 tors. eta vs tors. theta energy: -61.721 Dist. restrs. and SS energy: 0.217 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -714.264537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.264537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.482324 (E_RNA) where: Base-Base interactions energy: -466.730 where: short stacking energy: -205.966 Base-Backbone interact. energy: 0.582 local terms energy: -248.334327 where: bonds (distance) C4'-P energy: -50.218 bonds (distance) P-C4' energy: -50.325 flat angles C4'-P-C4' energy: -48.477 flat angles P-C4'-P energy: -39.122 tors. eta vs tors. theta energy: -60.192 Dist. restrs. and SS energy: 0.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -696.082049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.082049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.577020 (E_RNA) where: Base-Base interactions energy: -479.168 where: short stacking energy: -215.568 Base-Backbone interact. energy: -0.656 local terms energy: -217.752772 where: bonds (distance) C4'-P energy: -34.975 bonds (distance) P-C4' energy: -40.831 flat angles C4'-P-C4' energy: -55.051 flat angles P-C4'-P energy: -33.363 tors. eta vs tors. theta energy: -53.532 Dist. restrs. and SS energy: 1.495 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -663.607347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.607347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.848129 (E_RNA) where: Base-Base interactions energy: -448.105 where: short stacking energy: -202.191 Base-Backbone interact. energy: -0.514 local terms energy: -215.229054 where: bonds (distance) C4'-P energy: -34.352 bonds (distance) P-C4' energy: -40.955 flat angles C4'-P-C4' energy: -44.491 flat angles P-C4'-P energy: -33.376 tors. eta vs tors. theta energy: -62.055 Dist. restrs. and SS energy: 0.241 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -626.628875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.628875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.738345 (E_RNA) where: Base-Base interactions energy: -429.540 where: short stacking energy: -176.140 Base-Backbone interact. energy: -0.936 local terms energy: -196.262554 where: bonds (distance) C4'-P energy: -30.883 bonds (distance) P-C4' energy: -44.562 flat angles C4'-P-C4' energy: -40.053 flat angles P-C4'-P energy: -37.034 tors. eta vs tors. theta energy: -43.730 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -603.123435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.123435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.668082 (E_RNA) where: Base-Base interactions energy: -394.374 where: short stacking energy: -178.700 Base-Backbone interact. energy: 2.589 local terms energy: -211.883351 where: bonds (distance) C4'-P energy: -36.853 bonds (distance) P-C4' energy: -37.552 flat angles C4'-P-C4' energy: -46.452 flat angles P-C4'-P energy: -40.273 tors. eta vs tors. theta energy: -50.753 Dist. restrs. and SS energy: 0.545 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -540.180472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.180472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.352451 (E_RNA) where: Base-Base interactions energy: -344.974 where: short stacking energy: -158.270 Base-Backbone interact. energy: -0.328 local terms energy: -196.050518 where: bonds (distance) C4'-P energy: -38.693 bonds (distance) P-C4' energy: -47.885 flat angles C4'-P-C4' energy: -38.388 flat angles P-C4'-P energy: -27.669 tors. eta vs tors. theta energy: -43.416 Dist. restrs. and SS energy: 1.172 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -523.208050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.208050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.481895 (E_RNA) where: Base-Base interactions energy: -338.813 where: short stacking energy: -164.660 Base-Backbone interact. energy: -1.124 local terms energy: -183.545139 where: bonds (distance) C4'-P energy: -35.330 bonds (distance) P-C4' energy: -39.334 flat angles C4'-P-C4' energy: -36.403 flat angles P-C4'-P energy: -27.569 tors. eta vs tors. theta energy: -44.909 Dist. restrs. and SS energy: 0.274 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -495.522394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.522394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.155321 (E_RNA) where: Base-Base interactions energy: -324.811 where: short stacking energy: -138.823 Base-Backbone interact. energy: -1.062 local terms energy: -170.281836 where: bonds (distance) C4'-P energy: -39.005 bonds (distance) P-C4' energy: -30.934 flat angles C4'-P-C4' energy: -40.555 flat angles P-C4'-P energy: -27.217 tors. eta vs tors. theta energy: -32.571 Dist. restrs. and SS energy: 0.633 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -465.707621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.707621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.396137 (E_RNA) where: Base-Base interactions energy: -307.720 where: short stacking energy: -139.541 Base-Backbone interact. energy: 1.699 local terms energy: -160.374970 where: bonds (distance) C4'-P energy: -27.238 bonds (distance) P-C4' energy: -33.618 flat angles C4'-P-C4' energy: -42.193 flat angles P-C4'-P energy: -22.841 tors. eta vs tors. theta energy: -34.484 Dist. restrs. and SS energy: 0.689 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -743.543612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -743.543612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.860984 (E_RNA) where: Base-Base interactions energy: -505.638 where: short stacking energy: -226.480 Base-Backbone interact. energy: 0.185 local terms energy: -238.407718 where: bonds (distance) C4'-P energy: -43.302 bonds (distance) P-C4' energy: -44.250 flat angles C4'-P-C4' energy: -45.570 flat angles P-C4'-P energy: -36.458 tors. eta vs tors. theta energy: -68.828 Dist. restrs. and SS energy: 0.317 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -703.216881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.216881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.229948 (E_RNA) where: Base-Base interactions energy: -469.753 where: short stacking energy: -208.397 Base-Backbone interact. energy: -0.730 local terms energy: -232.746892 where: bonds (distance) C4'-P energy: -42.048 bonds (distance) P-C4' energy: -45.212 flat angles C4'-P-C4' energy: -48.590 flat angles P-C4'-P energy: -33.054 tors. eta vs tors. theta energy: -63.843 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -696.129297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.129297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.550660 (E_RNA) where: Base-Base interactions energy: -478.117 where: short stacking energy: -217.250 Base-Backbone interact. energy: -1.292 local terms energy: -217.141329 where: bonds (distance) C4'-P energy: -42.781 bonds (distance) P-C4' energy: -42.112 flat angles C4'-P-C4' energy: -41.778 flat angles P-C4'-P energy: -32.134 tors. eta vs tors. theta energy: -58.336 Dist. restrs. and SS energy: 0.421 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -679.166566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.166566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.573809 (E_RNA) where: Base-Base interactions energy: -461.521 where: short stacking energy: -212.366 Base-Backbone interact. energy: 0.257 local terms energy: -218.309837 where: bonds (distance) C4'-P energy: -40.880 bonds (distance) P-C4' energy: -50.128 flat angles C4'-P-C4' energy: -40.139 flat angles P-C4'-P energy: -28.688 tors. eta vs tors. theta energy: -58.475 Dist. restrs. and SS energy: 0.407 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -603.562323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.562323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.613566 (E_RNA) where: Base-Base interactions energy: -401.264 where: short stacking energy: -175.079 Base-Backbone interact. energy: -0.190 local terms energy: -208.159941 where: bonds (distance) C4'-P energy: -42.097 bonds (distance) P-C4' energy: -42.873 flat angles C4'-P-C4' energy: -49.649 flat angles P-C4'-P energy: -31.246 tors. eta vs tors. theta energy: -42.296 Dist. restrs. and SS energy: 6.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -620.528790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -620.528790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.857157 (E_RNA) where: Base-Base interactions energy: -412.867 where: short stacking energy: -191.483 Base-Backbone interact. energy: -0.884 local terms energy: -207.106085 where: bonds (distance) C4'-P energy: -34.289 bonds (distance) P-C4' energy: -44.585 flat angles C4'-P-C4' energy: -44.269 flat angles P-C4'-P energy: -27.236 tors. eta vs tors. theta energy: -56.727 Dist. restrs. and SS energy: 0.328 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -531.239784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.239784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.785099 (E_RNA) where: Base-Base interactions energy: -343.694 where: short stacking energy: -164.711 Base-Backbone interact. energy: -2.389 local terms energy: -185.702089 where: bonds (distance) C4'-P energy: -40.820 bonds (distance) P-C4' energy: -36.696 flat angles C4'-P-C4' energy: -40.373 flat angles P-C4'-P energy: -26.400 tors. eta vs tors. theta energy: -41.414 Dist. restrs. and SS energy: 0.545 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -501.299779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.299779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.927871 (E_RNA) where: Base-Base interactions energy: -326.726 where: short stacking energy: -152.525 Base-Backbone interact. energy: 0.377 local terms energy: -175.578514 where: bonds (distance) C4'-P energy: -42.885 bonds (distance) P-C4' energy: -38.209 flat angles C4'-P-C4' energy: -35.511 flat angles P-C4'-P energy: -25.574 tors. eta vs tors. theta energy: -33.400 Dist. restrs. and SS energy: 0.628 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -482.417592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.417592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.081393 (E_RNA) where: Base-Base interactions energy: -315.515 where: short stacking energy: -153.614 Base-Backbone interact. energy: -0.871 local terms energy: -166.695696 where: bonds (distance) C4'-P energy: -24.358 bonds (distance) P-C4' energy: -36.912 flat angles C4'-P-C4' energy: -36.417 flat angles P-C4'-P energy: -30.410 tors. eta vs tors. theta energy: -38.599 Dist. restrs. and SS energy: 0.664 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -504.334484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.334484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.706104 (E_RNA) where: Base-Base interactions energy: -343.746 where: short stacking energy: -146.631 Base-Backbone interact. energy: 1.429 local terms energy: -162.389260 where: bonds (distance) C4'-P energy: -25.162 bonds (distance) P-C4' energy: -39.630 flat angles C4'-P-C4' energy: -38.706 flat angles P-C4'-P energy: -26.066 tors. eta vs tors. theta energy: -32.824 Dist. restrs. and SS energy: 0.372 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -730.532769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.532769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.706967 (E_RNA) where: Base-Base interactions energy: -497.085 where: short stacking energy: -223.880 Base-Backbone interact. energy: -0.085 local terms energy: -233.536572 where: bonds (distance) C4'-P energy: -40.462 bonds (distance) P-C4' energy: -46.850 flat angles C4'-P-C4' energy: -51.760 flat angles P-C4'-P energy: -28.581 tors. eta vs tors. theta energy: -65.884 Dist. restrs. and SS energy: 0.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -724.500420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.500420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.588391 (E_RNA) where: Base-Base interactions energy: -483.070 where: short stacking energy: -217.283 Base-Backbone interact. energy: -1.310 local terms energy: -240.208507 where: bonds (distance) C4'-P energy: -49.141 bonds (distance) P-C4' energy: -42.331 flat angles C4'-P-C4' energy: -50.571 flat angles P-C4'-P energy: -34.625 tors. eta vs tors. theta energy: -63.540 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -696.487214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.487214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.943118 (E_RNA) where: Base-Base interactions energy: -447.316 where: short stacking energy: -201.727 Base-Backbone interact. energy: -0.522 local terms energy: -249.104781 where: bonds (distance) C4'-P energy: -47.062 bonds (distance) P-C4' energy: -53.442 flat angles C4'-P-C4' energy: -50.689 flat angles P-C4'-P energy: -30.791 tors. eta vs tors. theta energy: -67.121 Dist. restrs. and SS energy: 0.456 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -638.685622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.685622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.233808 (E_RNA) where: Base-Base interactions energy: -415.050 where: short stacking energy: -171.551 Base-Backbone interact. energy: -2.192 local terms energy: -221.992583 where: bonds (distance) C4'-P energy: -44.640 bonds (distance) P-C4' energy: -50.136 flat angles C4'-P-C4' energy: -44.422 flat angles P-C4'-P energy: -32.427 tors. eta vs tors. theta energy: -50.369 Dist. restrs. and SS energy: 0.548 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -655.308542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.308542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.655205 (E_RNA) where: Base-Base interactions energy: -434.297 where: short stacking energy: -192.699 Base-Backbone interact. energy: -0.796 local terms energy: -220.562582 where: bonds (distance) C4'-P energy: -44.364 bonds (distance) P-C4' energy: -46.871 flat angles C4'-P-C4' energy: -46.533 flat angles P-C4'-P energy: -30.955 tors. eta vs tors. theta energy: -51.840 Dist. restrs. and SS energy: 0.347 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -595.732334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.732334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.603397 (E_RNA) where: Base-Base interactions energy: -394.178 where: short stacking energy: -187.347 Base-Backbone interact. energy: -1.021 local terms energy: -201.404617 where: bonds (distance) C4'-P energy: -45.636 bonds (distance) P-C4' energy: -46.273 flat angles C4'-P-C4' energy: -45.889 flat angles P-C4'-P energy: -14.212 tors. eta vs tors. theta energy: -49.395 Dist. restrs. and SS energy: 0.871 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -569.766964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.766964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.781372 (E_RNA) where: Base-Base interactions energy: -371.455 where: short stacking energy: -178.584 Base-Backbone interact. energy: -0.541 local terms energy: -197.785102 where: bonds (distance) C4'-P energy: -26.203 bonds (distance) P-C4' energy: -43.429 flat angles C4'-P-C4' energy: -49.534 flat angles P-C4'-P energy: -32.911 tors. eta vs tors. theta energy: -45.708 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -505.711719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.711719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.974885 (E_RNA) where: Base-Base interactions energy: -328.501 where: short stacking energy: -158.331 Base-Backbone interact. energy: -1.191 local terms energy: -176.283506 where: bonds (distance) C4'-P energy: -39.422 bonds (distance) P-C4' energy: -34.287 flat angles C4'-P-C4' energy: -46.217 flat angles P-C4'-P energy: -23.885 tors. eta vs tors. theta energy: -32.471 Dist. restrs. and SS energy: 0.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -497.273429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.273429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.091097 (E_RNA) where: Base-Base interactions energy: -302.365 where: short stacking energy: -145.625 Base-Backbone interact. energy: -0.970 local terms energy: -194.756115 where: bonds (distance) C4'-P energy: -34.781 bonds (distance) P-C4' energy: -42.174 flat angles C4'-P-C4' energy: -49.512 flat angles P-C4'-P energy: -32.199 tors. eta vs tors. theta energy: -36.089 Dist. restrs. and SS energy: 0.818 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -481.462942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.462942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.177950 (E_RNA) where: Base-Base interactions energy: -305.075 where: short stacking energy: -142.781 Base-Backbone interact. energy: 0.257 local terms energy: -177.360416 where: bonds (distance) C4'-P energy: -35.065 bonds (distance) P-C4' energy: -35.545 flat angles C4'-P-C4' energy: -46.436 flat angles P-C4'-P energy: -28.228 tors. eta vs tors. theta energy: -32.086 Dist. restrs. and SS energy: 0.715 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -718.931197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.931197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.958586 (E_RNA) where: Base-Base interactions energy: -468.581 where: short stacking energy: -213.238 Base-Backbone interact. energy: -1.355 local terms energy: -249.022216 where: bonds (distance) C4'-P energy: -51.319 bonds (distance) P-C4' energy: -50.131 flat angles C4'-P-C4' energy: -50.467 flat angles P-C4'-P energy: -33.789 tors. eta vs tors. theta energy: -63.316 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -709.310253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.310253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.896316 (E_RNA) where: Base-Base interactions energy: -469.778 where: short stacking energy: -213.027 Base-Backbone interact. energy: -0.600 local terms energy: -239.517628 where: bonds (distance) C4'-P energy: -41.347 bonds (distance) P-C4' energy: -44.235 flat angles C4'-P-C4' energy: -50.511 flat angles P-C4'-P energy: -37.441 tors. eta vs tors. theta energy: -65.984 Dist. restrs. and SS energy: 0.586 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -712.268291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.268291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.919304 (E_RNA) where: Base-Base interactions energy: -472.703 where: short stacking energy: -231.512 Base-Backbone interact. energy: -0.477 local terms energy: -239.740177 where: bonds (distance) C4'-P energy: -44.362 bonds (distance) P-C4' energy: -42.283 flat angles C4'-P-C4' energy: -51.551 flat angles P-C4'-P energy: -33.667 tors. eta vs tors. theta energy: -67.877 Dist. restrs. and SS energy: 0.651 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -645.052921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.052921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.041922 (E_RNA) where: Base-Base interactions energy: -423.686 where: short stacking energy: -199.170 Base-Backbone interact. energy: -0.455 local terms energy: -221.901118 where: bonds (distance) C4'-P energy: -43.952 bonds (distance) P-C4' energy: -47.158 flat angles C4'-P-C4' energy: -44.791 flat angles P-C4'-P energy: -32.099 tors. eta vs tors. theta energy: -53.900 Dist. restrs. and SS energy: 0.989 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -610.615304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -610.615304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.825676 (E_RNA) where: Base-Base interactions energy: -403.419 where: short stacking energy: -178.525 Base-Backbone interact. energy: 0.213 local terms energy: -207.619693 where: bonds (distance) C4'-P energy: -38.763 bonds (distance) P-C4' energy: -40.103 flat angles C4'-P-C4' energy: -49.624 flat angles P-C4'-P energy: -28.820 tors. eta vs tors. theta energy: -50.309 Dist. restrs. and SS energy: 0.210 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -618.823101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.823101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.201730 (E_RNA) where: Base-Base interactions energy: -408.963 where: short stacking energy: -183.949 Base-Backbone interact. energy: -0.675 local terms energy: -210.564398 where: bonds (distance) C4'-P energy: -33.041 bonds (distance) P-C4' energy: -46.864 flat angles C4'-P-C4' energy: -48.094 flat angles P-C4'-P energy: -30.052 tors. eta vs tors. theta energy: -52.513 Dist. restrs. and SS energy: 1.379 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -533.361652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.361652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.539954 (E_RNA) where: Base-Base interactions energy: -355.512 where: short stacking energy: -152.322 Base-Backbone interact. energy: -1.044 local terms energy: -176.984677 where: bonds (distance) C4'-P energy: -32.607 bonds (distance) P-C4' energy: -37.275 flat angles C4'-P-C4' energy: -41.402 flat angles P-C4'-P energy: -30.920 tors. eta vs tors. theta energy: -34.780 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -487.949041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.949041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.671645 (E_RNA) where: Base-Base interactions energy: -333.250 where: short stacking energy: -150.833 Base-Backbone interact. energy: -0.304 local terms energy: -155.117422 where: bonds (distance) C4'-P energy: -37.623 bonds (distance) P-C4' energy: -31.449 flat angles C4'-P-C4' energy: -26.612 flat angles P-C4'-P energy: -23.003 tors. eta vs tors. theta energy: -36.431 Dist. restrs. and SS energy: 0.723 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -493.962698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.962698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.354130 (E_RNA) where: Base-Base interactions energy: -319.487 where: short stacking energy: -154.157 Base-Backbone interact. energy: -1.350 local terms energy: -173.516990 where: bonds (distance) C4'-P energy: -32.878 bonds (distance) P-C4' energy: -39.119 flat angles C4'-P-C4' energy: -37.766 flat angles P-C4'-P energy: -29.776 tors. eta vs tors. theta energy: -33.978 Dist. restrs. and SS energy: 0.391 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -483.510169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.510169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.838379 (E_RNA) where: Base-Base interactions energy: -322.242 where: short stacking energy: -159.643 Base-Backbone interact. energy: -1.309 local terms energy: -160.287625 where: bonds (distance) C4'-P energy: -34.720 bonds (distance) P-C4' energy: -17.854 flat angles C4'-P-C4' energy: -41.951 flat angles P-C4'-P energy: -26.416 tors. eta vs tors. theta energy: -39.347 Dist. restrs. and SS energy: 0.328 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -728.260901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.260901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.414811 (E_RNA) where: Base-Base interactions energy: -500.428 where: short stacking energy: -218.204 Base-Backbone interact. energy: 1.549 local terms energy: -229.535669 where: bonds (distance) C4'-P energy: -39.973 bonds (distance) P-C4' energy: -52.889 flat angles C4'-P-C4' energy: -48.170 flat angles P-C4'-P energy: -26.378 tors. eta vs tors. theta energy: -62.127 Dist. restrs. and SS energy: 0.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -705.585528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.585528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.918183 (E_RNA) where: Base-Base interactions energy: -465.105 where: short stacking energy: -211.108 Base-Backbone interact. energy: -1.397 local terms energy: -239.416096 where: bonds (distance) C4'-P energy: -45.266 bonds (distance) P-C4' energy: -44.352 flat angles C4'-P-C4' energy: -50.099 flat angles P-C4'-P energy: -33.819 tors. eta vs tors. theta energy: -65.881 Dist. restrs. and SS energy: 0.333 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -702.359308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.359308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.630267 (E_RNA) where: Base-Base interactions energy: -464.941 where: short stacking energy: -208.656 Base-Backbone interact. energy: -2.355 local terms energy: -235.333904 where: bonds (distance) C4'-P energy: -38.062 bonds (distance) P-C4' energy: -50.101 flat angles C4'-P-C4' energy: -49.832 flat angles P-C4'-P energy: -36.054 tors. eta vs tors. theta energy: -61.285 Dist. restrs. and SS energy: 0.271 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -651.131757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.131757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.330817 (E_RNA) where: Base-Base interactions energy: -419.248 where: short stacking energy: -213.563 Base-Backbone interact. energy: -0.360 local terms energy: -231.722870 where: bonds (distance) C4'-P energy: -46.551 bonds (distance) P-C4' energy: -46.721 flat angles C4'-P-C4' energy: -50.761 flat angles P-C4'-P energy: -28.794 tors. eta vs tors. theta energy: -58.896 Dist. restrs. and SS energy: 0.199 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -600.954667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.954667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.663620 (E_RNA) where: Base-Base interactions energy: -404.942 where: short stacking energy: -189.840 Base-Backbone interact. energy: 2.076 local terms energy: -198.797634 where: bonds (distance) C4'-P energy: -37.864 bonds (distance) P-C4' energy: -44.956 flat angles C4'-P-C4' energy: -43.653 flat angles P-C4'-P energy: -26.740 tors. eta vs tors. theta energy: -45.585 Dist. restrs. and SS energy: 0.709 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -591.299485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.299485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.305748 (E_RNA) where: Base-Base interactions energy: -378.770 where: short stacking energy: -178.564 Base-Backbone interact. energy: -1.190 local terms energy: -212.344880 where: bonds (distance) C4'-P energy: -40.068 bonds (distance) P-C4' energy: -44.187 flat angles C4'-P-C4' energy: -42.282 flat angles P-C4'-P energy: -29.421 tors. eta vs tors. theta energy: -56.387 Dist. restrs. and SS energy: 1.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -512.996199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.996199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.325675 (E_RNA) where: Base-Base interactions energy: -333.202 where: short stacking energy: -146.192 Base-Backbone interact. energy: -1.125 local terms energy: -178.998325 where: bonds (distance) C4'-P energy: -40.921 bonds (distance) P-C4' energy: -36.550 flat angles C4'-P-C4' energy: -48.920 flat angles P-C4'-P energy: -16.486 tors. eta vs tors. theta energy: -36.121 Dist. restrs. and SS energy: 0.329 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -513.793894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.793894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.425231 (E_RNA) where: Base-Base interactions energy: -330.099 where: short stacking energy: -155.982 Base-Backbone interact. energy: -0.658 local terms energy: -183.667777 where: bonds (distance) C4'-P energy: -39.898 bonds (distance) P-C4' energy: -30.412 flat angles C4'-P-C4' energy: -43.105 flat angles P-C4'-P energy: -33.656 tors. eta vs tors. theta energy: -36.598 Dist. restrs. and SS energy: 0.631 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -551.466305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.466305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.261571 (E_RNA) where: Base-Base interactions energy: -365.736 where: short stacking energy: -163.947 Base-Backbone interact. energy: -0.344 local terms energy: -186.181596 where: bonds (distance) C4'-P energy: -35.411 bonds (distance) P-C4' energy: -36.492 flat angles C4'-P-C4' energy: -45.302 flat angles P-C4'-P energy: -19.624 tors. eta vs tors. theta energy: -49.352 Dist. restrs. and SS energy: 0.795 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -455.817558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.817558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.105888 (E_RNA) where: Base-Base interactions energy: -289.227 where: short stacking energy: -125.036 Base-Backbone interact. energy: 0.125 local terms energy: -167.003645 where: bonds (distance) C4'-P energy: -38.509 bonds (distance) P-C4' energy: -38.395 flat angles C4'-P-C4' energy: -26.966 flat angles P-C4'-P energy: -34.099 tors. eta vs tors. theta energy: -29.035 Dist. restrs. and SS energy: 0.288 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -733.301069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -733.301069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -733.465325 (E_RNA) where: Base-Base interactions energy: -500.133 where: short stacking energy: -227.216 Base-Backbone interact. energy: -1.723 local terms energy: -231.609765 where: bonds (distance) C4'-P energy: -44.083 bonds (distance) P-C4' energy: -42.211 flat angles C4'-P-C4' energy: -47.419 flat angles P-C4'-P energy: -31.619 tors. eta vs tors. theta energy: -66.277 Dist. restrs. and SS energy: 0.164 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -726.645747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.645747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -726.890064 (E_RNA) where: Base-Base interactions energy: -487.050 where: short stacking energy: -230.796 Base-Backbone interact. energy: 0.114 local terms energy: -239.954718 where: bonds (distance) C4'-P energy: -39.428 bonds (distance) P-C4' energy: -44.431 flat angles C4'-P-C4' energy: -54.236 flat angles P-C4'-P energy: -34.730 tors. eta vs tors. theta energy: -67.129 Dist. restrs. and SS energy: 0.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -683.361796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.361796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.940578 (E_RNA) where: Base-Base interactions energy: -457.017 where: short stacking energy: -188.169 Base-Backbone interact. energy: -1.049 local terms energy: -225.874501 where: bonds (distance) C4'-P energy: -46.651 bonds (distance) P-C4' energy: -43.902 flat angles C4'-P-C4' energy: -50.993 flat angles P-C4'-P energy: -26.553 tors. eta vs tors. theta energy: -57.776 Dist. restrs. and SS energy: 0.579 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -641.847393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -641.847393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.491130 (E_RNA) where: Base-Base interactions energy: -429.649 where: short stacking energy: -193.018 Base-Backbone interact. energy: -1.066 local terms energy: -211.775866 where: bonds (distance) C4'-P energy: -37.240 bonds (distance) P-C4' energy: -44.815 flat angles C4'-P-C4' energy: -46.569 flat angles P-C4'-P energy: -27.518 tors. eta vs tors. theta energy: -55.634 Dist. restrs. and SS energy: 0.644 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -618.795976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.795976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.122658 (E_RNA) where: Base-Base interactions energy: -417.472 where: short stacking energy: -185.620 Base-Backbone interact. energy: -1.779 local terms energy: -199.871952 where: bonds (distance) C4'-P energy: -37.216 bonds (distance) P-C4' energy: -46.682 flat angles C4'-P-C4' energy: -42.308 flat angles P-C4'-P energy: -21.626 tors. eta vs tors. theta energy: -52.040 Dist. restrs. and SS energy: 0.327 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -589.540623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.540623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.671105 (E_RNA) where: Base-Base interactions energy: -390.622 where: short stacking energy: -157.139 Base-Backbone interact. energy: -1.560 local terms energy: -197.489887 where: bonds (distance) C4'-P energy: -49.271 bonds (distance) P-C4' energy: -30.006 flat angles C4'-P-C4' energy: -43.495 flat angles P-C4'-P energy: -30.479 tors. eta vs tors. theta energy: -44.240 Dist. restrs. and SS energy: 0.130 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -513.901637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.901637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.280820 (E_RNA) where: Base-Base interactions energy: -327.408 where: short stacking energy: -146.506 Base-Backbone interact. energy: 1.676 local terms energy: -188.548940 where: bonds (distance) C4'-P energy: -40.632 bonds (distance) P-C4' energy: -31.741 flat angles C4'-P-C4' energy: -48.887 flat angles P-C4'-P energy: -28.318 tors. eta vs tors. theta energy: -38.972 Dist. restrs. and SS energy: 0.379 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -498.269557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.269557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.576831 (E_RNA) where: Base-Base interactions energy: -310.775 where: short stacking energy: -144.228 Base-Backbone interact. energy: -0.444 local terms energy: -187.357311 where: bonds (distance) C4'-P energy: -37.127 bonds (distance) P-C4' energy: -38.472 flat angles C4'-P-C4' energy: -49.984 flat angles P-C4'-P energy: -29.121 tors. eta vs tors. theta energy: -32.652 Dist. restrs. and SS energy: 0.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -538.233274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.233274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.510264 (E_RNA) where: Base-Base interactions energy: -353.721 where: short stacking energy: -152.733 Base-Backbone interact. energy: 0.561 local terms energy: -185.350481 where: bonds (distance) C4'-P energy: -26.407 bonds (distance) P-C4' energy: -45.333 flat angles C4'-P-C4' energy: -42.412 flat angles P-C4'-P energy: -29.015 tors. eta vs tors. theta energy: -42.183 Dist. restrs. and SS energy: 0.277 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -455.844110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.844110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.146417 (E_RNA) where: Base-Base interactions energy: -295.675 where: short stacking energy: -133.644 Base-Backbone interact. energy: -1.613 local terms energy: -158.858156 where: bonds (distance) C4'-P energy: -30.180 bonds (distance) P-C4' energy: -39.279 flat angles C4'-P-C4' energy: -41.097 flat angles P-C4'-P energy: -26.864 tors. eta vs tors. theta energy: -21.438 Dist. restrs. and SS energy: 0.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -724.589132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.589132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.715091 (E_RNA) where: Base-Base interactions energy: -488.513 where: short stacking energy: -222.916 Base-Backbone interact. energy: 0.216 local terms energy: -236.418727 where: bonds (distance) C4'-P energy: -47.430 bonds (distance) P-C4' energy: -44.665 flat angles C4'-P-C4' energy: -47.287 flat angles P-C4'-P energy: -33.639 tors. eta vs tors. theta energy: -63.399 Dist. restrs. and SS energy: 0.126 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -725.412595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.412595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.923449 (E_RNA) where: Base-Base interactions energy: -481.469 where: short stacking energy: -227.479 Base-Backbone interact. energy: 0.597 local terms energy: -245.051059 where: bonds (distance) C4'-P energy: -48.521 bonds (distance) P-C4' energy: -44.813 flat angles C4'-P-C4' energy: -47.430 flat angles P-C4'-P energy: -38.264 tors. eta vs tors. theta energy: -66.023 Dist. restrs. and SS energy: 0.511 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -690.551709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.551709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.822596 (E_RNA) where: Base-Base interactions energy: -471.824 where: short stacking energy: -212.728 Base-Backbone interact. energy: -2.047 local terms energy: -216.951515 where: bonds (distance) C4'-P energy: -42.244 bonds (distance) P-C4' energy: -36.636 flat angles C4'-P-C4' energy: -45.789 flat angles P-C4'-P energy: -31.320 tors. eta vs tors. theta energy: -60.962 Dist. restrs. and SS energy: 0.271 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -618.067719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.067719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.749790 (E_RNA) where: Base-Base interactions energy: -415.196 where: short stacking energy: -188.653 Base-Backbone interact. energy: -1.347 local terms energy: -202.206777 where: bonds (distance) C4'-P energy: -44.566 bonds (distance) P-C4' energy: -36.090 flat angles C4'-P-C4' energy: -50.739 flat angles P-C4'-P energy: -21.943 tors. eta vs tors. theta energy: -48.868 Dist. restrs. and SS energy: 0.682 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -623.075604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -623.075604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -623.103920 (E_RNA) where: Base-Base interactions energy: -402.761 where: short stacking energy: -188.504 Base-Backbone interact. energy: -1.352 local terms energy: -218.990432 where: bonds (distance) C4'-P energy: -37.230 bonds (distance) P-C4' energy: -44.538 flat angles C4'-P-C4' energy: -53.433 flat angles P-C4'-P energy: -28.920 tors. eta vs tors. theta energy: -54.870 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -585.442953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.442953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.180768 (E_RNA) where: Base-Base interactions energy: -389.940 where: short stacking energy: -187.981 Base-Backbone interact. energy: -2.192 local terms energy: -194.048186 where: bonds (distance) C4'-P energy: -41.525 bonds (distance) P-C4' energy: -39.932 flat angles C4'-P-C4' energy: -38.124 flat angles P-C4'-P energy: -27.311 tors. eta vs tors. theta energy: -47.155 Dist. restrs. and SS energy: 0.738 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -537.453950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.453950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.433081 (E_RNA) where: Base-Base interactions energy: -339.503 where: short stacking energy: -150.841 Base-Backbone interact. energy: -0.433 local terms energy: -198.496310 where: bonds (distance) C4'-P energy: -32.681 bonds (distance) P-C4' energy: -43.446 flat angles C4'-P-C4' energy: -56.090 flat angles P-C4'-P energy: -30.363 tors. eta vs tors. theta energy: -35.916 Dist. restrs. and SS energy: 0.979 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -527.560279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.560279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.234939 (E_RNA) where: Base-Base interactions energy: -349.017 where: short stacking energy: -164.553 Base-Backbone interact. energy: -1.516 local terms energy: -177.701297 where: bonds (distance) C4'-P energy: -39.048 bonds (distance) P-C4' energy: -34.971 flat angles C4'-P-C4' energy: -41.624 flat angles P-C4'-P energy: -22.167 tors. eta vs tors. theta energy: -39.891 Dist. restrs. and SS energy: 0.675 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -473.722547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.722547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.876291 (E_RNA) where: Base-Base interactions energy: -309.381 where: short stacking energy: -145.159 Base-Backbone interact. energy: -0.641 local terms energy: -163.854614 where: bonds (distance) C4'-P energy: -32.877 bonds (distance) P-C4' energy: -34.569 flat angles C4'-P-C4' energy: -46.682 flat angles P-C4'-P energy: -17.059 tors. eta vs tors. theta energy: -32.667 Dist. restrs. and SS energy: 0.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -435.021802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.021802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.006077 (E_RNA) where: Base-Base interactions energy: -277.387 where: short stacking energy: -122.302 Base-Backbone interact. energy: -0.676 local terms energy: -157.942632 where: bonds (distance) C4'-P energy: -42.933 bonds (distance) P-C4' energy: -31.248 flat angles C4'-P-C4' energy: -30.044 flat angles P-C4'-P energy: -25.469 tors. eta vs tors. theta energy: -28.248 Dist. restrs. and SS energy: 0.984 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -747.518913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.518913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.735504 (E_RNA) where: Base-Base interactions energy: -502.992 where: short stacking energy: -240.108 Base-Backbone interact. energy: -1.658 local terms energy: -243.085802 where: bonds (distance) C4'-P energy: -40.876 bonds (distance) P-C4' energy: -49.580 flat angles C4'-P-C4' energy: -49.213 flat angles P-C4'-P energy: -36.374 tors. eta vs tors. theta energy: -67.042 Dist. restrs. and SS energy: 0.217 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -705.352200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.352200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.576264 (E_RNA) where: Base-Base interactions energy: -466.718 where: short stacking energy: -210.441 Base-Backbone interact. energy: -0.288 local terms energy: -238.570651 where: bonds (distance) C4'-P energy: -49.312 bonds (distance) P-C4' energy: -43.511 flat angles C4'-P-C4' energy: -51.794 flat angles P-C4'-P energy: -37.617 tors. eta vs tors. theta energy: -56.337 Dist. restrs. and SS energy: 0.224 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -652.651073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -652.651073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.791755 (E_RNA) where: Base-Base interactions energy: -437.722 where: short stacking energy: -207.966 Base-Backbone interact. energy: -1.377 local terms energy: -214.692819 where: bonds (distance) C4'-P energy: -46.216 bonds (distance) P-C4' energy: -45.264 flat angles C4'-P-C4' energy: -46.045 flat angles P-C4'-P energy: -23.663 tors. eta vs tors. theta energy: -53.506 Dist. restrs. and SS energy: 1.141 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -662.589093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.589093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.718350 (E_RNA) where: Base-Base interactions energy: -446.861 where: short stacking energy: -201.869 Base-Backbone interact. energy: -0.275 local terms energy: -215.582535 where: bonds (distance) C4'-P energy: -43.739 bonds (distance) P-C4' energy: -45.971 flat angles C4'-P-C4' energy: -46.769 flat angles P-C4'-P energy: -26.923 tors. eta vs tors. theta energy: -52.180 Dist. restrs. and SS energy: 0.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -632.495209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -632.495209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.712069 (E_RNA) where: Base-Base interactions energy: -427.804 where: short stacking energy: -195.096 Base-Backbone interact. energy: -1.640 local terms energy: -203.268288 where: bonds (distance) C4'-P energy: -36.749 bonds (distance) P-C4' energy: -35.078 flat angles C4'-P-C4' energy: -47.249 flat angles P-C4'-P energy: -26.230 tors. eta vs tors. theta energy: -57.962 Dist. restrs. and SS energy: 0.217 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -586.559698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.559698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.864765 (E_RNA) where: Base-Base interactions energy: -381.773 where: short stacking energy: -184.242 Base-Backbone interact. energy: -1.303 local terms energy: -203.788309 where: bonds (distance) C4'-P energy: -27.971 bonds (distance) P-C4' energy: -49.564 flat angles C4'-P-C4' energy: -50.291 flat angles P-C4'-P energy: -25.095 tors. eta vs tors. theta energy: -50.868 Dist. restrs. and SS energy: 0.305 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -546.006518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.006518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.194868 (E_RNA) where: Base-Base interactions energy: -367.104 where: short stacking energy: -171.765 Base-Backbone interact. energy: -1.418 local terms energy: -177.672489 where: bonds (distance) C4'-P energy: -36.657 bonds (distance) P-C4' energy: -36.595 flat angles C4'-P-C4' energy: -45.462 flat angles P-C4'-P energy: -24.838 tors. eta vs tors. theta energy: -34.121 Dist. restrs. and SS energy: 0.188 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -510.348657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.348657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.604696 (E_RNA) where: Base-Base interactions energy: -325.952 where: short stacking energy: -148.410 Base-Backbone interact. energy: -0.824 local terms energy: -183.828230 where: bonds (distance) C4'-P energy: -47.258 bonds (distance) P-C4' energy: -39.890 flat angles C4'-P-C4' energy: -47.074 flat angles P-C4'-P energy: -19.271 tors. eta vs tors. theta energy: -30.335 Dist. restrs. and SS energy: 0.256 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -476.193339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.193339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.404044 (E_RNA) where: Base-Base interactions energy: -320.822 where: short stacking energy: -134.867 Base-Backbone interact. energy: 1.793 local terms energy: -159.375588 where: bonds (distance) C4'-P energy: -32.418 bonds (distance) P-C4' energy: -36.316 flat angles C4'-P-C4' energy: -39.604 flat angles P-C4'-P energy: -25.988 tors. eta vs tors. theta energy: -25.049 Dist. restrs. and SS energy: 2.211 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -476.971358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.971358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.160202 (E_RNA) where: Base-Base interactions energy: -305.798 where: short stacking energy: -148.429 Base-Backbone interact. energy: -0.534 local terms energy: -170.828460 where: bonds (distance) C4'-P energy: -32.108 bonds (distance) P-C4' energy: -38.812 flat angles C4'-P-C4' energy: -36.510 flat angles P-C4'-P energy: -27.418 tors. eta vs tors. theta energy: -35.981 Dist. restrs. and SS energy: 0.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -750.290586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.290586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.455746 (E_RNA) where: Base-Base interactions energy: -508.472 where: short stacking energy: -240.539 Base-Backbone interact. energy: 0.523 local terms energy: -242.506162 where: bonds (distance) C4'-P energy: -48.351 bonds (distance) P-C4' energy: -42.349 flat angles C4'-P-C4' energy: -51.485 flat angles P-C4'-P energy: -31.497 tors. eta vs tors. theta energy: -68.824 Dist. restrs. and SS energy: 0.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -709.676407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.676407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.109759 (E_RNA) where: Base-Base interactions energy: -480.254 where: short stacking energy: -219.981 Base-Backbone interact. energy: -0.667 local terms energy: -229.188166 where: bonds (distance) C4'-P energy: -37.951 bonds (distance) P-C4' energy: -48.712 flat angles C4'-P-C4' energy: -48.451 flat angles P-C4'-P energy: -31.405 tors. eta vs tors. theta energy: -62.670 Dist. restrs. and SS energy: 0.433 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -660.614995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.614995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.181416 (E_RNA) where: Base-Base interactions energy: -447.760 where: short stacking energy: -199.804 Base-Backbone interact. energy: 0.868 local terms energy: -214.289268 where: bonds (distance) C4'-P energy: -37.252 bonds (distance) P-C4' energy: -40.339 flat angles C4'-P-C4' energy: -50.330 flat angles P-C4'-P energy: -29.516 tors. eta vs tors. theta energy: -56.853 Dist. restrs. and SS energy: 0.566 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -659.310024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.310024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.585905 (E_RNA) where: Base-Base interactions energy: -440.016 where: short stacking energy: -192.209 Base-Backbone interact. energy: -1.540 local terms energy: -218.029118 where: bonds (distance) C4'-P energy: -41.601 bonds (distance) P-C4' energy: -47.450 flat angles C4'-P-C4' energy: -43.787 flat angles P-C4'-P energy: -31.915 tors. eta vs tors. theta energy: -53.276 Dist. restrs. and SS energy: 0.276 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -584.196849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.196849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.660802 (E_RNA) where: Base-Base interactions energy: -383.851 where: short stacking energy: -180.653 Base-Backbone interact. energy: -1.346 local terms energy: -199.462945 where: bonds (distance) C4'-P energy: -36.367 bonds (distance) P-C4' energy: -42.572 flat angles C4'-P-C4' energy: -37.529 flat angles P-C4'-P energy: -28.848 tors. eta vs tors. theta energy: -54.147 Dist. restrs. and SS energy: 0.464 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -547.309321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.309321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.367982 (E_RNA) where: Base-Base interactions energy: -371.501 where: short stacking energy: -153.702 Base-Backbone interact. energy: 4.327 local terms energy: -181.193875 where: bonds (distance) C4'-P energy: -42.465 bonds (distance) P-C4' energy: -45.340 flat angles C4'-P-C4' energy: -37.517 flat angles P-C4'-P energy: -18.413 tors. eta vs tors. theta energy: -37.460 Dist. restrs. and SS energy: 1.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -551.550372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.550372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.094921 (E_RNA) where: Base-Base interactions energy: -374.488 where: short stacking energy: -166.505 Base-Backbone interact. energy: 6.240 local terms energy: -183.846857 where: bonds (distance) C4'-P energy: -40.229 bonds (distance) P-C4' energy: -39.866 flat angles C4'-P-C4' energy: -37.572 flat angles P-C4'-P energy: -28.375 tors. eta vs tors. theta energy: -37.805 Dist. restrs. and SS energy: 0.545 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -530.780653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.780653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.880041 (E_RNA) where: Base-Base interactions energy: -355.400 where: short stacking energy: -159.825 Base-Backbone interact. energy: 2.789 local terms energy: -179.269182 where: bonds (distance) C4'-P energy: -37.363 bonds (distance) P-C4' energy: -46.531 flat angles C4'-P-C4' energy: -45.308 flat angles P-C4'-P energy: -20.819 tors. eta vs tors. theta energy: -29.248 Dist. restrs. and SS energy: 1.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -491.100065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.100065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.531190 (E_RNA) where: Base-Base interactions energy: -320.681 where: short stacking energy: -141.492 Base-Backbone interact. energy: -0.029 local terms energy: -170.820577 where: bonds (distance) C4'-P energy: -45.821 bonds (distance) P-C4' energy: -38.626 flat angles C4'-P-C4' energy: -31.256 flat angles P-C4'-P energy: -23.471 tors. eta vs tors. theta energy: -31.647 Dist. restrs. and SS energy: 0.431 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -455.310586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.310586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.218950 (E_RNA) where: Base-Base interactions energy: -282.547 where: short stacking energy: -131.074 Base-Backbone interact. energy: 1.003 local terms energy: -174.674573 where: bonds (distance) C4'-P energy: -39.970 bonds (distance) P-C4' energy: -43.989 flat angles C4'-P-C4' energy: -37.100 flat angles P-C4'-P energy: -28.662 tors. eta vs tors. theta energy: -24.954 Dist. restrs. and SS energy: 0.908 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -745.247757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.247757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.416630 (E_RNA) where: Base-Base interactions energy: -497.262 where: short stacking energy: -216.228 Base-Backbone interact. energy: -1.570 local terms energy: -246.585332 where: bonds (distance) C4'-P energy: -48.076 bonds (distance) P-C4' energy: -48.309 flat angles C4'-P-C4' energy: -51.229 flat angles P-C4'-P energy: -33.172 tors. eta vs tors. theta energy: -65.799 Dist. restrs. and SS energy: 0.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -716.291523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.291523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.573953 (E_RNA) where: Base-Base interactions energy: -489.046 where: short stacking energy: -219.346 Base-Backbone interact. energy: -0.146 local terms energy: -227.381982 where: bonds (distance) C4'-P energy: -48.156 bonds (distance) P-C4' energy: -41.491 flat angles C4'-P-C4' energy: -53.866 flat angles P-C4'-P energy: -26.326 tors. eta vs tors. theta energy: -57.542 Dist. restrs. and SS energy: 0.282 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -670.100146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -670.100146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.868276 (E_RNA) where: Base-Base interactions energy: -453.790 where: short stacking energy: -198.716 Base-Backbone interact. energy: -0.748 local terms energy: -216.330783 where: bonds (distance) C4'-P energy: -40.385 bonds (distance) P-C4' energy: -46.954 flat angles C4'-P-C4' energy: -45.563 flat angles P-C4'-P energy: -25.701 tors. eta vs tors. theta energy: -57.727 Dist. restrs. and SS energy: 0.768 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -641.731192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -641.731192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.172575 (E_RNA) where: Base-Base interactions energy: -431.036 where: short stacking energy: -196.728 Base-Backbone interact. energy: 0.645 local terms energy: -211.781640 where: bonds (distance) C4'-P energy: -37.660 bonds (distance) P-C4' energy: -40.669 flat angles C4'-P-C4' energy: -44.187 flat angles P-C4'-P energy: -31.422 tors. eta vs tors. theta energy: -57.844 Dist. restrs. and SS energy: 0.441 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -570.394957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.394957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.799135 (E_RNA) where: Base-Base interactions energy: -370.274 where: short stacking energy: -175.152 Base-Backbone interact. energy: -0.840 local terms energy: -199.685726 where: bonds (distance) C4'-P energy: -37.929 bonds (distance) P-C4' energy: -39.830 flat angles C4'-P-C4' energy: -46.237 flat angles P-C4'-P energy: -26.065 tors. eta vs tors. theta energy: -49.625 Dist. restrs. and SS energy: 0.404 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -513.848583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.848583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.039458 (E_RNA) where: Base-Base interactions energy: -325.238 where: short stacking energy: -160.172 Base-Backbone interact. energy: -1.169 local terms energy: -187.632308 where: bonds (distance) C4'-P energy: -38.113 bonds (distance) P-C4' energy: -42.772 flat angles C4'-P-C4' energy: -46.335 flat angles P-C4'-P energy: -23.660 tors. eta vs tors. theta energy: -36.754 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -561.006041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.006041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.893361 (E_RNA) where: Base-Base interactions energy: -367.227 where: short stacking energy: -174.504 Base-Backbone interact. energy: 1.061 local terms energy: -195.727044 where: bonds (distance) C4'-P energy: -42.011 bonds (distance) P-C4' energy: -38.140 flat angles C4'-P-C4' energy: -39.406 flat angles P-C4'-P energy: -27.996 tors. eta vs tors. theta energy: -48.174 Dist. restrs. and SS energy: 0.887 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -511.178553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.178553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.099796 (E_RNA) where: Base-Base interactions energy: -335.293 where: short stacking energy: -151.720 Base-Backbone interact. energy: -0.688 local terms energy: -176.118902 where: bonds (distance) C4'-P energy: -38.147 bonds (distance) P-C4' energy: -36.729 flat angles C4'-P-C4' energy: -44.009 flat angles P-C4'-P energy: -25.290 tors. eta vs tors. theta energy: -31.944 Dist. restrs. and SS energy: 0.921 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -472.854946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.854946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.198429 (E_RNA) where: Base-Base interactions energy: -300.650 where: short stacking energy: -137.341 Base-Backbone interact. energy: -0.776 local terms energy: -171.771943 where: bonds (distance) C4'-P energy: -38.563 bonds (distance) P-C4' energy: -32.678 flat angles C4'-P-C4' energy: -40.238 flat angles P-C4'-P energy: -28.573 tors. eta vs tors. theta energy: -31.720 Dist. restrs. and SS energy: 0.343 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -437.249091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.249091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.743873 (E_RNA) where: Base-Base interactions energy: -272.954 where: short stacking energy: -126.942 Base-Backbone interact. energy: -0.550 local terms energy: -165.239577 where: bonds (distance) C4'-P energy: -35.323 bonds (distance) P-C4' energy: -47.533 flat angles C4'-P-C4' energy: -36.127 flat angles P-C4'-P energy: -19.870 tors. eta vs tors. theta energy: -26.387 Dist. restrs. and SS energy: 1.495 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -724.832921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.832921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.247292 (E_RNA) where: Base-Base interactions energy: -466.898 where: short stacking energy: -218.845 Base-Backbone interact. energy: -0.101 local terms energy: -258.247476 where: bonds (distance) C4'-P energy: -45.214 bonds (distance) P-C4' energy: -51.734 flat angles C4'-P-C4' energy: -53.644 flat angles P-C4'-P energy: -36.096 tors. eta vs tors. theta energy: -71.560 Dist. restrs. and SS energy: 0.414 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -722.199983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.199983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.508922 (E_RNA) where: Base-Base interactions energy: -476.059 where: short stacking energy: -235.611 Base-Backbone interact. energy: -1.043 local terms energy: -245.407813 where: bonds (distance) C4'-P energy: -39.271 bonds (distance) P-C4' energy: -45.498 flat angles C4'-P-C4' energy: -50.775 flat angles P-C4'-P energy: -40.501 tors. eta vs tors. theta energy: -69.362 Dist. restrs. and SS energy: 0.309 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -678.523225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.523225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.711039 (E_RNA) where: Base-Base interactions energy: -451.530 where: short stacking energy: -213.944 Base-Backbone interact. energy: -0.796 local terms energy: -226.384543 where: bonds (distance) C4'-P energy: -36.385 bonds (distance) P-C4' energy: -46.546 flat angles C4'-P-C4' energy: -51.239 flat angles P-C4'-P energy: -27.806 tors. eta vs tors. theta energy: -64.408 Dist. restrs. and SS energy: 0.188 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -650.616856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.616856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.162953 (E_RNA) where: Base-Base interactions energy: -426.631 where: short stacking energy: -202.386 Base-Backbone interact. energy: -0.568 local terms energy: -223.964233 where: bonds (distance) C4'-P energy: -35.472 bonds (distance) P-C4' energy: -49.549 flat angles C4'-P-C4' energy: -48.132 flat angles P-C4'-P energy: -33.884 tors. eta vs tors. theta energy: -56.927 Dist. restrs. and SS energy: 0.546 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -604.470171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.470171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.888097 (E_RNA) where: Base-Base interactions energy: -390.853 where: short stacking energy: -203.314 Base-Backbone interact. energy: -0.638 local terms energy: -213.396981 where: bonds (distance) C4'-P energy: -38.987 bonds (distance) P-C4' energy: -48.169 flat angles C4'-P-C4' energy: -50.274 flat angles P-C4'-P energy: -23.002 tors. eta vs tors. theta energy: -52.964 Dist. restrs. and SS energy: 0.418 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -591.405260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.405260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.727057 (E_RNA) where: Base-Base interactions energy: -383.656 where: short stacking energy: -168.413 Base-Backbone interact. energy: -0.477 local terms energy: -207.593728 where: bonds (distance) C4'-P energy: -42.983 bonds (distance) P-C4' energy: -41.935 flat angles C4'-P-C4' energy: -47.608 flat angles P-C4'-P energy: -24.626 tors. eta vs tors. theta energy: -50.441 Dist. restrs. and SS energy: 0.322 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -532.031038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.031038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.425724 (E_RNA) where: Base-Base interactions energy: -350.812 where: short stacking energy: -168.222 Base-Backbone interact. energy: 1.615 local terms energy: -183.229473 where: bonds (distance) C4'-P energy: -33.279 bonds (distance) P-C4' energy: -28.812 flat angles C4'-P-C4' energy: -51.143 flat angles P-C4'-P energy: -31.318 tors. eta vs tors. theta energy: -38.678 Dist. restrs. and SS energy: 0.395 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -494.605408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.605408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.876207 (E_RNA) where: Base-Base interactions energy: -313.259 where: short stacking energy: -147.148 Base-Backbone interact. energy: -1.360 local terms energy: -181.256856 where: bonds (distance) C4'-P energy: -43.023 bonds (distance) P-C4' energy: -40.251 flat angles C4'-P-C4' energy: -45.350 flat angles P-C4'-P energy: -15.160 tors. eta vs tors. theta energy: -37.473 Dist. restrs. and SS energy: 1.271 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -477.872050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.872050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.683438 (E_RNA) where: Base-Base interactions energy: -317.617 where: short stacking energy: -137.606 Base-Backbone interact. energy: -1.288 local terms energy: -161.778544 where: bonds (distance) C4'-P energy: -25.203 bonds (distance) P-C4' energy: -37.502 flat angles C4'-P-C4' energy: -42.712 flat angles P-C4'-P energy: -23.397 tors. eta vs tors. theta energy: -32.965 Dist. restrs. and SS energy: 2.811 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -442.734435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.734435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.973508 (E_RNA) where: Base-Base interactions energy: -284.630 where: short stacking energy: -122.038 Base-Backbone interact. energy: -0.521 local terms energy: -157.822543 where: bonds (distance) C4'-P energy: -39.447 bonds (distance) P-C4' energy: -42.838 flat angles C4'-P-C4' energy: -33.011 flat angles P-C4'-P energy: -17.733 tors. eta vs tors. theta energy: -24.794 Dist. restrs. and SS energy: 0.239 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -740.750752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.750752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.822593 (E_RNA) where: Base-Base interactions energy: -496.925 where: short stacking energy: -224.641 Base-Backbone interact. energy: -1.735 local terms energy: -242.162756 where: bonds (distance) C4'-P energy: -42.219 bonds (distance) P-C4' energy: -49.608 flat angles C4'-P-C4' energy: -46.264 flat angles P-C4'-P energy: -34.716 tors. eta vs tors. theta energy: -69.357 Dist. restrs. and SS energy: 0.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -722.971107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.971107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.678785 (E_RNA) where: Base-Base interactions energy: -482.294 where: short stacking energy: -228.752 Base-Backbone interact. energy: -0.487 local terms energy: -240.897454 where: bonds (distance) C4'-P energy: -43.819 bonds (distance) P-C4' energy: -50.024 flat angles C4'-P-C4' energy: -47.741 flat angles P-C4'-P energy: -32.554 tors. eta vs tors. theta energy: -66.759 Dist. restrs. and SS energy: 0.708 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -689.958915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.958915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.310918 (E_RNA) where: Base-Base interactions energy: -466.805 where: short stacking energy: -217.568 Base-Backbone interact. energy: -1.032 local terms energy: -222.474548 where: bonds (distance) C4'-P energy: -37.189 bonds (distance) P-C4' energy: -47.531 flat angles C4'-P-C4' energy: -51.559 flat angles P-C4'-P energy: -24.536 tors. eta vs tors. theta energy: -61.660 Dist. restrs. and SS energy: 0.352 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -646.811126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -646.811126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.093608 (E_RNA) where: Base-Base interactions energy: -421.848 where: short stacking energy: -188.847 Base-Backbone interact. energy: -0.604 local terms energy: -224.641528 where: bonds (distance) C4'-P energy: -47.404 bonds (distance) P-C4' energy: -44.376 flat angles C4'-P-C4' energy: -47.176 flat angles P-C4'-P energy: -28.591 tors. eta vs tors. theta energy: -57.095 Dist. restrs. and SS energy: 0.282 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -648.393680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.393680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.181618 (E_RNA) where: Base-Base interactions energy: -432.568 where: short stacking energy: -204.145 Base-Backbone interact. energy: -0.708 local terms energy: -215.904831 where: bonds (distance) C4'-P energy: -37.945 bonds (distance) P-C4' energy: -40.251 flat angles C4'-P-C4' energy: -52.081 flat angles P-C4'-P energy: -30.917 tors. eta vs tors. theta energy: -54.711 Dist. restrs. and SS energy: 0.788 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -561.934211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.934211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.332927 (E_RNA) where: Base-Base interactions energy: -361.483 where: short stacking energy: -174.235 Base-Backbone interact. energy: -0.118 local terms energy: -200.731823 where: bonds (distance) C4'-P energy: -36.019 bonds (distance) P-C4' energy: -38.387 flat angles C4'-P-C4' energy: -42.873 flat angles P-C4'-P energy: -36.435 tors. eta vs tors. theta energy: -47.018 Dist. restrs. and SS energy: 0.399 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -533.210951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.210951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.707330 (E_RNA) where: Base-Base interactions energy: -344.549 where: short stacking energy: -158.575 Base-Backbone interact. energy: -0.551 local terms energy: -188.607273 where: bonds (distance) C4'-P energy: -38.798 bonds (distance) P-C4' energy: -40.084 flat angles C4'-P-C4' energy: -44.871 flat angles P-C4'-P energy: -28.049 tors. eta vs tors. theta energy: -36.805 Dist. restrs. and SS energy: 0.496 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -505.429739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.429739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.922108 (E_RNA) where: Base-Base interactions energy: -337.818 where: short stacking energy: -147.742 Base-Backbone interact. energy: -0.344 local terms energy: -167.760924 where: bonds (distance) C4'-P energy: -29.608 bonds (distance) P-C4' energy: -40.263 flat angles C4'-P-C4' energy: -33.643 flat angles P-C4'-P energy: -33.548 tors. eta vs tors. theta energy: -30.700 Dist. restrs. and SS energy: 0.492 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -493.445598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.445598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.428885 (E_RNA) where: Base-Base interactions energy: -318.692 where: short stacking energy: -146.871 Base-Backbone interact. energy: 0.839 local terms energy: -176.575568 where: bonds (distance) C4'-P energy: -42.220 bonds (distance) P-C4' energy: -43.951 flat angles C4'-P-C4' energy: -31.340 flat angles P-C4'-P energy: -31.731 tors. eta vs tors. theta energy: -27.333 Dist. restrs. and SS energy: 0.983 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -477.715265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.715265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.313130 (E_RNA) where: Base-Base interactions energy: -298.912 where: short stacking energy: -152.836 Base-Backbone interact. energy: -0.401 local terms energy: -179.000207 where: bonds (distance) C4'-P energy: -36.457 bonds (distance) P-C4' energy: -41.809 flat angles C4'-P-C4' energy: -31.835 flat angles P-C4'-P energy: -35.489 tors. eta vs tors. theta energy: -33.411 Dist. restrs. and SS energy: 0.598 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -747.328132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.328132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.467404 (E_RNA) where: Base-Base interactions energy: -501.774 where: short stacking energy: -217.778 Base-Backbone interact. energy: -2.290 local terms energy: -243.403843 where: bonds (distance) C4'-P energy: -54.695 bonds (distance) P-C4' energy: -49.886 flat angles C4'-P-C4' energy: -43.262 flat angles P-C4'-P energy: -31.159 tors. eta vs tors. theta energy: -64.402 Dist. restrs. and SS energy: 0.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -703.893888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.893888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.195240 (E_RNA) where: Base-Base interactions energy: -466.689 where: short stacking energy: -209.901 Base-Backbone interact. energy: -0.995 local terms energy: -236.511531 where: bonds (distance) C4'-P energy: -44.742 bonds (distance) P-C4' energy: -51.430 flat angles C4'-P-C4' energy: -47.476 flat angles P-C4'-P energy: -26.518 tors. eta vs tors. theta energy: -66.346 Dist. restrs. and SS energy: 0.301 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -715.381022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.381022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.694264 (E_RNA) where: Base-Base interactions energy: -485.867 where: short stacking energy: -237.878 Base-Backbone interact. energy: 0.897 local terms energy: -230.723624 where: bonds (distance) C4'-P energy: -40.422 bonds (distance) P-C4' energy: -35.326 flat angles C4'-P-C4' energy: -48.657 flat angles P-C4'-P energy: -37.629 tors. eta vs tors. theta energy: -68.689 Dist. restrs. and SS energy: 0.313 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -640.172736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.172736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.370559 (E_RNA) where: Base-Base interactions energy: -423.619 where: short stacking energy: -200.576 Base-Backbone interact. energy: -0.420 local terms energy: -216.331230 where: bonds (distance) C4'-P energy: -42.606 bonds (distance) P-C4' energy: -40.736 flat angles C4'-P-C4' energy: -46.111 flat angles P-C4'-P energy: -26.496 tors. eta vs tors. theta energy: -60.382 Dist. restrs. and SS energy: 0.198 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -651.642661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.642661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.545016 (E_RNA) where: Base-Base interactions energy: -442.946 where: short stacking energy: -205.862 Base-Backbone interact. energy: -1.234 local terms energy: -208.364267 where: bonds (distance) C4'-P energy: -34.154 bonds (distance) P-C4' energy: -37.548 flat angles C4'-P-C4' energy: -50.649 flat angles P-C4'-P energy: -26.256 tors. eta vs tors. theta energy: -59.757 Dist. restrs. and SS energy: 0.902 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -564.470977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.470977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.937172 (E_RNA) where: Base-Base interactions energy: -376.490 where: short stacking energy: -171.044 Base-Backbone interact. energy: -0.354 local terms energy: -188.093832 where: bonds (distance) C4'-P energy: -40.163 bonds (distance) P-C4' energy: -43.758 flat angles C4'-P-C4' energy: -40.052 flat angles P-C4'-P energy: -23.367 tors. eta vs tors. theta energy: -40.754 Dist. restrs. and SS energy: 0.466 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -535.071943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.071943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.486044 (E_RNA) where: Base-Base interactions energy: -340.129 where: short stacking energy: -171.320 Base-Backbone interact. energy: -0.840 local terms energy: -194.517013 where: bonds (distance) C4'-P energy: -35.812 bonds (distance) P-C4' energy: -43.440 flat angles C4'-P-C4' energy: -37.977 flat angles P-C4'-P energy: -32.313 tors. eta vs tors. theta energy: -44.974 Dist. restrs. and SS energy: 0.414 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -511.055159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.055159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.563749 (E_RNA) where: Base-Base interactions energy: -326.051 where: short stacking energy: -158.862 Base-Backbone interact. energy: -0.523 local terms energy: -184.990506 where: bonds (distance) C4'-P energy: -29.345 bonds (distance) P-C4' energy: -40.855 flat angles C4'-P-C4' energy: -46.087 flat angles P-C4'-P energy: -26.124 tors. eta vs tors. theta energy: -42.580 Dist. restrs. and SS energy: 0.509 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -509.334942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.334942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.082241 (E_RNA) where: Base-Base interactions energy: -312.272 where: short stacking energy: -152.647 Base-Backbone interact. energy: -0.617 local terms energy: -197.193348 where: bonds (distance) C4'-P energy: -50.216 bonds (distance) P-C4' energy: -34.292 flat angles C4'-P-C4' energy: -41.397 flat angles P-C4'-P energy: -32.176 tors. eta vs tors. theta energy: -39.112 Dist. restrs. and SS energy: 0.747 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -471.285067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.285067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.486370 (E_RNA) where: Base-Base interactions energy: -303.595 where: short stacking energy: -141.081 Base-Backbone interact. energy: 0.754 local terms energy: -169.644976 where: bonds (distance) C4'-P energy: -36.620 bonds (distance) P-C4' energy: -36.020 flat angles C4'-P-C4' energy: -43.933 flat angles P-C4'-P energy: -22.264 tors. eta vs tors. theta energy: -30.809 Dist. restrs. and SS energy: 1.201 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -724.095239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.095239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.471591 (E_RNA) where: Base-Base interactions energy: -480.838 where: short stacking energy: -224.314 Base-Backbone interact. energy: 0.504 local terms energy: -244.137134 where: bonds (distance) C4'-P energy: -41.905 bonds (distance) P-C4' energy: -47.435 flat angles C4'-P-C4' energy: -54.285 flat angles P-C4'-P energy: -33.423 tors. eta vs tors. theta energy: -67.090 Dist. restrs. and SS energy: 0.376 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -713.452643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.452643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.543316 (E_RNA) where: Base-Base interactions energy: -480.559 where: short stacking energy: -233.030 Base-Backbone interact. energy: -0.544 local terms energy: -232.440432 where: bonds (distance) C4'-P energy: -40.558 bonds (distance) P-C4' energy: -47.947 flat angles C4'-P-C4' energy: -40.545 flat angles P-C4'-P energy: -34.707 tors. eta vs tors. theta energy: -68.684 Dist. restrs. and SS energy: 0.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -671.035006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.035006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.558493 (E_RNA) where: Base-Base interactions energy: -453.769 where: short stacking energy: -208.192 Base-Backbone interact. energy: -0.764 local terms energy: -217.025514 where: bonds (distance) C4'-P energy: -43.108 bonds (distance) P-C4' energy: -42.076 flat angles C4'-P-C4' energy: -46.402 flat angles P-C4'-P energy: -27.024 tors. eta vs tors. theta energy: -58.415 Dist. restrs. and SS energy: 0.523 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -674.296762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.296762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.461966 (E_RNA) where: Base-Base interactions energy: -453.303 where: short stacking energy: -208.426 Base-Backbone interact. energy: 0.739 local terms energy: -221.898365 where: bonds (distance) C4'-P energy: -39.367 bonds (distance) P-C4' energy: -44.653 flat angles C4'-P-C4' energy: -45.414 flat angles P-C4'-P energy: -33.067 tors. eta vs tors. theta energy: -59.397 Dist. restrs. and SS energy: 0.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -671.516231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.516231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.692177 (E_RNA) where: Base-Base interactions energy: -452.255 where: short stacking energy: -216.152 Base-Backbone interact. energy: -0.588 local terms energy: -218.848628 where: bonds (distance) C4'-P energy: -35.029 bonds (distance) P-C4' energy: -36.803 flat angles C4'-P-C4' energy: -49.858 flat angles P-C4'-P energy: -31.997 tors. eta vs tors. theta energy: -65.161 Dist. restrs. and SS energy: 0.176 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -590.661106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.661106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.880717 (E_RNA) where: Base-Base interactions energy: -387.400 where: short stacking energy: -180.319 Base-Backbone interact. energy: -0.976 local terms energy: -202.505164 where: bonds (distance) C4'-P energy: -38.304 bonds (distance) P-C4' energy: -44.869 flat angles C4'-P-C4' energy: -40.721 flat angles P-C4'-P energy: -27.045 tors. eta vs tors. theta energy: -51.566 Dist. restrs. and SS energy: 0.220 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -558.685228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.685228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.938297 (E_RNA) where: Base-Base interactions energy: -353.548 where: short stacking energy: -162.586 Base-Backbone interact. energy: 2.637 local terms energy: -208.027417 where: bonds (distance) C4'-P energy: -42.272 bonds (distance) P-C4' energy: -43.805 flat angles C4'-P-C4' energy: -43.616 flat angles P-C4'-P energy: -34.015 tors. eta vs tors. theta energy: -44.321 Dist. restrs. and SS energy: 0.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -511.754752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.754752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.975127 (E_RNA) where: Base-Base interactions energy: -333.132 where: short stacking energy: -157.939 Base-Backbone interact. energy: -0.619 local terms energy: -179.224317 where: bonds (distance) C4'-P energy: -42.165 bonds (distance) P-C4' energy: -27.753 flat angles C4'-P-C4' energy: -46.817 flat angles P-C4'-P energy: -24.460 tors. eta vs tors. theta energy: -38.029 Dist. restrs. and SS energy: 1.220 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -505.262943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.262943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.472905 (E_RNA) where: Base-Base interactions energy: -325.494 where: short stacking energy: -146.439 Base-Backbone interact. energy: -0.095 local terms energy: -179.883999 where: bonds (distance) C4'-P energy: -29.078 bonds (distance) P-C4' energy: -34.685 flat angles C4'-P-C4' energy: -41.168 flat angles P-C4'-P energy: -35.484 tors. eta vs tors. theta energy: -39.470 Dist. restrs. and SS energy: 0.210 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -483.339124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.339124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.452095 (E_RNA) where: Base-Base interactions energy: -306.398 where: short stacking energy: -140.077 Base-Backbone interact. energy: 2.451 local terms energy: -179.504915 where: bonds (distance) C4'-P energy: -35.614 bonds (distance) P-C4' energy: -41.619 flat angles C4'-P-C4' energy: -36.873 flat angles P-C4'-P energy: -33.339 tors. eta vs tors. theta energy: -32.059 Dist. restrs. and SS energy: 0.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -744.059913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.059913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.504758 (E_RNA) where: Base-Base interactions energy: -497.772 where: short stacking energy: -247.172 Base-Backbone interact. energy: -0.613 local terms energy: -246.120030 where: bonds (distance) C4'-P energy: -42.296 bonds (distance) P-C4' energy: -47.797 flat angles C4'-P-C4' energy: -49.547 flat angles P-C4'-P energy: -31.274 tors. eta vs tors. theta energy: -75.207 Dist. restrs. and SS energy: 0.445 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -693.463158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.463158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.421646 (E_RNA) where: Base-Base interactions energy: -467.024 where: short stacking energy: -220.038 Base-Backbone interact. energy: -0.331 local terms energy: -227.066365 where: bonds (distance) C4'-P energy: -39.684 bonds (distance) P-C4' energy: -47.733 flat angles C4'-P-C4' energy: -49.060 flat angles P-C4'-P energy: -32.630 tors. eta vs tors. theta energy: -57.960 Dist. restrs. and SS energy: 0.958 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -669.026984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.026984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.931248 (E_RNA) where: Base-Base interactions energy: -435.901 where: short stacking energy: -201.498 Base-Backbone interact. energy: -0.294 local terms energy: -233.736601 where: bonds (distance) C4'-P energy: -39.177 bonds (distance) P-C4' energy: -50.029 flat angles C4'-P-C4' energy: -51.147 flat angles P-C4'-P energy: -38.620 tors. eta vs tors. theta energy: -54.763 Dist. restrs. and SS energy: 0.904 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -664.609666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.609666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.594483 (E_RNA) where: Base-Base interactions energy: -460.491 where: short stacking energy: -204.876 Base-Backbone interact. energy: -0.910 local terms energy: -204.193334 where: bonds (distance) C4'-P energy: -38.734 bonds (distance) P-C4' energy: -36.312 flat angles C4'-P-C4' energy: -43.743 flat angles P-C4'-P energy: -32.096 tors. eta vs tors. theta energy: -53.307 Dist. restrs. and SS energy: 0.985 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -635.100931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.100931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.289672 (E_RNA) where: Base-Base interactions energy: -425.662 where: short stacking energy: -199.933 Base-Backbone interact. energy: -0.182 local terms energy: -209.445750 where: bonds (distance) C4'-P energy: -34.500 bonds (distance) P-C4' energy: -40.405 flat angles C4'-P-C4' energy: -53.976 flat angles P-C4'-P energy: -28.742 tors. eta vs tors. theta energy: -51.823 Dist. restrs. and SS energy: 0.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -568.860733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.860733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.253996 (E_RNA) where: Base-Base interactions energy: -383.138 where: short stacking energy: -185.270 Base-Backbone interact. energy: 1.558 local terms energy: -187.674251 where: bonds (distance) C4'-P energy: -39.149 bonds (distance) P-C4' energy: -41.435 flat angles C4'-P-C4' energy: -40.506 flat angles P-C4'-P energy: -19.604 tors. eta vs tors. theta energy: -46.980 Dist. restrs. and SS energy: 0.393 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -562.899601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.899601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.579801 (E_RNA) where: Base-Base interactions energy: -372.923 where: short stacking energy: -187.092 Base-Backbone interact. energy: -0.618 local terms energy: -190.039579 where: bonds (distance) C4'-P energy: -36.079 bonds (distance) P-C4' energy: -31.310 flat angles C4'-P-C4' energy: -38.224 flat angles P-C4'-P energy: -29.716 tors. eta vs tors. theta energy: -54.711 Dist. restrs. and SS energy: 0.680 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -502.892186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.892186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.491236 (E_RNA) where: Base-Base interactions energy: -331.065 where: short stacking energy: -138.032 Base-Backbone interact. energy: -1.103 local terms energy: -171.323828 where: bonds (distance) C4'-P energy: -37.078 bonds (distance) P-C4' energy: -41.691 flat angles C4'-P-C4' energy: -33.677 flat angles P-C4'-P energy: -35.038 tors. eta vs tors. theta energy: -23.840 Dist. restrs. and SS energy: 0.599 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -511.281316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.281316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.710291 (E_RNA) where: Base-Base interactions energy: -335.152 where: short stacking energy: -155.208 Base-Backbone interact. energy: -0.862 local terms energy: -175.696649 where: bonds (distance) C4'-P energy: -51.722 bonds (distance) P-C4' energy: -33.162 flat angles C4'-P-C4' energy: -28.934 flat angles P-C4'-P energy: -26.476 tors. eta vs tors. theta energy: -35.403 Dist. restrs. and SS energy: 0.429 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -473.587777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.587777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.246736 (E_RNA) where: Base-Base interactions energy: -313.499 where: short stacking energy: -140.776 Base-Backbone interact. energy: -1.825 local terms energy: -158.922926 where: bonds (distance) C4'-P energy: -28.768 bonds (distance) P-C4' energy: -32.335 flat angles C4'-P-C4' energy: -31.516 flat angles P-C4'-P energy: -29.774 tors. eta vs tors. theta energy: -36.530 Dist. restrs. and SS energy: 0.659 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -719.627420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.627420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.952502 (E_RNA) where: Base-Base interactions energy: -476.046 where: short stacking energy: -220.120 Base-Backbone interact. energy: 0.770 local terms energy: -244.675874 where: bonds (distance) C4'-P energy: -40.885 bonds (distance) P-C4' energy: -44.765 flat angles C4'-P-C4' energy: -56.260 flat angles P-C4'-P energy: -31.909 tors. eta vs tors. theta energy: -70.857 Dist. restrs. and SS energy: 0.325 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -707.630643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.630643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.234688 (E_RNA) where: Base-Base interactions energy: -471.623 where: short stacking energy: -236.291 Base-Backbone interact. energy: -0.295 local terms energy: -236.317527 where: bonds (distance) C4'-P energy: -39.863 bonds (distance) P-C4' energy: -46.457 flat angles C4'-P-C4' energy: -55.864 flat angles P-C4'-P energy: -26.699 tors. eta vs tors. theta energy: -67.435 Dist. restrs. and SS energy: 0.604 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -678.202891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.202891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.367441 (E_RNA) where: Base-Base interactions energy: -443.991 where: short stacking energy: -217.713 Base-Backbone interact. energy: -1.091 local terms energy: -233.285207 where: bonds (distance) C4'-P energy: -42.188 bonds (distance) P-C4' energy: -42.044 flat angles C4'-P-C4' energy: -53.634 flat angles P-C4'-P energy: -34.111 tors. eta vs tors. theta energy: -61.308 Dist. restrs. and SS energy: 0.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -661.330149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.330149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.616393 (E_RNA) where: Base-Base interactions energy: -439.092 where: short stacking energy: -202.985 Base-Backbone interact. energy: -1.072 local terms energy: -221.451918 where: bonds (distance) C4'-P energy: -46.838 bonds (distance) P-C4' energy: -39.318 flat angles C4'-P-C4' energy: -52.841 flat angles P-C4'-P energy: -26.969 tors. eta vs tors. theta energy: -55.485 Dist. restrs. and SS energy: 0.286 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -602.703721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.703721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.038933 (E_RNA) where: Base-Base interactions energy: -382.290 where: short stacking energy: -176.651 Base-Backbone interact. energy: -1.102 local terms energy: -219.646566 where: bonds (distance) C4'-P energy: -36.117 bonds (distance) P-C4' energy: -48.789 flat angles C4'-P-C4' energy: -49.614 flat angles P-C4'-P energy: -32.661 tors. eta vs tors. theta energy: -52.467 Dist. restrs. and SS energy: 0.335 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -566.755703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.755703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.250856 (E_RNA) where: Base-Base interactions energy: -351.010 where: short stacking energy: -174.864 Base-Backbone interact. energy: -0.366 local terms energy: -215.874398 where: bonds (distance) C4'-P energy: -44.828 bonds (distance) P-C4' energy: -42.066 flat angles C4'-P-C4' energy: -47.476 flat angles P-C4'-P energy: -32.209 tors. eta vs tors. theta energy: -49.296 Dist. restrs. and SS energy: 0.495 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -562.839318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.839318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.215018 (E_RNA) where: Base-Base interactions energy: -360.153 where: short stacking energy: -172.613 Base-Backbone interact. energy: 0.597 local terms energy: -203.659002 where: bonds (distance) C4'-P energy: -41.913 bonds (distance) P-C4' energy: -41.904 flat angles C4'-P-C4' energy: -47.583 flat angles P-C4'-P energy: -30.056 tors. eta vs tors. theta energy: -42.204 Dist. restrs. and SS energy: 0.376 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -507.398751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.398751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.525482 (E_RNA) where: Base-Base interactions energy: -329.069 where: short stacking energy: -165.576 Base-Backbone interact. energy: -0.773 local terms energy: -178.683607 where: bonds (distance) C4'-P energy: -36.736 bonds (distance) P-C4' energy: -36.797 flat angles C4'-P-C4' energy: -41.577 flat angles P-C4'-P energy: -22.628 tors. eta vs tors. theta energy: -40.945 Dist. restrs. and SS energy: 1.127 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -515.737590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.737590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.129159 (E_RNA) where: Base-Base interactions energy: -327.800 where: short stacking energy: -142.160 Base-Backbone interact. energy: -2.246 local terms energy: -186.082635 where: bonds (distance) C4'-P energy: -30.119 bonds (distance) P-C4' energy: -47.213 flat angles C4'-P-C4' energy: -46.901 flat angles P-C4'-P energy: -24.515 tors. eta vs tors. theta energy: -37.335 Dist. restrs. and SS energy: 0.392 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -470.914215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.914215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.615267 (E_RNA) where: Base-Base interactions energy: -302.050 where: short stacking energy: -138.054 Base-Backbone interact. energy: -1.810 local terms energy: -167.755161 where: bonds (distance) C4'-P energy: -27.205 bonds (distance) P-C4' energy: -37.948 flat angles C4'-P-C4' energy: -48.434 flat angles P-C4'-P energy: -27.983 tors. eta vs tors. theta energy: -26.184 Dist. restrs. and SS energy: 0.701 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -728.504878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.504878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.620086 (E_RNA) where: Base-Base interactions energy: -481.111 where: short stacking energy: -218.658 Base-Backbone interact. energy: -1.389 local terms energy: -246.120428 where: bonds (distance) C4'-P energy: -41.950 bonds (distance) P-C4' energy: -48.604 flat angles C4'-P-C4' energy: -52.411 flat angles P-C4'-P energy: -35.555 tors. eta vs tors. theta energy: -67.601 Dist. restrs. and SS energy: 0.115 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -730.760369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.760369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.900555 (E_RNA) where: Base-Base interactions energy: -492.189 where: short stacking energy: -232.407 Base-Backbone interact. energy: 0.716 local terms energy: -239.428281 where: bonds (distance) C4'-P energy: -42.561 bonds (distance) P-C4' energy: -40.460 flat angles C4'-P-C4' energy: -53.871 flat angles P-C4'-P energy: -34.523 tors. eta vs tors. theta energy: -68.013 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -663.634468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.634468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.256681 (E_RNA) where: Base-Base interactions energy: -435.726 where: short stacking energy: -183.269 Base-Backbone interact. energy: -0.461 local terms energy: -228.070060 where: bonds (distance) C4'-P energy: -51.734 bonds (distance) P-C4' energy: -49.003 flat angles C4'-P-C4' energy: -47.380 flat angles P-C4'-P energy: -27.242 tors. eta vs tors. theta energy: -52.711 Dist. restrs. and SS energy: 0.622 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -630.931171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.931171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -631.327088 (E_RNA) where: Base-Base interactions energy: -425.113 where: short stacking energy: -189.940 Base-Backbone interact. energy: -0.627 local terms energy: -205.587542 where: bonds (distance) C4'-P energy: -40.676 bonds (distance) P-C4' energy: -44.937 flat angles C4'-P-C4' energy: -46.937 flat angles P-C4'-P energy: -19.954 tors. eta vs tors. theta energy: -53.084 Dist. restrs. and SS energy: 0.396 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -602.576154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.576154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.601876 (E_RNA) where: Base-Base interactions energy: -396.125 where: short stacking energy: -186.737 Base-Backbone interact. energy: -0.164 local terms energy: -206.313203 where: bonds (distance) C4'-P energy: -43.363 bonds (distance) P-C4' energy: -48.307 flat angles C4'-P-C4' energy: -42.987 flat angles P-C4'-P energy: -23.057 tors. eta vs tors. theta energy: -48.600 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -576.673692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.673692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.999368 (E_RNA) where: Base-Base interactions energy: -361.785 where: short stacking energy: -163.981 Base-Backbone interact. energy: -0.298 local terms energy: -214.916942 where: bonds (distance) C4'-P energy: -39.126 bonds (distance) P-C4' energy: -46.644 flat angles C4'-P-C4' energy: -45.388 flat angles P-C4'-P energy: -31.884 tors. eta vs tors. theta energy: -51.876 Dist. restrs. and SS energy: 0.326 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -535.112453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.112453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.059000 (E_RNA) where: Base-Base interactions energy: -338.808 where: short stacking energy: -171.070 Base-Backbone interact. energy: -0.483 local terms energy: -196.767995 where: bonds (distance) C4'-P energy: -44.516 bonds (distance) P-C4' energy: -34.676 flat angles C4'-P-C4' energy: -42.123 flat angles P-C4'-P energy: -32.161 tors. eta vs tors. theta energy: -43.291 Dist. restrs. and SS energy: 0.947 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -528.934117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.934117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.633671 (E_RNA) where: Base-Base interactions energy: -339.482 where: short stacking energy: -160.085 Base-Backbone interact. energy: 4.825 local terms energy: -194.977250 where: bonds (distance) C4'-P energy: -36.548 bonds (distance) P-C4' energy: -36.817 flat angles C4'-P-C4' energy: -45.273 flat angles P-C4'-P energy: -31.181 tors. eta vs tors. theta energy: -45.158 Dist. restrs. and SS energy: 0.700 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -494.766683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.766683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.563246 (E_RNA) where: Base-Base interactions energy: -330.731 where: short stacking energy: -150.395 Base-Backbone interact. energy: 0.099 local terms energy: -164.930791 where: bonds (distance) C4'-P energy: -33.159 bonds (distance) P-C4' energy: -31.851 flat angles C4'-P-C4' energy: -36.867 flat angles P-C4'-P energy: -30.988 tors. eta vs tors. theta energy: -32.065 Dist. restrs. and SS energy: 0.797 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -466.431790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.431790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.965719 (E_RNA) where: Base-Base interactions energy: -295.529 where: short stacking energy: -136.213 Base-Backbone interact. energy: -1.011 local terms energy: -172.425152 where: bonds (distance) C4'-P energy: -35.379 bonds (distance) P-C4' energy: -34.976 flat angles C4'-P-C4' energy: -39.394 flat angles P-C4'-P energy: -30.755 tors. eta vs tors. theta energy: -31.922 Dist. restrs. and SS energy: 2.534 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -713.846211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.846211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.024816 (E_RNA) where: Base-Base interactions energy: -485.407 where: short stacking energy: -225.548 Base-Backbone interact. energy: 0.583 local terms energy: -229.201484 where: bonds (distance) C4'-P energy: -44.140 bonds (distance) P-C4' energy: -40.493 flat angles C4'-P-C4' energy: -50.235 flat angles P-C4'-P energy: -29.783 tors. eta vs tors. theta energy: -64.549 Dist. restrs. and SS energy: 0.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -716.911338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.911338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.459026 (E_RNA) where: Base-Base interactions energy: -469.955 where: short stacking energy: -218.351 Base-Backbone interact. energy: -0.444 local terms energy: -247.060167 where: bonds (distance) C4'-P energy: -49.333 bonds (distance) P-C4' energy: -42.243 flat angles C4'-P-C4' energy: -52.520 flat angles P-C4'-P energy: -34.753 tors. eta vs tors. theta energy: -68.210 Dist. restrs. and SS energy: 0.548 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -649.927663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.927663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.245027 (E_RNA) where: Base-Base interactions energy: -431.410 where: short stacking energy: -217.027 Base-Backbone interact. energy: 0.448 local terms energy: -219.282956 where: bonds (distance) C4'-P energy: -40.882 bonds (distance) P-C4' energy: -46.301 flat angles C4'-P-C4' energy: -49.138 flat angles P-C4'-P energy: -31.187 tors. eta vs tors. theta energy: -51.774 Dist. restrs. and SS energy: 0.317 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -663.901729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.901729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.325123 (E_RNA) where: Base-Base interactions energy: -443.644 where: short stacking energy: -205.015 Base-Backbone interact. energy: -1.508 local terms energy: -219.173016 where: bonds (distance) C4'-P energy: -40.550 bonds (distance) P-C4' energy: -45.445 flat angles C4'-P-C4' energy: -44.562 flat angles P-C4'-P energy: -28.300 tors. eta vs tors. theta energy: -60.317 Dist. restrs. and SS energy: 0.423 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -600.926445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.926445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.404134 (E_RNA) where: Base-Base interactions energy: -388.513 where: short stacking energy: -176.651 Base-Backbone interact. energy: -0.787 local terms energy: -212.103675 where: bonds (distance) C4'-P energy: -42.836 bonds (distance) P-C4' energy: -46.605 flat angles C4'-P-C4' energy: -40.349 flat angles P-C4'-P energy: -29.195 tors. eta vs tors. theta energy: -53.118 Dist. restrs. and SS energy: 0.478 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -570.844587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.844587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.172267 (E_RNA) where: Base-Base interactions energy: -366.421 where: short stacking energy: -169.721 Base-Backbone interact. energy: 1.620 local terms energy: -206.371032 where: bonds (distance) C4'-P energy: -37.302 bonds (distance) P-C4' energy: -49.767 flat angles C4'-P-C4' energy: -43.893 flat angles P-C4'-P energy: -32.470 tors. eta vs tors. theta energy: -42.939 Dist. restrs. and SS energy: 0.328 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -529.180058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.180058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.691852 (E_RNA) where: Base-Base interactions energy: -325.170 where: short stacking energy: -164.575 Base-Backbone interact. energy: -0.503 local terms energy: -204.018784 where: bonds (distance) C4'-P energy: -38.323 bonds (distance) P-C4' energy: -40.149 flat angles C4'-P-C4' energy: -48.861 flat angles P-C4'-P energy: -32.416 tors. eta vs tors. theta energy: -44.269 Dist. restrs. and SS energy: 0.512 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -505.172602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.172602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.805144 (E_RNA) where: Base-Base interactions energy: -315.545 where: short stacking energy: -147.130 Base-Backbone interact. energy: -0.624 local terms energy: -189.636346 where: bonds (distance) C4'-P energy: -37.866 bonds (distance) P-C4' energy: -40.149 flat angles C4'-P-C4' energy: -45.928 flat angles P-C4'-P energy: -22.579 tors. eta vs tors. theta energy: -43.114 Dist. restrs. and SS energy: 0.633 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -510.718849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.718849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.945803 (E_RNA) where: Base-Base interactions energy: -325.426 where: short stacking energy: -155.608 Base-Backbone interact. energy: -0.217 local terms energy: -185.302169 where: bonds (distance) C4'-P energy: -41.536 bonds (distance) P-C4' energy: -46.195 flat angles C4'-P-C4' energy: -34.936 flat angles P-C4'-P energy: -29.730 tors. eta vs tors. theta energy: -32.905 Dist. restrs. and SS energy: 0.227 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -492.332504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.332504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.842457 (E_RNA) where: Base-Base interactions energy: -327.847 where: short stacking energy: -152.599 Base-Backbone interact. energy: -0.810 local terms energy: -164.185499 where: bonds (distance) C4'-P energy: -34.697 bonds (distance) P-C4' energy: -38.035 flat angles C4'-P-C4' energy: -33.804 flat angles P-C4'-P energy: -26.543 tors. eta vs tors. theta energy: -31.106 Dist. restrs. and SS energy: 0.510 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -713.082347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.082347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.044793 (E_RNA) where: Base-Base interactions energy: -475.397 where: short stacking energy: -220.508 Base-Backbone interact. energy: -0.957 local terms energy: -237.690482 where: bonds (distance) C4'-P energy: -49.488 bonds (distance) P-C4' energy: -41.630 flat angles C4'-P-C4' energy: -54.003 flat angles P-C4'-P energy: -29.141 tors. eta vs tors. theta energy: -63.428 Dist. restrs. and SS energy: 0.962 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -673.315816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.315816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.461187 (E_RNA) where: Base-Base interactions energy: -458.275 where: short stacking energy: -198.070 Base-Backbone interact. energy: -0.676 local terms energy: -215.510535 where: bonds (distance) C4'-P energy: -47.372 bonds (distance) P-C4' energy: -40.695 flat angles C4'-P-C4' energy: -42.608 flat angles P-C4'-P energy: -28.741 tors. eta vs tors. theta energy: -56.096 Dist. restrs. and SS energy: 1.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -700.660658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.660658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.642232 (E_RNA) where: Base-Base interactions energy: -453.940 where: short stacking energy: -215.948 Base-Backbone interact. energy: -0.049 local terms energy: -247.653201 where: bonds (distance) C4'-P energy: -47.467 bonds (distance) P-C4' energy: -42.138 flat angles C4'-P-C4' energy: -52.613 flat angles P-C4'-P energy: -39.403 tors. eta vs tors. theta energy: -66.032 Dist. restrs. and SS energy: 0.982 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -613.838156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.838156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.625525 (E_RNA) where: Base-Base interactions energy: -387.691 where: short stacking energy: -177.712 Base-Backbone interact. energy: 1.306 local terms energy: -228.240510 where: bonds (distance) C4'-P energy: -44.680 bonds (distance) P-C4' energy: -44.736 flat angles C4'-P-C4' energy: -51.422 flat angles P-C4'-P energy: -34.756 tors. eta vs tors. theta energy: -52.646 Dist. restrs. and SS energy: 0.787 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -610.888562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -610.888562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.544202 (E_RNA) where: Base-Base interactions energy: -399.484 where: short stacking energy: -182.352 Base-Backbone interact. energy: -0.501 local terms energy: -211.559281 where: bonds (distance) C4'-P energy: -40.638 bonds (distance) P-C4' energy: -44.019 flat angles C4'-P-C4' energy: -46.649 flat angles P-C4'-P energy: -33.106 tors. eta vs tors. theta energy: -47.148 Dist. restrs. and SS energy: 0.656 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -528.299394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.299394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.383778 (E_RNA) where: Base-Base interactions energy: -331.528 where: short stacking energy: -146.492 Base-Backbone interact. energy: -1.075 local terms energy: -196.780636 where: bonds (distance) C4'-P energy: -33.244 bonds (distance) P-C4' energy: -45.719 flat angles C4'-P-C4' energy: -38.208 flat angles P-C4'-P energy: -36.494 tors. eta vs tors. theta energy: -43.116 Dist. restrs. and SS energy: 1.084 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -522.356205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.356205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.930928 (E_RNA) where: Base-Base interactions energy: -314.287 where: short stacking energy: -149.041 Base-Backbone interact. energy: -1.045 local terms energy: -207.598930 where: bonds (distance) C4'-P energy: -43.700 bonds (distance) P-C4' energy: -47.597 flat angles C4'-P-C4' energy: -41.318 flat angles P-C4'-P energy: -28.995 tors. eta vs tors. theta energy: -45.990 Dist. restrs. and SS energy: 0.575 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -490.354244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.354244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.528608 (E_RNA) where: Base-Base interactions energy: -322.502 where: short stacking energy: -150.024 Base-Backbone interact. energy: 0.338 local terms energy: -174.364712 where: bonds (distance) C4'-P energy: -31.528 bonds (distance) P-C4' energy: -34.743 flat angles C4'-P-C4' energy: -41.368 flat angles P-C4'-P energy: -26.134 tors. eta vs tors. theta energy: -40.591 Dist. restrs. and SS energy: 6.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -519.587366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.587366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.944660 (E_RNA) where: Base-Base interactions energy: -332.580 where: short stacking energy: -153.466 Base-Backbone interact. energy: -1.409 local terms energy: -185.955294 where: bonds (distance) C4'-P energy: -41.724 bonds (distance) P-C4' energy: -31.313 flat angles C4'-P-C4' energy: -45.678 flat angles P-C4'-P energy: -26.355 tors. eta vs tors. theta energy: -40.885 Dist. restrs. and SS energy: 0.357 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -464.552183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.552183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.360491 (E_RNA) where: Base-Base interactions energy: -301.750 where: short stacking energy: -140.246 Base-Backbone interact. energy: -1.514 local terms energy: -162.096579 where: bonds (distance) C4'-P energy: -42.830 bonds (distance) P-C4' energy: -45.325 flat angles C4'-P-C4' energy: -24.109 flat angles P-C4'-P energy: -17.063 tors. eta vs tors. theta energy: -32.769 Dist. restrs. and SS energy: 0.808 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -716.650759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.650759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.990202 (E_RNA) where: Base-Base interactions energy: -477.078 where: short stacking energy: -225.911 Base-Backbone interact. energy: -0.888 local terms energy: -239.025078 where: bonds (distance) C4'-P energy: -33.148 bonds (distance) P-C4' energy: -46.023 flat angles C4'-P-C4' energy: -51.940 flat angles P-C4'-P energy: -36.300 tors. eta vs tors. theta energy: -71.614 Dist. restrs. and SS energy: 0.339 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -698.644560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.644560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.170024 (E_RNA) where: Base-Base interactions energy: -470.531 where: short stacking energy: -211.722 Base-Backbone interact. energy: -0.174 local terms energy: -228.464472 where: bonds (distance) C4'-P energy: -44.990 bonds (distance) P-C4' energy: -45.596 flat angles C4'-P-C4' energy: -45.258 flat angles P-C4'-P energy: -36.912 tors. eta vs tors. theta energy: -55.708 Dist. restrs. and SS energy: 0.525 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -709.027211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.027211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.739530 (E_RNA) where: Base-Base interactions energy: -480.284 where: short stacking energy: -219.276 Base-Backbone interact. energy: -0.475 local terms energy: -228.980560 where: bonds (distance) C4'-P energy: -43.899 bonds (distance) P-C4' energy: -40.142 flat angles C4'-P-C4' energy: -50.296 flat angles P-C4'-P energy: -30.394 tors. eta vs tors. theta energy: -64.249 Dist. restrs. and SS energy: 0.712 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -602.384750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.384750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.972190 (E_RNA) where: Base-Base interactions energy: -384.098 where: short stacking energy: -176.427 Base-Backbone interact. energy: -2.095 local terms energy: -216.779002 where: bonds (distance) C4'-P energy: -45.046 bonds (distance) P-C4' energy: -43.758 flat angles C4'-P-C4' energy: -46.822 flat angles P-C4'-P energy: -36.904 tors. eta vs tors. theta energy: -44.250 Dist. restrs. and SS energy: 0.587 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -590.796586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.796586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.433169 (E_RNA) where: Base-Base interactions energy: -375.996 where: short stacking energy: -184.126 Base-Backbone interact. energy: 2.637 local terms energy: -218.074167 where: bonds (distance) C4'-P energy: -47.911 bonds (distance) P-C4' energy: -38.760 flat angles C4'-P-C4' energy: -39.961 flat angles P-C4'-P energy: -32.468 tors. eta vs tors. theta energy: -58.974 Dist. restrs. and SS energy: 0.637 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -614.125386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.125386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.735123 (E_RNA) where: Base-Base interactions energy: -403.397 where: short stacking energy: -178.891 Base-Backbone interact. energy: -0.653 local terms energy: -210.684891 where: bonds (distance) C4'-P energy: -40.994 bonds (distance) P-C4' energy: -44.132 flat angles C4'-P-C4' energy: -49.386 flat angles P-C4'-P energy: -29.024 tors. eta vs tors. theta energy: -47.149 Dist. restrs. and SS energy: 0.610 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -561.316599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.316599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.728979 (E_RNA) where: Base-Base interactions energy: -378.540 where: short stacking energy: -181.721 Base-Backbone interact. energy: -0.557 local terms energy: -182.632282 where: bonds (distance) C4'-P energy: -29.009 bonds (distance) P-C4' energy: -34.940 flat angles C4'-P-C4' energy: -38.845 flat angles P-C4'-P energy: -31.479 tors. eta vs tors. theta energy: -48.360 Dist. restrs. and SS energy: 0.412 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -510.351093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.351093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.931062 (E_RNA) where: Base-Base interactions energy: -341.728 where: short stacking energy: -154.380 Base-Backbone interact. energy: -1.194 local terms energy: -173.009585 where: bonds (distance) C4'-P energy: -31.314 bonds (distance) P-C4' energy: -39.843 flat angles C4'-P-C4' energy: -41.685 flat angles P-C4'-P energy: -21.330 tors. eta vs tors. theta energy: -38.837 Dist. restrs. and SS energy: 5.580 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -501.899931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.899931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.300160 (E_RNA) where: Base-Base interactions energy: -317.524 where: short stacking energy: -160.218 Base-Backbone interact. energy: -0.163 local terms energy: -186.613091 where: bonds (distance) C4'-P energy: -38.771 bonds (distance) P-C4' energy: -40.449 flat angles C4'-P-C4' energy: -39.532 flat angles P-C4'-P energy: -27.866 tors. eta vs tors. theta energy: -39.995 Dist. restrs. and SS energy: 2.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -466.810011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.810011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.031475 (E_RNA) where: Base-Base interactions energy: -304.408 where: short stacking energy: -140.681 Base-Backbone interact. energy: 1.872 local terms energy: -165.495325 where: bonds (distance) C4'-P energy: -37.366 bonds (distance) P-C4' energy: -38.273 flat angles C4'-P-C4' energy: -38.041 flat angles P-C4'-P energy: -24.392 tors. eta vs tors. theta energy: -27.423 Dist. restrs. and SS energy: 1.221 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -715.207402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.207402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.397846 (E_RNA) where: Base-Base interactions energy: -463.724 where: short stacking energy: -216.087 Base-Backbone interact. energy: -0.371 local terms energy: -251.303161 where: bonds (distance) C4'-P energy: -49.352 bonds (distance) P-C4' energy: -49.770 flat angles C4'-P-C4' energy: -50.384 flat angles P-C4'-P energy: -33.337 tors. eta vs tors. theta energy: -68.460 Dist. restrs. and SS energy: 0.190 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -686.432461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.432461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.652302 (E_RNA) where: Base-Base interactions energy: -454.525 where: short stacking energy: -208.012 Base-Backbone interact. energy: 0.661 local terms energy: -232.788444 where: bonds (distance) C4'-P energy: -42.331 bonds (distance) P-C4' energy: -44.468 flat angles C4'-P-C4' energy: -52.814 flat angles P-C4'-P energy: -30.477 tors. eta vs tors. theta energy: -62.699 Dist. restrs. and SS energy: 0.220 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -699.684891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.684891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.109436 (E_RNA) where: Base-Base interactions energy: -460.643 where: short stacking energy: -217.438 Base-Backbone interact. energy: -0.837 local terms energy: -238.629092 where: bonds (distance) C4'-P energy: -43.199 bonds (distance) P-C4' energy: -45.215 flat angles C4'-P-C4' energy: -52.257 flat angles P-C4'-P energy: -36.662 tors. eta vs tors. theta energy: -61.296 Dist. restrs. and SS energy: 0.425 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -601.574557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.574557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.155633 (E_RNA) where: Base-Base interactions energy: -393.437 where: short stacking energy: -183.374 Base-Backbone interact. energy: -1.233 local terms energy: -207.484931 where: bonds (distance) C4'-P energy: -43.877 bonds (distance) P-C4' energy: -44.358 flat angles C4'-P-C4' energy: -47.000 flat angles P-C4'-P energy: -23.395 tors. eta vs tors. theta energy: -48.855 Dist. restrs. and SS energy: 0.581 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -576.267752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.267752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.957391 (E_RNA) where: Base-Base interactions energy: -383.585 where: short stacking energy: -172.785 Base-Backbone interact. energy: 1.730 local terms energy: -200.102488 where: bonds (distance) C4'-P energy: -39.135 bonds (distance) P-C4' energy: -43.603 flat angles C4'-P-C4' energy: -40.000 flat angles P-C4'-P energy: -28.894 tors. eta vs tors. theta energy: -48.470 Dist. restrs. and SS energy: 5.690 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -607.735484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.735484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.175631 (E_RNA) where: Base-Base interactions energy: -392.232 where: short stacking energy: -173.892 Base-Backbone interact. energy: -0.645 local terms energy: -215.299498 where: bonds (distance) C4'-P energy: -36.212 bonds (distance) P-C4' energy: -48.441 flat angles C4'-P-C4' energy: -52.000 flat angles P-C4'-P energy: -27.690 tors. eta vs tors. theta energy: -50.955 Dist. restrs. and SS energy: 0.440 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -562.629111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.629111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.023525 (E_RNA) where: Base-Base interactions energy: -350.816 where: short stacking energy: -159.265 Base-Backbone interact. energy: 1.297 local terms energy: -213.505191 where: bonds (distance) C4'-P energy: -41.240 bonds (distance) P-C4' energy: -44.459 flat angles C4'-P-C4' energy: -48.180 flat angles P-C4'-P energy: -34.657 tors. eta vs tors. theta energy: -44.969 Dist. restrs. and SS energy: 0.394 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -483.720862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.720862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.701188 (E_RNA) where: Base-Base interactions energy: -324.150 where: short stacking energy: -134.288 Base-Backbone interact. energy: -0.353 local terms energy: -167.197750 where: bonds (distance) C4'-P energy: -28.871 bonds (distance) P-C4' energy: -49.203 flat angles C4'-P-C4' energy: -39.540 flat angles P-C4'-P energy: -23.901 tors. eta vs tors. theta energy: -25.683 Dist. restrs. and SS energy: 7.980 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -476.480035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.480035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.685135 (E_RNA) where: Base-Base interactions energy: -310.319 where: short stacking energy: -141.479 Base-Backbone interact. energy: -0.331 local terms energy: -166.035005 where: bonds (distance) C4'-P energy: -37.480 bonds (distance) P-C4' energy: -35.583 flat angles C4'-P-C4' energy: -39.214 flat angles P-C4'-P energy: -15.509 tors. eta vs tors. theta energy: -38.249 Dist. restrs. and SS energy: 0.205 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -442.840792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.840792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.250360 (E_RNA) where: Base-Base interactions energy: -279.067 where: short stacking energy: -121.615 Base-Backbone interact. energy: 4.381 local terms energy: -168.564045 where: bonds (distance) C4'-P energy: -27.632 bonds (distance) P-C4' energy: -42.552 flat angles C4'-P-C4' energy: -38.669 flat angles P-C4'-P energy: -29.335 tors. eta vs tors. theta energy: -30.376 Dist. restrs. and SS energy: 0.410 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -727.479710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.479710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.908272 (E_RNA) where: Base-Base interactions energy: -482.089 where: short stacking energy: -223.942 Base-Backbone interact. energy: -0.559 local terms energy: -245.260100 where: bonds (distance) C4'-P energy: -47.320 bonds (distance) P-C4' energy: -45.641 flat angles C4'-P-C4' energy: -55.025 flat angles P-C4'-P energy: -32.812 tors. eta vs tors. theta energy: -64.461 Dist. restrs. and SS energy: 0.429 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -689.576547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.576547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.909626 (E_RNA) where: Base-Base interactions energy: -449.172 where: short stacking energy: -214.228 Base-Backbone interact. energy: 0.942 local terms energy: -241.679711 where: bonds (distance) C4'-P energy: -44.290 bonds (distance) P-C4' energy: -50.362 flat angles C4'-P-C4' energy: -52.883 flat angles P-C4'-P energy: -34.574 tors. eta vs tors. theta energy: -59.571 Dist. restrs. and SS energy: 0.333 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -697.502977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.502977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.784107 (E_RNA) where: Base-Base interactions energy: -456.849 where: short stacking energy: -209.738 Base-Backbone interact. energy: -1.434 local terms energy: -239.501033 where: bonds (distance) C4'-P energy: -42.920 bonds (distance) P-C4' energy: -46.215 flat angles C4'-P-C4' energy: -48.888 flat angles P-C4'-P energy: -38.457 tors. eta vs tors. theta energy: -63.021 Dist. restrs. and SS energy: 0.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -596.982754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.982754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.107048 (E_RNA) where: Base-Base interactions energy: -388.672 where: short stacking energy: -190.888 Base-Backbone interact. energy: 0.957 local terms energy: -209.392549 where: bonds (distance) C4'-P energy: -41.749 bonds (distance) P-C4' energy: -34.973 flat angles C4'-P-C4' energy: -51.179 flat angles P-C4'-P energy: -34.038 tors. eta vs tors. theta energy: -47.454 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -633.534588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.534588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.787653 (E_RNA) where: Base-Base interactions energy: -418.294 where: short stacking energy: -186.504 Base-Backbone interact. energy: 1.714 local terms energy: -217.207747 where: bonds (distance) C4'-P energy: -42.075 bonds (distance) P-C4' energy: -42.659 flat angles C4'-P-C4' energy: -47.768 flat angles P-C4'-P energy: -29.969 tors. eta vs tors. theta energy: -54.737 Dist. restrs. and SS energy: 0.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -562.732660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.732660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.854170 (E_RNA) where: Base-Base interactions energy: -376.163 where: short stacking energy: -167.212 Base-Backbone interact. energy: -1.391 local terms energy: -185.300263 where: bonds (distance) C4'-P energy: -46.515 bonds (distance) P-C4' energy: -40.576 flat angles C4'-P-C4' energy: -32.424 flat angles P-C4'-P energy: -25.700 tors. eta vs tors. theta energy: -40.085 Dist. restrs. and SS energy: 0.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -522.633750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.633750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.888666 (E_RNA) where: Base-Base interactions energy: -333.756 where: short stacking energy: -162.674 Base-Backbone interact. energy: 2.248 local terms energy: -199.380807 where: bonds (distance) C4'-P energy: -46.264 bonds (distance) P-C4' energy: -48.300 flat angles C4'-P-C4' energy: -48.036 flat angles P-C4'-P energy: -20.526 tors. eta vs tors. theta energy: -36.254 Dist. restrs. and SS energy: 8.255 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -532.286536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.286536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.507124 (E_RNA) where: Base-Base interactions energy: -343.219 where: short stacking energy: -160.266 Base-Backbone interact. energy: -1.093 local terms energy: -188.194400 where: bonds (distance) C4'-P energy: -39.966 bonds (distance) P-C4' energy: -36.578 flat angles C4'-P-C4' energy: -35.655 flat angles P-C4'-P energy: -32.548 tors. eta vs tors. theta energy: -43.447 Dist. restrs. and SS energy: 0.221 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -490.481483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.481483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.718926 (E_RNA) where: Base-Base interactions energy: -300.212 where: short stacking energy: -136.897 Base-Backbone interact. energy: -0.766 local terms energy: -190.740709 where: bonds (distance) C4'-P energy: -30.410 bonds (distance) P-C4' energy: -43.170 flat angles C4'-P-C4' energy: -45.913 flat angles P-C4'-P energy: -32.640 tors. eta vs tors. theta energy: -38.608 Dist. restrs. and SS energy: 1.237 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -464.578755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.578755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.300788 (E_RNA) where: Base-Base interactions energy: -294.717 where: short stacking energy: -140.276 Base-Backbone interact. energy: -0.409 local terms energy: -170.175235 where: bonds (distance) C4'-P energy: -38.376 bonds (distance) P-C4' energy: -37.811 flat angles C4'-P-C4' energy: -41.095 flat angles P-C4'-P energy: -24.597 tors. eta vs tors. theta energy: -28.296 Dist. restrs. and SS energy: 0.722 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -736.024132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.024132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.085251 (E_RNA) where: Base-Base interactions energy: -495.419 where: short stacking energy: -227.572 Base-Backbone interact. energy: -1.988 local terms energy: -238.678319 where: bonds (distance) C4'-P energy: -41.845 bonds (distance) P-C4' energy: -41.873 flat angles C4'-P-C4' energy: -53.111 flat angles P-C4'-P energy: -33.648 tors. eta vs tors. theta energy: -68.201 Dist. restrs. and SS energy: 0.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -713.950194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.950194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.262081 (E_RNA) where: Base-Base interactions energy: -474.974 where: short stacking energy: -217.289 Base-Backbone interact. energy: -0.297 local terms energy: -238.991067 where: bonds (distance) C4'-P energy: -43.271 bonds (distance) P-C4' energy: -41.686 flat angles C4'-P-C4' energy: -51.806 flat angles P-C4'-P energy: -37.295 tors. eta vs tors. theta energy: -64.933 Dist. restrs. and SS energy: 0.312 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -669.972222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.972222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.038253 (E_RNA) where: Base-Base interactions energy: -448.394 where: short stacking energy: -195.220 Base-Backbone interact. energy: -1.501 local terms energy: -221.143510 where: bonds (distance) C4'-P energy: -46.032 bonds (distance) P-C4' energy: -47.610 flat angles C4'-P-C4' energy: -48.895 flat angles P-C4'-P energy: -29.765 tors. eta vs tors. theta energy: -48.842 Dist. restrs. and SS energy: 1.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -672.419677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.419677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.749243 (E_RNA) where: Base-Base interactions energy: -454.465 where: short stacking energy: -206.032 Base-Backbone interact. energy: 0.699 local terms energy: -218.983728 where: bonds (distance) C4'-P energy: -41.863 bonds (distance) P-C4' energy: -37.703 flat angles C4'-P-C4' energy: -52.518 flat angles P-C4'-P energy: -28.744 tors. eta vs tors. theta energy: -58.157 Dist. restrs. and SS energy: 0.330 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -587.965049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.965049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.641806 (E_RNA) where: Base-Base interactions energy: -377.858 where: short stacking energy: -176.551 Base-Backbone interact. energy: -0.364 local terms energy: -210.419932 where: bonds (distance) C4'-P energy: -45.847 bonds (distance) P-C4' energy: -40.629 flat angles C4'-P-C4' energy: -43.261 flat angles P-C4'-P energy: -32.312 tors. eta vs tors. theta energy: -48.371 Dist. restrs. and SS energy: 0.677 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -522.908707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.908707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.766892 (E_RNA) where: Base-Base interactions energy: -337.437 where: short stacking energy: -159.369 Base-Backbone interact. energy: -1.317 local terms energy: -196.013247 where: bonds (distance) C4'-P energy: -40.407 bonds (distance) P-C4' energy: -42.362 flat angles C4'-P-C4' energy: -48.866 flat angles P-C4'-P energy: -29.098 tors. eta vs tors. theta energy: -35.280 Dist. restrs. and SS energy: 11.858 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -556.722463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.722463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.640885 (E_RNA) where: Base-Base interactions energy: -356.084 where: short stacking energy: -172.544 Base-Backbone interact. energy: 0.089 local terms energy: -201.645738 where: bonds (distance) C4'-P energy: -36.130 bonds (distance) P-C4' energy: -40.280 flat angles C4'-P-C4' energy: -47.583 flat angles P-C4'-P energy: -29.698 tors. eta vs tors. theta energy: -47.955 Dist. restrs. and SS energy: 0.918 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -545.560278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.560278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.605754 (E_RNA) where: Base-Base interactions energy: -336.699 where: short stacking energy: -153.471 Base-Backbone interact. energy: -0.383 local terms energy: -209.524180 where: bonds (distance) C4'-P energy: -42.362 bonds (distance) P-C4' energy: -39.736 flat angles C4'-P-C4' energy: -48.230 flat angles P-C4'-P energy: -36.223 tors. eta vs tors. theta energy: -42.974 Dist. restrs. and SS energy: 1.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -489.767285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.767285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.567248 (E_RNA) where: Base-Base interactions energy: -307.524 where: short stacking energy: -151.190 Base-Backbone interact. energy: -0.657 local terms energy: -182.386429 where: bonds (distance) C4'-P energy: -41.250 bonds (distance) P-C4' energy: -36.722 flat angles C4'-P-C4' energy: -41.906 flat angles P-C4'-P energy: -22.296 tors. eta vs tors. theta energy: -40.212 Dist. restrs. and SS energy: 0.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -464.241797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.241797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.628837 (E_RNA) where: Base-Base interactions energy: -323.860 where: short stacking energy: -154.880 Base-Backbone interact. energy: 0.972 local terms energy: -141.740204 where: bonds (distance) C4'-P energy: -30.035 bonds (distance) P-C4' energy: -38.021 flat angles C4'-P-C4' energy: -28.365 flat angles P-C4'-P energy: -16.844 tors. eta vs tors. theta energy: -28.476 Dist. restrs. and SS energy: 0.387 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -738.566976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.566976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.836566 (E_RNA) where: Base-Base interactions energy: -483.595 where: short stacking energy: -232.060 Base-Backbone interact. energy: -0.539 local terms energy: -254.703256 where: bonds (distance) C4'-P energy: -48.757 bonds (distance) P-C4' energy: -48.630 flat angles C4'-P-C4' energy: -48.159 flat angles P-C4'-P energy: -37.745 tors. eta vs tors. theta energy: -71.412 Dist. restrs. and SS energy: 0.270 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -722.880901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.880901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.030870 (E_RNA) where: Base-Base interactions energy: -489.718 where: short stacking energy: -236.077 Base-Backbone interact. energy: 0.737 local terms energy: -234.050289 where: bonds (distance) C4'-P energy: -40.355 bonds (distance) P-C4' energy: -40.503 flat angles C4'-P-C4' energy: -47.122 flat angles P-C4'-P energy: -36.108 tors. eta vs tors. theta energy: -69.961 Dist. restrs. and SS energy: 0.150 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -654.093312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.093312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.309432 (E_RNA) where: Base-Base interactions energy: -447.926 where: short stacking energy: -193.796 Base-Backbone interact. energy: -0.618 local terms energy: -205.765486 where: bonds (distance) C4'-P energy: -38.962 bonds (distance) P-C4' energy: -48.529 flat angles C4'-P-C4' energy: -45.294 flat angles P-C4'-P energy: -21.376 tors. eta vs tors. theta energy: -51.605 Dist. restrs. and SS energy: 0.216 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -663.267119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.267119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.565886 (E_RNA) where: Base-Base interactions energy: -449.022 where: short stacking energy: -198.045 Base-Backbone interact. energy: -0.891 local terms energy: -213.652881 where: bonds (distance) C4'-P energy: -41.550 bonds (distance) P-C4' energy: -42.835 flat angles C4'-P-C4' energy: -51.285 flat angles P-C4'-P energy: -23.193 tors. eta vs tors. theta energy: -54.790 Dist. restrs. and SS energy: 0.299 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -603.421582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.421582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.681623 (E_RNA) where: Base-Base interactions energy: -385.585 where: short stacking energy: -189.533 Base-Backbone interact. energy: -0.140 local terms energy: -217.956543 where: bonds (distance) C4'-P energy: -41.508 bonds (distance) P-C4' energy: -35.709 flat angles C4'-P-C4' energy: -52.834 flat angles P-C4'-P energy: -34.976 tors. eta vs tors. theta energy: -52.930 Dist. restrs. and SS energy: 0.260 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -549.000706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.000706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.376935 (E_RNA) where: Base-Base interactions energy: -359.381 where: short stacking energy: -168.626 Base-Backbone interact. energy: -2.242 local terms energy: -187.753807 where: bonds (distance) C4'-P energy: -35.738 bonds (distance) P-C4' energy: -39.200 flat angles C4'-P-C4' energy: -42.771 flat angles P-C4'-P energy: -25.983 tors. eta vs tors. theta energy: -44.061 Dist. restrs. and SS energy: 0.376 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -582.220814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.220814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.919264 (E_RNA) where: Base-Base interactions energy: -390.822 where: short stacking energy: -174.511 Base-Backbone interact. energy: -1.515 local terms energy: -190.582033 where: bonds (distance) C4'-P energy: -44.117 bonds (distance) P-C4' energy: -31.721 flat angles C4'-P-C4' energy: -39.734 flat angles P-C4'-P energy: -19.553 tors. eta vs tors. theta energy: -55.457 Dist. restrs. and SS energy: 0.698 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -536.064376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.064376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.825989 (E_RNA) where: Base-Base interactions energy: -349.843 where: short stacking energy: -166.146 Base-Backbone interact. energy: -0.684 local terms energy: -186.299097 where: bonds (distance) C4'-P energy: -45.235 bonds (distance) P-C4' energy: -39.520 flat angles C4'-P-C4' energy: -37.019 flat angles P-C4'-P energy: -20.569 tors. eta vs tors. theta energy: -43.957 Dist. restrs. and SS energy: 0.762 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -496.543048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.543048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.984820 (E_RNA) where: Base-Base interactions energy: -324.120 where: short stacking energy: -133.251 Base-Backbone interact. energy: -1.949 local terms energy: -170.915727 where: bonds (distance) C4'-P energy: -34.000 bonds (distance) P-C4' energy: -42.514 flat angles C4'-P-C4' energy: -34.349 flat angles P-C4'-P energy: -31.161 tors. eta vs tors. theta energy: -28.891 Dist. restrs. and SS energy: 0.442 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -461.434571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.434571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.502180 (E_RNA) where: Base-Base interactions energy: -305.270 where: short stacking energy: -138.506 Base-Backbone interact. energy: 0.675 local terms energy: -157.907867 where: bonds (distance) C4'-P energy: -37.632 bonds (distance) P-C4' energy: -34.695 flat angles C4'-P-C4' energy: -40.482 flat angles P-C4'-P energy: -23.024 tors. eta vs tors. theta energy: -22.074 Dist. restrs. and SS energy: 1.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -746.326403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.326403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.915608 (E_RNA) where: Base-Base interactions energy: -496.775 where: short stacking energy: -235.021 Base-Backbone interact. energy: 2.972 local terms energy: -253.112737 where: bonds (distance) C4'-P energy: -49.545 bonds (distance) P-C4' energy: -45.021 flat angles C4'-P-C4' energy: -52.219 flat angles P-C4'-P energy: -35.645 tors. eta vs tors. theta energy: -70.683 Dist. restrs. and SS energy: 0.589 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -721.056406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.056406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.225129 (E_RNA) where: Base-Base interactions energy: -485.658 where: short stacking energy: -232.762 Base-Backbone interact. energy: -0.798 local terms energy: -234.769245 where: bonds (distance) C4'-P energy: -46.067 bonds (distance) P-C4' energy: -41.157 flat angles C4'-P-C4' energy: -50.381 flat angles P-C4'-P energy: -33.486 tors. eta vs tors. theta energy: -63.678 Dist. restrs. and SS energy: 0.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -674.030740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.030740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.075659 (E_RNA) where: Base-Base interactions energy: -447.622 where: short stacking energy: -210.227 Base-Backbone interact. energy: -0.540 local terms energy: -225.913703 where: bonds (distance) C4'-P energy: -37.781 bonds (distance) P-C4' energy: -45.794 flat angles C4'-P-C4' energy: -51.455 flat angles P-C4'-P energy: -30.403 tors. eta vs tors. theta energy: -60.481 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -627.181025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -627.181025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.106668 (E_RNA) where: Base-Base interactions energy: -390.755 where: short stacking energy: -199.867 Base-Backbone interact. energy: -1.212 local terms energy: -236.138783 where: bonds (distance) C4'-P energy: -47.734 bonds (distance) P-C4' energy: -45.560 flat angles C4'-P-C4' energy: -40.622 flat angles P-C4'-P energy: -43.418 tors. eta vs tors. theta energy: -58.804 Dist. restrs. and SS energy: 0.926 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -627.797126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -627.797126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.388967 (E_RNA) where: Base-Base interactions energy: -418.758 where: short stacking energy: -194.232 Base-Backbone interact. energy: -0.906 local terms energy: -208.725273 where: bonds (distance) C4'-P energy: -40.219 bonds (distance) P-C4' energy: -39.253 flat angles C4'-P-C4' energy: -51.780 flat angles P-C4'-P energy: -25.155 tors. eta vs tors. theta energy: -52.318 Dist. restrs. and SS energy: 0.592 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -589.277242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.277242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.008222 (E_RNA) where: Base-Base interactions energy: -378.317 where: short stacking energy: -196.447 Base-Backbone interact. energy: -0.493 local terms energy: -211.198653 where: bonds (distance) C4'-P energy: -35.753 bonds (distance) P-C4' energy: -35.981 flat angles C4'-P-C4' energy: -48.335 flat angles P-C4'-P energy: -34.684 tors. eta vs tors. theta energy: -56.446 Dist. restrs. and SS energy: 0.731 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -531.943591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.943591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.858175 (E_RNA) where: Base-Base interactions energy: -360.215 where: short stacking energy: -178.053 Base-Backbone interact. energy: 0.348 local terms energy: -172.991860 where: bonds (distance) C4'-P energy: -29.375 bonds (distance) P-C4' energy: -39.051 flat angles C4'-P-C4' energy: -38.978 flat angles P-C4'-P energy: -23.602 tors. eta vs tors. theta energy: -41.986 Dist. restrs. and SS energy: 0.915 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -501.546228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.546228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.176016 (E_RNA) where: Base-Base interactions energy: -321.549 where: short stacking energy: -160.504 Base-Backbone interact. energy: 0.787 local terms energy: -181.414377 where: bonds (distance) C4'-P energy: -32.027 bonds (distance) P-C4' energy: -35.337 flat angles C4'-P-C4' energy: -45.251 flat angles P-C4'-P energy: -28.542 tors. eta vs tors. theta energy: -40.257 Dist. restrs. and SS energy: 0.630 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -490.792412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.792412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.292270 (E_RNA) where: Base-Base interactions energy: -309.361 where: short stacking energy: -138.315 Base-Backbone interact. energy: -1.086 local terms energy: -180.845502 where: bonds (distance) C4'-P energy: -32.920 bonds (distance) P-C4' energy: -45.869 flat angles C4'-P-C4' energy: -34.390 flat angles P-C4'-P energy: -30.221 tors. eta vs tors. theta energy: -37.446 Dist. restrs. and SS energy: 0.500 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -467.082973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.082973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.900038 (E_RNA) where: Base-Base interactions energy: -302.561 where: short stacking energy: -146.276 Base-Backbone interact. energy: -0.153 local terms energy: -165.185347 where: bonds (distance) C4'-P energy: -35.207 bonds (distance) P-C4' energy: -32.466 flat angles C4'-P-C4' energy: -38.355 flat angles P-C4'-P energy: -24.201 tors. eta vs tors. theta energy: -34.956 Dist. restrs. and SS energy: 0.817 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -726.242917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.242917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -726.544701 (E_RNA) where: Base-Base interactions energy: -487.965 where: short stacking energy: -235.054 Base-Backbone interact. energy: -0.485 local terms energy: -238.094839 where: bonds (distance) C4'-P energy: -46.388 bonds (distance) P-C4' energy: -40.685 flat angles C4'-P-C4' energy: -51.289 flat angles P-C4'-P energy: -34.859 tors. eta vs tors. theta energy: -64.874 Dist. restrs. and SS energy: 0.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -719.206734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -719.206734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.352928 (E_RNA) where: Base-Base interactions energy: -469.227 where: short stacking energy: -220.980 Base-Backbone interact. energy: -0.636 local terms energy: -249.489487 where: bonds (distance) C4'-P energy: -44.761 bonds (distance) P-C4' energy: -46.538 flat angles C4'-P-C4' energy: -47.347 flat angles P-C4'-P energy: -44.224 tors. eta vs tors. theta energy: -66.620 Dist. restrs. and SS energy: 0.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -675.881897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.881897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.146573 (E_RNA) where: Base-Base interactions energy: -444.563 where: short stacking energy: -215.688 Base-Backbone interact. energy: -1.076 local terms energy: -230.508221 where: bonds (distance) C4'-P energy: -42.309 bonds (distance) P-C4' energy: -46.764 flat angles C4'-P-C4' energy: -52.026 flat angles P-C4'-P energy: -26.403 tors. eta vs tors. theta energy: -63.005 Dist. restrs. and SS energy: 0.265 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -602.541220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.541220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.154330 (E_RNA) where: Base-Base interactions energy: -401.654 where: short stacking energy: -191.931 Base-Backbone interact. energy: -0.363 local terms energy: -201.137212 where: bonds (distance) C4'-P energy: -34.181 bonds (distance) P-C4' energy: -35.992 flat angles C4'-P-C4' energy: -52.138 flat angles P-C4'-P energy: -30.565 tors. eta vs tors. theta energy: -48.261 Dist. restrs. and SS energy: 0.613 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -661.352137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.352137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.703833 (E_RNA) where: Base-Base interactions energy: -451.111 where: short stacking energy: -187.416 Base-Backbone interact. energy: -0.511 local terms energy: -211.081026 where: bonds (distance) C4'-P energy: -48.919 bonds (distance) P-C4' energy: -44.798 flat angles C4'-P-C4' energy: -40.670 flat angles P-C4'-P energy: -23.406 tors. eta vs tors. theta energy: -53.288 Dist. restrs. and SS energy: 1.352 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -554.215696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.215696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.813458 (E_RNA) where: Base-Base interactions energy: -369.923 where: short stacking energy: -184.678 Base-Backbone interact. energy: -0.677 local terms energy: -184.213640 where: bonds (distance) C4'-P energy: -37.453 bonds (distance) P-C4' energy: -30.208 flat angles C4'-P-C4' energy: -41.421 flat angles P-C4'-P energy: -22.532 tors. eta vs tors. theta energy: -52.600 Dist. restrs. and SS energy: 0.598 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -528.971905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.971905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.500106 (E_RNA) where: Base-Base interactions energy: -342.699 where: short stacking energy: -154.618 Base-Backbone interact. energy: -0.698 local terms energy: -186.103898 where: bonds (distance) C4'-P energy: -34.290 bonds (distance) P-C4' energy: -38.284 flat angles C4'-P-C4' energy: -44.514 flat angles P-C4'-P energy: -33.264 tors. eta vs tors. theta energy: -35.751 Dist. restrs. and SS energy: 0.528 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -535.842992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.842992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.114390 (E_RNA) where: Base-Base interactions energy: -353.872 where: short stacking energy: -150.199 Base-Backbone interact. energy: -0.739 local terms energy: -181.503638 where: bonds (distance) C4'-P energy: -41.822 bonds (distance) P-C4' energy: -33.151 flat angles C4'-P-C4' energy: -41.269 flat angles P-C4'-P energy: -28.118 tors. eta vs tors. theta energy: -37.144 Dist. restrs. and SS energy: 0.271 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -494.420020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.420020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.229466 (E_RNA) where: Base-Base interactions energy: -308.721 where: short stacking energy: -148.461 Base-Backbone interact. energy: -0.438 local terms energy: -186.070678 where: bonds (distance) C4'-P energy: -30.666 bonds (distance) P-C4' energy: -46.687 flat angles C4'-P-C4' energy: -46.237 flat angles P-C4'-P energy: -24.653 tors. eta vs tors. theta energy: -37.827 Dist. restrs. and SS energy: 0.809 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -455.194182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.194182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.908797 (E_RNA) where: Base-Base interactions energy: -295.467 where: short stacking energy: -135.102 Base-Backbone interact. energy: 0.176 local terms energy: -160.617602 where: bonds (distance) C4'-P energy: -39.246 bonds (distance) P-C4' energy: -43.355 flat angles C4'-P-C4' energy: -33.743 flat angles P-C4'-P energy: -20.913 tors. eta vs tors. theta energy: -23.361 Dist. restrs. and SS energy: 0.715 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -731.848793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.848793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.154998 (E_RNA) where: Base-Base interactions energy: -478.415 where: short stacking energy: -230.635 Base-Backbone interact. energy: -0.681 local terms energy: -253.058816 where: bonds (distance) C4'-P energy: -51.543 bonds (distance) P-C4' energy: -42.597 flat angles C4'-P-C4' energy: -50.184 flat angles P-C4'-P energy: -38.462 tors. eta vs tors. theta energy: -70.272 Dist. restrs. and SS energy: 0.306 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -715.635793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.635793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.450287 (E_RNA) where: Base-Base interactions energy: -468.561 where: short stacking energy: -215.868 Base-Backbone interact. energy: -1.181 local terms energy: -246.708721 where: bonds (distance) C4'-P energy: -42.186 bonds (distance) P-C4' energy: -49.696 flat angles C4'-P-C4' energy: -51.937 flat angles P-C4'-P energy: -34.987 tors. eta vs tors. theta energy: -67.903 Dist. restrs. and SS energy: 0.814 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -679.441316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.441316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.839234 (E_RNA) where: Base-Base interactions energy: -463.920 where: short stacking energy: -216.616 Base-Backbone interact. energy: -0.935 local terms energy: -214.983928 where: bonds (distance) C4'-P energy: -32.531 bonds (distance) P-C4' energy: -44.657 flat angles C4'-P-C4' energy: -53.729 flat angles P-C4'-P energy: -23.924 tors. eta vs tors. theta energy: -60.143 Dist. restrs. and SS energy: 0.398 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -677.105465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.105465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.787508 (E_RNA) where: Base-Base interactions energy: -463.155 where: short stacking energy: -207.921 Base-Backbone interact. energy: -1.428 local terms energy: -213.204819 where: bonds (distance) C4'-P energy: -35.186 bonds (distance) P-C4' energy: -41.643 flat angles C4'-P-C4' energy: -46.949 flat angles P-C4'-P energy: -29.145 tors. eta vs tors. theta energy: -60.281 Dist. restrs. and SS energy: 0.682 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -647.095745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.095745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.254940 (E_RNA) where: Base-Base interactions energy: -426.626 where: short stacking energy: -193.482 Base-Backbone interact. energy: 0.842 local terms energy: -221.471141 where: bonds (distance) C4'-P energy: -43.997 bonds (distance) P-C4' energy: -47.050 flat angles C4'-P-C4' energy: -48.724 flat angles P-C4'-P energy: -30.574 tors. eta vs tors. theta energy: -51.126 Dist. restrs. and SS energy: 0.159 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -539.337367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.337367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.845314 (E_RNA) where: Base-Base interactions energy: -344.243 where: short stacking energy: -159.446 Base-Backbone interact. energy: -0.926 local terms energy: -194.676173 where: bonds (distance) C4'-P energy: -33.074 bonds (distance) P-C4' energy: -45.650 flat angles C4'-P-C4' energy: -39.460 flat angles P-C4'-P energy: -33.866 tors. eta vs tors. theta energy: -42.625 Dist. restrs. and SS energy: 0.508 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -519.921763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.921763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.997035 (E_RNA) where: Base-Base interactions energy: -348.048 where: short stacking energy: -152.803 Base-Backbone interact. energy: 2.034 local terms energy: -173.983304 where: bonds (distance) C4'-P energy: -38.737 bonds (distance) P-C4' energy: -37.960 flat angles C4'-P-C4' energy: -38.645 flat angles P-C4'-P energy: -20.338 tors. eta vs tors. theta energy: -38.303 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -494.981129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.981129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.282786 (E_RNA) where: Base-Base interactions energy: -315.696 where: short stacking energy: -144.047 Base-Backbone interact. energy: -0.679 local terms energy: -183.907748 where: bonds (distance) C4'-P energy: -42.881 bonds (distance) P-C4' energy: -43.110 flat angles C4'-P-C4' energy: -28.405 flat angles P-C4'-P energy: -25.432 tors. eta vs tors. theta energy: -44.079 Dist. restrs. and SS energy: 5.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -501.878791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.878791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.320644 (E_RNA) where: Base-Base interactions energy: -310.911 where: short stacking energy: -149.209 Base-Backbone interact. energy: -1.892 local terms energy: -189.516948 where: bonds (distance) C4'-P energy: -36.541 bonds (distance) P-C4' energy: -38.237 flat angles C4'-P-C4' energy: -44.025 flat angles P-C4'-P energy: -24.485 tors. eta vs tors. theta energy: -46.230 Dist. restrs. and SS energy: 0.442 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -472.664276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.664276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.260447 (E_RNA) where: Base-Base interactions energy: -308.390 where: short stacking energy: -139.664 Base-Backbone interact. energy: 0.774 local terms energy: -165.644223 where: bonds (distance) C4'-P energy: -45.764 bonds (distance) P-C4' energy: -32.280 flat angles C4'-P-C4' energy: -37.307 flat angles P-C4'-P energy: -24.414 tors. eta vs tors. theta energy: -25.880 Dist. restrs. and SS energy: 0.596 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -738.636412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.636412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.659205 (E_RNA) where: Base-Base interactions energy: -497.588 where: short stacking energy: -230.862 Base-Backbone interact. energy: -0.347 local terms energy: -240.724359 where: bonds (distance) C4'-P energy: -43.298 bonds (distance) P-C4' energy: -48.691 flat angles C4'-P-C4' energy: -47.865 flat angles P-C4'-P energy: -32.289 tors. eta vs tors. theta energy: -68.583 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -716.912245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.912245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.988128 (E_RNA) where: Base-Base interactions energy: -474.723 where: short stacking energy: -224.631 Base-Backbone interact. energy: 0.037 local terms energy: -242.301301 where: bonds (distance) C4'-P energy: -43.510 bonds (distance) P-C4' energy: -37.149 flat angles C4'-P-C4' energy: -54.735 flat angles P-C4'-P energy: -34.959 tors. eta vs tors. theta energy: -71.948 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -695.367966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.367966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.900114 (E_RNA) where: Base-Base interactions energy: -458.026 where: short stacking energy: -224.054 Base-Backbone interact. energy: -0.593 local terms energy: -237.281167 where: bonds (distance) C4'-P energy: -39.192 bonds (distance) P-C4' energy: -45.471 flat angles C4'-P-C4' energy: -54.584 flat angles P-C4'-P energy: -33.003 tors. eta vs tors. theta energy: -65.032 Dist. restrs. and SS energy: 0.532 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -681.497864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.497864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.970781 (E_RNA) where: Base-Base interactions energy: -452.068 where: short stacking energy: -204.589 Base-Backbone interact. energy: -0.552 local terms energy: -229.350779 where: bonds (distance) C4'-P energy: -42.135 bonds (distance) P-C4' energy: -43.942 flat angles C4'-P-C4' energy: -49.603 flat angles P-C4'-P energy: -32.875 tors. eta vs tors. theta energy: -60.796 Dist. restrs. and SS energy: 0.473 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -641.327055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -641.327055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -641.907021 (E_RNA) where: Base-Base interactions energy: -441.104 where: short stacking energy: -194.322 Base-Backbone interact. energy: -1.624 local terms energy: -199.179516 where: bonds (distance) C4'-P energy: -42.293 bonds (distance) P-C4' energy: -39.846 flat angles C4'-P-C4' energy: -40.021 flat angles P-C4'-P energy: -20.693 tors. eta vs tors. theta energy: -56.328 Dist. restrs. and SS energy: 0.580 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -548.592479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.592479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.846702 (E_RNA) where: Base-Base interactions energy: -365.979 where: short stacking energy: -162.130 Base-Backbone interact. energy: 0.376 local terms energy: -183.243915 where: bonds (distance) C4'-P energy: -40.376 bonds (distance) P-C4' energy: -32.411 flat angles C4'-P-C4' energy: -40.567 flat angles P-C4'-P energy: -27.090 tors. eta vs tors. theta energy: -42.800 Dist. restrs. and SS energy: 0.254 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -514.841384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.841384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.122276 (E_RNA) where: Base-Base interactions energy: -326.232 where: short stacking energy: -153.392 Base-Backbone interact. energy: -0.703 local terms energy: -188.187027 where: bonds (distance) C4'-P energy: -40.187 bonds (distance) P-C4' energy: -43.862 flat angles C4'-P-C4' energy: -41.281 flat angles P-C4'-P energy: -27.830 tors. eta vs tors. theta energy: -35.027 Dist. restrs. and SS energy: 0.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -510.806496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.806496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.699417 (E_RNA) where: Base-Base interactions energy: -324.664 where: short stacking energy: -160.374 Base-Backbone interact. energy: -0.991 local terms energy: -186.044777 where: bonds (distance) C4'-P energy: -31.262 bonds (distance) P-C4' energy: -44.840 flat angles C4'-P-C4' energy: -37.804 flat angles P-C4'-P energy: -29.362 tors. eta vs tors. theta energy: -42.777 Dist. restrs. and SS energy: 0.893 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -514.405043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.405043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.655695 (E_RNA) where: Base-Base interactions energy: -318.340 where: short stacking energy: -154.503 Base-Backbone interact. energy: 0.622 local terms energy: -196.937843 where: bonds (distance) C4'-P energy: -41.554 bonds (distance) P-C4' energy: -37.317 flat angles C4'-P-C4' energy: -42.556 flat angles P-C4'-P energy: -28.075 tors. eta vs tors. theta energy: -47.435 Dist. restrs. and SS energy: 0.251 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -475.404734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.404734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.696888 (E_RNA) where: Base-Base interactions energy: -295.837 where: short stacking energy: -124.127 Base-Backbone interact. energy: -0.605 local terms energy: -182.255606 where: bonds (distance) C4'-P energy: -37.166 bonds (distance) P-C4' energy: -39.404 flat angles C4'-P-C4' energy: -46.479 flat angles P-C4'-P energy: -29.384 tors. eta vs tors. theta energy: -29.823 Dist. restrs. and SS energy: 3.292 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -736.770454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.770454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.121718 (E_RNA) where: Base-Base interactions energy: -483.421 where: short stacking energy: -234.504 Base-Backbone interact. energy: -1.191 local terms energy: -252.509060 where: bonds (distance) C4'-P energy: -49.589 bonds (distance) P-C4' energy: -40.788 flat angles C4'-P-C4' energy: -51.065 flat angles P-C4'-P energy: -36.274 tors. eta vs tors. theta energy: -74.794 Dist. restrs. and SS energy: 0.351 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -731.584949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.584949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.719493 (E_RNA) where: Base-Base interactions energy: -487.710 where: short stacking energy: -225.266 Base-Backbone interact. energy: 0.507 local terms energy: -244.516465 where: bonds (distance) C4'-P energy: -51.659 bonds (distance) P-C4' energy: -41.271 flat angles C4'-P-C4' energy: -52.402 flat angles P-C4'-P energy: -32.279 tors. eta vs tors. theta energy: -66.906 Dist. restrs. and SS energy: 0.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -661.706852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.706852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.125897 (E_RNA) where: Base-Base interactions energy: -436.215 where: short stacking energy: -211.175 Base-Backbone interact. energy: -0.300 local terms energy: -225.611450 where: bonds (distance) C4'-P energy: -41.630 bonds (distance) P-C4' energy: -39.912 flat angles C4'-P-C4' energy: -45.466 flat angles P-C4'-P energy: -31.333 tors. eta vs tors. theta energy: -67.270 Dist. restrs. and SS energy: 0.419 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -705.063473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.063473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.377154 (E_RNA) where: Base-Base interactions energy: -476.370 where: short stacking energy: -217.379 Base-Backbone interact. energy: -0.058 local terms energy: -228.949522 where: bonds (distance) C4'-P energy: -48.259 bonds (distance) P-C4' energy: -48.015 flat angles C4'-P-C4' energy: -40.784 flat angles P-C4'-P energy: -32.254 tors. eta vs tors. theta energy: -59.637 Dist. restrs. and SS energy: 0.314 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -637.285955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -637.285955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.767228 (E_RNA) where: Base-Base interactions energy: -423.850 where: short stacking energy: -198.907 Base-Backbone interact. energy: -1.184 local terms energy: -212.732489 where: bonds (distance) C4'-P energy: -45.188 bonds (distance) P-C4' energy: -38.919 flat angles C4'-P-C4' energy: -42.218 flat angles P-C4'-P energy: -37.406 tors. eta vs tors. theta energy: -49.001 Dist. restrs. and SS energy: 0.481 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -507.792614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.792614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.428447 (E_RNA) where: Base-Base interactions energy: -324.326 where: short stacking energy: -159.810 Base-Backbone interact. energy: -0.095 local terms energy: -185.007317 where: bonds (distance) C4'-P energy: -34.577 bonds (distance) P-C4' energy: -38.197 flat angles C4'-P-C4' energy: -41.946 flat angles P-C4'-P energy: -29.554 tors. eta vs tors. theta energy: -40.734 Dist. restrs. and SS energy: 1.636 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -537.654130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.654130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.424953 (E_RNA) where: Base-Base interactions energy: -344.765 where: short stacking energy: -170.729 Base-Backbone interact. energy: -0.551 local terms energy: -193.108728 where: bonds (distance) C4'-P energy: -35.544 bonds (distance) P-C4' energy: -40.570 flat angles C4'-P-C4' energy: -38.051 flat angles P-C4'-P energy: -29.275 tors. eta vs tors. theta energy: -49.668 Dist. restrs. and SS energy: 0.771 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -518.146170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.146170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.352935 (E_RNA) where: Base-Base interactions energy: -342.514 where: short stacking energy: -154.995 Base-Backbone interact. energy: -0.190 local terms energy: -175.648918 where: bonds (distance) C4'-P energy: -31.924 bonds (distance) P-C4' energy: -38.429 flat angles C4'-P-C4' energy: -37.050 flat angles P-C4'-P energy: -27.221 tors. eta vs tors. theta energy: -41.024 Dist. restrs. and SS energy: 0.207 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -491.592637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.592637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.273578 (E_RNA) where: Base-Base interactions energy: -306.263 where: short stacking energy: -151.742 Base-Backbone interact. energy: -0.736 local terms energy: -185.274490 where: bonds (distance) C4'-P energy: -32.215 bonds (distance) P-C4' energy: -46.037 flat angles C4'-P-C4' energy: -41.809 flat angles P-C4'-P energy: -23.927 tors. eta vs tors. theta energy: -41.286 Dist. restrs. and SS energy: 0.681 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -478.779765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.779765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.665244 (E_RNA) where: Base-Base interactions energy: -301.313 where: short stacking energy: -149.037 Base-Backbone interact. energy: -0.381 local terms energy: -177.970749 where: bonds (distance) C4'-P energy: -26.090 bonds (distance) P-C4' energy: -42.964 flat angles C4'-P-C4' energy: -42.916 flat angles P-C4'-P energy: -31.500 tors. eta vs tors. theta energy: -34.502 Dist. restrs. and SS energy: 0.885 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -730.479279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.479279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.315775 (E_RNA) where: Base-Base interactions energy: -474.816 where: short stacking energy: -230.979 Base-Backbone interact. energy: -0.255 local terms energy: -256.244719 where: bonds (distance) C4'-P energy: -50.468 bonds (distance) P-C4' energy: -50.175 flat angles C4'-P-C4' energy: -51.994 flat angles P-C4'-P energy: -37.243 tors. eta vs tors. theta energy: -66.365 Dist. restrs. and SS energy: 0.836 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -710.628838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -710.628838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.128246 (E_RNA) where: Base-Base interactions energy: -460.841 where: short stacking energy: -218.719 Base-Backbone interact. energy: -0.891 local terms energy: -249.396500 where: bonds (distance) C4'-P energy: -45.015 bonds (distance) P-C4' energy: -50.354 flat angles C4'-P-C4' energy: -53.945 flat angles P-C4'-P energy: -35.298 tors. eta vs tors. theta energy: -64.784 Dist. restrs. and SS energy: 0.499 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -726.351967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.351967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -726.903563 (E_RNA) where: Base-Base interactions energy: -480.580 where: short stacking energy: -218.965 Base-Backbone interact. energy: -1.095 local terms energy: -245.228426 where: bonds (distance) C4'-P energy: -43.394 bonds (distance) P-C4' energy: -44.761 flat angles C4'-P-C4' energy: -50.249 flat angles P-C4'-P energy: -41.640 tors. eta vs tors. theta energy: -65.184 Dist. restrs. and SS energy: 0.552 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -636.960921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.960921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.202799 (E_RNA) where: Base-Base interactions energy: -423.327 where: short stacking energy: -191.813 Base-Backbone interact. energy: -1.057 local terms energy: -212.818790 where: bonds (distance) C4'-P energy: -37.445 bonds (distance) P-C4' energy: -43.413 flat angles C4'-P-C4' energy: -49.051 flat angles P-C4'-P energy: -28.142 tors. eta vs tors. theta energy: -54.768 Dist. restrs. and SS energy: 0.242 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -618.408763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.408763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.184830 (E_RNA) where: Base-Base interactions energy: -409.426 where: short stacking energy: -191.094 Base-Backbone interact. energy: -0.862 local terms energy: -208.896671 where: bonds (distance) C4'-P energy: -40.004 bonds (distance) P-C4' energy: -44.641 flat angles C4'-P-C4' energy: -36.310 flat angles P-C4'-P energy: -32.222 tors. eta vs tors. theta energy: -55.719 Dist. restrs. and SS energy: 0.776 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -530.112156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.112156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.198592 (E_RNA) where: Base-Base interactions energy: -341.299 where: short stacking energy: -167.710 Base-Backbone interact. energy: -1.728 local terms energy: -187.172308 where: bonds (distance) C4'-P energy: -35.994 bonds (distance) P-C4' energy: -42.568 flat angles C4'-P-C4' energy: -39.733 flat angles P-C4'-P energy: -30.142 tors. eta vs tors. theta energy: -38.736 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -557.040506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.040506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.421016 (E_RNA) where: Base-Base interactions energy: -363.551 where: short stacking energy: -167.422 Base-Backbone interact. energy: -0.238 local terms energy: -193.631724 where: bonds (distance) C4'-P energy: -33.313 bonds (distance) P-C4' energy: -30.799 flat angles C4'-P-C4' energy: -44.936 flat angles P-C4'-P energy: -39.129 tors. eta vs tors. theta energy: -45.455 Dist. restrs. and SS energy: 0.381 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -527.008774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.008774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.183362 (E_RNA) where: Base-Base interactions energy: -338.482 where: short stacking energy: -164.520 Base-Backbone interact. energy: -0.421 local terms energy: -188.280776 where: bonds (distance) C4'-P energy: -35.400 bonds (distance) P-C4' energy: -25.998 flat angles C4'-P-C4' energy: -50.660 flat angles P-C4'-P energy: -28.273 tors. eta vs tors. theta energy: -47.950 Dist. restrs. and SS energy: 0.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -486.200017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.200017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.529912 (E_RNA) where: Base-Base interactions energy: -299.304 where: short stacking energy: -136.823 Base-Backbone interact. energy: -1.046 local terms energy: -186.180116 where: bonds (distance) C4'-P energy: -40.606 bonds (distance) P-C4' energy: -46.011 flat angles C4'-P-C4' energy: -36.204 flat angles P-C4'-P energy: -30.400 tors. eta vs tors. theta energy: -32.959 Dist. restrs. and SS energy: 0.330 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -503.364079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.364079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.741778 (E_RNA) where: Base-Base interactions energy: -323.008 where: short stacking energy: -148.713 Base-Backbone interact. energy: 0.511 local terms energy: -181.244967 where: bonds (distance) C4'-P energy: -39.115 bonds (distance) P-C4' energy: -40.694 flat angles C4'-P-C4' energy: -44.192 flat angles P-C4'-P energy: -22.537 tors. eta vs tors. theta energy: -34.708 Dist. restrs. and SS energy: 0.378 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -725.715802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.715802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.876886 (E_RNA) where: Base-Base interactions energy: -472.501 where: short stacking energy: -227.738 Base-Backbone interact. energy: -0.589 local terms energy: -252.787635 where: bonds (distance) C4'-P energy: -44.147 bonds (distance) P-C4' energy: -47.225 flat angles C4'-P-C4' energy: -51.551 flat angles P-C4'-P energy: -42.637 tors. eta vs tors. theta energy: -67.228 Dist. restrs. and SS energy: 0.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -708.940314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.940314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.817414 (E_RNA) where: Base-Base interactions energy: -466.818 where: short stacking energy: -219.989 Base-Backbone interact. energy: -0.576 local terms energy: -242.422977 where: bonds (distance) C4'-P energy: -43.649 bonds (distance) P-C4' energy: -49.166 flat angles C4'-P-C4' energy: -50.738 flat angles P-C4'-P energy: -36.425 tors. eta vs tors. theta energy: -62.446 Dist. restrs. and SS energy: 0.877 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -675.137333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.137333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.652986 (E_RNA) where: Base-Base interactions energy: -444.465 where: short stacking energy: -194.658 Base-Backbone interact. energy: -0.816 local terms energy: -230.372216 where: bonds (distance) C4'-P energy: -36.479 bonds (distance) P-C4' energy: -48.726 flat angles C4'-P-C4' energy: -52.753 flat angles P-C4'-P energy: -36.639 tors. eta vs tors. theta energy: -55.774 Dist. restrs. and SS energy: 0.516 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -628.098275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.098275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.425865 (E_RNA) where: Base-Base interactions energy: -408.686 where: short stacking energy: -187.610 Base-Backbone interact. energy: -0.793 local terms energy: -218.946633 where: bonds (distance) C4'-P energy: -40.058 bonds (distance) P-C4' energy: -39.668 flat angles C4'-P-C4' energy: -45.158 flat angles P-C4'-P energy: -34.849 tors. eta vs tors. theta energy: -59.214 Dist. restrs. and SS energy: 0.328 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -618.549812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.549812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.184508 (E_RNA) where: Base-Base interactions energy: -421.512 where: short stacking energy: -203.255 Base-Backbone interact. energy: -1.038 local terms energy: -196.634860 where: bonds (distance) C4'-P energy: -30.402 bonds (distance) P-C4' energy: -39.322 flat angles C4'-P-C4' energy: -39.395 flat angles P-C4'-P energy: -22.799 tors. eta vs tors. theta energy: -64.717 Dist. restrs. and SS energy: 0.635 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -563.341519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.341519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.108751 (E_RNA) where: Base-Base interactions energy: -373.634 where: short stacking energy: -172.193 Base-Backbone interact. energy: 2.997 local terms energy: -193.472472 where: bonds (distance) C4'-P energy: -44.830 bonds (distance) P-C4' energy: -36.522 flat angles C4'-P-C4' energy: -42.821 flat angles P-C4'-P energy: -24.461 tors. eta vs tors. theta energy: -44.840 Dist. restrs. and SS energy: 0.767 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -521.047010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.047010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.224544 (E_RNA) where: Base-Base interactions energy: -327.182 where: short stacking energy: -150.587 Base-Backbone interact. energy: 2.079 local terms energy: -196.121025 where: bonds (distance) C4'-P energy: -43.101 bonds (distance) P-C4' energy: -44.824 flat angles C4'-P-C4' energy: -44.717 flat angles P-C4'-P energy: -33.092 tors. eta vs tors. theta energy: -30.387 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -507.367420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.367420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.240043 (E_RNA) where: Base-Base interactions energy: -327.825 where: short stacking energy: -162.242 Base-Backbone interact. energy: 2.975 local terms energy: -183.390154 where: bonds (distance) C4'-P energy: -42.692 bonds (distance) P-C4' energy: -34.832 flat angles C4'-P-C4' energy: -41.337 flat angles P-C4'-P energy: -18.231 tors. eta vs tors. theta energy: -46.298 Dist. restrs. and SS energy: 0.873 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -524.356404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.356404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.523632 (E_RNA) where: Base-Base interactions energy: -331.722 where: short stacking energy: -172.183 Base-Backbone interact. energy: 1.209 local terms energy: -195.010612 where: bonds (distance) C4'-P energy: -41.192 bonds (distance) P-C4' energy: -39.055 flat angles C4'-P-C4' energy: -43.850 flat angles P-C4'-P energy: -30.002 tors. eta vs tors. theta energy: -40.911 Dist. restrs. and SS energy: 1.167 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -474.852876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.852876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.754704 (E_RNA) where: Base-Base interactions energy: -299.546 where: short stacking energy: -141.812 Base-Backbone interact. energy: 0.815 local terms energy: -177.023851 where: bonds (distance) C4'-P energy: -46.893 bonds (distance) P-C4' energy: -36.465 flat angles C4'-P-C4' energy: -38.899 flat angles P-C4'-P energy: -29.752 tors. eta vs tors. theta energy: -25.015 Dist. restrs. and SS energy: 0.902 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -718.842854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.842854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.161840 (E_RNA) where: Base-Base interactions energy: -484.049 where: short stacking energy: -234.335 Base-Backbone interact. energy: 1.447 local terms energy: -236.560525 where: bonds (distance) C4'-P energy: -42.836 bonds (distance) P-C4' energy: -41.389 flat angles C4'-P-C4' energy: -52.561 flat angles P-C4'-P energy: -33.994 tors. eta vs tors. theta energy: -65.781 Dist. restrs. and SS energy: 0.319 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -704.593144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.593144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.915058 (E_RNA) where: Base-Base interactions energy: -478.848 where: short stacking energy: -219.531 Base-Backbone interact. energy: -0.692 local terms energy: -225.375275 where: bonds (distance) C4'-P energy: -42.974 bonds (distance) P-C4' energy: -38.655 flat angles C4'-P-C4' energy: -52.371 flat angles P-C4'-P energy: -30.966 tors. eta vs tors. theta energy: -60.410 Dist. restrs. and SS energy: 0.322 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -669.994615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.994615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.207194 (E_RNA) where: Base-Base interactions energy: -444.911 where: short stacking energy: -201.891 Base-Backbone interact. energy: -0.429 local terms energy: -224.867113 where: bonds (distance) C4'-P energy: -47.516 bonds (distance) P-C4' energy: -44.188 flat angles C4'-P-C4' energy: -48.424 flat angles P-C4'-P energy: -30.012 tors. eta vs tors. theta energy: -54.726 Dist. restrs. and SS energy: 0.213 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -630.224243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.224243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -631.406156 (E_RNA) where: Base-Base interactions energy: -408.329 where: short stacking energy: -199.553 Base-Backbone interact. energy: -1.087 local terms energy: -221.990690 where: bonds (distance) C4'-P energy: -41.281 bonds (distance) P-C4' energy: -44.749 flat angles C4'-P-C4' energy: -48.411 flat angles P-C4'-P energy: -35.434 tors. eta vs tors. theta energy: -52.115 Dist. restrs. and SS energy: 1.182 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -633.629508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.629508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -634.343063 (E_RNA) where: Base-Base interactions energy: -423.926 where: short stacking energy: -192.500 Base-Backbone interact. energy: -2.159 local terms energy: -208.257684 where: bonds (distance) C4'-P energy: -31.188 bonds (distance) P-C4' energy: -49.390 flat angles C4'-P-C4' energy: -46.686 flat angles P-C4'-P energy: -26.719 tors. eta vs tors. theta energy: -54.275 Dist. restrs. and SS energy: 0.714 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -553.802551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.802551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.970920 (E_RNA) where: Base-Base interactions energy: -344.057 where: short stacking energy: -164.931 Base-Backbone interact. energy: -0.355 local terms energy: -209.558768 where: bonds (distance) C4'-P energy: -47.854 bonds (distance) P-C4' energy: -37.214 flat angles C4'-P-C4' energy: -47.573 flat angles P-C4'-P energy: -36.077 tors. eta vs tors. theta energy: -40.841 Dist. restrs. and SS energy: 0.168 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -520.650297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.650297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.461969 (E_RNA) where: Base-Base interactions energy: -338.690 where: short stacking energy: -154.591 Base-Backbone interact. energy: 0.384 local terms energy: -183.155936 where: bonds (distance) C4'-P energy: -34.983 bonds (distance) P-C4' energy: -41.464 flat angles C4'-P-C4' energy: -46.209 flat angles P-C4'-P energy: -29.196 tors. eta vs tors. theta energy: -31.305 Dist. restrs. and SS energy: 0.812 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -527.594440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.594440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.848597 (E_RNA) where: Base-Base interactions energy: -336.354 where: short stacking energy: -158.115 Base-Backbone interact. energy: -0.482 local terms energy: -192.012559 where: bonds (distance) C4'-P energy: -36.868 bonds (distance) P-C4' energy: -43.545 flat angles C4'-P-C4' energy: -50.253 flat angles P-C4'-P energy: -19.063 tors. eta vs tors. theta energy: -42.284 Dist. restrs. and SS energy: 1.254 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -491.925025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.925025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.526124 (E_RNA) where: Base-Base interactions energy: -316.490 where: short stacking energy: -130.848 Base-Backbone interact. energy: -1.697 local terms energy: -174.339139 where: bonds (distance) C4'-P energy: -37.028 bonds (distance) P-C4' energy: -33.759 flat angles C4'-P-C4' energy: -40.675 flat angles P-C4'-P energy: -31.569 tors. eta vs tors. theta energy: -31.309 Dist. restrs. and SS energy: 0.601 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -455.793930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.793930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.560362 (E_RNA) where: Base-Base interactions energy: -299.687 where: short stacking energy: -137.197 Base-Backbone interact. energy: -0.187 local terms energy: -156.686880 where: bonds (distance) C4'-P energy: -30.764 bonds (distance) P-C4' energy: -35.050 flat angles C4'-P-C4' energy: -38.701 flat angles P-C4'-P energy: -23.502 tors. eta vs tors. theta energy: -28.671 Dist. restrs. and SS energy: 0.766 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -732.140115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.140115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.702374 (E_RNA) where: Base-Base interactions energy: -484.431 where: short stacking energy: -233.462 Base-Backbone interact. energy: 3.191 local terms energy: -251.461938 where: bonds (distance) C4'-P energy: -45.284 bonds (distance) P-C4' energy: -48.015 flat angles C4'-P-C4' energy: -52.022 flat angles P-C4'-P energy: -39.069 tors. eta vs tors. theta energy: -67.072 Dist. restrs. and SS energy: 0.562 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -716.468966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.468966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.031523 (E_RNA) where: Base-Base interactions energy: -477.346 where: short stacking energy: -221.360 Base-Backbone interact. energy: -1.645 local terms energy: -238.040757 where: bonds (distance) C4'-P energy: -41.327 bonds (distance) P-C4' energy: -47.401 flat angles C4'-P-C4' energy: -47.852 flat angles P-C4'-P energy: -33.815 tors. eta vs tors. theta energy: -67.645 Dist. restrs. and SS energy: 0.563 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -696.855938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.855938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.440637 (E_RNA) where: Base-Base interactions energy: -456.488 where: short stacking energy: -216.334 Base-Backbone interact. energy: -1.067 local terms energy: -239.886225 where: bonds (distance) C4'-P energy: -49.571 bonds (distance) P-C4' energy: -42.274 flat angles C4'-P-C4' energy: -53.680 flat angles P-C4'-P energy: -29.786 tors. eta vs tors. theta energy: -64.576 Dist. restrs. and SS energy: 0.585 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -646.671059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -646.671059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.946463 (E_RNA) where: Base-Base interactions energy: -423.388 where: short stacking energy: -191.896 Base-Backbone interact. energy: -0.342 local terms energy: -223.216833 where: bonds (distance) C4'-P energy: -40.578 bonds (distance) P-C4' energy: -43.293 flat angles C4'-P-C4' energy: -45.247 flat angles P-C4'-P energy: -35.634 tors. eta vs tors. theta energy: -58.465 Dist. restrs. and SS energy: 0.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -614.347218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.347218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.090378 (E_RNA) where: Base-Base interactions energy: -398.208 where: short stacking energy: -196.076 Base-Backbone interact. energy: -1.313 local terms energy: -215.570042 where: bonds (distance) C4'-P energy: -41.062 bonds (distance) P-C4' energy: -34.692 flat angles C4'-P-C4' energy: -52.040 flat angles P-C4'-P energy: -30.152 tors. eta vs tors. theta energy: -57.624 Dist. restrs. and SS energy: 0.743 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -536.179880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.179880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.286825 (E_RNA) where: Base-Base interactions energy: -344.836 where: short stacking energy: -173.350 Base-Backbone interact. energy: -0.103 local terms energy: -191.348172 where: bonds (distance) C4'-P energy: -38.883 bonds (distance) P-C4' energy: -35.830 flat angles C4'-P-C4' energy: -41.844 flat angles P-C4'-P energy: -28.224 tors. eta vs tors. theta energy: -46.567 Dist. restrs. and SS energy: 0.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -535.601935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.601935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.088204 (E_RNA) where: Base-Base interactions energy: -334.054 where: short stacking energy: -168.680 Base-Backbone interact. energy: -0.399 local terms energy: -201.635721 where: bonds (distance) C4'-P energy: -34.531 bonds (distance) P-C4' energy: -46.550 flat angles C4'-P-C4' energy: -38.676 flat angles P-C4'-P energy: -33.094 tors. eta vs tors. theta energy: -48.784 Dist. restrs. and SS energy: 0.486 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -563.980240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.980240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.347260 (E_RNA) where: Base-Base interactions energy: -367.121 where: short stacking energy: -155.904 Base-Backbone interact. energy: -1.285 local terms energy: -195.941235 where: bonds (distance) C4'-P energy: -46.864 bonds (distance) P-C4' energy: -33.892 flat angles C4'-P-C4' energy: -40.517 flat angles P-C4'-P energy: -32.111 tors. eta vs tors. theta energy: -42.557 Dist. restrs. and SS energy: 0.367 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -507.241180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.241180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.965728 (E_RNA) where: Base-Base interactions energy: -319.834 where: short stacking energy: -148.077 Base-Backbone interact. energy: 0.302 local terms energy: -188.433698 where: bonds (distance) C4'-P energy: -40.975 bonds (distance) P-C4' energy: -43.753 flat angles C4'-P-C4' energy: -43.228 flat angles P-C4'-P energy: -28.078 tors. eta vs tors. theta energy: -32.400 Dist. restrs. and SS energy: 0.725 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -473.127932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.127932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.467759 (E_RNA) where: Base-Base interactions energy: -312.713 where: short stacking energy: -148.165 Base-Backbone interact. energy: -1.059 local terms energy: -159.695873 where: bonds (distance) C4'-P energy: -30.890 bonds (distance) P-C4' energy: -37.591 flat angles C4'-P-C4' energy: -36.195 flat angles P-C4'-P energy: -19.865 tors. eta vs tors. theta energy: -35.156 Dist. restrs. and SS energy: 0.340 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -744.355284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.355284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.590311 (E_RNA) where: Base-Base interactions energy: -489.980 where: short stacking energy: -229.341 Base-Backbone interact. energy: -1.001 local terms energy: -253.608801 where: bonds (distance) C4'-P energy: -46.619 bonds (distance) P-C4' energy: -51.958 flat angles C4'-P-C4' energy: -53.440 flat angles P-C4'-P energy: -32.971 tors. eta vs tors. theta energy: -68.621 Dist. restrs. and SS energy: 0.235 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -705.173563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.173563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.457730 (E_RNA) where: Base-Base interactions energy: -459.764 where: short stacking energy: -214.877 Base-Backbone interact. energy: -0.490 local terms energy: -246.203819 where: bonds (distance) C4'-P energy: -43.423 bonds (distance) P-C4' energy: -49.646 flat angles C4'-P-C4' energy: -48.922 flat angles P-C4'-P energy: -39.364 tors. eta vs tors. theta energy: -64.848 Dist. restrs. and SS energy: 1.284 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -702.545093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.545093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.579326 (E_RNA) where: Base-Base interactions energy: -478.718 where: short stacking energy: -211.686 Base-Backbone interact. energy: -0.210 local terms energy: -223.651586 where: bonds (distance) C4'-P energy: -41.187 bonds (distance) P-C4' energy: -44.684 flat angles C4'-P-C4' energy: -49.843 flat angles P-C4'-P energy: -27.489 tors. eta vs tors. theta energy: -60.448 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -645.437908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.437908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.150435 (E_RNA) where: Base-Base interactions energy: -421.281 where: short stacking energy: -196.406 Base-Backbone interact. energy: -1.112 local terms energy: -223.757028 where: bonds (distance) C4'-P energy: -41.869 bonds (distance) P-C4' energy: -41.333 flat angles C4'-P-C4' energy: -56.585 flat angles P-C4'-P energy: -27.245 tors. eta vs tors. theta energy: -56.724 Dist. restrs. and SS energy: 0.713 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -589.776369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.776369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.325258 (E_RNA) where: Base-Base interactions energy: -382.608 where: short stacking energy: -190.074 Base-Backbone interact. energy: 0.332 local terms energy: -208.048932 where: bonds (distance) C4'-P energy: -43.142 bonds (distance) P-C4' energy: -34.182 flat angles C4'-P-C4' energy: -45.689 flat angles P-C4'-P energy: -32.615 tors. eta vs tors. theta energy: -52.421 Dist. restrs. and SS energy: 0.549 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -547.371517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.371517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.390578 (E_RNA) where: Base-Base interactions energy: -351.527 where: short stacking energy: -159.821 Base-Backbone interact. energy: -1.169 local terms energy: -194.694265 where: bonds (distance) C4'-P energy: -42.019 bonds (distance) P-C4' energy: -47.069 flat angles C4'-P-C4' energy: -46.176 flat angles P-C4'-P energy: -21.876 tors. eta vs tors. theta energy: -37.555 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -521.448140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.448140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.577295 (E_RNA) where: Base-Base interactions energy: -339.077 where: short stacking energy: -151.559 Base-Backbone interact. energy: 4.857 local terms energy: -187.357692 where: bonds (distance) C4'-P energy: -33.441 bonds (distance) P-C4' energy: -42.712 flat angles C4'-P-C4' energy: -45.348 flat angles P-C4'-P energy: -31.154 tors. eta vs tors. theta energy: -34.703 Dist. restrs. and SS energy: 0.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -487.353314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.353314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.205495 (E_RNA) where: Base-Base interactions energy: -323.408 where: short stacking energy: -148.245 Base-Backbone interact. energy: -0.229 local terms energy: -169.568333 where: bonds (distance) C4'-P energy: -33.872 bonds (distance) P-C4' energy: -45.441 flat angles C4'-P-C4' energy: -27.451 flat angles P-C4'-P energy: -22.527 tors. eta vs tors. theta energy: -40.277 Dist. restrs. and SS energy: 5.852 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -483.840637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.840637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.779047 (E_RNA) where: Base-Base interactions energy: -311.918 where: short stacking energy: -146.946 Base-Backbone interact. energy: -0.690 local terms energy: -172.170650 where: bonds (distance) C4'-P energy: -33.423 bonds (distance) P-C4' energy: -39.496 flat angles C4'-P-C4' energy: -36.622 flat angles P-C4'-P energy: -28.017 tors. eta vs tors. theta energy: -34.613 Dist. restrs. and SS energy: 0.938 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -449.588552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.588552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.905499 (E_RNA) where: Base-Base interactions energy: -284.907 where: short stacking energy: -141.847 Base-Backbone interact. energy: -0.933 local terms energy: -166.065657 where: bonds (distance) C4'-P energy: -35.414 bonds (distance) P-C4' energy: -29.506 flat angles C4'-P-C4' energy: -46.985 flat angles P-C4'-P energy: -22.074 tors. eta vs tors. theta energy: -32.086 Dist. restrs. and SS energy: 2.317 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -750.631364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.631364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.762341 (E_RNA) where: Base-Base interactions energy: -513.194 where: short stacking energy: -238.513 Base-Backbone interact. energy: -1.990 local terms energy: -235.578296 where: bonds (distance) C4'-P energy: -34.773 bonds (distance) P-C4' energy: -40.526 flat angles C4'-P-C4' energy: -57.604 flat angles P-C4'-P energy: -36.528 tors. eta vs tors. theta energy: -66.148 Dist. restrs. and SS energy: 0.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -711.626751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.626751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.929073 (E_RNA) where: Base-Base interactions energy: -483.388 where: short stacking energy: -222.601 Base-Backbone interact. energy: -0.708 local terms energy: -227.833128 where: bonds (distance) C4'-P energy: -40.487 bonds (distance) P-C4' energy: -46.869 flat angles C4'-P-C4' energy: -49.599 flat angles P-C4'-P energy: -32.689 tors. eta vs tors. theta energy: -58.189 Dist. restrs. and SS energy: 0.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -695.827824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.827824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.981905 (E_RNA) where: Base-Base interactions energy: -478.112 where: short stacking energy: -212.276 Base-Backbone interact. energy: 0.150 local terms energy: -218.019793 where: bonds (distance) C4'-P energy: -37.667 bonds (distance) P-C4' energy: -43.330 flat angles C4'-P-C4' energy: -48.984 flat angles P-C4'-P energy: -30.300 tors. eta vs tors. theta energy: -57.739 Dist. restrs. and SS energy: 0.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -639.803277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -639.803277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -641.994826 (E_RNA) where: Base-Base interactions energy: -438.472 where: short stacking energy: -193.077 Base-Backbone interact. energy: 1.795 local terms energy: -205.317258 where: bonds (distance) C4'-P energy: -35.778 bonds (distance) P-C4' energy: -43.681 flat angles C4'-P-C4' energy: -48.610 flat angles P-C4'-P energy: -22.964 tors. eta vs tors. theta energy: -54.284 Dist. restrs. and SS energy: 2.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -576.939101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.939101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.091895 (E_RNA) where: Base-Base interactions energy: -376.269 where: short stacking energy: -182.903 Base-Backbone interact. energy: -0.382 local terms energy: -200.441023 where: bonds (distance) C4'-P energy: -33.457 bonds (distance) P-C4' energy: -37.659 flat angles C4'-P-C4' energy: -50.145 flat angles P-C4'-P energy: -32.793 tors. eta vs tors. theta energy: -46.387 Dist. restrs. and SS energy: 0.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -550.621840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.621840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.695942 (E_RNA) where: Base-Base interactions energy: -354.294 where: short stacking energy: -177.833 Base-Backbone interact. energy: -0.201 local terms energy: -196.201389 where: bonds (distance) C4'-P energy: -36.661 bonds (distance) P-C4' energy: -34.120 flat angles C4'-P-C4' energy: -41.091 flat angles P-C4'-P energy: -32.278 tors. eta vs tors. theta energy: -52.051 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -530.013358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.013358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.670545 (E_RNA) where: Base-Base interactions energy: -344.416 where: short stacking energy: -169.549 Base-Backbone interact. energy: -1.085 local terms energy: -185.170054 where: bonds (distance) C4'-P energy: -32.660 bonds (distance) P-C4' energy: -41.374 flat angles C4'-P-C4' energy: -41.968 flat angles P-C4'-P energy: -20.425 tors. eta vs tors. theta energy: -48.743 Dist. restrs. and SS energy: 0.657 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -497.794566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.794566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.226825 (E_RNA) where: Base-Base interactions energy: -325.983 where: short stacking energy: -162.986 Base-Backbone interact. energy: 2.041 local terms energy: -174.284617 where: bonds (distance) C4'-P energy: -37.734 bonds (distance) P-C4' energy: -36.621 flat angles C4'-P-C4' energy: -39.132 flat angles P-C4'-P energy: -24.904 tors. eta vs tors. theta energy: -35.893 Dist. restrs. and SS energy: 0.432 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -487.325200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.325200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.066901 (E_RNA) where: Base-Base interactions energy: -309.802 where: short stacking energy: -150.654 Base-Backbone interact. energy: -0.741 local terms energy: -181.523399 where: bonds (distance) C4'-P energy: -42.817 bonds (distance) P-C4' energy: -39.696 flat angles C4'-P-C4' energy: -45.326 flat angles P-C4'-P energy: -23.764 tors. eta vs tors. theta energy: -29.920 Dist. restrs. and SS energy: 4.742 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -444.862924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.862924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.238357 (E_RNA) where: Base-Base interactions energy: -279.194 where: short stacking energy: -127.402 Base-Backbone interact. energy: 0.585 local terms energy: -172.629575 where: bonds (distance) C4'-P energy: -30.551 bonds (distance) P-C4' energy: -43.293 flat angles C4'-P-C4' energy: -47.800 flat angles P-C4'-P energy: -21.400 tors. eta vs tors. theta energy: -29.586 Dist. restrs. and SS energy: 6.375 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -767.731867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.731867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.292560 (E_RNA) where: Base-Base interactions energy: -520.935 where: short stacking energy: -234.374 Base-Backbone interact. energy: 0.188 local terms energy: -247.545627 where: bonds (distance) C4'-P energy: -41.746 bonds (distance) P-C4' energy: -47.552 flat angles C4'-P-C4' energy: -50.393 flat angles P-C4'-P energy: -37.862 tors. eta vs tors. theta energy: -69.994 Dist. restrs. and SS energy: 0.561 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -740.089382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.089382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.414958 (E_RNA) where: Base-Base interactions energy: -490.976 where: short stacking energy: -225.621 Base-Backbone interact. energy: -0.642 local terms energy: -248.797876 where: bonds (distance) C4'-P energy: -43.147 bonds (distance) P-C4' energy: -49.744 flat angles C4'-P-C4' energy: -53.307 flat angles P-C4'-P energy: -39.586 tors. eta vs tors. theta energy: -63.014 Dist. restrs. and SS energy: 0.326 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -714.390895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.390895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.551643 (E_RNA) where: Base-Base interactions energy: -469.334 where: short stacking energy: -230.602 Base-Backbone interact. energy: -0.392 local terms energy: -244.825188 where: bonds (distance) C4'-P energy: -40.767 bonds (distance) P-C4' energy: -48.512 flat angles C4'-P-C4' energy: -55.429 flat angles P-C4'-P energy: -34.157 tors. eta vs tors. theta energy: -65.960 Dist. restrs. and SS energy: 0.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -642.352267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.352267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.160291 (E_RNA) where: Base-Base interactions energy: -428.781 where: short stacking energy: -184.961 Base-Backbone interact. energy: -1.074 local terms energy: -213.305158 where: bonds (distance) C4'-P energy: -30.365 bonds (distance) P-C4' energy: -47.021 flat angles C4'-P-C4' energy: -51.127 flat angles P-C4'-P energy: -28.349 tors. eta vs tors. theta energy: -56.443 Dist. restrs. and SS energy: 0.808 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -572.641623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.641623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.688980 (E_RNA) where: Base-Base interactions energy: -367.010 where: short stacking energy: -175.369 Base-Backbone interact. energy: -1.449 local terms energy: -205.230195 where: bonds (distance) C4'-P energy: -37.825 bonds (distance) P-C4' energy: -36.773 flat angles C4'-P-C4' energy: -48.443 flat angles P-C4'-P energy: -30.566 tors. eta vs tors. theta energy: -51.622 Dist. restrs. and SS energy: 1.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -578.063148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.063148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.306639 (E_RNA) where: Base-Base interactions energy: -374.073 where: short stacking energy: -174.119 Base-Backbone interact. energy: -0.585 local terms energy: -203.648904 where: bonds (distance) C4'-P energy: -46.514 bonds (distance) P-C4' energy: -45.467 flat angles C4'-P-C4' energy: -28.600 flat angles P-C4'-P energy: -29.928 tors. eta vs tors. theta energy: -53.140 Dist. restrs. and SS energy: 0.243 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -494.803408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.803408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.047897 (E_RNA) where: Base-Base interactions energy: -334.061 where: short stacking energy: -164.640 Base-Backbone interact. energy: -0.081 local terms energy: -160.905749 where: bonds (distance) C4'-P energy: -33.914 bonds (distance) P-C4' energy: -34.653 flat angles C4'-P-C4' energy: -30.635 flat angles P-C4'-P energy: -23.641 tors. eta vs tors. theta energy: -38.062 Dist. restrs. and SS energy: 0.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -511.692843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.692843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.043163 (E_RNA) where: Base-Base interactions energy: -345.850 where: short stacking energy: -152.781 Base-Backbone interact. energy: -0.517 local terms energy: -165.676024 where: bonds (distance) C4'-P energy: -37.035 bonds (distance) P-C4' energy: -32.441 flat angles C4'-P-C4' energy: -37.708 flat angles P-C4'-P energy: -20.752 tors. eta vs tors. theta energy: -37.740 Dist. restrs. and SS energy: 0.350 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -463.650469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.650469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.603338 (E_RNA) where: Base-Base interactions energy: -280.378 where: short stacking energy: -143.300 Base-Backbone interact. energy: 0.380 local terms energy: -187.605044 where: bonds (distance) C4'-P energy: -43.609 bonds (distance) P-C4' energy: -37.161 flat angles C4'-P-C4' energy: -45.460 flat angles P-C4'-P energy: -21.526 tors. eta vs tors. theta energy: -39.850 Dist. restrs. and SS energy: 3.953 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -461.022461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.022461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.529480 (E_RNA) where: Base-Base interactions energy: -316.245 where: short stacking energy: -132.471 Base-Backbone interact. energy: 2.740 local terms energy: -148.024713 where: bonds (distance) C4'-P energy: -22.635 bonds (distance) P-C4' energy: -49.099 flat angles C4'-P-C4' energy: -37.583 flat angles P-C4'-P energy: -19.474 tors. eta vs tors. theta energy: -19.233 Dist. restrs. and SS energy: 0.507 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -755.617710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.617710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.741272 (E_RNA) where: Base-Base interactions energy: -512.451 where: short stacking energy: -235.912 Base-Backbone interact. energy: -2.210 local terms energy: -241.080770 where: bonds (distance) C4'-P energy: -45.908 bonds (distance) P-C4' energy: -47.105 flat angles C4'-P-C4' energy: -50.770 flat angles P-C4'-P energy: -30.368 tors. eta vs tors. theta energy: -66.930 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -714.957713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.957713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.058777 (E_RNA) where: Base-Base interactions energy: -477.245 where: short stacking energy: -219.537 Base-Backbone interact. energy: -2.372 local terms energy: -235.441256 where: bonds (distance) C4'-P energy: -46.824 bonds (distance) P-C4' energy: -46.575 flat angles C4'-P-C4' energy: -42.748 flat angles P-C4'-P energy: -33.955 tors. eta vs tors. theta energy: -65.340 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -698.297937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.297937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.634701 (E_RNA) where: Base-Base interactions energy: -466.738 where: short stacking energy: -205.467 Base-Backbone interact. energy: -0.454 local terms energy: -231.442649 where: bonds (distance) C4'-P energy: -38.372 bonds (distance) P-C4' energy: -43.593 flat angles C4'-P-C4' energy: -52.855 flat angles P-C4'-P energy: -33.714 tors. eta vs tors. theta energy: -62.909 Dist. restrs. and SS energy: 0.337 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -644.015863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.015863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.312390 (E_RNA) where: Base-Base interactions energy: -446.608 where: short stacking energy: -190.058 Base-Backbone interact. energy: -1.832 local terms energy: -195.872120 where: bonds (distance) C4'-P energy: -37.235 bonds (distance) P-C4' energy: -38.623 flat angles C4'-P-C4' energy: -38.388 flat angles P-C4'-P energy: -31.459 tors. eta vs tors. theta energy: -50.166 Dist. restrs. and SS energy: 0.297 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -579.640948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.640948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.054053 (E_RNA) where: Base-Base interactions energy: -375.627 where: short stacking energy: -178.480 Base-Backbone interact. energy: -0.974 local terms energy: -203.452727 where: bonds (distance) C4'-P energy: -40.433 bonds (distance) P-C4' energy: -40.023 flat angles C4'-P-C4' energy: -44.143 flat angles P-C4'-P energy: -29.551 tors. eta vs tors. theta energy: -49.303 Dist. restrs. and SS energy: 0.413 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -544.586997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.586997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.723028 (E_RNA) where: Base-Base interactions energy: -366.528 where: short stacking energy: -174.542 Base-Backbone interact. energy: -0.164 local terms energy: -179.030974 where: bonds (distance) C4'-P energy: -26.020 bonds (distance) P-C4' energy: -39.037 flat angles C4'-P-C4' energy: -42.099 flat angles P-C4'-P energy: -29.316 tors. eta vs tors. theta energy: -42.559 Dist. restrs. and SS energy: 1.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -549.136028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.136028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.381303 (E_RNA) where: Base-Base interactions energy: -379.186 where: short stacking energy: -176.178 Base-Backbone interact. energy: -0.842 local terms energy: -169.352779 where: bonds (distance) C4'-P energy: -38.315 bonds (distance) P-C4' energy: -20.441 flat angles C4'-P-C4' energy: -41.844 flat angles P-C4'-P energy: -26.252 tors. eta vs tors. theta energy: -42.501 Dist. restrs. and SS energy: 0.245 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -499.676335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.676335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.530772 (E_RNA) where: Base-Base interactions energy: -320.919 where: short stacking energy: -156.463 Base-Backbone interact. energy: -1.161 local terms energy: -178.450346 where: bonds (distance) C4'-P energy: -38.667 bonds (distance) P-C4' energy: -40.778 flat angles C4'-P-C4' energy: -30.219 flat angles P-C4'-P energy: -29.132 tors. eta vs tors. theta energy: -39.654 Dist. restrs. and SS energy: 0.854 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -500.571050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.571050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.971668 (E_RNA) where: Base-Base interactions energy: -327.413 where: short stacking energy: -146.031 Base-Backbone interact. energy: -1.145 local terms energy: -172.414339 where: bonds (distance) C4'-P energy: -37.614 bonds (distance) P-C4' energy: -46.688 flat angles C4'-P-C4' energy: -42.726 flat angles P-C4'-P energy: -13.512 tors. eta vs tors. theta energy: -31.875 Dist. restrs. and SS energy: 0.401 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -464.474194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.474194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.570056 (E_RNA) where: Base-Base interactions energy: -314.357 where: short stacking energy: -144.450 Base-Backbone interact. energy: -0.904 local terms energy: -150.309245 where: bonds (distance) C4'-P energy: -30.382 bonds (distance) P-C4' energy: -30.855 flat angles C4'-P-C4' energy: -41.656 flat angles P-C4'-P energy: -20.000 tors. eta vs tors. theta energy: -27.416 Dist. restrs. and SS energy: 1.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -743.138918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -743.138918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.725560 (E_RNA) where: Base-Base interactions energy: -503.193 where: short stacking energy: -235.647 Base-Backbone interact. energy: 0.374 local terms energy: -240.906425 where: bonds (distance) C4'-P energy: -45.755 bonds (distance) P-C4' energy: -45.615 flat angles C4'-P-C4' energy: -47.607 flat angles P-C4'-P energy: -37.216 tors. eta vs tors. theta energy: -64.714 Dist. restrs. and SS energy: 0.587 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -733.184288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -733.184288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -733.867261 (E_RNA) where: Base-Base interactions energy: -489.282 where: short stacking energy: -228.925 Base-Backbone interact. energy: -2.533 local terms energy: -242.052676 where: bonds (distance) C4'-P energy: -40.175 bonds (distance) P-C4' energy: -44.797 flat angles C4'-P-C4' energy: -48.367 flat angles P-C4'-P energy: -37.369 tors. eta vs tors. theta energy: -71.344 Dist. restrs. and SS energy: 0.683 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -699.238377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.238377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.688084 (E_RNA) where: Base-Base interactions energy: -466.105 where: short stacking energy: -220.971 Base-Backbone interact. energy: -0.436 local terms energy: -233.147226 where: bonds (distance) C4'-P energy: -51.217 bonds (distance) P-C4' energy: -48.925 flat angles C4'-P-C4' energy: -47.035 flat angles P-C4'-P energy: -27.652 tors. eta vs tors. theta energy: -58.318 Dist. restrs. and SS energy: 0.450 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -625.429658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -625.429658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -625.552855 (E_RNA) where: Base-Base interactions energy: -409.266 where: short stacking energy: -177.056 Base-Backbone interact. energy: -1.029 local terms energy: -215.257444 where: bonds (distance) C4'-P energy: -41.139 bonds (distance) P-C4' energy: -44.868 flat angles C4'-P-C4' energy: -53.399 flat angles P-C4'-P energy: -28.996 tors. eta vs tors. theta energy: -46.855 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -571.959619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.959619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.799417 (E_RNA) where: Base-Base interactions energy: -370.532 where: short stacking energy: -191.911 Base-Backbone interact. energy: -1.176 local terms energy: -201.091426 where: bonds (distance) C4'-P energy: -39.740 bonds (distance) P-C4' energy: -43.552 flat angles C4'-P-C4' energy: -45.522 flat angles P-C4'-P energy: -22.730 tors. eta vs tors. theta energy: -49.547 Dist. restrs. and SS energy: 0.840 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -530.683729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.683729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.984000 (E_RNA) where: Base-Base interactions energy: -333.613 where: short stacking energy: -150.929 Base-Backbone interact. energy: -1.564 local terms energy: -195.807036 where: bonds (distance) C4'-P energy: -45.532 bonds (distance) P-C4' energy: -42.199 flat angles C4'-P-C4' energy: -46.411 flat angles P-C4'-P energy: -28.327 tors. eta vs tors. theta energy: -33.338 Dist. restrs. and SS energy: 0.300 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -537.073837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.073837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.855648 (E_RNA) where: Base-Base interactions energy: -348.867 where: short stacking energy: -164.631 Base-Backbone interact. energy: -1.226 local terms energy: -187.762351 where: bonds (distance) C4'-P energy: -38.278 bonds (distance) P-C4' energy: -32.258 flat angles C4'-P-C4' energy: -36.110 flat angles P-C4'-P energy: -30.817 tors. eta vs tors. theta energy: -50.299 Dist. restrs. and SS energy: 0.782 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -522.267959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.267959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.329711 (E_RNA) where: Base-Base interactions energy: -329.211 where: short stacking energy: -157.947 Base-Backbone interact. energy: -0.755 local terms energy: -193.362985 where: bonds (distance) C4'-P energy: -37.351 bonds (distance) P-C4' energy: -49.605 flat angles C4'-P-C4' energy: -41.818 flat angles P-C4'-P energy: -22.507 tors. eta vs tors. theta energy: -42.081 Dist. restrs. and SS energy: 1.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -493.777135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.777135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.107810 (E_RNA) where: Base-Base interactions energy: -311.500 where: short stacking energy: -145.123 Base-Backbone interact. energy: -1.117 local terms energy: -181.490065 where: bonds (distance) C4'-P energy: -40.613 bonds (distance) P-C4' energy: -39.572 flat angles C4'-P-C4' energy: -39.973 flat angles P-C4'-P energy: -24.467 tors. eta vs tors. theta energy: -36.864 Dist. restrs. and SS energy: 0.331 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -475.750804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.750804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.163085 (E_RNA) where: Base-Base interactions energy: -300.471 where: short stacking energy: -128.655 Base-Backbone interact. energy: 0.995 local terms energy: -177.687461 where: bonds (distance) C4'-P energy: -45.516 bonds (distance) P-C4' energy: -32.859 flat angles C4'-P-C4' energy: -43.222 flat angles P-C4'-P energy: -25.654 tors. eta vs tors. theta energy: -30.436 Dist. restrs. and SS energy: 1.412 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -735.926485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.926485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.589587 (E_RNA) where: Base-Base interactions energy: -496.947 where: short stacking energy: -215.499 Base-Backbone interact. energy: -1.106 local terms energy: -238.536086 where: bonds (distance) C4'-P energy: -53.049 bonds (distance) P-C4' energy: -45.383 flat angles C4'-P-C4' energy: -56.518 flat angles P-C4'-P energy: -27.570 tors. eta vs tors. theta energy: -56.016 Dist. restrs. and SS energy: 0.663 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -730.070299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.070299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.629584 (E_RNA) where: Base-Base interactions energy: -482.399 where: short stacking energy: -215.188 Base-Backbone interact. energy: 0.286 local terms energy: -248.516561 where: bonds (distance) C4'-P energy: -47.209 bonds (distance) P-C4' energy: -46.701 flat angles C4'-P-C4' energy: -48.775 flat angles P-C4'-P energy: -36.858 tors. eta vs tors. theta energy: -68.973 Dist. restrs. and SS energy: 0.559 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -688.437364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.437364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.669546 (E_RNA) where: Base-Base interactions energy: -456.529 where: short stacking energy: -208.949 Base-Backbone interact. energy: -1.597 local terms energy: -230.543874 where: bonds (distance) C4'-P energy: -42.244 bonds (distance) P-C4' energy: -41.030 flat angles C4'-P-C4' energy: -52.938 flat angles P-C4'-P energy: -32.724 tors. eta vs tors. theta energy: -61.608 Dist. restrs. and SS energy: 0.232 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -633.474451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.474451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.903900 (E_RNA) where: Base-Base interactions energy: -419.301 where: short stacking energy: -182.174 Base-Backbone interact. energy: -1.774 local terms energy: -212.828744 where: bonds (distance) C4'-P energy: -37.139 bonds (distance) P-C4' energy: -39.509 flat angles C4'-P-C4' energy: -52.150 flat angles P-C4'-P energy: -33.308 tors. eta vs tors. theta energy: -50.722 Dist. restrs. and SS energy: 0.429 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -579.043005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.043005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.771054 (E_RNA) where: Base-Base interactions energy: -367.032 where: short stacking energy: -181.576 Base-Backbone interact. energy: -0.716 local terms energy: -212.023360 where: bonds (distance) C4'-P energy: -39.106 bonds (distance) P-C4' energy: -45.920 flat angles C4'-P-C4' energy: -47.789 flat angles P-C4'-P energy: -34.314 tors. eta vs tors. theta energy: -44.895 Dist. restrs. and SS energy: 0.728 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -542.314267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.314267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.783802 (E_RNA) where: Base-Base interactions energy: -362.713 where: short stacking energy: -166.474 Base-Backbone interact. energy: -0.430 local terms energy: -179.641035 where: bonds (distance) C4'-P energy: -29.539 bonds (distance) P-C4' energy: -43.049 flat angles C4'-P-C4' energy: -45.690 flat angles P-C4'-P energy: -29.392 tors. eta vs tors. theta energy: -31.971 Dist. restrs. and SS energy: 0.470 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -548.075259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.075259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.488913 (E_RNA) where: Base-Base interactions energy: -344.894 where: short stacking energy: -164.728 Base-Backbone interact. energy: -0.474 local terms energy: -203.121485 where: bonds (distance) C4'-P energy: -46.098 bonds (distance) P-C4' energy: -35.399 flat angles C4'-P-C4' energy: -44.569 flat angles P-C4'-P energy: -32.768 tors. eta vs tors. theta energy: -44.287 Dist. restrs. and SS energy: 0.414 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -523.416451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.416451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.902784 (E_RNA) where: Base-Base interactions energy: -347.288 where: short stacking energy: -157.711 Base-Backbone interact. energy: -0.244 local terms energy: -176.371766 where: bonds (distance) C4'-P energy: -32.401 bonds (distance) P-C4' energy: -42.599 flat angles C4'-P-C4' energy: -32.138 flat angles P-C4'-P energy: -23.100 tors. eta vs tors. theta energy: -46.134 Dist. restrs. and SS energy: 0.486 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -503.016294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.016294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.343743 (E_RNA) where: Base-Base interactions energy: -323.313 where: short stacking energy: -131.239 Base-Backbone interact. energy: -0.849 local terms energy: -179.181363 where: bonds (distance) C4'-P energy: -44.885 bonds (distance) P-C4' energy: -37.401 flat angles C4'-P-C4' energy: -48.969 flat angles P-C4'-P energy: -19.133 tors. eta vs tors. theta energy: -28.794 Dist. restrs. and SS energy: 0.327 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -465.388321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.388321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.176511 (E_RNA) where: Base-Base interactions energy: -307.142 where: short stacking energy: -133.890 Base-Backbone interact. energy: -0.444 local terms energy: -158.590566 where: bonds (distance) C4'-P energy: -34.468 bonds (distance) P-C4' energy: -32.083 flat angles C4'-P-C4' energy: -31.045 flat angles P-C4'-P energy: -32.707 tors. eta vs tors. theta energy: -28.287 Dist. restrs. and SS energy: 0.788 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -743.340688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -743.340688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.752196 (E_RNA) where: Base-Base interactions energy: -500.268 where: short stacking energy: -217.700 Base-Backbone interact. energy: -1.245 local terms energy: -242.239069 where: bonds (distance) C4'-P energy: -51.405 bonds (distance) P-C4' energy: -41.936 flat angles C4'-P-C4' energy: -50.246 flat angles P-C4'-P energy: -34.644 tors. eta vs tors. theta energy: -64.007 Dist. restrs. and SS energy: 0.412 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -704.885065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.885065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.221713 (E_RNA) where: Base-Base interactions energy: -469.934 where: short stacking energy: -211.196 Base-Backbone interact. energy: -0.662 local terms energy: -234.625178 where: bonds (distance) C4'-P energy: -47.597 bonds (distance) P-C4' energy: -42.190 flat angles C4'-P-C4' energy: -54.153 flat angles P-C4'-P energy: -32.348 tors. eta vs tors. theta energy: -58.337 Dist. restrs. and SS energy: 0.337 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -686.646718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.646718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.056432 (E_RNA) where: Base-Base interactions energy: -454.106 where: short stacking energy: -224.400 Base-Backbone interact. energy: 0.932 local terms energy: -233.882179 where: bonds (distance) C4'-P energy: -30.576 bonds (distance) P-C4' energy: -49.134 flat angles C4'-P-C4' energy: -53.718 flat angles P-C4'-P energy: -39.796 tors. eta vs tors. theta energy: -60.658 Dist. restrs. and SS energy: 0.410 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -642.072634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.072634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.778851 (E_RNA) where: Base-Base interactions energy: -430.584 where: short stacking energy: -201.030 Base-Backbone interact. energy: -1.067 local terms energy: -211.126865 where: bonds (distance) C4'-P energy: -44.113 bonds (distance) P-C4' energy: -46.985 flat angles C4'-P-C4' energy: -47.208 flat angles P-C4'-P energy: -24.897 tors. eta vs tors. theta energy: -47.924 Dist. restrs. and SS energy: 0.706 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -633.932303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.932303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -634.756410 (E_RNA) where: Base-Base interactions energy: -418.667 where: short stacking energy: -185.360 Base-Backbone interact. energy: -0.419 local terms energy: -215.669887 where: bonds (distance) C4'-P energy: -41.525 bonds (distance) P-C4' energy: -45.178 flat angles C4'-P-C4' energy: -43.011 flat angles P-C4'-P energy: -29.330 tors. eta vs tors. theta energy: -56.625 Dist. restrs. and SS energy: 0.824 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -563.413903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.413903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.098074 (E_RNA) where: Base-Base interactions energy: -376.196 where: short stacking energy: -178.034 Base-Backbone interact. energy: 0.505 local terms energy: -188.406381 where: bonds (distance) C4'-P energy: -41.463 bonds (distance) P-C4' energy: -31.064 flat angles C4'-P-C4' energy: -43.884 flat angles P-C4'-P energy: -32.022 tors. eta vs tors. theta energy: -39.974 Dist. restrs. and SS energy: 0.684 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -547.486141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.486141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.836503 (E_RNA) where: Base-Base interactions energy: -343.729 where: short stacking energy: -156.955 Base-Backbone interact. energy: -0.738 local terms energy: -203.369489 where: bonds (distance) C4'-P energy: -45.737 bonds (distance) P-C4' energy: -45.845 flat angles C4'-P-C4' energy: -42.767 flat angles P-C4'-P energy: -24.853 tors. eta vs tors. theta energy: -44.167 Dist. restrs. and SS energy: 0.350 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -523.237535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.237535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.392371 (E_RNA) where: Base-Base interactions energy: -330.690 where: short stacking energy: -152.910 Base-Backbone interact. energy: -0.682 local terms energy: -192.020287 where: bonds (distance) C4'-P energy: -38.735 bonds (distance) P-C4' energy: -39.642 flat angles C4'-P-C4' energy: -45.661 flat angles P-C4'-P energy: -29.890 tors. eta vs tors. theta energy: -38.094 Dist. restrs. and SS energy: 0.155 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -500.958927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.958927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.802128 (E_RNA) where: Base-Base interactions energy: -324.179 where: short stacking energy: -156.587 Base-Backbone interact. energy: -0.476 local terms energy: -177.147103 where: bonds (distance) C4'-P energy: -37.691 bonds (distance) P-C4' energy: -31.677 flat angles C4'-P-C4' energy: -37.161 flat angles P-C4'-P energy: -30.143 tors. eta vs tors. theta energy: -40.476 Dist. restrs. and SS energy: 0.843 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -469.653841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.653841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.500271 (E_RNA) where: Base-Base interactions energy: -315.397 where: short stacking energy: -144.524 Base-Backbone interact. energy: 1.490 local terms energy: -156.593091 where: bonds (distance) C4'-P energy: -34.173 bonds (distance) P-C4' energy: -39.039 flat angles C4'-P-C4' energy: -32.263 flat angles P-C4'-P energy: -17.401 tors. eta vs tors. theta energy: -33.718 Dist. restrs. and SS energy: 0.846 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -750.039515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.039515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.396977 (E_RNA) where: Base-Base interactions energy: -499.119 where: short stacking energy: -231.224 Base-Backbone interact. energy: -2.983 local terms energy: -248.294929 where: bonds (distance) C4'-P energy: -44.485 bonds (distance) P-C4' energy: -50.461 flat angles C4'-P-C4' energy: -53.769 flat angles P-C4'-P energy: -35.924 tors. eta vs tors. theta energy: -63.656 Dist. restrs. and SS energy: 0.357 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -714.793261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.793261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.941695 (E_RNA) where: Base-Base interactions energy: -476.331 where: short stacking energy: -214.827 Base-Backbone interact. energy: -0.304 local terms energy: -239.306827 where: bonds (distance) C4'-P energy: -45.582 bonds (distance) P-C4' energy: -45.458 flat angles C4'-P-C4' energy: -51.838 flat angles P-C4'-P energy: -32.270 tors. eta vs tors. theta energy: -64.158 Dist. restrs. and SS energy: 1.148 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -694.436742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.436742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.640964 (E_RNA) where: Base-Base interactions energy: -476.087 where: short stacking energy: -219.359 Base-Backbone interact. energy: 1.167 local terms energy: -219.721373 where: bonds (distance) C4'-P energy: -37.115 bonds (distance) P-C4' energy: -40.937 flat angles C4'-P-C4' energy: -51.271 flat angles P-C4'-P energy: -30.075 tors. eta vs tors. theta energy: -60.323 Dist. restrs. and SS energy: 0.204 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -668.500413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.500413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.026354 (E_RNA) where: Base-Base interactions energy: -435.036 where: short stacking energy: -196.502 Base-Backbone interact. energy: -1.207 local terms energy: -232.783844 where: bonds (distance) C4'-P energy: -46.870 bonds (distance) P-C4' energy: -46.772 flat angles C4'-P-C4' energy: -49.281 flat angles P-C4'-P energy: -33.837 tors. eta vs tors. theta energy: -56.023 Dist. restrs. and SS energy: 0.526 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -612.057103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.057103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -612.491643 (E_RNA) where: Base-Base interactions energy: -404.537 where: short stacking energy: -177.839 Base-Backbone interact. energy: -1.300 local terms energy: -206.655282 where: bonds (distance) C4'-P energy: -41.217 bonds (distance) P-C4' energy: -36.563 flat angles C4'-P-C4' energy: -48.892 flat angles P-C4'-P energy: -36.067 tors. eta vs tors. theta energy: -43.917 Dist. restrs. and SS energy: 0.435 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -573.096647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.096647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.888982 (E_RNA) where: Base-Base interactions energy: -366.596 where: short stacking energy: -165.761 Base-Backbone interact. energy: 1.840 local terms energy: -209.133768 where: bonds (distance) C4'-P energy: -43.424 bonds (distance) P-C4' energy: -48.389 flat angles C4'-P-C4' energy: -45.599 flat angles P-C4'-P energy: -30.645 tors. eta vs tors. theta energy: -41.077 Dist. restrs. and SS energy: 0.792 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -519.864315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.864315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.360100 (E_RNA) where: Base-Base interactions energy: -328.717 where: short stacking energy: -150.775 Base-Backbone interact. energy: -0.375 local terms energy: -191.268142 where: bonds (distance) C4'-P energy: -42.338 bonds (distance) P-C4' energy: -40.220 flat angles C4'-P-C4' energy: -41.433 flat angles P-C4'-P energy: -24.970 tors. eta vs tors. theta energy: -42.308 Dist. restrs. and SS energy: 0.496 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -557.286213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.286213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.584942 (E_RNA) where: Base-Base interactions energy: -354.927 where: short stacking energy: -168.893 Base-Backbone interact. energy: -0.631 local terms energy: -202.027536 where: bonds (distance) C4'-P energy: -32.366 bonds (distance) P-C4' energy: -44.736 flat angles C4'-P-C4' energy: -46.546 flat angles P-C4'-P energy: -30.222 tors. eta vs tors. theta energy: -48.158 Dist. restrs. and SS energy: 0.299 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -494.451664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.451664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.907842 (E_RNA) where: Base-Base interactions energy: -326.737 where: short stacking energy: -128.126 Base-Backbone interact. energy: -0.642 local terms energy: -167.529611 where: bonds (distance) C4'-P energy: -42.191 bonds (distance) P-C4' energy: -40.042 flat angles C4'-P-C4' energy: -40.657 flat angles P-C4'-P energy: -16.352 tors. eta vs tors. theta energy: -28.289 Dist. restrs. and SS energy: 0.456 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -459.839288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.839288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.473161 (E_RNA) where: Base-Base interactions energy: -297.597 where: short stacking energy: -134.966 Base-Backbone interact. energy: -2.052 local terms energy: -160.824150 where: bonds (distance) C4'-P energy: -42.006 bonds (distance) P-C4' energy: -37.441 flat angles C4'-P-C4' energy: -28.139 flat angles P-C4'-P energy: -26.075 tors. eta vs tors. theta energy: -27.163 Dist. restrs. and SS energy: 0.634 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 10 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 9534136 moves confirmed later: 11052055 all moves confirmed: 20586191 percent of confirmed moves: 12.866369 current total energy: -747.897754 recalc. total energy: -747.897754 replica 9 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 8654317 moves confirmed later: 9890961 all moves confirmed: 18545278 percent of confirmed moves: 11.590799 current total energy: -670.205303 recalc. total energy: -670.205303 replica 7 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 9029465 moves confirmed later: 10325882 all moves confirmed: 19355347 percent of confirmed moves: 12.097092 current total energy: -627.772103 recalc. total energy: -627.772103 replica 6 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 8352224 moves confirmed later: 9504693 all moves confirmed: 17856917 percent of confirmed moves: 11.160573 current total energy: -591.680175 recalc. total energy: -591.680175 replica 2 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 10793640 moves confirmed later: 12723714 all moves confirmed: 23517354 percent of confirmed moves: 14.698346 current total energy: -538.313626 recalc. total energy: -538.313626 replica 1 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 8138999 moves confirmed later: 9090520 all moves confirmed: 17229519 percent of confirmed moves: 10.768449 current total energy: -478.295991 recalc. total energy: -478.295991 replica 5 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 10779254 moves confirmed later: 12738903 all moves confirmed: 23518157 percent of confirmed moves: 14.698848 current total energy: -468.243585 recalc. total energy: -468.243585 replica 4 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 9489129 moves confirmed later: 10960338 all moves confirmed: 20449467 percent of confirmed moves: 12.780917 current total energy: -438.212384 recalc. total energy: -438.212384 replica 8 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 9920580 moves confirmed later: 11565724 all moves confirmed: 21486304 percent of confirmed moves: 13.428940 current total energy: -385.631887 recalc. total energy: -385.631887 replica 3 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 9716654 moves confirmed later: 11327921 all moves confirmed: 21044575 percent of confirmed moves: 13.152859 current total energy: -430.387506 recalc. total energy: -430.387506 out arg RESULTS//1/Tetraloop_10_steps-c5c38540_01 Time of doing 1600000 iterations: 1529.904 seconds